by
Sc.B. Brown University
Providence, RI 1999
SUBMITTED TO THE DEPARTMENT OF BIOLOGY
IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTORATE OF PHILOSOPHY
AT THE
MASSACHUSETTS INSTITUTE OF TECHNOLOGY
JUNE 2008
 2008 Massachusetts Institute of Technology
All rights reserved
Signature of Author………………………………………………………………………………..
Lourdes M. Alemán
Department of Biology
August 1, 2008
Certified by…………………………………………………………………………………………
Phillip A. Sharp
Institute Professor of Biology
Thesis Supervisor
Accepted by……………………………………………………………………………….............
Stephen P. Bell
Professor of Biology
Chair, Biology Graduate Committee
1

by
Complementary short interfering RNAs (siRNAs) are routinely used to knockdown gene expression. siRNAs bind to their target sequence and guide transcript cleavage and subsequent degradation. This type of silencing is associated with equivalent levels of RNA and protein knockdown. siRNA-mediated knockdown was originally thought to be highly specific.
However, the downregulation of non-target mRNAs has been observed following transfection of siRNAs in human cells. Many of these RNA changes are due to siRNA binding to partially complementary sequences within nontargeted transcripts and therefore are termed “off-target” effects.
To examine the mRNA:siRNA interactions important for off-target effects, we generated a panel of mRNA:siRNA combinations containing a variety of base pairing interactions in the 9 th
10 th , and 11 th positions of two siRNA binding sites located in a reporter gene. This region was chosen because siRNA-mediated transcript cleavage occurs between the 10 th
,
and 11 th positions of the mRNA:siRNA duplex. Approximately half of the mRNA:siRNA combinations containing mismatches in positions 9-11 resulted in a two-fold or more mRNA decrease, with varying degrees of protein knockdown. mRNA and protein analysis revealed combinations for which the resulting mRNA and protein levels did not correlate. Although siRNA-mediated transcript cleavage is catalyzed by the endonuclease Argonaute 2 (Ago2), knockdown of Ago2 expression did not affect mRNA knockdown for imperfectly complementary combinations. These results indicate that off-target mRNA reductions are likely attributable to Ago2-independent degradation processes.
Using the same reporter system we have also uncovered instances in which complementary siRNAs resulted in high protein/RNA knockdown ratios with dramatic protein silencing. For these particular combinations, the disparity between RNA and protein knockdown is dependent on Ago2 function. This may suggest that the sequences within atypical complementary mRNA:siRNA combinations result in unproductive cleavage by Ago2, leading to persistent binding and enhanced silencing through translational repression.
Our findings demonstrate that differences within complementary target sequences can lead to differences in the type of silencing mechanisms that result. The results presented in this dissertation also provide a better understanding of how off-target effects mediate mRNA and protein knockdown of unrelated transcripts, with meaningful implications for those using siRNAs as a tool.
Thesis Supervisor: Phillip A. Sharp
Title: Institute Professor of Biology
2

Abstract ............................................................................................................................2
Figures and Tables ..........................................................................................................6
Acknowledgments ...........................................................................................................7
CHAPTER 1: Introduction .............................................................................................10
Introduction to small RNA-mediated silencing .............................................................11
siRNAs.........................................................................................................................13
Introduction to siRNAs .............................................................................................13
siRNA biogenesis ....................................................................................................13
siRNA-mediated regulation and function .................................................................15
miRNAs........................................................................................................................17
Introduction to miRNAs............................................................................................17
miRNA biogenesis ...................................................................................................18
miRNA function and target recognition ....................................................................20
miRNA-mediated regulation: translational repression .............................................23
miRNA-mediated regulation: RNA decay ................................................................25
Localization of miRNA-mediated repression............................................................28
Biological implications of miRNA function................................................................30
piRNAs.........................................................................................................................31
Introduction to piRNAs.............................................................................................31
piRNA biogenesis ....................................................................................................32
piRNA function.........................................................................................................32
Argonaute protein family..............................................................................................33
Introduction to the Argonaute family ........................................................................33
Argonaute structure .................................................................................................34
Small silencing RNA loading and sorting into Argonaute containing complexes.....35
RNAi-based applications .............................................................................................37
Introduction to RNAi-based experimental applications ............................................37
siRNA specificity ......................................................................................................37
Figures.............................................................................................................................41
CHAPTER 2: Comparison of siRNA-induced off-target RNA and protein effects ...44
Introduction ......................................................................................................................45
Results.............................................................................................................................48
Importance of complementarity within positions 9-11 for off-target effects..................48
3

Imperfectly complementary siRNA binding yields canonical cleavage products .........53
Some off-target mRNA changes probably occur via Ago2-independent degradation pathways......................................................................................................................56
Discussion .......................................................................................................................58
Material and Methods ......................................................................................................63
DNA constructs............................................................................................................63
Construction of stable cell lines ...................................................................................63
siRNAs.........................................................................................................................63
Cell culture and transfections ......................................................................................64
Real Time RT-PCR......................................................................................................65
Luciferase Assays........................................................................................................67
5' RACE .......................................................................................................................67
Table 1 - RNA and protein knockdown for 30 mRNA:siRNA combinations.....................69
Table 2 – Protein/RNA knockdown ratios for 30 miRNA:siRNA combinations ................70
Figures.............................................................................................................................71
CHAPTER 3 : Characterization of mRNA:siRNA combinations with high protein/RNA knockdown ratios ....................................................................................79
Introduction ......................................................................................................................80
Results.............................................................................................................................81
Time course experiments of G:U wobble combinations ..............................................81
Perfectly complementary siRNAs can result in translational repression and enhanced silencing.......................................................................................................................83
Dramatic silencing resulting from atypical complementary combinations is Ago2dependent....................................................................................................................88
Discussion .......................................................................................................................91
Materials and Methods ....................................................................................................98
DNA constructs............................................................................................................98
Construction of targeted reporter constructs and stable cell lines ...............................98
siRNAs.........................................................................................................................99
Cell culture and transfections ....................................................................................100
Real time RT-PCR .....................................................................................................100
Luciferase assays ......................................................................................................102
4

siRNA degradation analysis.......................................................................................102
Figures...........................................................................................................................104
CHAPTER 4: Concluding remarks .............................................................................111
CHAPTER 5: References.............................................................................................115
CHAPTER 6: Biographical note..................................................................................130
5

Figure 1.1 - siRNA and miRNA pathways in mammalian cells. .......................................41
Figure 1.2 - Schematic representation of animal miRNA target interactions...................43
Figure 2.1 - Time course of RNA and protein knockdown for a perfect and imperfectly complementary combination. ..………………………………………………………….71
Figure 2.2 - Effects of mismatches in positions 9-11 on mRNA and protein levels. . ......72
Figure 2.3 - Comparison of G:U wobble effects on mRNA and protein knockdown with those of mismatched combinations for positions 9-11.............................................74
Figure 2.4 - Imperfectly complementary siRNAs result in degradation products that correspond to canonical siRNA-mediated cleavage events. ...................................75
Figure 2.5 - Ago2 is not required for off-target mRNA downregulation. ..........................77
Figure 2.6 - Ago2 is not required for off-target mRNA and protein downregulation. …...78
Figure 3.1 - Time course experiment of G:U wobble at position 9. ...............................104
Figure 3.2 - RNA and protein effects for a G:U wobble combination compared to those of related mRNA:siRNA duplexes..............................................................................105
Figure 3.3 - Perfectly complementary siRNAs can result in translational repression and enhanced silencing. . .............................................................................................106
Figure 3.4 - Perfectly complementary siRNAs can result in high protein/RNA knockdown ratios in both cell line and transient transfections. ................................................107
Figure 3.5 - Dramatic silencing resulting from atypical siRNAs is not an experimental artifact. . .................................................................................................................108
Figure 3.6 - The dramatic silencing effect resulting from atypical perfect siRNAs is dependent on Ago2 function..................................................................................109
Figure 3.7 - Ago2’s catalytic activity is necessary for full silencing effects exhibited by atypical perfect siRNAs..........................................................................................110
Table 1 - RNA and protein knockdown for 30 mRNA:siRNA combinations.....................69
Table 2 - Protein/RNA knockdown ratios for 30 miRNA:siRNA combinations.................70
6

The work described in this dissertation would not have been possible without guidance and support from numerous individuals and institutions. No words can adequately describe my gratitude to those who have fostered my development as a scientist and have supported me both academically and personally throughout graduate school. First, I am deeply indebted to my two graduate advisors: Frank Solomon and
Phillip Sharp. Frank was my first graduate advisor and has continued to be a mentor and friend throughout my time. Frank has fostered my development as a graduate student from our first meetings after Biochemistry class to the writing of this dissertation.
Thank you for you unending commitment, wisdom and wit, and for all the hours you have sat with me and talked about science, teaching, and life. Graduate school would have been extremely difficult without your guidance and encouragement. To Phil, for believing in me and for allowing me to spread my wings. Phil has always fostered my scientific independence and critical thinking. Phil leads by example and I have learned a tremendous amount from his dedication to science, his clarity of thought and vision, and his ability to extract the most important information from complex experiments. Thank you for helping me to approach every step of the scientific process with rigor. Phil is simply a great scientist and a wonderful role model and leader to all of his students and postdocs.
To my colleagues in the Solomon lab, Margaret, Seth, and Soni. You guided me through my first years in graduate school and were incredibly kind and generous. Thank you! To present and past Sharp lab members, Alla, Allan, Anthony, Amanda, Amy,
Cathie, Chonghui, Chris, Dean, Deyin, Grace, Graham, Hristo, Joel, Margaret, Mary,
Mauro and Stefan, for being critical, challenging, and supportive. I am especially grateful to Allan, Amy, Anthony, Chonghui and Grace, for their advice and insightful suggestions. In addition, thank you Amy, Chonghui and Grace, for your camaraderie and for cheering up my long lab days with your friendship. To Margarita, for your willingness to listen, your patience and encouragement, and for you warm smile. Thank you for keeping the lab running smoothly and for being a wonderful lab mom. We are incredibly fortunate to have you.
To the members of my thesis committee, Frank Solomon, Steve Bell, Dave Bartel and Victor Ambros, for their thoughtful advice and encouragement. I would also like to thank the following funding agencies and fellowships, NSF, NIH and the Leventhal presidential fellowship, for funding my graduate work.
Our lives as graduate students would not be the same without the enormous help and support that Betsey Walsh has always provided to graduate students. Betsey thank you so much, you have always been there when I needed you. To the members of the
MIT Biology graduate community and to the many organizations that I have been lucky enough to participate in during graduate school, in particular BioREFS. I have deeply enjoyed working with you and it has truly been a pleasure being part of such a wonderful and vibrant graduate community.
To my wonderful MIT family, Bryan, Hannah, Seth, Shamsah, Soni and Stacie, thank you! I am incredibly fortunate to have found such an amazing group of friends
7

who have been there for me through many trying times and who provided much laughter throughout our time together at MIT. Without you and your company, I would not have been able to survive graduate school! To Bryan, for his undying optimism and being such a reliable friend. To Hannah, for a wonderful friendship that started back when we were in college working in the same lab and that has continued until today. To Seth, for listening, no matter the topic of conversation, and for the many moments of laughter that we have shared together. To Shamsah, for her sense of humor, and her amazing listening skills. We have been through a lot together and graduate school would not have been the same without you. To Soni, for her readiness and willingness to help when I first arrive in the Solomon lab and for your continuous support and friendship. To
Stacie, a dear friend and my partner in crime for both our prelims and dissertations.
Thank you for your friendship and for your sense of humor. I am incredibly fortunate for everything we have shared during graduate school, including our creative endeavors which have truly kept me sane during times of stress. Last, but not least I am incredibly indebted to Megan, who has been instrumental in guiding me through the different stages of graduate school. Thank you Megan for your dedication and friendship.
I am also full of gratitude to all of my friends outside of MIT that throughout the years have supported me and encouraged me. In particular, I would like to thank those that have actually shared part of this experience with me by being my roommates during my first five years in graduate school. To Cesar, for always making me laugh and for teaching me how to be ‘fierce’. To Moira, for your warmth and compassion. Thank you for taking care of me while I was preparing for my prelims and for being there for me during difficult professional and personal moments.
This work would truly not have been possible without the support provided by my family. Bruce, Ginny, Emilie, and Olivia, thank you for being my family away from home, and thank you for all your kindness and encouragement through these years at MIT. My most sincere gratitude goes to Bruce and Ginny, for reading my dissertation from beginning to end and for being my editorial team. You guys are awesome! To my extended family in Cuba, Spain and Miami, who have continued to provide love and support despite the distance that separates us. To my family, Papi, Mami, Abuela,
Abuelo, Jose and Viany, “gracias, gracias”! I am truly at a loss for words to express how thankful I am for all the sacrifices you have made to give me the educational opportunities that I have been able to enjoy throughout my life. I am deeply touched and thankful for your unending support and love. I would never have been able to accomplish this huge undertaking without you. Let this dissertation be a testament to the love, sacrifice, and support you have poured into me for the last thirty years.
To my partner, best friend, and husband, Tyler. There is no way that I can adequately thank you. I am incredibly fortunate for having you. Thank you for being my biggest supporter and cheerleader throughout this process. You have always believed in me and have contributed an enormous amount to the completion of this dissertation and to my happiness and well-being during graduate school. Thank you for reading my thesis more times than I can actually count. Thank you for your kindness and your unconditional love. I am forever grateful to you.
8

9

Chapter 1: Introduction
10

Chapter 1: Introduction
Development and proper cell function rely on the precise temporal and spatial control of gene expression, which is accomplished by the exquisite regulation of the genes involved in these processes. Regulation of gene expression can be highly complex, often involving both proteins and noncoding regulatory RNAs that work in conjunction to repress or activate gene expression. Noncoding RNAs have been implicated in an array of regulatory functions including chromosome structure, DNA replication, splicing, rRNA processing, RNA editing, ribosome function, and protein sorting. More recently, the understanding of the regulatory roles of noncoding RNAs in gene expression has been broadened by the discovery of RNA interference (RNAi).
RNAi is a conserved cellular silencing response triggered by double stranded RNA
(dsRNA). dsRNA molecules are processed by the RNAi machinery into small silencing
RNAs (siRNAs), which guide the silencing of complementary sequences (Elbashir et al.,
2001b; Voinnet and Baulcombe, 1997; Zamore et al., 2000). The discovery of RNAi has enabled the identification of a new class of noncoding RNAs with critical roles in the regulation of gene expression, broadly known as small RNAs. This new class of noncoding RNAs has been found to regulate gene expression at many different levels in nearly every model eukaryotic organism.
RNAi was first observed in plants. Introduction of a transgene homologous to the chalcone synthase (CHS) enzyme in petunias, led to silencing of both the transgene and the endogenous CHS gene (Napoli et al., 1990). The discovery of RNAi arose from observations in Caenorhabditis elegans (Fire et al., 1998). Injection of dsRNA with sequence complementary to an endogenous gene led to its specific silencing.
Subsequently, RNAi and RNAi-related mechanisms have been reported in a variety of organisms, including trypanosomes, planaria, fungi, flies, zebrafish, mice and humans.
11

Chapter 1: Introduction
It is thought that RNAi might have arisen as a defense mechanism against foreign nucleic acid elements, such as viruses and transposons, whose propagation and replication often involve a dsRNA molecule. In plants and C. elegans , RNAi signals can be transmitted between cells and through the germ line, making this a potent immune response in these organisms.
In addition to its role as a defense mechanism against foreign nucleic acid elements, the RNAi machinery has also been implicated in the biogenesis and function of an endogenous small RNA subclass, now known as microRNAs (miRNAs), which naturally forms dsRNA hairpins. miRNAs were first identified by Victor Ambros and colleagues in C. elegans prior to the discovery of RNAi (Lee et al., 1993). The C. elegans miRNA lin-4 was shown to negatively regulate the temporal expression of the lin-14 protein through the first larval stage (Wightman et al., 1993). Components of the
RNAi pathway responsible for the processing of dsRNA precursor into siRNAs, were also found to process hairpin miRNA precursors, thereby providing roles for the RNAi machinery in an endogenous regulatory mechanism (Grishok et al., 2001). The realization that the biogenesis of siRNAs and miRNAs is connected has led to the discovery many more miRNAs. miRNAs have been uncovered in plants and animals, where they serve to regulate developmental transitions and basic cell processes by suppressing expression of key transcripts.
The discovery of RNAi has also resulted in the intense study of the RNAi pathway components that mediate the biogenesis and function of small RNAs. Among the most important of these factors are Argonaute proteins. Small RNAs bind to one or more Argonaute proteins. The type of small RNA and the specific Argonaute protein it binds to, determine the type of biological regulation these small RNAs mediate.
In addition to siRNA and miRNAs, new classes of small silencing RNAs have been uncovered. Moreover, small silencing RNAs have been implicated in a broad array
12

Chapter 1: Introduction of cellular processes. For example, small RNAs derived from genomic repeat regions called heterochromatic small RNAs (hcRNAs), have been identified in Saccharomyces pombe , Trypanosoma brucei and plants, where their function is associated with transcriptional silencing of heterochromatic regions. scanRNAs (scnRNAs) have been identified in Tetrahymena thermophila , where they participate in chromatin modification and DNA elimination during differentiation. More recently, a new class of small silencing
RNAs, Piwi-interacting RNAs (piRNAs) has been implicated in transposon silencing in the germline of flies and mammals.
Mammalian small RNAs can be broadly divided into three subclasses: siRNAs, miRNAs and piRNAs. This chapter will focus on the subclasses of small mammalian silencing RNAs relevant for this work: siRNAs and miRNAs. In addition, emphasis will be placed on discussing the mammalian Argonaute proteins that mediate siRNA and miRNA biology.
Introduction to siRNAs siRNAs are 21-23 nucleotide dsRNA molecules with 3' two nucleotide hydroxyl overhangs and 5' monophosphates. siRNAs were originally found to be associated with transgene silencing in plants (Hamilton and Baulcombe, 1999). Using Drosophila extracts, two different studies demonstrated that siRNAs are the effector molecules of
RNAi (Hammond et al., 2000; Zamore et al., 2000). Subsequent experiments showed that chemically synthesized siRNAs could be used in mammalian cells to silence the expression of transfected reporters and endogenous genes (Elbashir et al., 2001a). siRNA biogenesis siRNAs originate from long double stranded precursors that are cleaved
13

Chapter 1: Introduction processively by the RNAse III enzyme Dicer (Hammond et al., 2000), Figure 1.1).
Dicer’s endonuclease activity cleaves a long double stranded RNA molecule (dsRNA) at
21 nucleotide intervals (Elbashir et al., 2001b; Elbashir et al., 2001c; Zamore et al.,
2000). Dicer enzymes do not act alone. In C. elegans , Drosophila , and mammals, Dicer proteins form a complex with dsRNA binding protein partners and this binding is generally required for Dicer’s function (reviewed in Rossi, 2005). In mammals, Dicer binds to the TAR DNA-binding protein (TRBP) (Chendrimada et al., 2005; Haase et al.,
2005). siRNAs regulate gene expression by binding to the RNA induced silencing complex (RISC) and mediating mRNA degradation of complementary targets (Figure
1.1). Only one strand of the siRNA duplex, the guide strand, is incorporated into RISC. siRNA strand selection is accomplished by cleavage of the non-incorporated strand
(termed the passenger strand). Cleavage of the passenger strand is accomplished through the action of the catalytic core of the RISC complex, a member of the conserved
Argonaute family (Kiriakidou et al., 2007; Leuschner et al., 2006; Matranga et al., 2005;
Rand et al., 2005). Humans have four Argonaute proteins (Argonautes 1-4), however, only Argonaute 2 (Ago2) has been shown to have catalytic activity in vitro (Liu et al.,
2004; Meister et al., 2004) (the Argonaute family will be discussed in greater detail in later sections). In mammals, Ago2 is responsible for passenger strand cleavage
(Leuschner et al., 2006; Matranga et al., 2005). Which of the two strands is incorporated and which strand is cleaved depends on the relative thermodynamic stability of the strands’ 5' ends. The strand within the less thermodynamically stable or less tightly paired 5' end is incorporated into RISC (Khvorova et al., 2003; Leuschner et al., 2006;
Schwarz et al., 2003). This observation has enabled the establishment of more efficient siRNA design guidelines for experimental and therapeutic applications.
RISC was first identified by co-immunoprecipitation with a biotinylated siRNA
14

Chapter 1: Introduction
(Martinez et al., 2002). RISC activity has been associated with complexes of various sizes, ranging from 160 kDa to 80S (Gregory et al., 2005; Martinez et al., 2002;
Mourelatos et al., 2002; Nykanen et al., 2001; Pham et al., 2004). All of these RISC complexes bind a member of the Argonaute family. In mammalian cells, RISC binds
Ago2. Although recombinant Ago2 alone, charged with a single stranded siRNA
(ssRNA), can induce silencing of a target transcript (Rivas et al., 2005), it cannot use dsRNA as a substrate, indicating that other components of RISC are essential for its activity in vivo (Liu et al., 2004). Subsequent studies have identified a 500 kDa RISC complex that can use both ssRNA and dsRNA as substrates (Gregory et al., 2005). The
500 kDa RISC complex is composed of Dicer, TRBP, and Ago2. In mammalian cells, both Dicer and its double stranded RNA binding partner, TRBP, are needed for efficient dsRNA processing (Chendrimada et al., 2005; Haase et al., 2005). Therefore, it appears that both siRNA processing and function are linked by a common set of proteins. siRNA-mediated regulation and function
The mechanism responsible for siRNA-mediated silencing has been carefully studied. Conventionally, siRNAs are known to bind transcripts containing perfect complementary sequences. This results in endonucleolytic cleavage by Ago2 on the target between the bases paired with positions 10 and 11 of the guide strand (Elbashir et al., 2001b), Figure 1.1). The guide strand remains associated with RISC, allowing it to perform multiple rounds of cleavage. This cleavage event leads to target mRNA degradation and, as a consequence, inhibition of protein synthesis. Therefore, siRNA targeting is associated with the same degree of RNA and protein knockdown.
Endogenous siRNAs have been identified in fungi, plants and C. elegans .
Naturally occurring sources of dsRNA in these organisms include convergent transcription, transcription of repetitive elements or transposons, and viral replication
15

Chapter 1: Introduction intermediates (reviewed in Farazi et al., 2008). Endogenous siRNAs have been more extensively studied in plants, where they originate from overlapping sense and antisense transcripts (natural antisense transgenes or natsiRNAs) or from non-coding genomic and repeat-associated regions (transacting siRNAs or tasiRNAs and hcRNAs). Endogenous siRNAs function in plants is associated with transposon and transgene silencing.
Originally, flies and mammals were not thought to encode endogenous siRNAs.
However, recently, extensive sequencing of Drosophila somatic cells and Drosophila and mouse ovaries has uncovered small noncoding RNAs with the hallmark properties of siRNAs (Czech et al., 2008; Ghildiyal et al., 2008; Kawamura et al., 2008; Okamura et al., 2008; Tam et al., 2008; Watanabe et al., 2008). Endogenous Drosophila and mammalian siRNAs are 21 nucleotides long and their biogenesis seems to depend on
Dicer and Ago2 function (Czech et al., 2008; Ghildiyal et al., 2008; Kawamura et al.,
2008; Okamura et al., 2008; Tam et al., 2008; Watanabe et al., 2008). Similar to endogenous siRNAs in fungi, plants and C. elegans , these siRNAs are homologous to transposons and protein coding genes. In Drosophila cells, mutations in the specific
Dicer and Argonaute genes, which are largely responsible for the biogenesis of endogenous siRNAs, Dicer-2 and Ago2, resulted in increased expression of certain transposons indicating a potential function for endogenous siRNAs in animals (Ghildiyal et al., 2008; Kawamura et al., 2008). However, further experiments are needed to clarify the role of these newly identified endogenous animal siRNAs.
A major difference between RNAi in fungi, plants and C. elegans versus RNAi in flies and mammals is the presence of a siRNA-amplification step catalyzed by the RNAdependent RNA polymerase (RdRP) (Farazi et al., 2008). Primary siRNAs initiate the formation of dsRNAs by mediating cleavage of target mRNAs, which can serve as substrates for RdRP activity. Newly generated dsRNAs are cleaved by Dicer, generating secondary siRNAs and resulting in the amplification of the RNAi response
16

Chapter 1: Introduction and robust silencing. Unlike fungi, plants, and C. elegans , Drosophila and mammals, do not encode a RdRP enzyme within their genomes. RdRP activity correlates with the ability that plants and C. elegans have of transmitting the silencing response to other tissues, and to the germ line. As expected by the absence of a RdRP enzyme in flies and mammals, neither horizontal nor vertical RNAi transmission has been observed in these biological systems.
Introduction to miRNAs miRNAs are small RNAs transcribed from endogenous genes. They are typically
20-23 nucleotides long and bear similarity to siRNAs, as they also possess 5' monophosphates and 3' two nucleotide hydroxyl overhangs. However, unlike siRNAs, which are primarily derived from long dsRNA molecules, miRNAs are processed from dsRNA hairpin precursors (Figure 1.1). The first miRNA, lin-4 , was discovered in C. elegans . Lin-4 is required for proper developmental timing (Chalfie et al., 1981).
Cloning of lin-4 revealed that this gene encodes a 21 nucleotide noncoding RNA (Lee et al., 1993). Furthermore, lin-4 was complementary to sequences within the 3' UTR of the lin-14 transcript, and was found to negatively regulate the levels of the lin-14 protein
(Wightman et al., 1993). Subsequently, another gene involved in developmental timing in C. elegans , let-7, was also identified and shown to encode a small noncoding 21 nucleotide RNA (Reinhart et al., 2000). Similarly to lin-4 , let-7 was complementary to elements within the 3' UTR of several genes involved in developmental timing.
Evidence that this new class of small RNAs, subsequently termed miRNAs, might be related to siRNAs was provided by two key observations. First, C. elegans Dicer mutants had similar phenotypes to those of lin-4 and let-7 mutants. Second, RNAi components in C. elegans , in particular Dicer-1 and the Argonaute proteins, Alg-1 and
17

Chapter 1: Introduction
Alg-2 , were necessary for the maturation and function of lin-4 and let-7 miRNAs (Grishok et al., 2001). miRNAs are found in the genomes of plants, animals and even viruses (reviewed in Matranga and Zamore, 2007) and are the most abundant class of small silencing
RNAs in mammals. To date, hundreds of miRNAs have been cloned and sequenced in various organisms. One to two hundred miRNAs are expressed in invertebrates and plants (reviewed in Farazi et al., 2008). Humans have approximately 500 miRNAs which are differentially expressed in tissues and throughout development (Ason et al., 2006;
Landgraf et al., 2007). Although miRNAs were previously thought to be expressed only in multicellular organisms, they have also been found in the unicellular green algae
Chlamydomonas reinhardtii (Molnar et al., 2007; Zhao et al., 2007). Several reports indicate that miRNAs regulate a wide range of cellular processes and developmental transitions through inhibition of protein synthesis and mRNA stability (reviewed in
Bushati and Cohen, 2007). In addition, alterations in miRNA expression have been associated with different types of cancers (reviewed in Osada and Takahashi, 2007;
Zhao and Srivastava, 2007), and deletion of proteins involved in miRNA biogenesis has been associated with several diseases, such as DiGeorge syndrome (Gregory et al.,
2004). miRNA biogenesis miRNAs are encoded within non-coding protein regions or within the introns of protein coding genes (reviewed in Bartel, 2004). miRNA primary transcripts (primiRNAs) are transcribed by Polymerase II, sometimes as polycistronic transcripts, and contain both a 5' cap and a poly A tail (Tanzer and Stadler, 2004, Figure 1.1). primiRNAs, fold into imperfect double stranded hairpin structures (Figure 1.1). pri-miRNAs are subsequently processed in two steps by two different RNAse III endonucleases:
18

Chapter 1: Introduction
Drosha in the nucleus and Dicer in the cytoplasm (reviewed in Kim, 2005, Figure 1.1). In the nucleus, Drosha and its double stranded RNA binding partner, DiGeorge syndrome critical region 8 (DGCR8, also known as Pasha in Drosophila ) cleave pri-miRNAs into approximately 70 nucleotide hairpins known as pre-miRNAs (Denli et al., 2004; Gregory et al., 2004; Landthaler et al., 2004; Lee et al., 2003). Splicing of certain introns encoding miRNAs, generates a splicing intermediate that corresponds precisely to a premiRNA, mimicking a Drosha/DGCR8 product. These types of miRNAs are known as mirtrons and are able to circumvent the requirement for Drosha/DGCR8 processing
(Berezikov et al., 2007; Okamura et al., 2007; Ruby et al., 2007). pre-miRNAs exit the nucleus through their interaction with Exportin 5, which recognizes 3' two nucleotide overhangs (Bohnsack et al., 2004; Lund et al., 2004; Yi et al., 2003). Once in the cytoplasm, pre-miRNAs are processed by Dicer and its partner
TRBP (Chendrimada et al., 2005; Haase et al., 2005). The result is a 21-23 nucleotide duplex (Figure 1.1). miRNAs bind a RNA silencing complex which is less well-defined than RISC. In mammals, this complex contains one of the four human Argonaute proteins and is known as the microRNP (miRNP) or the miRNA-induced silencing complex (miRISC). Other protein components have also been found to associate with miRISC. These include the Fragile X mental retardation protein (FMRP), a modulator of translation in neurons, and two processing body (P-body) proteins that have been shown to have important roles in miRNA-mediated silencing, GW182 (named for the presence of glycine(G)-tryptophan(W) repeats and for its molecular mass of 182 kDa) and DEADbox RNA helicase RCK/p54 (reviewed in Rana, 2007). However, exactly how all of the miRNP associated proteins influence miRNP function is not completely understood.
As observed with siRNA duplexes, miRNA duplexes undergo strand selection which is also determined by the relative thermodynamic stability of the strands’ 5' ends
(Khvorova et al., 2003; Leuschner et al., 2006; Schwarz et al., 2003, Figure 1.1). The
19

Chapter 1: Introduction strand with the less stable 5' end is simply known as the miRNA strand and the strand with the more stable 5' end is known as the miRNA* strand. Unlike siRNAs, however, animal miRNA duplexes often contain central mismatches. Mismatches within the center of small silencing RNA duplexes, whether these duplexes are siRNAs or miRNAs, disrupt Ago2 mediated cleavage of the strand with the more thermodynamically stable 5' end (Leuschner et al., 2006; Matranga et al., 2005; Miyoshi et al., 2005; Rand et al.,
2005). As a consequence, most mature miRNA strands in animals are selected through a cleavage independent mechanism which is not currently well understood. miRNA function and target recognition
In mammals, miRNAs repress gene expression primarily by affecting protein production, commonly referred to as translational repression. Similar to siRNAs, miRNAs can mediate endonucleolytic cleavage of target transcripts when bound with perfect or near perfect complementarity (Hutvagner and Zamore, 2002; Meister et al.,
2004; Okamura et al., 2004; Yekta et al., 2004; Zeng et al., 2003, Figure 1.1). However, this mode of regulation is most prevalent among plants miRNAs, because the majority of mammalian miRNA target sites are only partially complementary to the respective miRNA and therefore they do not elicit endonucleolytic cleavage. Conversely, siRNAs can repress transcript expression through translational repression without endonucleolytic cleavage of a mRNA bearing imperfectly complementary binding sites
(Doench et al., 2003; Zeng et al., 2003). These observations indicate that the extent of complementarity between a small silencing RNA and its target (and not its origin) determines whether the small RNA mediates cleavage or translational repression.
Translational repression is mediated through the action of an Argonaute protein within the miRNP. All four human Argonautes, Agos 1-4, bind miRNAs in vivo (Meister et al.,
2004) and appear to be capable of mediating translational repression (to be discussed in
20

Chapter 1: Introduction more detail in later sections of this Chapter). This is based on the observation that miRNA-independent tethering of Ago2, 3 and 4 to a mRNA reporter can result in translational repression (Pillai et al., 2004).
Mammalian miRNA binding sites are usually found within the 3' UTR of genes. miRNAs can bind and regulate a multitude of targets, while a single target can be regulated by a combination of miRNAs (reviewed in Kim, 2005). Unlike endonucleolytic cleavage, translational repression is a cooperative mechanism, which suggests that target expression can be fine-tuned by altering the number of miRNA binding sites
(Doench et al., 2003; Grimson et al., 2007; Nielsen et al., 2007). miRNA pairing follows a set of rules, which have been elucidated experimentally and by bioinformatics analyses. Based on sequence conservation and functional studies, the mature miRNA can be broadly divided into two regions: a 5' and a 3' region
(Figure 1.2). Nucleotide positions within the 5' region, in particular positions 2-7, are essential for target site recognition and miRNA binding (Brennecke et al., 2005; Doench and Sharp, 2004; Grimson et al., 2007; Haley and Zamore, 2004; Kloosterman et al.,
2004; Lewis et al., 2005; Nielsen et al., 2007; Stark et al., 2005). These positions have been termed the “seed” region and form the basis for all putative target prediction algorithms (Figure 1.2). Based on conservation of 3' UTR segments containing exact complementarity to the seed regions of conserved miRNAs, targets for this class of miRNAs have been predicted (Lewis et al., 2005). These predictions indicate that at least 30% of mammalian mRNAs contain one or more binding sites for conserved miRNAs (Lewis et al., 2005). Based on identical nucleotide sequence within the seed region, miRNAs can be clustered into families. Members of the same miRNA family are thought to regulate overlapping set of genes. The 3' region of the miRNA is not necessary for miRNA binding, but it can compensate for weak 5' regions and can contribute to silencing (Brennecke et al., 2005; Doench and Sharp, 2004; Grimson et al.,
21

Chapter 1: Introduction
2007; Haley and Zamore, 2004). Although examples of miRNA:target interactions with some degree of complementarity to both the 5' and 3' region of the miRNA exist, bioinformatics analyses indicate that the majority of conserved animal miRNA target interactions only involve the miRNA seed (Brennecke et al., 2005; Lewis et al., 2005).
In addition to the miRNA seed (positions 2-7), two recent studies have also identified other determinants that confer greater miRNA-mediated silencing and can be incorporated into miRNA target predictions for better accuracy of miRNA binding and specificity (Grimson et al., 2007; Nielsen et al., 2007). Base pairing at position 8 and an
A at position 1 on the target transcript correlated with stronger miRNA repression than seed matches alone. Based on the degree of silencing conferred by each of these determinants, a hierarchy for seed matches has been proposed: at one end of the spectrum is the seed match alone (referred to as a “6 mer” seed match type) which is associated with the lowest level of miRNA-mediated silencing among the different seed match types in the hierarchy. At the other end of the spectrum is the seed match plus the combinations of these newly discovered determinants: pairing at positions 1 (the nucleotide in the target is an A) and 8 (referred to as an “8 mer” seed match type), which is associated with the highest degree of miRNA-mediated silencing among seed match types (Grimson et al., 2007; Nielsen et al., 2007). In addition to the determinants uncovered at positions 1 and 8, an A or a U at position 9 in the target, irrespective of complementarity to the miRNA, also correlates with stronger miRNA-mediated silencing
(Nielsen et al., 2007). Furthermore, these two studies also reported that binding site context can play a significant role in miRNA-silencing. For example, increased miRNAmediated silencing correlated with the following: 1) proximity of binding sites to the stop codon or the end of the 3' UTR; 2) increased conservation and A/U-rich content of sequences surrounding binding sites; and 3) close proximity of binding sites (Grimson et al., 2007; Nielsen et al., 2007). Target site accessibility and mRNA secondary structure
22

Chapter 1: Introduction have also been previously reported as important indicators of robust siRNA-mediated and miRNA-mediated silencing (Ameres et al., 2007; Cullen, 2006; Gregory et al., 2004;
Heale et al., 2005; Long et al., 2007; Luo and Chang, 2004; Overhoff et al., 2005;
Schubert et al., 2005) underscoring the importance of binding site context for both miRNA and siRNA-mediated silencing. miRNA-mediated regulation: translational repression
The mechanistic details of how miRNAs inhibit protein expression remain highly controversial. Several studies using different systems have revealed contradictory results. Early miRNA experiments in C. elegans indicated that miRNAs repress protein synthesis at a step after translation initiation (Olsen and Ambros, 1999; Seggerson et al.,
2002). More recent studies have both supported and challenged this view. Studies that agree with the early observations in worms, showed that miRNAs and their targets associate with actively translating polysomes, as demonstrated by their sensitivity to drugs that inhibit translation such as hippuristanol, puromycin, and pactamycin (Maroney et al., 2006; Nottrott et al., 2006; Petersen et al., 2006). Additional evidence that miRNAs repress translation at a step after initiation comes from the observation that silencing still occurs for a reporter with a virus internal ribosome entry site (IRES)
(Petersen et al., 2006). IRESs can initiate translation independently of the cap structure.
Therefore, these experiments indicate that miRNA inhibition takes place at a step after cap recognition (Petersen et al., 2006). Exactly how miRNAs affect inhibition of translation at a step after initiation is not known. Based on the observation that ribosomes associated with repressed messages dissociate more rapidly after inhibition of translation than those associated with nonrepressed messages, it has been proposed that miRNAs cause premature ribosome dissociation or ribosome “drop-off” (Petersen et al., 2006).
23

Chapter 1: Introduction
In contrast with these studies, other in vivo and in vitro studies have concluded that miRNA inhibition occurs during initiation of translation (Chendrimada et al., 2007;
Humphreys et al., 2005; Kiriakidou et al., 2007; Mathonnet et al., 2007; Pillai et al., 2005;
Thermann and Hentze, 2007; Wakiyama et al., 2006; Wang et al., 2006). In this group of studies, miRNA and their targets are not associated with polyribosomes but instead with the free ribosome pool. In addition, when the cap was substituted for an IRESs or a nonfunctional cap, reporter constructs containing miRNA binding sites could not be repressed, indicating that miRNAs mediate translational repression by inhibiting cap recognition (Humphreys et al., 2005; Mathonnet et al., 2007; Pillai et al., 2005;
Wakiyama et al., 2007).
Two recent reports have illustrated two different pathways by which miRNAs might inhibit initiation of translation. In one report, the Mid domain of mammalian Ago2 was found to contain a region with sequence similarity to the cap-binding domain found in the translation initiation factor subunit eIF4E (Kiriakidou et al., 2007). In eIF4E, this domain contains two conserved tryptophans which serve to anchor the cap’s methylated guanosine. Initiation of translation begins with the recognition of the cap structure, m 7 GppN, by the eIF4E subunit of the translation initiation factor eIF4F. These two tryptophan residues in eIF4E are essential for cap recognition. In Argonaute proteins that are able to induce translational repression, the tryptophans have been replaced by two phenylalanines. Human Ago2 binds to m 7 GTP and substitution of one or two of the conserved phenylalanines leads to inhibition of protein silencing (Kiriakidou et al., 2007).
These results indicate that miRNA silencing inhibits translation initiation by preventing eIF4E from binding to the cap structure (Kiriakidou et al., 2007).
An alternative mechanism has been proposed by Chendrimada and colleagues to account for miRNA repression of translation initiation. In their report, Ago2, TRBP and
Dicer associate with the large ribosomal subunit, 60S, and with the translation initiation
24

Chapter 1: Introduction factor eIF6 (Chendrimada et al., 2007). It has been recently reported that eIF6 prevents premature recruitment of the 40S subunit (Russell and Spremulli, 1978). Depletion of eIF6 in human cells and C. elegans relieves miRNA repression, indicating that miRNAs might repress their targets by preventing binding of the 40S subunit to the 60S ribosomal subunit (Chendrimada et al., 2007). Complicating these observations is the fact that eIF6 has been shown to participate in the maturation of the 60S subunit in yeast and humans (Basu et al., 2001; Sanvito et al., 1999; Si and Maitra, 1999). Therefore, depletion of eIF6 could have secondary effects that may have affected the outcome of these experiments.
Given that both miRNAs have been reported by several groups to inhibit protein synthesis at initiation or post initiation steps, it is hard to reconcile the different modes of translational repression. It is possible that the different conclusions obtained from both in vitro and in vivo miRNA repression experiments are a reflection of experimental biases. On the other hand, it is also possible that miRNAs repress protein expression through a multitude of mechanisms which vary based on cell type and context. Based on tethering studies, it has been proposed that all human Argonautes are capable of inducing translational repression (Pillai et al., 2004). None of the in vivo and in vitro miRNA repression studies have addressed which Argonautes are responsible for mediating translational repression in their experimental systems. It is possible that different Argonautes regulate targets through different mechanisms. It is also possible that the interaction of various protein components with miRNPs determines which mechanism predominates. miRNA-mediated regulation: RNA decay
In recent years, multiple studies in C. elegans , Drosophila and mammalian cells have reported that miRNAs not only affect protein synthesis but also mRNA stability
25

Chapter 1: Introduction through cleavage independent pathways (Bagga et al., 2005; Behm-Ansmant et al.,
2006; Giraldez et al., 2006; Jing et al., 2005; Lim et al., 2005; Rehwinkel et al., 2006;
Schmitter et al., 2006; Wu et al., 2006). miRNA-mediated transcript instability involves the mRNA degradation machinery used for bulk mRNA degradation.
Bulk mRNA degradation can take place through the action of two different pathways. Poly A tails are removed from transcripts targeted for destruction. Poly A removal is generally followed by either progressive 3'
→
5' decay catalyzed by the exosome, or by removal of the cap with subsequent 5' → 3' degradation catalyzed by the exonuclease Xrn1 (reviewed in Parker and Sheth, 2007). The exosome is localized to the cytoplasm while Xrn1 localizes to small dense structures within the cytoplasm called processing bodies (P-bodies) that house translationally inactive mRNAs and components of the mRNA degradation machinery such as decapping, deadenylase enzymes, and accessory proteins.
Evidence that miRNAs might regulate transcript levels first came from overexpression studies of two tissue specific miRNAs in HeLa cells: miR-1 (muscle) and miR-124 (brain) (Lim et al., 2005). The majority of the downregulated mRNAs contained seed matches in their 3' UTR to either miR-1 and miR-124. Subsequently, experiments with C. elegans ’ let-7 target, lin-41 , confirmed that miRNA-induced mRNA downregulation is not due to endonucleolytic cleavage between positions 10 and 11
(Bagga et al., 2005). Studies of several miRNAs in Drosophila , miR-430 in zebrafish, and mammalian miR-125 and let-7, have indicated that miRNAs mediate mRNA decay by involving components of the mRNA degradation machinery and inducing rapid deadenylation (Behm-Ansmant et al., 2006; Giraldez et al., 2006; Wu and Belasco,
2005). Rapid target transcript deadenylation is mediated through the recruitment of the
CCR4-NOT deadenylase complex (Figure 1.1). Depletion of the decapping enzymes
Dcp1 and Dcp2, and depletion of decapping activators both prevent miRNA-induced
26

Chapter 1: Introduction mRNA decay (Behm-Ansmant et al., 2006; Eulalio et al., 2007b). Therefore, miRNAmediated mRNA decay requires both rapid deadenylation and decapping (Eulalio et al.,
2008). In addition to decapping and deadenylation enzymes, another P-body component, GW182, has been implicated in rapid deadenylation of target transcripts.
Studies in Drosophila S2 cells, mammalian cells and C. elegans have shown that
GW182 binds Argonaute proteins and is necessary for both mRNA decay and translational repression (Behm-Ansmant et al., 2006; Ding et al., 2005; Liu et al., 2005a;
Meister et al., 2005; Rehwinkel et al., 2006). GW182 tethering to the 3' UTR of a reporter construct in the absence of reporter miRNA binding sites can result in both mRNA and translational repression of the reporter even in the absence of Ago1 expression, Drosophila ’s Argonaute protein dedicated to the miRNA pathway (Behm-
Ansmant et al., 2006). It is currently thought that GW182 is recruited to miRNA targets through its interaction with Argonaute proteins, and that its recruitment marks the transcript for both mRNA decay and translational repression.
The extent of a target’s overall protein knockdown due to mRNA decay through rapid deadenylation or translational repression likely depends on the target sequence and the structure of the mRNA:miRNA duplex since the same miRNA can cause mostly translational repression or mostly mRNA decay through deadenylation, depending on the target sequence (Eulalio et al., 2007b). In addition, questions have arisen as to whether deadenylation is a by-product of translational repression. Several lines of evidence have shown that miRNA-mediated decay can occur independently of translational repression. For example, inhibition of translational repression by either the insertion of a stem loop structure in the 5' UTR (Wu et al., 2006), by the insertion of a translation incompetent cap (Mishima et al., 2006; Wakiyama et al., 2007), or by the addition of translation inhibitors (Eulalio et al., 2007b; Wakiyama et al., 2007), does not affect miRNA-induced deadenylation or mRNA decay. Just as deadenylation can occur
27

Chapter 1: Introduction independently of translational repression, translational repression can also occur independently of deadenylation. For example, numerous examples of miRNA targets that do not experience mRNA decay have been reported (reviewed in Filipowicz et al.,
2008). In addition, deletion of one of the subunits of the deadenylase complex in
Drosophila S2 cells, NOT1, results in a dramatic reduction of miRNA-mediated mRNA decay, but does not fully restore protein levels, especially for targets for which the overall protein knockdown is due mostly to translational repression (Behm-Ansmant et al.,
2006). Furthermore, substitution of the poly A tail of a reporter construct (with binding sites for mammalian miR-125b) for a 3' terminal loop affects the overall protein knockdown, due to a decrease in miRNA-mediated mRNA decay, but does not affect the extent of protein knockdown due to translational repression (Wu et al., 2006). These results indicate that other pathways, which are independent of deadenylation, contribute to translational repression.
Localization of miRNA-mediated repression
Animal Argonaute proteins localize to the cytoplasm and to P-bodies (Behm-
Ansmant et al., 2006; Ding et al., 2005; Liu et al., 2005a; Sen and Blau, 2005). This observation, and the fact that other P-body components have been involved in miRNA silencing (mainly GW182, the CCR4-NOT deadenylase complex, decapping enzymes and activators, and the RNA helicase RCK/p54) has led to the belief that repressed messages are sequestered in P-bodies, away from the translation machinery, and that
P-bodies are important for miRNA-mediated silencing (reviewed in Filipowicz et al.,
2008). Evidence that supported this hypothesis came from the observation that miRNAs and repressed messages also localize to P-bodies (Bhattacharyya et al., 2006; Jakymiw et al., 2005; Liu et al., 2005a; Liu et al., 2005b; Pillai et al., 2005). Localization of transcripts to P-bodies is associated with mRNA degradation, although there are
28

Chapter 1: Introduction examples in S. cerevisiae and human cells where messages can be targeted to Pbodies in a reversible manner (Bhattacharyya et al., 2006; Brengues et al., 2005). One example involves the cationic amino acid transporter (CAT-1) mRNA, which is repressed by the liver specific miRNA miR-122. Repression leads to CAT-1’s accumulation in Pbodies (Bhattacharyya et al., 2006). Following cellular stress, such as amino acid starvation, CAT-1 is released from P-bodies into the cytoplasm. This is due to binding of the HuR protein (an AU rich element binding protein also known as ELAV1) to the 3'
UTR of CAT-1 (Bhattacharyya et al., 2006).
Recently, several studies have argued against a central role for P-bodies in miRNA silencing (Chu and Rana, 2006; Eulalio et al., 2007a; Leung et al., 2006).
Knockdown of P-body components not involved in miRNA-mediated silencing results in their dispersal, yet miRNA repression (both translational repression and mRNA decay) is not affected (Chu and Rana, 2006; Eulalio et al., 2007a). Another line of evidence that argues against P-bodies having an important role in miRNA-mediated silencing comes from quantitation of Ago2 localization. Approximately 2% of an enhanced GFP (EGFP)
Ago2 construct localizes to P-bodies in HeLa cells and, unlike other P-body components such as the decapping enzymes Dcp1 and Dcp2, Ago2 localized to P-bodies exchanges at a much slower rate (Leung et al., 2006). Furthermore, when components of the miRNA or siRNA silencing pathways are depleted, P-body formation is affected, indicating that macroscopic P-bodies are a consequence of miRNA silencing, rather than a cause (Eulalio et al., 2007a). It is possible that miRNA repression is initiated within the cytoplasm and that formation of P-bodies is caused by the conglomeration of complex protein structures associated with mRNA decay or translationally repressed messages.
It is important to note that P-bodies lack ribosomes and all of the translation initiation factors, except for eIF4E (Filipowicz et al., 2008). Therefore, accumulation of translationally repressed mRNAs in P-bodies could only occur after ribosome
29

Chapter 1: Introduction dissociation.
In addition to their localization to P-bodies, Argonautes also localize to stress granules (Leung et al., 2006). These cytoplasmic structures typically form in the setting of cellular stress or as the result of general inhibition of translation initiation. Unlike Pbodies, stress granules do contain ribosomal components, in particular the 40S subunit.
Stress granules also contain components present in P-bodies such as eIF4E and the
RNA helicase RCK/p54. However, most P-body components are not present in stress granules and vice versa. Argonaute proteins found in stress granules exchange rapidly with Argonaute cytoplasmic pools and more importantly, their localization to stress granules is dependent on miRNAs (Leung et al., 2006). It is possible that these structures may have a role in miRNP-mediated repression. Leung and colleagues have proposed that translational repression most likely occurs within the cytoplasm and that localization to P-bodies and stress granules probably correspond to different functional states of miRNP (Leung et al., 2006).
Biological implications of miRNA function
Individual miRNA functional studies have revealed that miRNAs influence cellular processes to different degrees. One set of miRNAs regulates gene expression by acting as binary switches. Deletion of these miRNAs causes strong phenotypes. Two examples are the miRNA lsy-6 and miR-273 in C. elegans . Lsy-6 and miR-273 specify left to right asymmetry of distinct gustatory neurons in nematode brains. Lsy-6 is only expressed in the left gustatory neurons (ASEL neurons) and miR-273 is only expressed in the right gustatory neurons (ASER neurons) (Chang et al., 2003; Johnston and
Hobert, 2003; Johnston et al., 2005). Neuronal asymmetry is established by a double negative feedback loop in which two transcription factors mediate repression of each other by inducing the expression of lsy-6 in ASEL neurons and miR-273 in ASER
30

Chapter 1: Introduction neurons (Johnston et al., 2005). Misexpression or knockout of lsy-6 and misexpression of miR-273 results in failure to establish neuronal ASE asymmetry (Chang et al., 2003;
Johnston and Hobert, 2003; Johnston et al., 2005) indicating that these miRNAs play a critical role in gustatory neuronal specification.
Other miRNAs do not behave like biological switches. Instead transcription seems to be the primary mode of regulation and miRNA expression acts as a secondary level of regulation to reinforce the first. Deletion of these miRNAs may result in subtle phenotypes that can be difficult to quantify or characterize. An example of this mode of regulation is miR-7 in Drosophila . During photoreceptor differentiation, EGF activation leads to the degradation of the protein Yan, a repressor of miR-7 transcription (Li and
Carthew, 2005). The increase in miR-7 expression leads to further repression of Yan and maintenance of the differentiation program. However, miR-7 mutant flies have normal eye development. To observe inhibition of photoreceptor differentiation, the miR-
7 mutation was combined with an EGF signal insensitive Yan mutation, indicating that miR-7 reinforces the inhibition of Yan expression (Li and Carthew, 2005). However, miR-7 expression is not necessary under normal developmental conditions.
Introduction to piRNAs piRNAs are 24-33 nucleotide RNAs that associate with Piwi proteins in the germline, where they are believed to repress the expression of transposons and repetitive elements. Piwi proteins are a subclass of the larger Argonuate family of proteins (the Argonaute family will be discussed in greater detail in later sections). piRNAs contain a 5' monophosphate and are 3' methylated (Horwich et al., 2007; Kirino and Mourelatos, 2007a; Kirino and Mourelatos, 2007b; Ohara et al., 2007; Saito et al.,
2007).
31

Chapter 1: Introduction piRNA biogenesis
Unlike siRNAs and miRNAs, piRNA biogenesis is independent of Drosha and
Dicer (reviewed by O'Donnell and Boeke, 2007) and is believed to involve Piwi proteins.
In Drosophila , where piRNA biogenesis has been studied in detail, three Piwi family members are associated with piRNA biogenesis: Piwi, Aubergine and Drosophila Ago3.
Piwi and Aubergine bind to piRNAs that preferentially begin with a U and match the antisense strand of transposons. In contrast, Ago3 lacks a preference for a U at the 5' end. Instead, it preferentially binds piRNAs that match sense transposon strands and have an A at position 10. In addition, the distance between the 5' end of complementary piRNAs is 10 nucleotides. A model has been proposed to explain these observations
(Brennecke et al., 2007). In this model, piRNAs are generated through an amplification loop. Primary processing of long antisense RNA, corresponding to transposon sequences, generates small antisense piRNAs with a 5' U bias. These primary piRNAs bind to Piwi or Aubergine, which in turn catalyze the cleavage of a complementary transposon transcript at a site that is 10 nucleotides downstream from the 5' end of the primary piRNA. An unknown endonuclease degrades the 3' end of the cleaved transposon transcript to generate a secondary piRNA which corresponds to the sense sequence of the transposon and has an A at position 10. This secondary piRNA binds to Ago3 and mediates the catalysis of a complementary transposon transcript. The product of this Ago3 cleavage event is a transcript that is antisense to the transposon sequence and has a U at its 5' end. Trimming of the cleaved transposon transcript’s 3' end by an unknown endonuclease generates a piRNA that can then bind to Piwi or
Aubergine, starting the amplification loop once again. piRNA function
In flies, piRNAs are thought to arise from master loci with transposon sequences
32

Chapter 1: Introduction and to act in “trans” to silence copies of these transposons within the genome
(Brennecke et al., 2007). In mammals, however, piRNAs sequences are highly complex and many piRNAs map to loci that do not contain repetitive sequences. Although mammalian piRNA’s function is largely unknown, knockout studies of three mouse Piwi proteins, Mili, Miwi and Miwi2, result in arrested spermatogenesis (review in O'Donnell and Boeke, 2007). Knockout mice for Miwi2 and Mili genes also show some degree of transposon derepression, suggesting that in mammals, one of the functions of the piRNA pathway is to repress transposon activity within the germline (Aravin et al., 2007;
Carmell et al., 2007).
Introduction to the Argonaute family
The family of Argonautes is subdivided mainly into two subfamilies: Argonautelike proteins and Piwi-like proteins. These subdivisions have been made based on the sequence similarities between members of this family and the two founding proteins for these two subgroups: Ago1 in Arabidopsis thaliana (Bohmert et al., 1998) and Piwi (Pelement induced wimpy testis) in Drosophila (Lin and Spradling, 1997). There is a third class of Argonaute proteins which have only been found in C. elegans and are phylogenetically different from Argonaute-like and Piwi-like proteins.
Each organism in which RNAi has been studied possesses differences in the number and type of Argonautes. The most simple example is S. pombe which has only one Argonaute protein. On the other end of the spectrum is C. elegans , which possesses 27 Argonautes: 5 Argonaute-like proteins, 3 Piwi-like proteins and 19 C. elegans specific Argonautes corresponding to the third class of Argonaute proteins.
Humans have a total of 8 Argonautes: 4 Argonaute-like proteins (Ago1, 2, 3 and 4) and 4
Piwi-like proteins (Hili, Hiwi1, 2 and Piwi3) (reviewed in Hutvagner and Simard, 2008).
33

Chapter 1: Introduction
In mammals, Ago1, 2, 3 and 4 are associated with siRNAs and miRNA function while
Piwi proteins has been implicated in germ cell development and piRNA biology, a distinct class of small silencing RNAs found in animals.
Argonaute structure
Argonaute proteins contain three different domains: PAZ, Mid and PIWI domains.
X-ray crystallography and nuclear magnetic resonance (NMR) spectroscopy of individual domains and full length archaeal Argonaute proteins have identified structural features important for Argonaute function (Lingel et al., 2003; Lingel et al., 2004; Ma et al., 2004;
Parker et al., 2004; Parker et al., 2005; Rashid et al., 2007; Rivas et al., 2005; Song et al., 2003; Song et al., 2004; Yan et al., 2003; Yuan et al., 2005). The PAZ domain is found in both Argonaute-like and Piwi-like proteins (Cerutti et al., 2000). The PAZ domain has a binding pocket that is able to recognize 2 nucleotide 3' overhangs, which are characteristic of small RNA processing by RNAse III enzymes (Lingel et al., 2003;
Lingel et al., 2004; Ma et al., 2004; Song et al., 2003; Yan et al., 2003).
The PIWI domain of Argonautes has a RNAse H-like fold. RNAse H enzymes cleave RNA-DNA duplexes by a mechanism that involves the conserved catalytic triad
Asp-Asp-Glu/Asp and two divalent metal ions (reviewed in Hutvagner and Simard,
2008). Argonaute proteins, on the other hand, cleave RNA-RNA duplexes using a more degenerate catalytic triad, Asp-Asp-Asp/Glu/His/Lys and one divalent metal ion
(Hutvagner and Simard, 2008). Argonaute products also contain features that are characteristic of RNAse H cleavage events: a 3' hydroxyl and a 5' phosphate. Human
Ago2 has a catalytic triad that consists of Asp/Asp/His. As previously mentioned, human
Ago2 is the only one of the four human Argonaute proteins that has been shown to have catalytic activity in vitro (Liu et al., 2004) despite the fact that the catalytic residues are also conserved in Ago3 (Liu et al., 2004). It is not known what specifications might be
34

Chapter 1: Introduction associated with endonucleolytically inactive Argonautes. Of all the Argonautes and Piwi proteins identified so far, only 7 have been shown directly to contain catalytic activity: S. pombe ’s only Ago protein, Arabidopsis Ago1 and 4, Drosophila Ago1 and 2, Drosophila
Piwi and human Ago2 (Hock and Meister, 2008).
The Mid domain lies between the PAZ and the PIWI domains. The interface between the PIWI and Mid domain binds the 5' phosphate of small RNAs via its interaction with a divalent cation (Ma et al., 2004; Song et al., 2004). In addition, metazoan Argonautes contain a conserved motif within the Mid domain, called MC, with homology to the cap-binding motif found in eIF4E (Kiriakidou et al., 2007). It has been suggested that one way in which Argonaute proteins inhibit protein synthesis is by competing with eIF4E binding for the cap structure and thereby preventing translation initiation (Kiriakidou et al., 2007). Structural studies performed with a bound ssRNA have also revealed why Argonaute-mediated cleavage always occurs at a fixed position.
Anchoring of the 5' phosphate between the Mid and the PIWI domain positions the scissile phosphate on the target RNA between positions 10 and 11 in front of the catalytic triad.
Pairing between the guide strand of a siRNA and the transcript target leads to the formation of an A-form helix (a structure formed by dsRNA), which is essential for endonucleolytic cleavage (Chiu and Rana, 2003).
Small silencing RNA loading and sorting into Argonaute containing complexes
How do small RNAs distinguish among different Argonaute containing miRNPs?
The answer to this question is complex and depends on the organism that is examined and whether or not specialized pathways exist for either siRNA or miRNA silencing. The best studied example is in Drosophila which has two different Argonautes and Dicer proteins. In flies, Dicer-1 and Ago1 are mainly associated with the miRNA pathway. siRNAs are processed by Dicer-2 and its partner R2D2, whereas miRNAs are processed
35

Chapter 1: Introduction by Dicer-1 and its partner Loquacious (Okamura et al., 2004, reviewed in Tomari and
Zamore, 2005). However, whether a siRNA or a miRNA gets shuttled into Ago1 or Ago2 containing miRNPs does not depend on which of the two Dicer enzymes it binds, but rather on the structure of the small silencing RNA duplex. Perfectly matched duplexes, such as siRNA precursors, bind to Ago2 while mismatched duplexes, such as most animal miRNAs, are shuttled to the Ago1 pathway (Forstemann et al., 2007; Tomari et al., 2007). In Drosophila , Ago1 cannot mediate RNAi effectively because it is a poor endonuclease. Conversely, Drosophila Ago2 cannot effectively translationally repress miRNA targets with central bulges (Forstemann et al., 2007). Similar studies in C. elegans , which also has specialized Argonuate proteins for the siRNA and miRNA pathways, correlate with the finding in Drosophila that duplex structure determines to which Argonuate containing complex the small RNA will bind (Steiner et al., 2007).
Deep sequencing of small RNAs associated with different Argonaute proteins in plants has uncovered a different mechanism for small silencing RNA sorting (Mi et al.,
2008; Montgomery et al., 2008). Plants have a diverse number of small RNAs. In addition to miRNAs, plants have 3 classes of endogenous siRNAs. Each different small
RNA class preferentially binds to a different Argonaute protein (reviewed by Kim, 2008).
Bioinformatic analyses of small silencing RNAs associated with different Argonautes have uncovered a strong 5' nucleotide bias for each Argonaute (Mi et al., 2008) indicating that Argonaute sorting in plants is dependent not on the structure of the small silencing RNA duplex but on its sequence. However, 5' nucleotide bias cannot explain all small RNA binding preferences. For example, plant miR-390, which, based on sequence, should bind to plant Ago1 or Ago2, actually binds to Ago7, even when the 5' nucleotide of miR-390 is mutated to a nucleotide that is not associated with Ago7 binding
(Montgomery et al., 2008).
In mammals, the distinction between the siRNA and miRNA pathways is less
36

Chapter 1: Introduction clear. Both miRNAs and siRNAs can interchangeably enter either pathway (Doench et al., 2003; Hutvagner and Zamore, 2002) and mammals possess only one Dicer protein.
Mammalian Ago1, Ago2 and Ago3 have been shown to bind siRNAs in vivo despite the fact that only Ago2 has catalytic activity in vitro and is therefore thought to be the only
Argonaute that can mediate siRNA silencing in mammals (Liu et al., 2004). As previously mentioned, all four human Argonautes can bind miRNAs (Meister et al., 2004) and induce translational repression of a reporter in vivo (Pillai et al., 2004). Although most mammalian studies have focused on studying Ago2’s function because of its ability to induce both mRNA cleavage and translational repression, the role that the other human Argonautes play with respect to small RNA silencing is not clear. This makes deciphering how siRNAs and miRNAs partition within mammalian Argonautes a challenging problem.
Introduction to RNAi-based experimental applications
The discovery that chemically synthesized siRNAs can trigger RNAi in vivo
(Elbashir et al., 2001b) has heralded a revolution in research, making it possible to knockdown genes of interest and to perform large scale screens using RNAi based libraries in mammalian cells and other nongenetically tractable systems. Up to this point, the use of RNAi in mammalian systems had not been successful because long dsRNAs are potent triggers of the nonspecific interferon response. In addition, RNAi technology has the potential to be used as a medical therapy.
RNAi’s growing importance as an experimental and therapeutic tool, has necessitated the study of the specificity of siRNA-mediated silencing. siRNA specificity
37

Chapter 1: Introduction
Early RNAi studies concerned with siRNA design and specificity, investigated the effect of mismatches in the mRNA and siRNA duplex on overall protein silencing
(Elbashir et al., 2001c). Single nucleotide perturbations within the mRNA:siRNA duplex eliminated almost completely protein silencing of a target reporter in vitro , suggesting that siRNA mediated silencing was highly specific (Elbashir et al., 2001c). Other early reports supported these conclusions (Chi et al., 2003; Ding et al., 2003; Semizarov et al.,
2003). For example, a siRNA that is complementary to a mutant allele transcript of the superoxide dismutase 1 (SOD1) gene was successful at distinguishing between wildtype and SOD1 mutant transcripts in vivo and in vitro . Wildtype and mutant SOD1 transcripts varied by only one nucleotide at position 10 (Ding et al., 2003).
More recently, however, microarray data obtained after transfection of complementary siRNAs against the mitogen-activated protein kinase 14 (MAPK14), revealed unintended mRNA downregulation of transcripts with partial complementarity to the MAPK14 siRNAs (Jackson et al., 2003). Prior studies had indicated that unintended siRNA-mediated regulation could be a consequence of high siRNA concentration
(Semizarov et al., 2003). However, Jackson and colleagues showed that unintended transcript downregulation, known as “off-target” effects, occurs even when low levels of siRNAs are transfected (Jackson et al., 2003). Different siRNA sequences targeting the
MAPK14 transcript, produced unique expression signatures. Furthermore, off-target effects were observed even at early time points after transfection when target protein expression, MAPK14, had not yet changed, indicating that off-target effects are not a secondary effect caused by downregulation of the intended target’s protein level
(Jackson et al., 2003).
Clues that off-target effects could be related to miRNA-mediate mechanisms came from comparison of off-target transcripts and the transfected siRNAs that result in their downregulation. The 3' UTR of off-target transcripts contained partially
38

Chapter 1: Introduction complementarity sequences to the 5' region of the MAPK14 siRNAs (Jackson et al.,
2003). This type of interaction is reminiscent of miRNA interactions with target transcripts. Although complementarity to the 3' region of the miRNA strand can increase miRNA-mediated silencing, complementarity to the 5' region or seed is sufficient to confer repression (Brennecke et al., 2005; Doench and Sharp, 2004; Grimson et al.,
2007). In addition, transfection of tissue specific miRNAs in HeLa cells revealed that miRNAs can also induce mRNA downregulation of target transcripts. Similar to the RNA changes reported after ectopic introduction of miRNAs into HeLa cells (Lim et al., 2005), off-target effects are associated with modest 1.5 to 2-fold RNA changes (Jackson et al.,
2003; Jackson et al., 2006a; Jackson et al., 2006b). In addition, off-target transcript microarray data has been used to uncover determinants besides the seed region, that correlate with increased off-target mRNA downregulation. The off-target determinants uncovered were the same as the miRNA determinants associated with increased target silencing (see “miRNA function and target recognition” section for further information)
(Nielsen et al., 2007).
Even though off-target effects are typically associated with modest amounts of
RNA downregulation, off-target effects can still have phenotypic consequences (Fedorov et al., 2006; Kleinman et al., 2008; Lin et al., 2005). For example, reduction in cell viability has been observed as a consequence of off-target effects. These phenotypic effects are dependent on Ago2 function, indicating that they are not the result of interferon-like responses (Fedorov et al., 2006). The standard recommendation for designing and performing RNAi based gene knockdown experiments has been to utilize several different siRNAs for the same target. If the same phenotype is observed with several siRNAs, then it is unlikely that the phenotype is due to off-target gene silencing
(Jackson and Linsley, 2004). More recently, it has been shown that a 2' -O-methyl ribosyl substitution at position 2 of the guide strand can decrease off-target effects by up
39

Chapter 1: Introduction to 80% without affecting on-target silencing (Jackson et al., 2006a).
Although off-target effects have been associated with phenotypic consequences, the full extent of off-target effects is not fully understood. One major limitation of offtarget studies is their use of transcript levels as a surrogate for protein expression. In
Chapter 2, I will describe the effects on both mRNA and protein levels for a panel of mismatched mRNA:siRNA combinations. In addition, I will describe mechanistic experiments aimed at elucidating the role of Ago2 in off-target RNA and protein effects.
In Chapter 3, I will discuss the characterization of a set of mismatched and complementary mRNA:siRNA combinations that resulted in high protein/RNA knockdown ratios. Finally, in Chapter 4 I will discuss the implications of the findings in
Chapter 2 and 3 for both off-target effects and miRNA function and explore future experiments.
40

Chapter 1: Introduction
Figures
Figure 1.1 - siRNA and miRNA pathways in mammalian cells.
On the left: the miRNA pathway. miRNAs originate from hairpin precursors called pri-miRNAs. miRNAs are transcribed by Pol II and contain a cap and a polyA tail. They are first processed by
Drosha/DGCR8 in the nucleus to yield the ~ 70 nucleotide pre-miRNA precursor. pre-miRNAs are further processed in the cytoplasm by Dicer/TRBP to yield a 20-23 nucleotide long duplex
(miRNA/miRNA*). miRNA strand selection occurs in a cleavage independent manner. The strand with the less thermodynamically stable 5' end is incorporated into the miRNP (miRNA
41

Chapter 1: Introduction strand). Most mammalian miRNAs targets contain partially complementary sequences to miRNAs within their 3' UTR. miRNAs mediate translational repression and/or mRNA decay through rapid deadenylation. On the right: the siRNA pathway. Long dsRNA precursors are processed by Dicer/TRBP into 21 nucleotide long duplexes. Similarly to miRNA strand selection, the strand with the less thermodynamically stable 5' end, the guide strand, is incorporated into RISC. The other strand, the passenger strand, is cleaved by Ago2 and is subsequently degraded. siRNAs bind to transcripts with perfect complementarity and mediate endonucleolytic cleavage of the target mRNA between positions 10 and 11 of the mRNA:siRNA duplex. miRNAs can perform target cleavage and siRNAs can mediate translational repression.
42

Chapter 1: Introduction
Figure 1.2 - Schematic representation of animal miRNA target interactions.
Most animal miRNAs are only partially complementary to target sequences. The seed
(nucleotides 2-7) within the 5' region of the miRNA strand is essential for miRNA binding and function. Binding to the 3' region is not necessary for miRNA function, but it can enhance silencing and compensate for weak 5' binding sites. Some animal miRNA target sites have complementarity in both the 5' and 3' regions and often, these miRNA:target interactions contain central bulges, which prevent endonucleolytic cleavage by Ago2. However, the majority of animal miRNA targets are complementarity to only the 5' region.
43

Chapter 2: Comparison of siRNA-induced off-target RNA and protein effects
The material presented in this chapter was adapted, with permission, from the following publication:
Alemán, L. M., Doench, J. and Sharp, P. A. (2007). Comparison of siRNA-induced offtarget RNA and protein effects. RNA 13 , 385-395.
Experimental contributions:
Lourdes M. Alemán conducted all the experiments.
44

Chapter 2: Comparison of siRNA-induced off-target RNA and protein effects
Short interfering RNAs (siRNAs) have emerged as a powerful experimental tool to study gene function given their ability to cause downregulation of target messages in a sequence-specific manner. Complementary siRNAs mediate sequence-specific silencing by inducing mRNA cleavage and subsequent mRNA degradation of target transcripts. siRNAs guide the RNA-induced silencing complex (RISC) to mediate endonucleolytic cleavage of the target mRNA at the site opposite the 10 th and 11 th position of the guide siRNA strand (Martinez et al., 2002). Within the RISC complex, cleavage is catalyzed by a specific member of the Argonaute protein family (Liu et al.,
2004; Song et al., 2004). Although all four mammalian Argonaute proteins are capable of binding both siRNAs and microRNAs (miRNAs), only Argonaute 2 (Ago2) is able to perform RNA cleavage in mammals (Liu et al., 2004). siRNA-mediated mRNA downregulation was initially reported to be highly specific
(Chi et al., 2003; Semizarov et al., 2003). Additionally, several reports demonstrated that even single nucleotide mismatches between the siRNA strand and the target mRNA greatly decreased the rate of target mRNA cleavage (Ding et al., 2003; Haley and
Zamore, 2004; Martinez, 2004). However, microarray analyses have shown that siRNAs with only partial complementarity to mRNAs can also cause a reduction in the RNA levels of a large number of transcripts (Jackson et al., 2003; Jackson et al., 2006b). This type of mRNA regulation has been termed an “off-target” effect and is typically associated with less than two-fold mRNA downregulation (Birmingham et al., 2006;
Holen et al., 2005; Jackson et al., 2003; Jackson et al., 2006b; Lin et al., 2005;
Persengiev et al., 2004; Saxena et al., 2003; Scacheri et al., 2004; Schwarz et al.,
2006). Further analysis of the off-target mRNAs revealed that this mRNA effect is determined by complementarity of the mRNA to the 5' region of the guide siRNA strand.
45

Chapter 2: Comparison of siRNA-induced off-target RNA and protein effects
This type of complementarity is reminiscent of canonical miRNA regulation, in which the same 5' region plays a central role in mRNA:miRNA interactions (Brennecke et al., 2003;
Brennecke et al., 2005; Doench and Sharp, 2004; Kloosterman et al., 2004). This region, specifically nucleotides 2-7 at the 5' end of the miRNA strand, is considered the
“seed region” (Lewis et al., 2005). mRNA complementarity to the 3' region of a miRNA is not generally required for miRNA function, but it is likely that additional complementarity to this region results in enhanced miRNA-mediated downregulation
(Brennecke et al., 2005; Doench et al., 2003).
More recently, microarray experiments identified changes in the mRNA levels of a large number of transcripts in HeLa cells after transfection of siRNAs corresponding to two tissue-specific miRNAs, miR-1 in muscle cells and miR-124 in neuronal cells (Lim et al., 2005). A high percentage of the downregulated transcripts (88% for miR-1 and 76% for miR-124) had complementarity to the seed region of the corresponding miRNA.
These results indicate that the interaction between the seed region of a partially complementary siRNA guide strand and a particular mRNA could be similar to the interaction observed between a miRNA and its target. Further analysis revealed that compared to all other cell types, the specific tissue in which the miRNA was exclusively expressed also exhibited the lowest expression of the downregulated transcripts. This biological correlation indicates that the downregulated transcripts identified by this microarray study are most likely endogenous targets of miR-1 and miR-124. Thus, in this case the “off-target” interactions between the miR-1 and miR-124 siRNAs and their corresponding downregulated mRNAs probably reflect the physiological interaction between a miRNA and its target mRNA population.
The finding that partially complementary siRNAs can cause reductions in mRNA levels suggests that mammalian miRNAs could regulate their targets by decreasing mRNA levels, in addition to attenuating translation. Support for this hypothesis has been
46

Chapter 2: Comparison of siRNA-induced off-target RNA and protein effects provided by several studies, which independently reported that miRNAs can reduce the mRNA levels of partially complementary target genes (Bagga et al., 2005; Behm-
Ansmant et al., 2006; Giraldez et al., 2006; Jing et al., 2005; Lim et al., 2005; Rehwinkel et al., 2006; Schmitter et al., 2006; Wu and Belasco, 2005; Wu et al., 2006). Zebrafish miR-430, for example, has been shown to downregulate hundreds of maternal mRNAs during early embryonic development (Giraldez et al., 2006). Furthermore, two miRNAs that had been reported previously to act primarily by translational repression,
Caenorhabditis elegans lin-4 and let-7 , also reduce the levels of their target transcripts, lin-14 and lin-28 (Bagga et al., 2005). It is not well understood how miRNAs mediate the downregulation of mRNA targets. It is known that at least some miRNAs direct mRNA degradation through deadenylation and subsequent degradation of target transcripts
(Behm-Ansmant et al., 2006; Giraldez et al., 2006; Wu et al., 2006). This process probably involves processing bodies (P-bodies), which are cytoplasmic sites of mRNA degradation (Jakymiw et al., 2005; Liu et al., 2005a; Sen and Blau, 2005). In addition, there is evidence that at least one miRNA, miR-16, mediates the rapid destruction of certain AU-rich element (ARE) containing mRNAs by targeting these transcripts for AREmediated mRNA degradation (Jing et al., 2005). Given the similarities between offtarget mRNA downregulation and miRNA-mediated RNA degradation, it is likely that both of these effects share common mechanisms.
Previous experiments in our lab suggested that siRNAs designed to function like miRNAs induced strong protein reduction with little change in mRNA levels (Doench et al., 2003). In these experiments, HeLa cells were transiently transfected with a siRNA that bound to four or six partially complementary binding sites in the 3' UTR of a luciferase reporter construct. Using the same siRNAs and targets, we subsequently observed a two-fold decrease in mRNA levels when the mRNAs were expressed from an integrated gene (data not shown). Under these conditions, the silencing at the
47

Chapter 2: Comparison of siRNA-induced off-target RNA and protein effects protein level was 30-fold. In this chapter, we address the question of whether interactions between partially complementary siRNA guide strands and mRNAs produce tightly correlated changes in mRNA degradation and translational efficacy. We have concentrated on dissecting the biological significance of positions 9-11 in off-target gene regulation given the importance of the siRNA central region in mRNA cleavage (Haley and Zamore, 2004). To this end, single base substitutions at positions 9-11 were introduced in stably expressed reporters containing two identical siRNA binding sites and used different siRNAs to create various mRNA:siRNA combinations. Quantitative
RNA and protein analysis was performed in parallel for each combination to measure the degree of silencing at the RNA and protein levels. To probe the potential mechanisms involved in off-target mRNA downregulation, degradation products (corresponding to the
3' UTR of an endogenous gene) generated by partially complementary siRNAs have been mapped and the importance of Ago2 in this process has been assessed.
In this chapter various mRNA: siRNAs combinations that result in different levels of mRNA reduction are described. Instances in which the extent of mRNA and protein knockdown do not correlate were observed, underscoring the importance of assessing siRNA-mediated effects by measuring both mRNA and protein levels. Furthermore, isolation and sequencing of degradation products identified a variety of products; some are likely the result of a canonical siRNA cleavage event while others are probably generated by Ago2-independent degradation processes.
Off-target mRNA downregulation could be due to endonucleolytic cleavage reminiscent of canonical siRNA cleavage. When a siRNA is perfectly complementary to
48

Chapter 2: Comparison of siRNA-induced off-target RNA and protein effects its target site, canonical siRNA cleavage occurs between the 10 th and 11 th nucleotides opposite the siRNA guide strand. Therefore, we decided to test whether complementarity within this region is important for off-target mRNA downregulation.
Single mismatches in this region of complementarity are known to reduce dramatically mRNA cleavage in vitro (Haley and Zamore, 2004; Martinez, 2004; Schwarz et al.,
2006). We designed six 3' UTR constructs containing two binding sites for a siRNA against the chemokine C-X-C motif receptor 4 (CXCR4) with single base substitutions in either the 9 th , 10 th or 11 th positions. Each CXCR4 binding site is base paired at position
8 and contains an adenosine in position 1, opposite the siRNA guide strand. Both of these features were associated with the strongest degree of mRNA downregulation for miR-1 and miR-124 targets and for a large set of off-target interactions (Grimson et al.,
2007; Nielsen et al., 2007). Thus, this sequence configuration allows for maximal mRNA knockdown in our studies. Two binding sites were used instead of one to increase the strength of potential siRNA-mediated effects. For each construct, the two identical binding sites were cloned into the 3' UTR of the reporter Renilla reniformis luciferase gene ( Renilla luciferase). Five different siRNAs were used to generate a total of 30 mRNA:siRNA combinations: 28 mRNA:siRNA combinations containing single and double mismatches at the 9 th , 10 th , and/or 11 th positions, and 2 perfectly complementary mRNA:siRNA combinations (Table 1).
The Renilla luciferase constructs containing variations of the CXCR4 binding site in their 3' UTRs were transfected into HeLa cells and stable cell lines were established.
These cell lines were transfected with 5 nM of siRNA. This concentration was chosen after titration experiments with a stably expressed Photinus pyralis luciferase reporter construct (firefly luciferase) containing six binding sites, showed that the resulting twofold decrease in mRNA levels did not vary significantly with increasing siRNA concentrations (data not shown). RNA and protein levels were measured at 48 hours
49

Chapter 2: Comparison of siRNA-induced off-target RNA and protein effects post-transfection. This duration was selected because both maximal RNA and protein knockdown are observed at 48 hours. Time course experiments performed with two of the five siRNAs utilized in this study, CXCR4 and CXCR4-B (Figure 2.1, Table 1), indicated that mRNA downregulation peaks 24 hours after siRNA transfection and remains relatively the same 48 hours post-transfection, whereas protein knockdown peaked 48 hours after siRNA treatment (Figure 2.1 A, B). A 48 hour time point after siRNA transfection is typically necessary to observe both maximum RNA and protein knockdown for most genes. RNA and protein analyses were performed by quantitative real-time PCR and luciferase assays, respectively. Both of these assays have the advantage of being highly quantitative, allowing the detection of even small changes in both RNA and protein. For each mRNA:siRNA combination, RNA and protein measurements were made from three to five independent experiments and the average results are reported.
Changes in the 9 th , 10 th , and 11 th positions had varied effects on both mRNA and protein levels (Figure 2.2 and Table 1). In all cases, the decrease in luciferase activity was greater than the decrease in mRNA levels. This suggested that the reduction in protein was the result of a combination of mRNA downregulation and translational repression (Figure 2.2 A). Perfectly complementary combinations 13 and 27 resulted in an average 4.9 + 1.2-fold mRNA decrease and an average 7.5 + 1.6-fold protein knockdown (Figure 2.2 A and Table 1). Transient transfections of combinations 13 and
27 resulted in higher degree of RNA and protein knockdown (data not shown).
Therefore, reductions in mRNA and protein levels greater than the ones reported here for stable transfections are probably limited by the fraction of cells successfully transfected.
The average RNA and protein decrease for all the mRNA:siRNA combinations was 2.1 + 0.1-fold and 4.0 + 0.2-fold, respectively. Notably, 43% of the combinations
50

Chapter 2: Comparison of siRNA-induced off-target RNA and protein effects containing mismatches between the 9 th and the 11 th position resulted in at least a twofold mRNA decrease (Figure 2.2 A). Many of these downregulated mRNA:siRNA combinations contained both single and double mismatches in the 9-11 region. This degree of mRNA knockdown paralleled the two-fold mRNA reduction that we have previously observed between the imperfectly complementary CXCR4 siRNA and the firefly reporter construct containing six CXCR4 binding sites (Petersen et al., 2006).
Several important observations emerged from RNA and protein analysis of the
30 different mRNA:siRNA combinations. First, changes at the protein level do not always correlate with changes at the RNA level. In some cases, there were large changes in protein levels with only small changes in mRNA levels (Figure 2.2 A, Table 1 and Table 2). Subgroups of responses resulting from different combinations are apparent when the results are plotted as the normalized average mRNA knockdown versus the ratio of normalized protein knockdown to normalized mRNA knockdown (with all values expressed as fold change) (Figure 2.2 B, Table 2). One subgroup contains mRNA:siRNA combinations that are significantly regulated at the mRNA level with similar changes at the protein level (Figure 2.2 B, subgroup I - combinations 9, 13, and
27). As expected, this subgroup largely consists of perfect combinations (13 and 27,
Table 1). A second subgroup of mRNA:siRNA combinations caused intermediate, 2-3 fold changes at both mRNA and protein levels (Figure 2.2 B, subgroup II - combinations
1, 3, 5, 7, 8, 11, 12, 15, 17-21, 23-26, 29, and 30). These first two subgroups demonstrate protein changes that closely parallel changes at the mRNA level (Table 2).
A third subgroup is composed of a series of combinations which produced moderate protein downregulation despite very little mRNA knockdown (Figure 2.2 B, subgroup III - combinations 2, 10, 16, 22, and 28). Finally, the last subgroup includes only two combinations (4 and 6), both of which caused a large degree of protein knockdown and exhibited little to no change in mRNA levels. One possible explanation for the small
51

Chapter 2: Comparison of siRNA-induced off-target RNA and protein effects change in RNA observed for these combinations at the 48 hour time point is that the mRNA might then be recovering from repression while the protein levels still reflect the repressed state. In other words, it is possible that G:U wobbles at positions 9 or 10 are downregulated with different kinetics than perfect and mismatched combinations.
However, this alternative explanation is unlikely because the siRNA that gave rise to combinations 4 and 6, CXCR4 siRNA, (G:U wobbles at position 10 and 9, respectively) was also utilized for the time point experiments previously described. These experiments established that Renilla luciferase mRNA repression begins to recover after the 48 hour time point (Figure 2.1 A, B). In addition, the Renilla luciferase reporter used in these experiments has a protein half-life of approximately 5 hours (Bronstein et al.,
1994). It is unlikely that the mRNA recovered substantially from siRNA repression with no detectable recovery at the protein level. Therefore, the third and fourth subgroups likely reflect combinations for which protein knockdown is largely due to translational repression.
RNA and protein analysis showed that different types of mismatches resulted in different degrees of protein knockdown. Among all nucleotide changes, single G:U mismatches at position 9 or 10 correlated with the highest levels of translational repression (combinations 4 and 6, Table 1, and Table 2). For example, a single G:U mismatch at the 10 th position (combination 4) resulted in protein knockdown (5.13 + 1.1fold) comparable to that of perfectly complementary mRNA:siRNA combinations (13 and
27, Table 1). This particular G:U mismatch, however, failed to cause mRNA degradation. The G:U mismatch in the 9 th position, combination 6, showed higher protein knockdown (10.7 + 3.7-fold) in comparison to perfect complementary mRNA:siRNA combinations 13 and 27 (Figure 2.2 A, Table 1, and Table 2 ). The mRNA levels for this combination decreased only two-fold. Unlike single G:U mismatches, double nucleotide changes containing both a G:U mismatch and a second mismatch
52

Chapter 2: Comparison of siRNA-induced off-target RNA and protein effects resulted in protein knockdown equivalent to that observed for double nucleotide changes that do not have G:U mismatch (Figure 2.3). The average protein knockdown for these mRNA:siRNA combinations was 2.9 + 0.3-fold. For combinations containing two mismatches other than a G:U, the average protein knockdown was 3.0 + 0.2-fold (Figure
2.3).
We also considered whether the type of nucleotide at positions 9-11 in the mRNA affected the degree of mRNA knockdown. We observed an average mRNA knockdown of 2.6 + 0.1-fold for mRNA reporter constructs containing a combination of purine and pyrimidine nucleotides at positions 9-11 (all combinations contained in the 1 st , 3 rd and 5 th columns of Table 1). In contrast, mRNA reporter constructs containing all pyrimidine nucleotides in positions 9-11 caused a smaller, 1.3 + 0.1-fold mRNA decrease (all combinations contained in the 2 nd , 4 th and 6 th columns of Table 1). This analysis excluded complementary mRNA:siRNA combinations 13 and 27. However, the average protein knockdown for reporter mRNAs containing either purines and pyrimidines at positions 9-11, or pyrimidines only, was 3.7 + 0.2-fold and 3.7 + 0.3-fold, respectively.
Therefore, for these combinations, the nucleotide composition of positions 9-11 affected the degree of mRNA knockdown, but not the degree of protein knockdown. These results suggest that mRNA suppression may be greater if a purine base is present in the
9-11 region in mismatched mRNA:siRNA interactions, while translational repression might not be affected in these circumstances.
We observed mRNA decreases even when mismatches were created at positions 10 and 11, the same positions that are engaged by canonical siRNA-mediated cleavage and that are important for the efficiency of this process (Haley and Zamore,
53

Chapter 2: Comparison of siRNA-induced off-target RNA and protein effects
2004). To determine if decreases in mRNA caused by imperfectly complementary siRNAs could result from endonucleolytic cleavage within the siRNA binding site, we mapped 3' terminal degradation intermediates after transfection with two siRNAs that bound with imperfect complementarity to the endogenous Cxcr4 gene. These experiments focused on an endogenous gene to permit mapping of degradation products relative to a single siRNA binding site on a mRNA. One siRNA, CXCR4-A, resulted in a mismatch at position 10. The other siRNA, CXCR4-B, resulted in a mismatch at position 11 (Figure 2.4 A). In addition, three control siRNAs were used: one with perfect complementarity to the endogenous Cxcr4 gene, and two unrelated siRNAs against green fluorescent protein (GFP) and firefly luciferase respectively. Mapping of degradation products was performed using rapid amplification of cDNA ends (5' RACE) on mRNA from HeLa cells 48 hours after siRNA transfection. Canonical siRNAmediated cleavage at position 10 results in a 3' cleavage product that contains a 5' phosphate and can therefore act as a substrate for 5' RACE (Kasschau et al., 2003).
Various reports have shown that the 3' cleavage product is degraded by the 5' → 3' exonuclease Xrn1 and that 3' fragments accumulate when Xrn1 is suppressed (Gazzani et al., 2004; Orban and Izaurralde, 2005; Souret et al., 2004). To stabilize the 3' cleavage products resulting from direct siRNA targeting in our experiments, Xrn1 was concomitantly knocked down by RNAi.
5' RACE analysis of RNA from cells transfected with the previously mentioned siRNAs revealed bands of approximately 250 base pairs, which is consistent with the size of the expected amplified cleavage product and the location of the primers used during nested PCR (data not shown). In total, 171 amplified products were sequenced and analyzed. 43% (73/171) of the degradation products mapped to the siRNA binding site, while 57% (98/171) of the degradation products mapped to regions upstream and downstream of the siRNA binding site (Figure 2.4 B, C). Notably, 93% (68/73) of the
54

Chapter 2: Comparison of siRNA-induced off-target RNA and protein effects products that mapped to sequences spanning the siRNA target site were recovered from cells transfected with either perfectly or imperfectly complementary CXCR4 siRNAs. In contrast, only 7% (5/73) of the products that mapped to sequences spanning the siRNA target site were recovered from cells transfected with control siRNAs. These results indicate that the cleavage products corresponding to the siRNA-targeted region were likely generated by the specific binding of perfectly and imperfectly complementary
CXCR4 siRNAs. Significantly, 47% (34/73) of the products that mapped to the sequence spanning the siRNA target site corresponded to the canonical cleavage site
(10 th position). These sequences were only recovered from cells transfected with
CXCR4 siRNAs. As expected, the perfectly complementary CXCR4 siRNA yielded degradation products that corresponded to the canonical cleavage site. 45% (20/44) of the degradation products recovered from cells transfected with the perfectly complementary CXCR4 siRNA mapped to the canonical cleavage site. This percentage is similar to prior results reported for analysis of siRNA-directed cleavage (Schmitter et al., 2006). In addition, 48% (21/44) of the degradation products recovered from cells transfected with the perfectly complementary CXCR4 siRNA mapped to sites that were
1-3 nucleotides downstream of the canonical cleavage site. No degradation products were recovered that mapped upstream of the canonical cleavage site for the CXCR4 siRNA. These results suggest that the degradation products that mapped closely downstream of the canonical cleavage site for the perfectly complementary CXCR4 siRNA might represent canonical cleavage products that are in the process of being degraded.
As previously noted, sequence analysis of amplified products resulting from treatment with the imperfectly complementary siRNAs CXCR4-A and CXCR4-B, revealed a low percentage of cleavage products that corresponded to the canonical siRNA cleavage site (Figure 2.4 C). 26% (10/39) of the products recovered from cells
55

Chapter 2: Comparison of siRNA-induced off-target RNA and protein effects transfected with the CXCR4-A siRNA mapped to the canonical cleavage site, whereas
14% (4/28) of the products recovered from cells transfected with the CXCR4-B siRNA mapped to the canonical cleavage site. None of the degradation products recovered from cells transfected with the control siRNAs mapped to the canonical siRNA cleavage site. This observation suggests that the degradation products that were cloned from cells transfected with imperfectly complementary siRNAs and whose sequences mapped to the 10 th position are likely the result of canonical siRNA-directed cleavage events.
As previously mentioned, perfectly complementary siRNA-mediated cleavage at position 10 is probably the result of endonucleolytic cleavage by Ago2, the only
Argonaute family member that is cleavage-competent. Canonical cleavage products were cloned when imperfectly complementary siRNAs were transfected, suggesting that cleavage at position 10 might be the primary mechanism for downregulating off-target mRNAs. To test this hypothesis, we knocked down Ago2 in cells stably expressing one of the Renilla luciferase reporter constructs and measured RNA levels after transfection with an imperfectly complementary siRNA as described previously.
For these experiments, the cell line that stably expresses a Renilla luciferase reporter construct with a UAC trinucleotide at positions 9-11 was utilized (mRNA reporter in column 3, Table 1). Two CXCR4 siRNAs were used following Ago2 knockdown: one with perfect complementarity to the target sequence (combination 27, Table 1) and another with two mismatches at positions 10 th and 11 th (combination 15, Table 1). Cells were first transfected with Ago2 siRNAs and then transfected again with a CXCR4 siRNA 16 hours later. The cells were collected 48 hours after the Ago2 siRNA transfection. As a control, GFP siRNA was also transfected on the same day as Ago2
56

Chapter 2: Comparison of siRNA-induced off-target RNA and protein effects siRNAs to assess the effect of an unrelated siRNA transfection on Renilla luciferase mRNA levels.
The extent of mRNA knockdown due to the perfectly and imperfectly complementary CXCR4 siRNAs was not significantly affected by the GFP siRNA transfection (Figure 2.5 A). mRNA knockdown due to the perfectly complementary
CXCR4 siRNA decreased two-fold when Ago2 was also knocked down. In contrast, mRNA knockdown due to transfection of the imperfectly complementary siRNA changed less than two-fold. Ago2 mRNA levels were reduced 12.8 + 4.8 -fold and 10.9 + 4.5 -fold in cells transfected with perfectly and imperfectly complementary siRNAs, respectively
(Figure 2.5 B). Given that the same degree of Ago2 knockdown was observed for cells transfected with perfectly or imperfectly complementary siRNAs, insufficient Ago2 knockdown is not a likely explanation for why the mRNA reporter levels were not significantly changed for the imperfectly complementary mRNA:siRNA combination.
These results indicate that Ago2 mediated cleavage and/or other functions performed by
Ago2 are not solely responsible for off-target mRNA reductions and that other processes are probably involved in destabilizing off-target mRNAs.
To verify that Ago2 is not required for imperfectly complementary siRNA mediated mRNA downregulation, imperfectly complementary combinations 25 and 15 were transiently transfected into AGO2-/- MEFs (Liu et al., 2004) together with either a control plasmid or a plasmid expressing wild type human Ago2. Their complementary counterpart combinations, combinations 13 and 27, were used as controls.
In keeping with the results observed when Ago2 expression was knocked down by RNAi, loss of Ago2 expression produced a marked decrease in RNA and protein downregulation for both complementary siRNA combinations tested (Figure 2.6 A, B). In contrast, loss of Ago2 expression did not significantly alter the extent of mRNA or protein downregulation for the two imperfectly complementary combinations tested (Figure 2.6
57

Chapter 2: Comparison of siRNA-induced off-target RNA and protein effects
A, B). These results confirmed that Ago2 is not required for the silencing mechanisms that result from imperfectly complementary duplexes. Interestingly, both perfectly complementary combinations tested still experienced some degree of mRNA and protein downregulation in the absence of Ago2 expression. For example, in the presence of the control plasmid, the complementary combination with a GCC trinucleotide sequence at positions 9-11 (combination 13) resulted in 2.1 + 0.0 and 2.9 + 0.2 -fold knockdown for mRNA and protein changes, respectively, and the complementary combination with a
UAC trinucleotide sequence at positions 9-11 (combination 27) resulted in 3.6 + 0.8 and
6.2 + 1.0 -fold knockdown for mRNA and protein changes, respectively. This result indicates that in the absence of Ago2, complementary siRNAs can still enter other
Argonaute containing miRNPs to induce mRNA and protein downregulation.
Furthermore, both complementary combinations result in higher degrees of protein than mRNA knockdown in the absence of Ago2 expression, particularly combination 27, indicating that under certain circumstances, complementary combinations can mediate translational repression.
Imperfectly complementary siRNAs frequently induce a moderate mRNA reduction. When this effect is observed in the context of the targeting of a specific mRNA by a perfectly complementary siRNA, these mRNA reductions are considered offtarget effects. This effect may also be typical of mRNA:miRNA interactions.
There is an incomplete understanding of the contribution of off-target effects to the phenotypes that result from siRNA targeted gene knockdown experiments. There are several reports of unanticipated phenotypes generated by a siRNA to a specific mRNA, with off-target effects implicated in some cases (Fedorov et al., 2006; Kleinman et al., 2008; Lin et al., 2005; Scacheri et al., 2004). A recent study that examined the
58

Chapter 2: Comparison of siRNA-induced off-target RNA and protein effects effects of siRNAs on cell physiology observed that 29% (51/176) of a large siRNA population targeting two nonessential transcripts led to a reduction in cell viability of over
25% (Fedorov et al., 2006). This phenotype correlated mainly with the presence of a
UGGC motif within the siRNA guide strand. However, the general finding that expression of siRNAs from integrated short hairpin RNAs (shRNAs) can result in silencing of the target gene with little detectable effect on cell viability suggests that detrimental off-target effects are not common. In the experiments discussed in this chapter, only one of the siRNAs utilized contained the UGGC motif (CXCR4 siRNA) and none caused a reduction in cell viability. Therefore, the effects observed at the RNA and protein level in our results are likely mediated by partial complementarity to the siRNAs utilized, and are unrelated to cell toxicity.
Published studies of off-target effects have focused largely on evaluating offtarget mRNA regulation (Birmingham et al., 2006; Chi et al., 2003; Jackson et al., 2003;
Persengiev et al., 2004; Semizarov et al., 2003). The effects of off-target regulation at the protein level have been characterized for only a few siRNA:mRNA combinations. In one of these studies, the degree of protein knockdown correlated with the previously observed changes in mRNA levels (Jackson et al., 2006b). In two other studies, offtarget gene regulation was largely associated with changes in protein levels and with less than two-fold changes in RNA (Saxena et al., 2003; Scacheri et al., 2004). The study described in this chapter is the first in which off-target changes in both protein and mRNA levels are characterized systematically for a large number of mRNA:siRNA interactions.
Imperfectly complementary siRNAs can cause a spectrum of actions. At one end of the spectrum, we observe certain imperfectly complementary interactions that yield mRNA degradation with little additional translational repression. Conversely, certain mismatches result in significant protein reduction with little or no change in mRNA levels.
59

Chapter 2: Comparison of siRNA-induced off-target RNA and protein effects
Other mRNA:siRNA interactions fall in the middle of the spectrum, yielding some degree of mRNA degradation and translational repression. These results indicate that off-target activity can include regulation at the protein level that is independent of mRNA downregulation. Indeed, 7 of the 30 siRNA:miRNA combinations studied here exhibited robust changes in protein levels and little or no change in mRNA levels (Table 2). Two combinations (4 and 6) in this group had exact complementarity except for a G:U wobble in either positions 9 or 10 (Table 1). The other 5 examples (combinations 2, 10, 16, 22, and 28) corresponded to mRNA targets with only pyrimidines in positions 9-11 (Table 1).
A similar spectrum of mRNA and protein effects has recently been observed following transfection of a siRNA corresponding to a muscle cell specific miRNA, miR-1.
Using stable isotope labeling with amino acids in cell culture (SILAC), Vinther and colleagues investigated the effects of transfecting miR-1 into HeLa cells on protein expression and compared these changes with previously identified mRNA changes determined by microarray analysis. There was a slight overlap between the genes repressed by miR-1 at the mRNA and protein levels. In fact, 4 targets were identified for which corresponding protein and RNA repressions were observed. This report identified only 12 proteins that were repressed by miR-1 transfection (Lim et al., 2005; Vinther et al., 2006).
Our detailed analysis of the different mismatch types tested revealed that G:U wobbles in positions 9 and 10, unlike other types of mismatches, resulted in significant protein knockdown with only modest changes at the mRNA level. Others have reported a loss in silencing at both the protein and mRNA levels with a G:U wobble at position 10
(Holen et al., 2005; Schwarz et al., 2006). However, in agreement with our results,
Saxena and colleagues have observed that G:U wobbles in the central region of the mRNA:siRNA duplex results in protein knockdown, similar to the degree of protein knockdown observed for perfectly complementary siRNAs, with little change in mRNA
60

Chapter 2: Comparison of siRNA-induced off-target RNA and protein effects levels (Saxena et al., 2003). This effect could potentially be explained if a G:U wobble in positions 9 and 10 caused a perturbation in the helix minor groove of the mRNA:siRNA duplex, leading to inhibition of endonucleolytic cleavage, but not binding. Consistent with this hypothesis, Haley and Zamore have reported that base pairs formed by the central region of the siRNA guide strand contribute to formation of an A-form helix required for mRNA cleavage, but are not necessary for siRNA binding (Haley and
Zamore, 2004).
Mapping of endogenous Cxcr4 degradation products generated after treatment with various imperfectly complementary siRNAs suggests that a siRNA-directed Ago2 cleavage event probably contributes to a fraction of the modest mRNA reduction we observed. 26% (10/39) and 14% (4/28) of the degradation products generated by the imperfectly complementary siRNAs CXCR-A and CXCR4-B, respectively, mapped to position 10. In contrast to our results, other studies have not found that imperfectly complementary siRNA or miRNA binding results in the generation of canonical cleavage products. Degradation products of the C. elegans let-7 mRNA target, lin-41 , mapped outside of the two let-7 binding sites (Bagga et al., 2005). Similarly, 5' RACE experiments performed on a luciferase reporter construct containing the 3' UTR of the mammalian miR-125b target, lin-28, did not yield degradation products that mapped within the miR-125b binding sites (Wu et al., 2006). A recent study observed that most of the degradation products recovered from a luciferase reporter containing three let-7 binding sites in its 3' UTR mapped within the actual binding sites. However, none of the degradation products corresponded to the canonical cleavage site at position 10
(Schmitter et al., 2006). Compared to prior studies, it is possible that the higher degree of complementarity between our mRNA and siRNAs contributed to our detection of cleavage at the canonical position 10. Simultaneous knockdown of Xrn1, which stabilizes 3' cleavage products, may also have contributed to our detection of canonical
61

Chapter 2: Comparison of siRNA-induced off-target RNA and protein effects cleavage.
If reductions in mRNA levels were due primarily to canonical cleavage, then
Ago2 inhibition should suppress the mRNA reductions observed with partially complementary siRNAs. However, we observed only a minor suppression of mRNA and protein changes when Ago2 was knocked down or completely absent in these cases.
Thus, we conclude that an Ago2-independent pathway is also important in mediating downregulation of mRNA levels. Schmitter and colleagues have recently reported similar results, demonstrating that degradation of a luciferase reporter containing three 3'
UTR let-7 binding sites in mammalian cells only partially decreases when Ago2 is concomitantly knocked down (Schmitter et al., 2006). Another strong indication of an
Ago2-independent pathway for off-target mRNA degradation in our results is the mapping of numerous non-canonical 5' RACE products to sequences spanning the siRNA binding site. Similar products were very rare in cells transfected with control siRNAs. These products are probably generated by processes that are stimulated by the binding of a siRNA in an Ago2-independent fashion. Recently, various reports have implicated several Drosophila miRNAs, zebrafish miR-430, and mammalian let-7 and miR-125b in promoting deadenylation of target transcripts and subsequent mRNA decay
(Behm-Ansmant et al., 2006; Giraldez et al., 2006; Wu et al., 2006). It appears likely that this pathway or another pathway yet to be defined is the Ago2-independent pathway responsible for a large majority of the mRNA changes observed with off-target interactions.
62

Chapter 2: Comparison of siRNA-induced off-target RNA and protein effects
EGFP control plasmid and wild type human Ago2 constructs we obtained from the
Tuschl lab (Meister et al., 2004). Briefly, EGFP and wild type Ago2 constructs containing a N-terminal FLAG/HA tag were cloned into a modified pIRESneo plasmid
(Meister et al., 2004). The firefly expressing reporter GL3 (Promega) was used for transient transfections to control for transfection efficiency.
A modified version of the pRL-TK vector containing a multiple-cloning site downstream of the Renilla luciferase stop codon was generated (pRL-TK 3'MCS). To create stable cell lines that expressed different Renilla luciferase reporters, a pRL-TK 3'MCS Bgl
II/HpaI fragment containing the Renilla luciferase gene and the SV40 poly A signal was cloned into a pPur BamHI/SwaI fragment containing the puromycin resistance gene
(pRL-TK 3'MCS Pur). 3' UTR binding sites were constructed by annealing two DNA oligonucleotides containing two identical CXCR4 binding sites separated by the sequence CCGG and flanked by XhoI and SpeI sites. Annealed oligos were then inserted into pRL-TK 3'MCS Puro’s XhoI and SpeI sites, which are located directly downstream from the Renilla luciferase coding region. HeLa cells were then transfected with the modified pRL-TK 3'MCS Puro constructs containing different versions of the
CXCR4 binding sites and selected with puromycin (600 ng/mL).
siRNAs were purchased from Dharmacon and prepared according to manufacturer’s instructions. Sequences of siRNAs (sense strand) used in this study are as follows:
63

Chapter 2: Comparison of siRNA-induced off-target RNA and protein effects
CXCR4: 5'- GUUUUCACUCCAGCUAACAdTdT -3';
CXCR4-A: 5'- GUUUUCACUGCAGCUAACAdTdT -3';
CXCR4-B: 5'- GUUUUCACGCCAGCUAACAdTdT -3';
CXCR4-C: 5'- GUUUUCACUCGAGCUAACAdTdT -3';
CXCR4-D: 5'- GUUUUCACUACAGCUAACAdTdT -3';
GFP: 5'- GGCUACGUCCAGGAGCGCAdTdT -3';
Firefly luciferase: 5'- CUUACGCUGAGUACUUCGAdTdT -3';
Ago2-1: 5'- GCACGGAAGUCCAUCUGAAUU -3';
Ago2-2: 5'- GCAGGACAAAGAUGUAUUAUU -3';
Xrn1-beta: 5'- GUACCUGGAUAUACUAAGAdTdT -3';
Xrn1-delta: 5'- CUACUCAAGUACCUACUAAdTdT -3'
Cell lines expressing Renilla reporter constructs or AGO2 -/- MEFs obtained from the
Hannon lab (Liu et al., 2004) were grown in DMEM supplemented with 10% inactivated fetal bovine serum and penicillin/streptomycin. For stable cell line transfections, the day before transfection, cells were seeded at 1.5X10
5 cells/well for 6-well plates and 3.0X10
4 cells/well for 24-well plates in antibiotic-free media. Transfections were performed using
Oligofectamine according to the manufacturer’s instructions (Invitrogen) in a final volume of 1.25 mL for 6-well plates and 0.25 mL for 24-well plates. For transient transfections, the day before transfection, cells were seeded at 5.5X10
5 cells/well for 6-well plates and
1.0X10
5 cells/well for 24-well plates in antibiotic-free media. Transfections were performed using Lipofectamine 2000 according to the manufacturer’s instructions
(Invitrogen) in a final volume of 2.50 mL for 6-well plates and 0.50 mL for 24-well plates.
For the transient AGO2 -/- MEFs’ transfections, the Renilla reporter with a GCC and a
64

Chapter 2: Comparison of siRNA-induced off-target RNA and protein effects
UAC trinucleotide at position 9-11 were transfected at a final concentration of 1.1 ng/ µ l, the firefly reporter construct (GL3, Progema) was transfected at a final concentration of
0.1 ng/ µ l, and the EFGP control vector or the wild type human Ago2 containing plasmids were transfected at a final concentration of 0.4 ng/
µ l. For stable and transient transfections siRNAs were used at a final concentration of 5 nM or 10 nM, respectively, except when indicated otherwise.
For detection of Renilla mRNA, total RNA was harvested 48 hrs after transfection using the RNAeasy kit (Qiagen) and DNAse-treated with RNA Free DNAse Set (Qiagen). 4 or
5 µ g of RNA were used for reverse transcription reactions with specific primers for
Renilla luciferase (Rluc) and TATA binding protein (TBP), which served as an internal control. The following are the reverse transcription primers for TBP and Rluc: TBP RT primer 5'-GTACATGAGAGCCATTACGTCGTC-3'; Rluc RT primer 5'-
GCATTCTAGTTGTGGTTTGTCC-3'. The Rluc RT primer is located downstream of the
3' UTR CXCR4 binding sites. Reverse transcription was performed using EndoFree RT
(Ambion) or Superscript III (Invitrogen) according to manufacturer’s guidelines. For the stable cell line transfections, the resulting cDNA was diluted 1/5 or 1/10 and either 1 or 4
µ l of diluted cDNA were subjected to real-time PCR . For the transient transfections 1 µ l of the reverse transcription reaction was subjected to real-time PCR. Each PCR reaction was measured in quadruplicate. Rluc primers and probe were designed against the cDNA junction between pRL-TK vector sequence and the Renilla luciferase exon
(pRL-TK contains a chimeric intron upstream of the Renilla reporter gene). The following are the primers and Taqman probes used for amplification of Rluc and TBP:
Rluc forward primer (FP) 5'-TGCAGAAGTTGGTCGTGAGGCA-3'; Rluc reverse primer
65

Chapter 2: Comparison of siRNA-induced off-target RNA and protein effects
(RP) 5'-TCTAGCCTTAAGAGCTGTAATTGAACTGGG-3'; Rluc probe 5’-FAM-
TGGGCAGGTGTCCAC-MGB-NFQ-3' (FAM: 6-carboxy-fluorescin; MGB: minor groove binding; NFQ: nonfluorescent quencher; Applied Biosystems); TBP primers and probe were obtained from Applied Biosystems (Taqman Gene Expression Assays, #
Hs00427620_m1). Real-time PCR was performed in a total volume of 25 µ l, using the
Taqman Universal PCR Master Mix protocol according to manufacture’s instructions.
Final concentrations of probes and primers used per reaction were 250 nM and 900 nM, respectively. Increasing concentrations of cDNA were utilized to determine the linear range of real-time PCR. Titration experiments with five increasing concentrations of cDNA revealed that the TBP and Rluc Taqman probes and primers resulted in Ct values that were in the linear range. TBP and Rluc Taqman probe and primers both demonstrated a linear correlation with a R 2 value of 0.995 and 0.992, respectively.
Subsequent experiments that utilized both TBP and Rluc Taqman probe/primers were performed with cDNA concentrations that were within the linear range established by the titration experiments.
Relative mRNA levels were determined using the 2 ∆∆ Ct method.
Control experiments measuring the change in ∆ Ct with different template dilutions showed similar efficiencies of amplification for the Renilla luciferase and TBP Taqman probes/primers. mRNA amounts were normalized to GFP siRNA transfections. For detection of Ago2 and Xrn1 mRNA levels, total RNA was harvested 48 hours after transfection as previously described. 250 ng of RNA were utilized for reverse transcription reactions with oligo(dT). Reverse transcription was performed as previously described. 1 µ l of resulting cDNA was subjected to real-time PCR using
Syber Green primers (SYBR). Each PCR reaction was measured in quadruplicate. The following are the primers used for amplification of Ago2, Xrn1 and TBP, which served as an internal control: Ago2 FP 5'-CGCGTCCGAAGGCTGCTCTA-3'; Ago2 RP 5'-
TGGCTGTGCCTTGTAAAACGCT-3'; Xrn1 FP 5'-AGCTTTCGACTCCCGTTTCTCCAA-
66

Chapter 2: Comparison of siRNA-induced off-target RNA and protein effects
3'; Xrn1 RP 5'-GGCCAACACATATCCTGGGTTGTA-3'; TBP FP 5'-
GGAGAGTTCTGGGATTCTAC-3'; TBP RP 5'-TTATCCTCATGATTACCGCAG-3'. Real time was performed in a total volume of 20 µ l, using the SYBR Universal PCR Master
Mix protocol according to manufacturer’s instructions. Relative mRNA levels were determined as previously described. Real-time reactions were conducted in an ABI
PRISM 7000 Sequence Detection System Thermal Cycler (Applied Biosystems).
Renilla luciferase assays were performed 48 hours after transfection according to manufacturer’s instructions (Promega) and detected with an Optocomp I luminometer
(MGM Instruments). Each transfection reaction and luciferase assay was done in triplicate. All of the readings obtained from luciferase assays were within the linear range (seven orders of magnitude) established by both the manufacturer (Promega) and by titration experiments previously performed in our lab.
For Renilla luciferase assays,
Renilla luciferase activity was assayed and normalized to a GFP siRNA or a siControl siRNA (Dharmacon) transfection. For dual luciferase assays, Renilla and firefly luciferase activities were consecutively assayed. Renilla luciferase readings were first normalized to firefly luciferase readings. Relative Renilla luciferase counts were then normalized against a GFP or a siControl siRNA (Dharmacon) transfection.
HeLa cells were transfected with 100 nM of Xrn1 siRNAs (Xrn1-beta and Xrn1-delta) and
5 nM of unrelated siRNAs (targeting GFP or Firefly luciferase) or 5 nM of perfectly and imperfectly complementary CXCR4 siRNAs. Total RNA was harvested 48 hrs after transfection using the RNAeasy kit (Qiagen) and DNAse-treated with RNA Free DNAse
67

Chapter 2: Comparison of siRNA-induced off-target RNA and protein effects
Set (Qiagen). 4 µ g of RNA were ligated to a synthetic RNA oligonucleotide adaptor
(GCUGAUGGCGAUGAAUGAACACUGCGUUUGCUGGCUUUGAUGAAA) by treatment with T4 RNA ligase (2 units, New England Biolabs) for 1 hour at 37 ˚C. After the ligation reaction, RNA was phenol/chloroform-extracted and precipitated with ethanol. Ligation products were reverse-transcribed using oligo (dT) primer and EndoFree RT (Ambion) according to manufacturer’s guidelines. The resulting cDNAs were amplified by successive rounds of PCR with nested pair of primers. The first round of PCR was performed for 20 cycles using the following primers: RNA adaptor outer FP 5'-
GCTGATGGCGATGAATGAACA-3' and CXCR4 outer RP 5'-
CCTGCCTAGACACACATCA-3'. The second round of PCR was performed for 35 cycles using the following primers: RNA adaptor inner FP 5'-
ACACTGCGTTTGCTGGCTTTGATG-3' and CXCR4 inner RP 5'-
GAGACATACAGCAACTAAGAACT-3'. RT-PCR products were examined by electrophoresis, gel-purified and cloned into pCR2.1TOPO vector for sequencing
(Invitrogen).
68

Chapter 2: Comparison of siRNA-induced off-target RNA and protein effects
69

Chapter 2: Comparison of siRNA-induced off-target RNA and protein effects
70

Chapter 2: Comparison of siRNA-induced off-target RNA and protein effects
Figure 2.1 - Time course of RNA and protein knockdown for a perfect and imperfectly complementary combination.
(A) RNA and (B) protein analysis of a stably expressed Renilla luciferase reporter after transfection of 5 nM of a perfectly complementary siRNA, CXCR4-B siRNA (combination 27,
Perf), or an imperfectly complementary siRNA, CXCR4 siRNA (combination 1, Impf).
Cells were collected for RNA and protein analysis 12, 24, 48 and 72 hours after transfection. Samples were normalized to an unrelated siRNA (targeting GFP, Control). A siRNA targeting the coding sequence of Renilla luciferase was used as a positive control (Renilla). RNA and protein analysis for (A) and (B) was performed by quantitative real-time PCR and Renilla luciferace assays, respectively. Normalized average mRNA and protein knockdown (fold change + SD) are shown. mRNA sequences (black) and guide siRNA sequences (red) for positions 9-11 are shown for relevant combinations.
71

Chapter 2: Comparison of siRNA-induced off-target RNA and protein effects
Figure 2.2 - Effects of mismatches in positions 9-11 on mRNA and protein levels.
(A) Average normalized RNA and protein reductions, expressed as fold change, of the 30 mRNA:siRNA combinations (Table 1). Five CXCR4 siRNAs (Table 1) each containing a single nucleotide change within positions 9-11 were transfected into 6 different stable cell lines expressing Renilla luciferase reporters, which also contained a single nucleotide change within positions 9-11 in both CXCR4 binding sites. Cells were collected for RNA and protein analysis
48 hours after transfection. RNA analysis was performed by quantitative real-time PCR. TBP was used as an internal control. Protein analysis was performed by Renilla luciferase assays. For both RNA and protein analysis, samples were normalized to an unrelated siRNA (targeting GFP) transfection. For each mRNA:siRNA combination, the average normalized RNA and protein reductions (fold change) were calculated from at least three independent experiments. Each bar graph represents the average normalized RNA reduction (orange) overlapped with the average
72

Chapter 2: Comparison of siRNA-induced off-target RNA and protein effects normalized protein reduction (green), both expressed as fold change, for a particular mRNA:siRNA combination. Each combination is numbered and represented in Table 1. (B)
Ratio of normalized protein knockdown to normalized RNA knockdown (fold change) for each of the 30 mRNA:siRNA combinations. The normalized protein reduction (expressed as fold change) of each mRNA:siRNA combination was divided by its corresponding normalized mRNA reduction (fold change) to calculate the ratio between these two measurements. The protein to
RNA ratio was then plotted versus normalized RNA knockdown (fold change) for each combination. The combinations were grouped into four distinct subgroups (labeled I-IV) according to their distribution in this plot.
73

Chapter 2: Comparison of siRNA-induced off-target RNA and protein effects
Figure 2.3 - Comparison of G:U wobble effects on mRNA and protein knockdown with those of mismatched combinations for positions 9-11.
Average mRNA and protein knockdown for G:U wobble combinations without other types of mismatches (Combinations 4 and 6, Table 1) were compared to the average mRNA and protein knockdown for single mismatches (Combinations 1-3, 5, 9-10, 14, 23-24, 28), for combinations containing G:U wobbles plus a single mismatch (Combinations 12, 16, 18, 22, and 30), and for combinations containing double mismatches (Combinations 7-8, 11, 15, 21, 25-26, and 29).
Normalized average mRNA and protein knockdown (fold change + S.D.) values were obtained from Table 1.
74

Chapter 2: Comparison of siRNA-induced off-target RNA and protein effects
Figure 2.4 - Imperfectly complementary siRNAs result in degradation products that correspond to canonical siRNA-mediated cleavage events.
(A) Schematic of the interaction between two CXCR4 siRNAs that contain nucleotide changes in position 10 (CXCR4-A, Impf-10th) and position 11 (CXCR4-B, Impf-11th) and the endogenous
Cxcr4 transcript. The perfectly complementary CXCR4 siRNA (guide strand, red) is also shown binding to the endogenous Cxcr4 mRNA for reference. (B) 5' RACE analysis performed on the endogenous Cxcr4 mRNA after transfection with imperfectly complementary siRNAs. HeLa cells were transfected with 100 nM of Xrn1 siRNAs and 10 nM of either control siRNA (GFP or firefly), perfectly complementary (CXCR4) or imperfectly complementary siRNA (CXCR4-A or
CXCR4-B). Cells were collected 48 hours after siRNA transfection and subjected to RNA ligation followed by reverse transcription, nested PCR and TOPO cloning. Each number corresponds to a distinct degradation product. The canonical siRNA cleavage product is highlighted with an asterisk. The CXCR4 siRNAs target sequence is indicated. (C) Summary of the 5' RACE analysis performed on the endogenous Cxcr4 mRNA after transfection with perfectly and imperfectly complementary siRNAs. The total number of clones sequenced and the number of clones that mapped to each degradation site are indicated for all the transfected
75

Chapter 2: Comparison of siRNA-induced off-target RNA and protein effects siRNAs. Degradation products that mapped to the siRNA binding site have been highlighted
(yellow) and the canonical siRNA cleavage product is highlighted with an asterisk.
76

Chapter 2: Comparison of siRNA-induced off-target RNA and protein effects
Figure 2.5 - Ago2 is not required for off-target mRNA downregulation.
(A) RNA analysis of a stably expressed Renilla luciferase reporter after transfection of 10 nM of a perfectly complementary siRNA, CXCR4-D siRNA (combination 27, Perf), or 10 nM of an imperfectly complementary siRNA, CXCR4-B (combination 15, mismatches at position 10 and
11, Imperf). These cells were transfected with either 100 nM of an unrelated siRNA (targeting
GFP, Control) or 100 nM of Ago2 siRNAs (Ago2-1 and Ago2-2) 16 hours prior to the CXCR4 siRNAs transfections. (B) RNA analysis of Ago2 levels for experiment in (A). RNA analysis for
(A) and protein analysis for (B) was performed by quantitative real-time PCR. TBP was used as an internal control. Samples were normalized to an unrelated siRNA (targeting GFP) transfection. Normalized average mRNA knockdown (fold change + S.D.) was calculated from two independent experiments. mRNA sequences (black) and guide siRNA sequences (red) for positions 9-11 are shown for relevant combinations.
77

Chapter 2: Comparison of siRNA-induced off-target RNA and protein effects
Figure 2.6 - Ago2 is not required for off-target mRNA and protein downregulation.
(A) RNA and protein analysis of a Renilla luciferase reporter 48 hours after transfection of 10 nM of a perfectly complementary siRNA, CXCR4-D siRNA (combination 27, Perf), or an imperfectly complementary siRNA, CXCR4-B siRNA (combination 15, Impf) into AGO2 -/-
MEFs in the presence of a control or an Ago2 expressing plasmid.
Samples were normalized to an unrelated siRNA transfection (Control). Normalized average mRNA and protein knockdown
(fold change + S.D.) was calculated from three independent experiments. (B) RNA and protein analysis of a Renilla luciferase reporter 48 hours after transfection of 10 nM of a perfectly complementary siRNA, CXCR4-B siRNA (combination 13, Perf), or an imperfectly complementary siRNA, CXCR4-D siRNA (combination 25, Impf) into AGO2 -/- MEFs in the presence of a control or an Ago2 expressing plasmid.
Samples were normalized to an unrelated siRNA transfection (Control). Normalized average mRNA and protein knockdown (fold change
+ S.D.) were calculated from two independent experiments. RNA and protein analysis for (A) and (B) was performed by quantitative real-time PCR and Renilla luciferace assays, respectively. mRNA sequences (black) and guide siRNA sequences (red) for positions 9-11 are shown for relevant combinations.
78

Chapter 3: Characterization of mRNA:siRNA combinations with high protein/RNA knockdown ratios
Experimental contributions:
Lourdes M. Alemán conducted all the experiments.
79

Chapter 3: Characterization of mRNA:siRNA combinations with high protein/RNA knockdown ratios
Conservation and bioinformatics analysis of miRNA seeds and the 3' UTRs of their putative targets have uncovered additional determinants outside of the seed that are important for miRNA silencing and that could be used to predict more accurately miRNA targets (Grimson et al., 2007; Nielsen et al., 2007). These determinants were identified by comparing target sequences with degrees of target mRNA downregulation.
Characteristics that distinguished the most downregulated RNAs from the rest of the
RNA pool with seed matches were noted (Grimson et al., 2007; Nielsen et al., 2007).
These characteristics include 1) having a matching nucleotide pair at position 8 together with the presence of A at position 1 in the target; 2) the presence of U or A at position 9 in the target sequence; 3) proximity to other miRNA binding sites; 4) AU-rich nucleotide sequences near the target site; and 5) proximity of the target site with respect to the stop codon or the end of the 3' UTR. However, these analyses have considered only changes in target transcript levels. Comparison of quantitative changes in protein levels for targets that contain these determinants versus those that do not has been performed only for one miRNA, miR-25 (Grimson et al., 2007). miR-25 targets containing these determinants experienced increased protein downregulation in comparison to those that do not contain these determinants. However, it is not known whether these determinants can be applied generally to those miRNAs which induce silencing primarily through translational expression with little to no change in target transcript levels.
In Chapter 2, we reported examples of mRNA:siRNA combinations from a large panel of mismatched mRNA:siRNA pairs that resulted in different levels of RNA and protein knockdown. The two most striking examples of differences between RNA and protein knockdown were combinations that resulted in G:U wobbles at position 9 or 10
(combinations 4 and 6, Chapter 2). We decided to investigate these two combinations to
80

Chapter 3: Characterization of mRNA:siRNA combinations with high protein/RNA knockdown ratios uncover determinants that contribute to large protein/RNA knockdown ratios in siRNAmediated silencing.
In the previous chapter we compared protein and mRNA changes for 30 mRNA:siRNA combinations with various types of mismatches in positions 9-11.
Different silencing effects were observed for the different combinations. In particular, when protein/RNA knockdown ratios were plotted for each combination, a range of RNA and protein knockdown effects were observed. Some combinations such as perfectly complementary combinations, exhibited the same degree of protein and RNA knockdown, whereas other combinations exhibited differences in the extent of RNA and protein knockdown. Disparity between the extent of RNA and protein knockdown was observed for combinations with single and double mismatches within positions 9-11.
However, the highest protein/RNA knockdown ratios resulted from combinations with single G:U wobbles in positions 9 or 10. For example, a G:U wobble combination at position 9 or 10 yielded a protein/RNA knockdown ratio of 5.3 and 5.7, respectively (2.0
+ 0.6 and 10.7 + 3.7-fold RNA and protein knockdown, respectively for the G:U wobble at position 9; and 0.9 + 0.1 and 5.13 + 1.1-fold RNA and protein knockdown, respectively for the G:U wobble at position 10). Having an additional mismatch within positions 9-11 in conjunction with a G:U wobble resulted in comparable extent of RNA and protein knockdown. These results indicated that G:U wobbles within positions 9-11 were unusual in that they, more so than any other type of mismatch tested, resulted in the highest degree of translational repression. We were intrigued by these results and decided to explore these observations further.
81

Chapter 3: Characterization of mRNA:siRNA combinations with high protein/RNA knockdown ratios
To investigate further the activity of G:U wobbles at position 9 and 10, we performed an experiment in which RNA and protein samples were collected 24 and 48 hours after transfection. We wanted to verify that the differences we had previously observed at 48 hours between RNA and protein knockdown were not due to rapid mRNA recovery from siRNA repression relative to the rate of protein recovery.
Transfections of cells stably expressing the Renilla reporter with a UCU trinucleotide at positions 9-11 (Column 6, Table 1, Chapter 2) were compared with transient transfections of the same reporter in HeLa cells. A control siRNA that results in a bulge within positions 9-11 for the UCU reporter but which contains the same seed and 3' region as the siRNA that results in the G:U wobble at position 9, was also transfected.
Both cell line and transient transfections resulted in a very similar trend of mRNA and protein downregulation for both siRNAs (Figure 3.1 A, B). A bulge within the central region resulted in little to no RNA downregulation and only small protein changes for both types of transfections (Figure 3.1 A, B). The protein/RNA knockdown ratio for the bulge combination was 2.0 for both cell line and transient transfections. In contrast, in either transient or stable transfections, a G:U wobble at position 9 resulted in different extents of RNA and protein knockdown for both 24 and 48 hour time points (Figure 3.1
A, B). Protein/RNA knockdown ratios resulting from stable transfections of cells expressing the G:U wobble reporter were 2.8 and 4.0 for the 24 and 48 hour time points, respectively. Protein/RNA knockdown ratios resulting from transient transfections of the same G:U wobble combination were 7.5 and 6.5 for the 24 and 48 hour time points, respectively. These results indicate that the disparity we previously observed between
RNA and protein knockdown for G:U wobbles within positions 9-11 in a 48 hour time point are not likely due to rapid mRNA recovery.
Both RNA and protein downregulation, and protein/RNA knockdown ratios were more substantial for transient transfections of the G:U wobble at position 9 than for
82

Chapter 3: Characterization of mRNA:siRNA combinations with high protein/RNA knockdown ratios stable cell line transfections of this combination (Figure 3.1 A, B). This is probably due to inherent differences between the two types of transfections. In a transient transfection, there is an increased probability that the reporter containing plasmid and siRNA are co-transfected and thus, have overlapping activities. In a stable cell line transfection, siRNAs are delivered only to a fraction of the cells that stably express the reporter. Given this observation and the fact that we wished to test the effect of this type of pairing on mRNA and protein expression in other cell types, we decided to conduct most of our experiments with transient transfections.
To verify that the enhanced silencing observed for transient transfections of the
G:U wobble combination for the UCU reporter was not due to a specific activity associated with the CXCR4 siRNA or the transfection conditions used for this experiment, the same siRNA used for creating this G:U wobble, CXCR4, was also transfected with three different reporters. These reporters contain the same target sequence as that of the UCU reporter, except for position 9 (Figure 3.2). A control siRNA that resulted in at least two mismatches at positions 9-11 for each of the reporters was transfected in parallel. Dramatic silencing and discrepancy between RNA and protein reduction was observed only for the G:U wobble at position 9, indicating that the original observation was not due to a particular siRNA, but rather to the structure of the mRNA:siRNA combination (Figure 3.2).
To test whether symmetry plays a role in G:U wobble mediated protein and RNA knockdown, we designed a reporter construct with the trinucleotide sequence UCG in positions 9-11. The activities of a perfect combination and a G:U wobble combination at position 9 for this sequence was compared to that of a reporter with the trinucleotide
83

Chapter 3: Characterization of mRNA:siRNA combinations with high protein/RNA knockdown ratios
UCU in positions 9-11. These two sets of reporters and their corresponding G:U wobble combinations tested whether symmetry is important for the G:U wobble effect at position
9. As controls, we used a siRNA with no complementarity from positions 10-19, and a siRNA which creates a bulge within positions 9-11. These two kinds of controls should result in the same degree of mRNA and protein knockdown, because as described in
Chapter 2, a G:U wobble at position 9 with an additional mismatch did not result in a discrepancy between mRNA and protein knockdown. Surprisingly, both sets of perfectly complementary siRNAs yielded a large disparity between the degree of protein and RNA knockdown (Figure 3.3). This degree of disparity between RNA and protein knockdown had only been observed previously for G:U wobbles at position 9 and 10 (combination 4 and 6, Chapter 2), but not for a perfectly complementary siRNA (see combinations 13 and 27, Table 1, Chapter 2). As observed with G:U wobble combinations at positions 9 or 10, the complementary combinations of reporters with trinucleotides UCU and UCG resulted in both disparate levels of protein and RNA knockdowns and dramatic silencing, as protein knockdowns from these combinations were larger than those observed with other previously examined perfect and mismatched miRNA:siRNA combinations (Table
1 and data not shown). Protein knockdown for the perfect combinations was 31 + 8.9 and 43.9 + 9.0-fold change for the UCU and UCG reporters, respectively (Figure 3.3).
For the perfect combinations, changing the nucleotide identity at position 9 from a U:A base pair to a G:C base pair, did not alter the discrepancy between protein and
RNA knockdown (Figure 3.3). In contrast, changing the geometry of the G:U wobble at position 9 significantly reduced the extent of protein knockdown, but did not alter the extent of RNA downregulation (5.85 + 2.11 and 6.18 + 1.08-fold change for the UCU and
UCG reporter, respectively), resulting in a much smaller protein/RNA knockdown ratio
(protein/RNA knockdown ratios of 6 and 2 for the UCU and the UCG reporter, respectively). This result indicates that G:U wobble symmetry within positions 9-11 can
84

Chapter 3: Characterization of mRNA:siRNA combinations with high protein/RNA knockdown ratios affect overall silencing.
Complementarity within the 3' region or within positions 9-11 is important for high protein/RNA knockdown ratios for both UCU and UCG reporters (Figure 3.3). mRNA:siRNA combinations with no 3' complementarity (no base pairing from positions
10-19) or with a bulge within positions 9-11, resulted in reduced levels of RNA knockdown, particularly for the UCG reporter. More importantly, protein knockdown was approximately 10 times less for these combinations, compared to their perfectly complementary counterparts, resulting in a substantial reduction of protein/RNA knockdown ratios (Figure 3.3). The siRNAs that generated both types of control combinations for each reporter, G:U wobbles without 3 complementarity and bulges within positions 9-11, were different for the UCU and the UCG reporters. Nevertheless, they both resulted in very similar RNA and protein knockdowns (Figure 3.3), indicating that the high protein/RNA knockdown ratios observed for these two perfectly complementary combinations are not likely to have been an experimental artifact created by these two reporters.
Complementarity within the miRNA’s 3' region is not essential for miRNA targeting and binding as reported by our lab and others (Brennecke et al.,
2005; Doench and Sharp, 2004; Grimson et al., 2007; Haley and Zamore, 2004;
Kloosterman et al., 2004; Lewis et al., 2005; Nielsen et al., 2007; Stark et al., 2005).
However, 5' region complementarity alone is not always sufficient to mediate effective miRNA silencing. For example, mutations in C. elegans cog-1 ’s binding site for the miRNA lsy-6 that disrupt 3' pairing but maintains seed pairing, resulted in the loss of miRNA-mediated repression (Didiano and Hobert, 2006).
Given the surprising protein to RNA knockdown ratios generated by the perfectly complementary combinations for the UCU and UCG reporters, we decided to determine the extent of mRNA and protein silencing for the perfect duplex corresponding to the
UUC trinucleotide, the other trinucleotide sequence at position 9-11 that had previously
85

Chapter 3: Characterization of mRNA:siRNA combinations with high protein/RNA knockdown ratios shown high protein/RNA knockdown ratios. This trinucleotide RNA sequence corresponds to combination 4, a G:U wobble at position 10, which had previously yielded a protein/RNA knockdown ratio of 5.6 (Chapter 2). For this experiment, the perfectly complementary combination for the UUC reporter was transiently transfected.
Combinations resulting in a G:U wobble at position 10, with an additional mismatch at position 11 or a bulge within the central region of the UUC reporter were also transfected as controls. In addition, the perfectly complementary combination for the UCU reporter and its corresponding controls were transiently transfected in parallel. Surprisingly, both perfectly complementary combinations resulted in degrees of mRNA and protein downregulation that were similar to those observed for their respective G:U wobble combinations at positions 9 and 10 (Figure 3.4 A, B). As previously noted for the UCU reporter, the corresponding perfectly complementary combinations also resulted in a much higher ratio of protein/RNA knockdown. Specifically, protein/RNA knockdown ratios for the perfect combinations were 8 and 6.5 for UCU and UUC reporters, respectively. As expected, an additional mismatch or a bulge within positions 9-11 resulted in smaller protein/RNA knockdown ratios for both of these reporters (Figure 3.4
A, B). For the reporter with a trinucleotide UCU at positions 9-11, the protein to RNA knockdown ratio was 4.1 for a G:U at position 9 with a mismatch at position 11. For the reporter with the trinucleotide UUC, the protein to RNA knockdown ratio was 2.2 for a
G:U at position 10 with a mismatch at position 11.
To verify that the disparity between RNA and protein knockdown observed with these complementary combinations with atypical activity was not an artifact of transient transfections, we performed the same experiment in cells stably expressing the UCU reporter. The lack of correlation between protein and RNA knockdown observed for the reporter with a UCU trinucleotide sequence at positions 9-11 in transient transfections was also observed for transfections of cells stably expressing this same reporter (Figure
86

Chapter 3: Characterization of mRNA:siRNA combinations with high protein/RNA knockdown ratios
3.4 C). Protein/RNA knockdown ratios for the perfect mRNA:siRNA combination and the
G:U wobble at position 9 were 3.9 and 3.2, respectively, whereas a G:U at position 9 with an additional mismatch at position 11 or a bulge within positions 9-11 resulted in protein/RNA knockdown ratios of 2.4 and 2.3, respectively. This set of experiments confirmed the notion that complementary siRNAs can result in translational repression in certain cases. These experiments suggest that G:U wobbles at position 9 or 10 and their complementary counterpart combinations generate high protein/RNA knockdown ratios. Furthermore, high protein/RNA knockdown for perfect and G:U wobble combinations is dependent on the configuration of the G:U wobble and perhaps also on the presence of a U or C at positions 9 and 10.
To confirm that the atypical protein/RNA knockdown ratios observed with complementary combinations were not an artifact of the siRNAs transfected, we decided to test different preparations (both different synthesis and siRNA preparations) of the same siRNAs used previously. Perfectly complementary combinations with trinucleotide sequences UCU and UUC at positions 9-11 were transiently transfected in HeLa cells.
Reassuringly, both perfectly complementary combinations resulted in protein/RNA knockdown ratios similar to those previously observed (Figure 3.5 A). In addition, the extent of RNA and protein knockdown did not change from previous experiments, indicating that previous results were not due to a faulty set of siRNA aliquots.
We also endeavored to eliminate the possibility that the observed noncorrelating
RNA and protein knockdowns for these complementary combinations could be the result of siRNA degradation within the siRNA preparations used for transfection, causing them to bind to target sites with partial complementarity, in a manner similar to miRNA binding. To test for siRNA degradation, different siRNAs sequences and different batches of the same siRNA were 5' labeled and resolved by gel electrophoresis. The extent of degradation was quantitated and compared to the radioactive signal from intact
87

Chapter 3: Characterization of mRNA:siRNA combinations with high protein/RNA knockdown ratios siRNA. These siRNAs and the respective preparations analyzed in this experiment
(Figure 3.5 B, C) have been previously transfected and their effect on RNA and protein knockdown has been previously analyzed (see Table 1 in Chapter 2, Figure 3.3 and
3.4). On average, siRNA degradation constituted 20% of the total radioactive signal, regardless of the siRNA examined, indicating that most of the siRNAs transfected were intact (Figure 3.5 B, C). Therefore, the disparity observed between protein and RNA knockdown for various complementary combinations cannot be attributed to effects mediated by degraded siRNA preparations.
Given that approximately 80% of the overall protein knockdown for complementary combinations with atypical silencing is the result of translational repression, we tested whether Ago2 was necessary for this activity. The reporter with a
UCU trinucleotide sequence at positions 9-11 was transfected with siRNAs that resulted in a complementary combination, a G:U wobble at position 9 (combination 6, Table 1,
Chapter 2) and a G:U at position 9 with a mismatch at position 11 (combination 18,
Table 1, Chapter 2). These combinations were transfected in AGO2 -/- MEFs (Liu et al.,
2004), together with either a control plasmid, a plasmid expressing wild type human
Ago2, or wild type human Ago1 cDNA. It is important to note that these cells already express mouse Ago1 protein (Liu et al., 2004, data not shown).
In the presence of the Ago2 containing plasmid, the extent of RNA and protein knockdowns for all the combinations tested were similar to those observed for transient transfections in HeLa cells in which Ago2 is endogenously expressed (Figure 3.6).
Protein knockdown for complementary combinations decreased dramatically in the absence of Ago2 expression (AGO2 -/- MEFs transfected with a control plasmid) in
88

Chapter 3: Characterization of mRNA:siRNA combinations with high protein/RNA knockdown ratios comparison to cells expressing Ago2 (28.7 + 3.1 and 5.7 + 0.0 -fold knockdown for Ago2 and control plasmid transfections, respectively). A similar decrease in protein knockdown was also observed for the G:U wobble combination at position 9 when AGO2
-/- MEFs transfected with Ago2 were compared with those transfected with control plasmid (29.5 + 0.0 and 4 + 0.3 -fold protein knockdown, respectively, Figure 3.6). In contrast, a G:U wobble at position 9 with a mismatch at position 11 (combination 18) did not demonstrate a substantial decrease in protein knockdown upon loss of Ago2 expression (Figure 3.6). Therefore, the dramatic silencing resulting from atypical complementary combinations is dependent on Ago2 expression.
Loss of Ago2 expression also correlated with a substantial decrease in RNA knockdown for both the perfect and the G:U wobble combinations (Figure 3.6). In the absence of Ago2, RNA and protein knockdown were 2.0 + 1.1 and 5.7 + 0.7 -fold change, respectively for the complementary combination and 1.7 + 0.6 and 4.0 + 0.3 fold change, respectively for the G:U wobble combination. Notably, RNA and protein knockdown are still observed in the absence of Ago2. This observation is consistent with the RNA and protein knockdown effect observed for other perfectly complementary combinations (13 and 27) when transfected in AGO2 -/- MEFs (see Chapter 2, Figure
2.5 and Figure 2.6). These results indicate that in the absence of Ago2, complementary combinations can still silence target expression by Ago2-independent mRNA degradation pathways as well as by translational repression, presumably through their interaction with other Argonaute proteins (Ago1, 3 and 4).
The high protein/RNA knockdown ratios observed for the atypical complementary combinations in the presence of Ago2 decreased in the absence of Ago2, and thus are
Ago2-dependent (Figure 3.6). In the presence of the Ago2 containing plasmid, protein/RNA knockdown ratios are 4.5, 3.9 and 2.3 for the perfect combination, the G:U combination and the G:U with a mismatch combination, respectively. These ratios are
89

Chapter 3: Characterization of mRNA:siRNA combinations with high protein/RNA knockdown ratios similar to those observed for HeLa cells (Figures 3.2 and 3.3). However, in the presence of control containing plasmid, protein/RNA knockdown ratios are 2.9, 2.4 and 1.9 for the perfect combination, the G:U combination and the G:U with a mismatch combination, respectively. Interestingly, overexpression of Ago1 in AGO2 -/- MEFs resulted in similar protein/RNA knockdown ratios similar to those observed for the control plasmid (Figure
3.6). Therefore, the disparity between protein and RNA knockdown exhibited by the perfect and the G:U wobble combination is an effect that is dependent on Ago2 function and not simply the result of overexpression of Argonaute protein.
To assess whether the dramatic silencing observed for atypical complementary and G:U wobble combinations is dependent on cleavage by Ago2, we transfected a complementary combination with atypical activity in AGO2 -/- MEFs along with a catalytically dead Ago2 mutant. This Ago2 mutant construct, Ago2 D597A, has a single point mutation in one of the two aspartate residues that form the catalytic triad within the
PIWI domain of Ago2 and cannot cleave a complementary RNA substrate in vitro (Liu et al., 2004). This mutant can bind to siRNAs in vivo and does not affect the expression of
Ago2 (data not shown) or its localization to P-bodies (Liu et al., 2005b). A control or wild type Ago2-containing plasmid was also transfected together with the UCU reporter and either, 1) a complementary siRNA, 2) a siRNA that results in a G:U wobble at position 9, or 3) a siRNA that results in a G:U at position 9 with a mismatch at position 11. The extent of RNA and protein silencing in either the presence or absence of Ago2 expression were very similar to those observed previously (Figure 3.6 and Figure 3.7).
However, transfection of Ago2 D597A resulted in the loss of the dramatic silencing effects previously observed for the perfect and the G:U wobble combination in the presence of Ago2 (Figure 3.7). Protein knockdown of the perfect and the G:U wobble combination decreased from a 28.4 + 16.5 -fold and a 24.5 + 4.9 -fold change, respectively for cells transfected with wild type Ago2 to a 2.8 + 0.3 -fold and 2.6 + 0.9 -
90

Chapter 3: Characterization of mRNA:siRNA combinations with high protein/RNA knockdown ratios fold change, respectively for cells transfected with Ago2 D597A (Figure 3.7). This result implicates mRNA cleavage by Ago2 in the dramatic silencing observed for the complementary combinations with atypical activities. This is puzzling because, on average, 80% of protein reduction observed for the perfect and the G:U wobble combinations is due to translational repression. As previously mentioned, Ago2 protein expression was not affected by the D597A change (data not shown), indicating that the
RNA and protein knockdowns observed with Ago2 D507A are almost certainly not due to differences in levels of Ago2 expression.
We have previously reported mismatched mRNA:siRNA combinations that generated dramatic differences in the degree of protein knockdown relative to RNA knockdown (Chapter 2). In particular, G:U wobble combinations at positions 9 or 10 demonstrated strikingly enhanced protein knockdown relative to RNA knockdown. The results described in this chapter indicate that this observation can also be extended to complementary combinations, in particular to those with trinucleotides UUC, UCU and
UCG sequences at positions 9-11.
It is widely accepted that complementary combinations engage Ago2-containing
RISC complexes and mediate cleavage followed by RNA degradation. In these cases, the vast majority of the protein knockdown can be attributed to mRNA degradation. This type of siRNA-mediated silencing was observed previously for complementary combinations with trinucleotides GCC and UAC at positions 9-11 (Table 1, Chapter 2).
In contrast, only 20% of the protein knockdown that results from complementary siRNAs with atypical activity, those with trinucleotides UUC, UCU, and UCG at positions 9-11, can be attributed to mRNA degradation. The majority of the protein knockdown for these combinations is due to translational repression. These results seem to be independent
91

Chapter 3: Characterization of mRNA:siRNA combinations with high protein/RNA knockdown ratios of whether the reporter is expressed transiently or stably. This unusual activity is not due to the particular siRNAs used in these experiments as the same siRNAs generate similar degrees of RNA and protein knockdowns when targeted to sequences with two or more mismatches in positions 9-11. In addition, this phenomenon has been observed with three different mRNA:siRNA complementary combinations, those with trinucleotides
UUC, UCU and UCG at positions 9-11. Large screens have previously been conducted to identify features that lead to effective siRNA knockdown (Khvorova et al., 2003;
Reynolds et al., 2004; Schwarz et al., 2003; Taxman et al., 2006). Generally, siRNA efficiency has been evaluated by measuring either the extent of RNA knockdown or target protein knockdown, but rarely both. Therefore, it is possible that perfectly complementary combinations that result in silencing primarily through translational repression were missed in these large siRNA libraries.
The observation that complementary combinations can result in translational repression was previously noted in hippocampal neurons (Davidson et al., 2004). siRNAs targeting SOD1 or caspase-3 mRNAs resulted in downregulation of the respective protein within 6 hours after transfection. However, only one of the four complementary siRNAs tested, yielded mRNA downregulation, albeit 24 hours after transfection (Davidson et al., 2004). The complementary combinations that did not yield mRNA degradation had a CUA or an AGA trinucleotide sequence at positions 9-11. The combination that resulted in both RNA and protein knockdown had a GGU trinucleotide sequence at positions 9-11. None of these trinucleotide sequences at positions 9-11 are represented in our study (Davidson et al., 2004). However, it is possible that the observations made with complementary combinations in neurons and our own observations with atypical complementary combinations share a common mechanism.
In addition to an increase in protein/RNA knockdown ratios, complementary combinations with atypical protein/RNA knockdown ratios seem to result in enhanced
92

Chapter 3: Characterization of mRNA:siRNA combinations with high protein/RNA knockdown ratios protein silencing as compared to other complementary combinations which are associated with the same degree of protein and RNA knockdown (Combinations 13 and
27; Table 1, Chapter 2). For example, transient expression of complementary combinations with a UAC and a GCC trinucleotide sequence at positions 9-11 in AGO2 knockout MEFs transfected with an Ago2 containing plasmid, resulted in 19.3 + 6.5 and
11.6 + 1.0 -fold protein changes, respectively. In contrast, the comparable transfection of the complementary combination with a UCU trinucleotide at positions 9-11 resulted in
28.7 + 3.1-fold protein change. Studies in which a large number of siRNAs were used against a common target have identified several determinants that correlate with increased siRNA-mediated silencing (Khvorova et al., 2003, Reynolds, 2004 #77).
Among these determinants, low internal stability (positions 9-14) (Khvorova et al., 2003) and an A or U at position 10 (Reynolds et al., 2004) are both associated with increased siRNA efficiency. Neither of these two parameters can account for the increased silencing efficiency we observed for complementary siRNAs with atypical protein/RNA knockdown ratios. For example, a change from the trinucleotide sequence UAC to UUC at positions 9-11 caused the protein/RNA knockdown ratio to increase from 1 to 5. This single nucleotide change would not affect significantly the internal stability of the mRNA:siRNA duplex or change the preference of an A or a U at position 10. In addition to sequence determinants, local mRNA secondary structure and target accessibility are also thought to be important for siRNA and miRNA efficiency (Ameres et al., 2007;
Cullen, 2006; Heale et al., 2005; Long et al., 2007; Luo and Chang, 2004; Overhoff et al., 2005; Schubert et al., 2005). However, in all of the cases reported in our study, the only changes made to the RNA reporter were within positions 9-11 and are not likely to affect the reporter’s mRNA secondary structure.
Determinants that correlate with miRNA efficiency have also been identified.
These include base pairing at position 8, an A at position 1 on the target mRNA, an A or
93

Chapter 3: Characterization of mRNA:siRNA combinations with high protein/RNA knockdown ratios
U at position 9 on the target mRNA, proximity between binding sites, A/U rich sequences surrounding binding sites, additional 3' complementarity, number of binding sites, and proximity of binding sites to the end of the coding sequence or the end of the 3' UTR
(Doench and Sharp, 2004; Grimson et al., 2007; Nielsen et al., 2007). It is unknown if all of these determinants correlate with translational repression alone and not with both an increase in miRNA-mediated RNA and protein knockdown. Additionally, with the exception of the A or U at position 9 determinant, none of these determinants apply to the atypical complementary combinations described in this chapter given that the only variable that changed for these combinations was the sequence of positions 9-11.
Having an A or a U at position 9 did not correlate with atypical protein/RNA knockdown ratios since reporters with a UUC or a UCG trinucleotide sequence at positions 9-11 were in this group.
Our results indicate that the dramatic silencing observed with atypical complementary combinations is sequence-specific and dependent on Ago2.
Furthermore, enhanced silencing and high protein/RNA knockdown ratios are no longer observed when one of the catalytic residues within Ago2 is mutated, indicating that these effects are dependent on Ago2-mediated catalysis. Given the extent of RNA knockdown and the disparity observed between protein and RNA knockdown for atypical complementary combinations, we postulate that endonucleolytic cleavage is not important for the actual silencing step. In fact, stable expression of reporters with atypical complementary protein/RNA knockdown ratios, resulted in small RNA changes
(2.0 + 0.6 and 0.91 + 0.1-fold for both reporters with a UCU and a UUC trinucleotide sequence at positions 9-11). Compared to the RNA knockdown observed for stable transfections of typical perfect combinations, the equivalent extent of RNA knockdown for combinations with atypical protein/RNA knockdown ratios was only observed when the atypical combinations were transiently transfected. In addition, if typical and atypical
94

Chapter 3: Characterization of mRNA:siRNA combinations with high protein/RNA knockdown ratios complementary combinations are compared using the same type of experimental protocol (transient transfection), complementary combinations with typical protein/RNA knockdown ratios always result in a higher extent of RNA knockdown. For example, transient expression of complementary combinations with a GCC trinucleotide sequence at positions 9-11 in AGO2 knockout MEFs transfected with an Ago2 containing plasmid, resulted in 12.6 + 0.1 -fold mRNA changes while transfection of the complementary combination with a UCU trinucleotide at positions 9-11 resulted in 6.4 + 0.2 -fold mRNA change.
Given that endonucleolytic cleavage does not seem to be as important for the silencing of complementary combinations with atypical protein/RNA knockdown ratios, it is possible that cleavage is instead required for an event upstream of the actual silencing mechanism. In Drosophila , siRNAs and miRNAs partition into distinct Argonaute complexes (Forstemann et al., 2007; Tomari et al., 2007). siRNAs bind to Ago2 whereas miRNAs preferentially bind to Ago1 containing complexes. In Drosophila , partitioning of small RNA duplexes is dependent on the structure of the duplex and not dependent on which of the two Dicer enzymes processes the precursor duplex. For example, pre-miRNA duplexes, which in Drosophila are processed by Dicer-1, will associate with Ago2 containing miRNPs if the miRNA duplex is perfectly complementary
(Forstemann et al., 2007).
Small RNA partitioning can have phenotypic consequences, because Drosophila
Ago1 is a poor endonuclease and does not induce robust silencing of perfectly matched targets, whereas Drosophila Ago2 does not direct degradation and robust silencing of mRNAs with central mismatches in their target sites (Forstemann et al., 2007). In addition, the mechanism of strand selection for a siRNA or miRNA duplex is determined both by the specific Argonaute protein to which they bind and by the structure of the mature duplex (Leuschner et al., 2006; Matranga et al., 2005; Miyoshi et al., 2005; Rand
95

Chapter 3: Characterization of mRNA:siRNA combinations with high protein/RNA knockdown ratios et al., 2005). In both Drosophila embryos and human cell extracts, Ago2 containing
RISCs can cleave the passenger strand of a siRNA duplex or the miRNA* strand of a miRNA/miRNA* duplex designed to have perfect complementarity (Leuschner et al.,
2006; Matranga et al., 2005; Miyoshi et al., 2005; Rand et al., 2005). Introduction of a chemical modification in the scissile phosphodiester bond (position 10) of the miRNA* strand that blocks Ago2-catalyzed cleavage, inhibits Ago2 loading of mammalian miR-1 and reduces silencing of its target when the miR-1 strand is perfectly matched to its miR-
1* strand. However, there is no effect on miR-1 loading and silencing when the miR-
1/miR-1* duplex contains central mismatches (Matranga et al., 2005). This indicates that endogenous animal miRNAs, which are processed from mismatched pre-miRNA duplexes, can be loaded into Ago2 by a bypass mechanism that does not require cleavage (Leuschner et al., 2006; Matranga et al., 2005; Miyoshi et al., 2005; Rand et al., 2005). In addition, these results also indicate that siRNA loading and siRNAmediated silencing are facilitated by Ago2 cleavage. In mammals, it appears that all four
Argonautes are capable of binding miRNAs (Meister et al., 2004) and at least Ago1,
Ago2 and Ago3 are able to bind siRNAs in vivo as well (Liu et al., 2004), indicating that small RNA partitioning might not occur as described in Drosophila (Bellare and
Sontheimer, 2007). However, as suggested by the in vitro studies (Meister et al., 2004), it is possible that cleavage-assisted loading of siRNAs by Ago2 provides some level of specificity to the function of Ago2 containing RISC complexes (Matranga and Zamore,
2007). This hypothesis could explain why the effects of complementary combinations with atypical protein/RNA knockdown ratios are dependent on Ago2-mediated catalysis.
Perhaps, Ago2 assisted cleavage of atypical complementary siRNAs is necessary for proper loading and RISC function in our experiments.
If catalysis is necessary for proper loading into Ago2 containing RISC, how can the difference between the RNA and protein knockdown observed for atypical
96

Chapter 3: Characterization of mRNA:siRNA combinations with high protein/RNA knockdown ratios complementary combinations be explained? The disparity between the RNA and protein knockdown for complementary combinations with UUC, UCU and UCG trinucleotides at positions 9-11 suggests that Ago2-mediated cleavage is not the primary mode of silencing. The differences between RNA and protein knockdown between typical versus atypical complementary combinations could reflect a substrate preference for RISC cleavage. It is possible that these atypical complementary combinations result in sustained RISC binding, but inefficient cleavage. One could test this hypothesis by transfecting a reporter RNA containing a chemical modification at position 10 and/or 11, such as a phosphorothioate modification or a 2'O -methylated base, to prevent Ago2mediated target cleavage. If inhibiting cleavage of the modified target leads to enhance binding, then we would expect that the noncleavable reporter RNA would be silenced primarily through translational repression. An alternatively explanation for why Ago2mediated cleavage is necessary but does not contribute to the primary mode of silencing for atypical complementary combinations is that Ago2 is required for strand selection and loading, while other Argonautes, which do not posses catalytic activity, are responsible for the actual silencing step.
We have proposed a model in which complementary siRNAs that result in atypical protein/RNA knockdown ratios and enhanced silencing are properly loaded into
RISC complexes by Ago2-mediated catalysis. However, our model also proposes that enhanced silencing is due likely to inefficient RISC cleavage. These two hypotheses result in the following conundrum: how are atypical siRNAs loaded if Ago2 cleavage is required but yet inefficient cleavage is a characteristic of their silencing activity? It is important to note that these atypical combinations still result in some degree of target
RNA knockdown, albeit substantially lower than for perfect complementary combinations. Perhaps, inefficient Ago2-mediated cleavage produces a sufficient number of siRNA loaded RISC to mediate target silencing.
97

Chapter 3: Characterization of mRNA:siRNA combinations with high protein/RNA knockdown ratios
Our results indicate that Ago2-mediated cleavage might have sequence preferences. The ultimate biological significance of this specificity remains to be elucidated. Future experiments that address the significance of this phenomenon will shed light on regulatory mechanisms important for Ago2 function and RNAi biology.
EGFP control plasmid, wild type human Ago1 and Ago2 constructs we obtained from the
Tuschl lab (Meister et al., 2004). Briefly, EGFP and Ago constructs containing a Nterminal FLAG/HA tag were cloned into a modified pIRESneo plasmid (Meister et al.,
2004). Ago2 D597A was made using Quick Change and the following oligos: Ago2
D597A forward primer 5' - TTTCTGGGAGCAGCCGTCACTCACCCC - 3'; Ago2 D597A reverse primer 5'- GGGGTGAGTGACGGCTGCTCCCAGAAA - 3'. The firefly expressing reporter GL3 (Promega) was used for transient transfections to control for transfection efficiency.
A modified version of the pRL-TK vector containing a multiple-cloning site downstream of the Renilla luciferase stop codon was previously generated (pRL-TK 3'MCS, see
Materials and Methods section in Chapter 2). To create constructs that could be transiently transfected and used for creating stable cell lines, a pRL-TK 3'MCS Bgl
II/HpaI fragment containing the Renilla luciferase gene and the SV40 poly A signal was cloned into a pPur BamHI/SwaI fragment containing the puromycin resistance gene
(pRL-TK 3'MCS Pur). 3' UTR binding sites were constructed by annealing two DNA oligonucleotides containing two identical CXCR4 binding sites separated by the
98

Chapter 3: Characterization of mRNA:siRNA combinations with high protein/RNA knockdown ratios sequence CCGG and flanked by XhoI and SpeI sites. Annealed oligos were then inserted into pRL-TK 3'MCS Puro’s XhoI and SpeI sites, which are located directly downstream from the Renilla luciferase coding region. To create a stably expressing cell line of these Renilla reporters, HeLa cells were transfected with the pRL-TK 3'MCS Puro vector containing CXCR4 binding sites and selected with puromycin (600 ng/mL).
siRNAs were purchased from Dharmacon and prepared according to manufacturer’s instructions. Sequences of siRNAs (sense strand) used in this study are as follows: siControl (ON-TARGET plus siCONTROL, Dharmacon):
5’- UGGUUUACAUGUCGACUAA -3';
GFP: 5'- GGCUACGUCCAGGAGCGCAdTdT -3';
CXCR4: 5'- GUUUUCACUCCAGCUAACAdTdT -3';
CXCR4-B: 5'- GUUUUCACGCCAGCUAACAdTdT -3';
CXCR4-C: 5'- GUUUUCACUCGAGCUAACAdTdT -3';
CXCR4-D: 5'- GUUUUCACUACAGCUAACAdTdT -3';
CXCR4-E: 5'- GUUUUCACUCUAGCUAACAdTdT -3';
CXCR4-F: 5'- GUUUUCACUUCAGCUAACAdTdT -3';
CXCR4-G: 5'- GUUUUCACUCAAGCUAACAdTdT -3';
CXCR4-t9C near perfect: 5'- GUUUUCACAUGAGCUAACAdTdT -3';
CXCR4-t9G: 5'- CGGAGGGAAUCAGCUAACAdTdT -3';
CXCR4-t9C: 5'- CGGAGGGAAUGAGCUAACAdTdT -3';
CXCR4-t9U: 5'- CGGAGGGAAUAAGCUAACAdTdT -3';
99

Chapter 3: Characterization of mRNA:siRNA combinations with high protein/RNA knockdown ratios
HeLa cells or AGO2 -/- MEFs obtained from the Hannon lab (Liu et al., 2004) were grown in DMEM supplemented with 10% inactivated fetal bovine serum and penicillin/streptomycin. For stable cell line transfections, the day before transfection, cells were seeded at 1.5X10
5 cells/well for 6-well plates and 3.0X10
4 cells/well for 24well plates in antibiotic-free media. Transfections were performed using Oligofectamine according to the manufacturer’s instructions (Invitrogen) in a final volume of 1.25 mL for
6-well plates and 0.25 mL for 24-well plates. For transient cell line transfections, the day before transfection, cells were seeded at 5.5X10
5 cells/well for 6-well plates and 1.0X10
5 cells/well for 24-well plates in antibiotic-free media. Transfections were performed using
Lipofectamine 2000 according to the manufacturer’s instructions (Invitrogen) in a final volume of 2.50 mL for 6-well plates and 0.50 mL for 24-well plates. For transient HeLa cell transfections, Renilla reporter constructs were transfected at a final concentration of
1.5 ng/
µ l and the firefly reporter construct (GL3, Promega) was transfected at a final concentration of 0.1 ng/ µ l. For the transient AGO2 -/- MEFs’ transfections, the Renilla reporter with a UCU trinucleotide at position 9-11 was transfected at a final concentration of 1.1 ng/ µ l, the firefly reporter construct (GL3, Progema) was transfected at a final concentration of 0.1 ng/ µ l, and the EFGP control vector, Ago2 or Ago1 containing plasmids were transfected at a final concentration of 0.4 ng/ µ l. For both transient and stable transfections siRNAs were used at a final concentration of 10 nM.
For detection of Renilla mRNA, total RNA was harvested 48 hrs after transfection
(unless otherwise indicated) using the RNAeasy kit (Qiagen) and DNAse-treated with
Turbo DNAse (Ambion). 5 µ g or 500 ng of DNAse treated RNA were used for reverse
100

Chapter 3: Characterization of mRNA:siRNA combinations with high protein/RNA knockdown ratios transcription reactions with specific primers for Renilla luciferase (Rluc) and TATA binding protein (TBP), which served as an internal control. The following are the reverse transcription primers for TBP and Rluc: TBP RT primer 5'-
GTACATGAGAGCCATTACGTCGTC-3'; Rluc RT primer 5'-
GCATTCTAGTTGTGGTTTGTCC-3'. The Rluc RT primer is located downstream of the
3' UTR CXCR4 binding sites. Reverse transcription was performed using Superscript III
(Invitrogen) according to manufacturer’s guidelines. 1
µ l of reverse transcription reaction was subjected to real-time PCR. Each PCR reaction was measured in quadruplicate.
Rluc primers and probe were designed against the cDNA junction between pRL-TK vector sequence and the Renilla luciferase exon (pRL-TK contains a chimeric intron upstream of the Renilla reporter gene). The following are the primers and Taqman probes used for amplification of Rluc and TBP: Rluc forward primer (FP) 5'-
TGCAGAAGTTGGTCGTGAGGCA-3'; Rluc reverse primer (RP) 5'-
TCTAGCCTTAAGAGCTGTAATTGAACTGGG-3'; Rluc probe 5’-FAM-
TGGGCAGGTGTCCAC-MGB-NFQ-3' (FAM: 6-carboxy-fluorescin; MGB: minor groove binding; NFQ: nonfluorescent quencher; Applied Biosystems); TBP primers and probe were obtained from Applied Biosystems (Taqman Gene Expression Assays, #
Hs00427620_m1). Real-time PCR was performed in a total volume of 25
µ l, using the
Taqman Universal PCR Master Mix protocol according to manufacturer’s instructions.
Final concentrations of probes and primers used per reaction were 250 nM and 900 nM, respectively. Relative mRNA levels were determined using the 2 ∆∆ Ct method. mRNA amounts were normalized to a GFP siRNA or a siControl siRNA (Dharmacon) transfection.
101

Chapter 3: Characterization of mRNA:siRNA combinations with high protein/RNA knockdown ratios
Renilla luciferase assays or dual-luciferase assays were performed 48 hours after transfection (unless indicated otherwise) according to manufacturer’s instructions
(Promega) and detected with a Glomax 20/20 luminometer (Promega). Each transfection reaction and luciferase assay was done in triplicate. All of the readings obtained from luciferase assays were within the linear range (seven orders of magnitude) established by both the manufacturer (Promega) and by titration experiments previously performed in our lab. For Renilla luciferase assays, Renilla luciferase activity was assayed and normalized to a GFP siRNA or a siControl siRNA
(Dharmacon) transfection. For dual luciferase assays, Renilla and firefly luciferase activities were consecutively assayed. Renilla luciferase readings were first normalized to firefly luciferase readings. Relative Renilla luciferase counts were then normalized against a GFP or a siControl siRNA (Dharmacon) transfection.
siRNAs were 5' labeled in reactions containing 10 pmol of siRNA,
γ
32 P-ATP
(6000 Ci, mmol, New England Nuclear), 1 unit of T4 polynucleotide kinase (New
England Biolabs), and 1 µ l of 1X T4 polynucleotide kinase buffer (New England Biolabs) in a final volume of 10 µ l. The reaction was incubated for 30 minutes at 37 ˚C.
Radiolabeled siRNAs were purified using Sephadex G25 columns (GE Healthcare).
Samples were heated for 5 minutes at 90 ˚C and separated on a 15% denaturing polyacrylamide gel. A radioactively labeled 10 base pair DNA ladder (Invitrogen) was used as a length standard. The gel was exposed on a phosphoimager screen for 2 hours and analyzed using Image Quant Software. For each siRNA tested, intact siRNA signal was compared to the sum of the signals obtained from all of the degradation
102

Chapter 3: Characterization of mRNA:siRNA combinations with high protein/RNA knockdown ratios products.
103

Chapter 3: Characterization of mRNA:siRNA combinations with high protein/RNA knockdown ratios
Figure 3.1 - Time course experiment of G:U wobble at position 9.
RNA and protein reductions of a Renilla reporter with a UCU trinucleotide at positions 9-11 that was either (A) stably expressed or (B) transiently transfected in HeLa cells. Cells were transfected with either 10 nM of a siRNA that results in a G:U wobble at position 9, CXCR4
(combination 6, G:U) or 10 nM of a siRNA that results in a bulge within positions 9-11, CXCR4t9C near perfect (Bulge). Cells were collected for RNA and protein analysis 24 and 48 hours after transfection. Samples were normalized to an unrelated siRNA (targeting GFP). Normalized average mRNA and protein knockdown (fold change + SD) are shown. mRNA sequences (black) and guide siRNA sequences (red) for positions 9-11 are shown underneath relevant combinations.
104

Chapter 3: Characterization of mRNA:siRNA combinations with high protein/RNA knockdown ratios
Figure 3.2 - RNA and protein effects for a G:U wobble combination compared to those of related mRNA:siRNA duplexes.
HeLa cells were transiently transfected with three different Renilla reporter constructs which only differed at position 9. Cells were transfected with either 10 nM of a siRNA that results in a G:U wobble or a mismatch at position 9, CXCR4, or 10 nM of a siRNA that results in at least 2 mismatches within positions 9-11, CXCR4-t9C near perfect (Mismatch). Cells were collected for
RNA and protein analysis 48 hours after transfection. Samples were normalized to an unrelated siRNA (Control). Normalized average mRNA and protein knockdown (fold change + SD) were calculated from two independent experiments. mRNA sequences (black) and guide siRNA sequences (red) for positions 9-11 are shown underneath relevant combinations.
105

Chapter 3: Characterization of mRNA:siRNA combinations with high protein/RNA knockdown ratios
Figure 3.3 - Perfectly complementary siRNAs can result in translational repression and enhanced silencing.
HeLa cells were transiently transfected with two different Renilla reporter constructs which only differed in sequence at position 9. When the appropriate siRNAs are transfected, both of these reporters can form G:U wobbles at position 9 with different symmetries. Cells were transfected with four different siRNAs: I) 10 nM of a perfectly complementary siRNA, CXCR4-E and
CXCR4-C for the reporter with a U and a G at position 9, respectively (Perf); II) 10 nM of a siRNA that results in a G:U wobble at position 9, CXCR4 and CXCR4-G for the reporter with a
U and a G at position 9, respectively (Wobble); III) 10 nM of a siRNA that results in a G:U wobble at position 9 with no complementarity from positions 10-19, CXCR4-t9G and CXCR4t9U for the reporter with a U and a G at position 9, respectively (Wobble w/out 3' comp); IV) or
10 nM of a siRNA that results in a bulge within positions 9-11, CXCR4-t9C near perfect and
CXCR4-B for the reporter with a U and a G at position 9, respectively (Bulge). Cells were collected for RNA and protein analysis 48 hours after transfection. Samples were normalized to an unrelated siRNA (Control). Normalized average mRNA and protein knockdown (fold change
+ SD) were calculated from two independent experiments. mRNA sequences (black) and guide siRNA sequences (red) for positions 9-11 are shown underneath relevant combinations.
106

Chapter 3: Characterization of mRNA:siRNA combinations with high protein/RNA knockdown ratios
Figure 3.4 - Perfectly complementary siRNAs can result in high protein/RNA knockdown ratios in both cell line and transient transfections.
RNA and protein reductions of a Renilla reporter with a UCU or a UUC trinucleotide sequence at positions 9-11 that was either stably expressed (A, B) or transiently transfected (C) in HeLa cells. Cells were transfected with either I) 10 nM of a perfectly complementary siRNA, CXCR4-
E and CXCR4-F for the UCU and the UUC reporter, respectively (Perf); II) 10 nM of a siRNA that results in a G:U wobble at position 9 or 10, CXCR4 for both UCU and UUC reporters (G:U);
III) 10 nM of a siRNA that results in a G:U wobble at position 9 or 10 with a mismatch at position 11, CXCR-B for both UCU and UUC reporters (G:U w/ mis); IV) or 10 nM of a siRNA that results in a bulge within positions 9-11, CXCR4-t9C near perfect and CXCR4-B for the UCU and the UUC reporter, respectively (Bulge). Cells were collected for RNA and protein analysis
48 hours after transfection. Samples were normalized to an unrelated siRNA (Control).
Normalized average mRNA and protein knockdown (fold change + SD) are shown. mRNA sequences (black) and guide siRNA sequences (red) for positions 9-11 are shown underneath relevant combinations.
107

Chapter 3: Characterization of mRNA:siRNA combinations with high protein/RNA knockdown ratios
Figure 3.5 - Dramatic silencing resulting from atypical siRNAs is not an experimental artifact.
(A) HeLa cells were transiently transfected with a reporter containing a UCU or a UUC trinucleotide sequence at positions 9-11 and 10 nM of their respective perfectly complementary siRNAs, CXCR4-E and CXCR4-F for the UCU and the UUC reporter, respectively (Perf).
Perfectly complementary siRNAs were re-synthesized and newly made aliquots were used for this experiment. Cells were collected for RNA and protein analysis 48 hours after transfection.
Samples were normalized to an unrelated siRNA (Control). Normalized average mRNA and protein knockdown (fold change + SD) are shown. mRNA sequences (black) and guide siRNA sequences (red) for positions 9-11 are shown underneath relevant combinations. (B) Different preparations (indicated by #1 and #2) of siRNAs that result in typical complementary combinations (CXCR4-B and CXCR4-D), siRNAs that result in atypical complementary combinations (CXCR4-C and CXCR4-E) as well as a siRNA that results in a G:U wobble at position 9 (CXCR4) and an unrelated siRNA (Control) were 5' end labeled and resolved in a 15% polyacrylamide denaturing gel. mRNA sequences (black) and antisense siRNA sequences (red) for positions 9-11 are shown above each siRNA labeled to indicate the pertinent combinations.
Protein/RNA knockdown ratios (blue) are indicated for the combinations that these siRNAs generated. (C) Quantification of (B). Percentages of intact and degraded siRNAs were calculated by dividing the total radioactive siRNA signal by the specific radioactive signal from intact siRNA or the sum of the radioactive signals from degradation products, respectively.
108

Chapter 3: Characterization of mRNA:siRNA combinations with high protein/RNA knockdown ratios
Figure 3.6 - The dramatic silencing effect resulting from atypical perfect siRNAs is dependent on Ago2 function.
RNA and protein analysis of a Renilla luciferase reporter with a UCU trinucleotide sequence at positions 9-11, after transfection in AGO2 -/- MEFs with either I) 10 nM of a perfectly complementary siRNA, CXCR4-E (Perf); II) 10 nM of a siRNA that results in a G:U wobble at position 9, CXCR4 (G:U); III) or 10 nM of a siRNA that results in a G:U wobble at position 9 with a mismatch at position 11, CXCR4-B (G:U w/ mis). Reporters were co-transfected with either a control EGFP plasmid (Control), an Ago2 (AGO2) or an Ago1 (AGO1) expressing plasmid.
Samples were normalized to an unrelated siRNA transfection (Control). Normalized average mRNA and protein knockdown (fold change + S.D.) were calculated from two independent experiments. mRNA sequences (black) and guide siRNA sequences (red) for positions 9-11 are shown underneath relevant combinations.
109

Chapter 3: Characterization of mRNA:siRNA combinations with high protein/RNA knockdown ratios
Figure 3.7 - Ago2’s catalytic activity is necessary for full silencing effects exhibited by atypical perfect siRNAs.
RNA and protein analysis of a Renilla luciferase reporter with a UCU trinucleotide sequence at positions 9-11, after transfection in AGO2 -/- MEFs with either 10 nM of a perfectly complementary siRNA, CXCR4-E (Perf), 10 nM of a siRNA that results in a G:U wobble at position 9, CXCR4 (G:U) or 10 nM of a siRNA that results in a G:U wobble at position 9 with a mismatch at position 11, CXCR4-B (G:U w/ mis). Reporters were co-transfected with either a control EGFP plasmid (Control), a wild type Ago2 (AGO2) or catalytically dead Ago2 (AGO2
D597A) expressing plasmid.
Samples were normalized to an unrelated siRNA transfection
(Control). Normalized average mRNA and protein knockdown (fold change + S.D.) were calculated from three independent experiments. mRNA sequences (black) and guide siRNA sequences (red) for positions 9-11 are shown underneath relevant combinations.
110

Chapter 4: Concluding Remarks
111

Chapter 4: Concluding Remarks siRNAs have been shown to be mediators of the RNAi response. When complementary to their targets, they are able to guide endonucleolytic cleavage, resulting in mRNA downregulation. The specificity of siRNA-mediated silencing has been intensely investigated given the widespread experimental use of siRNAs and their potential therapeutic applications. Off-target effects have been previously defined as the downregulation of transcripts levels after transfection of an unrelated siRNA (Jackson et al., 2003). However, the consequences of off-target effects at the protein level were poorly understood.
The work described in this dissertation has primarily focused on whether interactions between partially complementary siRNA guide strands and mRNAs produce tightly correlated changes in mRNA and protein downregulation. In particular, we have investigated the importance of the central region of the mRNA:siRNA duplex, positions
9-11, because this region is directly involved in siRNA-mediated target transcript cleavage.
Using a reporter system with binding sites to a siRNA we have determined the extent of RNA and protein knockdown for a large panel of mismatched mRNA:siRNA duplexes within positions 9-11. As discussed in Chapter 2, RNA analysis of these combinations confirmed that partial complementarily can result in mRNA downregulation even when the mismatches are within the positions involved in siRNA-mediated target cleavage. In addition, comparison of RNA and protein knockdown for the 30 mRNA:siRNA combinations showed that in addition to mRNA downregulation, off-target effects can result in translational repression. These results underscore the importance of measuring both RNA and protein downregulation when assessing the full impact of off-target effects.
Given the similarities between miRNA silencing and off-target effects, the results described in Chapter 2 may have implications for miRNA-mediated silencing pathways.
112

Chapter 4: Concluding Remarks
Experiments aimed at elucidating the mechanisms by which imperfectly complementary siRNAs mediate transcript downregulation, revealed that Ago2 is not required for offtarget mRNA downregulation. Drosophila Ago1 (the Argonaute protein in Drosophila dedicated to the miRNA pathway) is required for miRNA-mediated target degradation
(Behm-Ansmant et al., 2006; Giraldez et al., 2006; Wu et al., 2006), however, it is currently not known which of the four human Argonautes mediates target degradation.
Our results suggest that Ago2 is not necessary for miRNA-mediated transcript downregulation in human cells.
Given that miRNAs are known to reduce mRNA levels by inducing rapid deadenylation (Behm-Ansmant et al., 2006; Giraldez et al., 2006; Wu et al., 2006), it is also likely that off-target interactions result in rapid deadenylation. Future experiments will test this hypothesis by determining the poly A tail length of a reporter in the presence of a complementary or a mismatched siRNA. Poly A tail length should also be determined for complementary and mismatched combinations in the absence of Ago2.
As noted in Chapter 2, in the absence of Ago2 expression, two of the complementary combinations (combinations 13 and 27) resulted in a large disparity between RNA and protein knockdown, similar to the results observed for imperfectly complementary combinations. This finding indicates that in the absence of Ago2 expression, complementary combinations can enter an alternative pathway to endonucleolytic cleavage, perhaps through increased deadenylation. The additional experiments proposed will provide a better mechanistic understanding of off-target mRNA downregulation in human cells.
In addition to uncovering mismatched combinations that result in mRNA and protein knockdown that are independent of Ago2 function, we have also identified complementary combinations that result in high protein/RNA knockdown ratios. How these complementary siRNAs result in atypical protein/RNA knockdown ratios remains
113

Chapter 4: Concluding Remarks unclear. Unlike the mismatched combinations with unequal RNA and protein knockdowns described in Chapter 2, RNA and protein knockdowns for atypical complementary combinations are dependent on Ago2’s catalytic activity. Given that endonucleolytic cleavage is not the primary mechanism responsible for overall protein silencing for these combinations, it is likely that Ago2’s catalytic activity is required for passenger strand cleavage and strand selection of these atypical complementary siRNAs. Therefore, we hypothesize that complementary combinations with atypical protein/RNA knockdown ratios may not be cleaved efficiently and that inefficient cleavage leads to sustained binding and translational repression.
The results described in Chapter 3 leave a number of questions unanswered.
Future experiments should focus on the following questions. First, can complementary combinations placed in different mRNA contexts and sequences result in high protein/RNA knockdown ratios? Second, do high protein/RNA knockdown ratios for atypical complementary combinations depend on the location of the siRNA binding site
(e.g. 3' UTR versus coding region)? Third, do the high protein/RNA knockdown ratios for atypical complementary combinations change with the number of siRNA binding sites?
Answering these questions will lead to a better understanding of the mechanisms that are involved in small RNA silencing.
114

Chapter 5: References
115

Chapter 5: References
Ameres, S. L., Martinez, J., and Schroeder, R. (2007). Molecular basis for target RNA recognition and cleavage by human RISC. Cell 130 , 101-112.
Aravin, A. A., Sachidanandam, R., Girard, A., Fejes-Toth, K., and Hannon, G. J. (2007).
Developmentally regulated piRNA clusters implicate MILI in transposon control. Science
316 , 744-747.
Ason, B., Darnell, D. K., Wittbrodt, B., Berezikov, E., Kloosterman, W. P., Wittbrodt, J.,
Antin, P. B., and Plasterk, R. H. (2006). Differences in vertebrate microRNA expression.
Proc Natl Acad Sci U S A 103 , 14385-14389.
Bagga, S., Bracht, J., Hunter, S., Massirer, K., Holtz, J., Eachus, R., and Pasquinelli, A.
E. (2005). Regulation by let-7 and lin-4 miRNAs results in target mRNA degradation. Cell
122 , 553-563.
Bartel, D. P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell
116 , 281-297.
Basu, U., Si, K., Warner, J. R., and Maitra, U. (2001). The Saccharomyces cerevisiae
TIF6 gene encoding translation initiation factor 6 is required for 60S ribosomal subunit biogenesis. Mol Cell Biol 21 , 1453-1462.
Behm-Ansmant, I., Rehwinkel, J., Doerks, T., Stark, A., Bork, P., and Izaurralde, E.
(2006). mRNA degradation by miRNAs and GW182 requires both CCR4:NOT deadenylase and DCP1:DCP2 decapping complexes. Genes Dev 20 , 1885-1898.
Bellare, P., and Sontheimer, E. J. (2007). A fork in the road for microRNAs. Nat Struct
Mol Biol 14 , 684-686.
Berezikov, E., Chung, W. J., Willis, J., Cuppen, E., and Lai, E. C. (2007). Mammalian mirtron genes. Mol Cell 28 , 328-336.
Bhattacharyya, S. N., Habermacher, R., Martine, U., Closs, E. I., and Filipowicz, W.
(2006). Relief of microRNA-mediated translational repression in human cells subjected to stress. Cell 125 , 1111-1124.
Birmingham, A., Anderson, E. M., Reynolds, A., Ilsley-Tyree, D., Leake, D., Fedorov, Y.,
Baskerville, S., Maksimova, E., Robinson, K., Karpilow, J.
, et al.
(2006). 3' UTR seed matches, but not overall identity, are associated with RNAi off-targets. Nat Methods 3 ,
199-204.
Bohmert, K., Camus, I., Bellini, C., Bouchez, D., Caboche, M., and Benning, C. (1998).
AGO1 defines a novel locus of Arabidopsis controlling leaf development. Embo J 17 ,
170-180.
Bohnsack, M. T., Czaplinski, K., and Gorlich, D. (2004). Exportin 5 is a RanGTPdependent dsRNA-binding protein that mediates nuclear export of pre-miRNAs. RNA 10 ,
185-191.
Brengues, M., Teixeira, D., and Parker, R. (2005). Movement of eukaryotic mRNAs between polysomes and cytoplasmic processing bodies. Science 310 , 486-489.
116

Chapter 5: References
Brennecke, J., Aravin, A. A., Stark, A., Dus, M., Kellis, M., Sachidanandam, R., and
Hannon, G. J. (2007). Discrete small RNA-generating loci as master regulators of transposon activity in Drosophila. Cell 128 , 1089-1103.
Brennecke, J., Hipfner, D. R., Stark, A., Russell, R. B., and Cohen, S. M. (2003). bantam encodes a developmentally regulated microRNA that controls cell proliferation and regulates the proapoptotic gene hid in Drosophila. Cell 113 , 25-36.
Brennecke, J., Stark, A., Russell, R. B., and Cohen, S. M. (2005). Principles of microRNA-target recognition. PLoS Biol 3 , e85.
Bronstein, I., Fortin, J., Stanley, P. E., Stewart, G. S., and Kricka, L. J. (1994).
Chemiluminescent and bioluminescent reporter gene assays. Anal Biochem 219 , 169-
181.
Bushati, N., and Cohen, S. M. (2007). microRNA functions. Annu Rev Cell Dev Biol 23 ,
175-205.
Carmell, M. A., Girard, A., van de Kant, H. J., Bourc'his, D., Bestor, T. H., de Rooij, D.
G., and Hannon, G. J. (2007). MIWI2 is essential for spermatogenesis and repression of transposons in the mouse male germline. Dev Cell 12 , 503-514.
Cerutti, L., Mian, N., and Bateman, A. (2000). Domains in gene silencing and cell differentiation proteins: the novel PAZ domain and redefinition of the Piwi domain.
Trends Biochem Sci 25 , 481-482.
Chalfie, M., Horvitz, H. R., and Sulston, J. E. (1981). Mutations that lead to reiterations in the cell lineages of C. elegans. Cell 24 , 59-69.
Chang, S., Johnston, R. J., Jr., and Hobert, O. (2003). A transcriptional regulatory cascade that controls left/right asymmetry in chemosensory neurons of C. elegans.
Genes Dev 17 , 2123-2137.
Chendrimada, T. P., Finn, K. J., Ji, X., Baillat, D., Gregory, R. I., Liebhaber, S. A.,
Pasquinelli, A. E., and Shiekhattar, R. (2007). MicroRNA silencing through RISC recruitment of eIF6. Nature 447 , 823-828.
Chendrimada, T. P., Gregory, R. I., Kumaraswamy, E., Norman, J., Cooch, N.,
Nishikura, K., and Shiekhattar, R. (2005). TRBP recruits the Dicer complex to Ago2 for microRNA processing and gene silencing. Nature 436 , 740-744.
Chi, J. T., Chang, H. Y., Wang, N. N., Chang, D. S., Dunphy, N., and Brown, P. O.
(2003). Genomewide view of gene silencing by small interfering RNAs. Proc Natl Acad
Sci U S A 100 , 6343-6346.
Chiu, Y. L., and Rana, T. M. (2003). siRNA function in RNAi: a chemical modification analysis. RNA 9 , 1034-1048.
Chu, C. Y., and Rana, T. M. (2006). Translation Repression in Human Cells by
MicroRNA-Induced Gene Silencing Requires RCK/p54. PLoS Biol 4 , e210.
117

Chapter 5: References
Cullen, B. R. (2006). Viruses and microRNAs. Nat Genet 38 Suppl , S25-30.
Czech, B., Malone, C. D., Zhou, R., Stark, A., Schlingeheyde, C., Dus, M., Perrimon, N.,
Kellis, M., Wohlschlegel, J. A., Sachidanandam, R.
, et al.
(2008). An endogenous small interfering RNA pathway in Drosophila. Nature.
Davidson, T. J., Harel, S., Arboleda, V. A., Prunell, G. F., Shelanski, M. L., Greene, L.
A., and Troy, C. M. (2004). Highly efficient small interfering RNA delivery to primary mammalian neurons induces MicroRNA-like effects before mRNA degradation. J
Neurosci 24 , 10040-10046.
Denli, A. M., Tops, B. B., Plasterk, R. H., Ketting, R. F., and Hannon, G. J. (2004).
Processing of primary microRNAs by the Microprocessor complex. Nature 432 , 231-235.
Didiano, D., and Hobert, O. (2006). Perfect seed pairing is not a generally reliable predictor for miRNA-target interactions. Nat Struct Mol Biol 13 , 849-851.
Ding, H., Schwarz, D. S., Keene, A., Affar el, B., Fenton, L., Xia, X., Shi, Y., Zamore, P.
D., and Xu, Z. (2003). Selective silencing by RNAi of a dominant allele that causes amyotrophic lateral sclerosis. Aging Cell 2 , 209-217.
Ding, L., Spencer, A., Morita, K., and Han, M. (2005). The developmental timing regulator AIN-1 interacts with miRISCs and may target the argonaute protein ALG-1 to cytoplasmic P bodies in C. elegans. Mol Cell 19 , 437-447.
Doench, J. G., Petersen, C. P., and Sharp, P. A. (2003). siRNAs can function as miRNAs. Genes Dev 17 , 438-442.
Doench, J. G., and Sharp, P. A. (2004). Specificity of microRNA target selection in translational repression. Genes Dev 18 , 504-511.
Elbashir, S. M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K., and Tuschl, T.
(2001a). Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411 , 494-498.
Elbashir, S. M., Lendeckel, W., and Tuschl, T. (2001b). RNA interference is mediated by
21- and 22-nucleotide RNAs. Genes Dev 15 , 188-200.
Elbashir, S. M., Martinez, J., Patkaniowska, A., Lendeckel, W., and Tuschl, T. (2001c).
Functional anatomy of siRNAs for mediating efficient RNAi in Drosophila melanogaster embryo lysate. Embo J 20 , 6877-6888.
Eulalio, A., Behm-Ansmant, I., Schweizer, D., and Izaurralde, E. (2007a). P-body formation is a consequence, not the cause, of RNA-mediated gene silencing. Mol Cell
Biol 27 , 3970-3981.
Eulalio, A., Huntzinger, E., and Izaurralde, E. (2008). Getting to the root of miRNAmediated gene silencing. Cell 132 , 9-14.
118

Chapter 5: References
Eulalio, A., Rehwinkel, J., Stricker, M., Huntzinger, E., Yang, S. F., Doerks, T., Dorner,
S., Bork, P., Boutros, M., and Izaurralde, E. (2007b). Target-specific requirements for enhancers of decapping in miRNA-mediated gene silencing. Genes Dev 21 , 2558-2570.
Farazi, T. A., Juranek, S. A., and Tuschl, T. (2008). The growing catalog of small RNAs and their association with distinct Argonaute/Piwi family members. Development 135 ,
1201-1214.
Fedorov, Y., Anderson, E. M., Birmingham, A., Reynolds, A., Karpilow, J., Robinson, K.,
Leake, D., Marshall, W. S., and Khvorova, A. (2006). Off-target effects by siRNA can induce toxic phenotype. RNA 12 , 1188-1196.
Filipowicz, W., Bhattacharyya, S. N., and Sonenberg, N. (2008). Mechanisms of posttranscriptional regulation by microRNAs: are the answers in sight? Nat Rev Genet 9 ,
102-114.
Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S. E., and Mello, C. C. (1998).
Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391 , 806-811.
Forstemann, K., Horwich, M. D., Wee, L., Tomari, Y., and Zamore, P. D. (2007).
Drosophila microRNAs are sorted into functionally distinct argonaute complexes after production by dicer-1. Cell 130 , 287-297.
Gazzani, S., Lawrenson, T., Woodward, C., Headon, D., and Sablowski, R. (2004). A link between mRNA turnover and RNA interference in Arabidopsis. Science 306 , 1046-
1048.
Ghildiyal, M., Seitz, H., Horwich, M. D., Li, C., Du, T., Lee, S., Xu, J., Kittler, E. L., Zapp,
M. L., Weng, Z., and Zamore, P. D. (2008). Endogenous siRNAs Derived from
Transposons and mRNAs in Drosophila Somatic Cells. Science.
Giraldez, A. J., Mishima, Y., Rihel, J., Grocock, R. J., Van Dongen, S., Inoue, K.,
Enright, A. J., and Schier, A. F. (2006). Zebrafish MiR-430 promotes deadenylation and clearance of maternal mRNAs. Science 312 , 75-79.
Gregory, R. I., Chendrimada, T. P., Cooch, N., and Shiekhattar, R. (2005). Human RISC couples microRNA biogenesis and posttranscriptional gene silencing. Cell 123 , 631-640.
Gregory, R. I., Yan, K. P., Amuthan, G., Chendrimada, T., Doratotaj, B., Cooch, N., and
Shiekhattar, R. (2004). The Microprocessor complex mediates the genesis of microRNAs. Nature 432 , 235-240.
Grimson, A., Farh, K. K., Johnston, W. K., Garrett-Engele, P., Lim, L. P., and Bartel, D.
P. (2007). MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell 27 , 91-105.
Grishok, A., Pasquinelli, A. E., Conte, D., Li, N., Parrish, S., Ha, I., Baillie, D. L., Fire, A.,
Ruvkun, G., and Mello, C. C. (2001). Genes and mechanisms related to RNA interference regulate expression of the small temporal RNAs that control C. elegans developmental timing. Cell 106 , 23-34.
119

Chapter 5: References
Haase, A. D., Jaskiewicz, L., Zhang, H., Laine, S., Sack, R., Gatignol, A., and Filipowicz,
W. (2005). TRBP, a regulator of cellular PKR and HIV-1 virus expression, interacts with
Dicer and functions in RNA silencing. EMBO Rep 6 , 961-967.
Haley, B., and Zamore, P. D. (2004). Kinetic analysis of the RNAi enzyme complex. Nat
Struct Mol Biol 11 , 599-606.
Hamilton, A. J., and Baulcombe, D. C. (1999). A species of small antisense RNA in posttranscriptional gene silencing in plants. Science 286 , 950-952.
Hammond, S. M., Bernstein, E., Beach, D., and Hannon, G. J. (2000). An RNA-directed nuclease mediates post-transcriptional gene silencing in Drosophila cells. Nature 404 ,
293-296.
Heale, B. S., Soifer, H. S., Bowers, C., and Rossi, J. J. (2005). siRNA target site secondary structure predictions using local stable substructures. Nucleic Acids Res 33 , e30.
Hock, J., and Meister, G. (2008). The Argonaute protein family. Genome Biol 9 , 210.
Holen, T., Moe, S. E., Sorbo, J. G., Meza, T. J., Ottersen, O. P., and Klungland, A.
(2005). Tolerated wobble mutations in siRNAs decrease specificity, but can enhance activity in vivo. Nucleic Acids Res 33 , 4704-4710.
Horwich, M. D., Li, C., Matranga, C., Vagin, V., Farley, G., Wang, P., and Zamore, P. D.
(2007). The Drosophila RNA methyltransferase, DmHen1, modifies germline piRNAs and single-stranded siRNAs in RISC. Curr Biol 17 , 1265-1272.
Humphreys, D. T., Westman, B. J., Martin, D. I., and Preiss, T. (2005). MicroRNAs control translation initiation by inhibiting eukaryotic initiation factor 4E/cap and poly(A) tail function. Proc Natl Acad Sci U S A 102 , 16961-16966.
Hutvagner, G., and Simard, M. J. (2008). Argonaute proteins: key players in RNA silencing. Nat Rev Mol Cell Biol 9 , 22-32.
Hutvagner, G., and Zamore, P. D. (2002). A microRNA in a multiple-turnover RNAi enzyme complex. Science 297 , 2056-2060.
Jackson, A. L., Bartz, S. R., Schelter, J., Kobayashi, S. V., Burchard, J., Mao, M., Li, B.,
Cavet, G., and Linsley, P. S. (2003). Expression profiling reveals off-target gene regulation by RNAi. Nat Biotechnol 21 , 635-637.
Jackson, A. L., Burchard, J., Leake, D., Reynolds, A., Schelter, J., Guo, J., Johnson, J.
M., Lim, L., Karpilow, J., Nichols, K.
, et al.
(2006a). Position-specific chemical modification of siRNAs reduces "off-target" transcript silencing. RNA 12 , 1197-1205.
Jackson, A. L., Burchard, J., Schelter, J., Chau, B. N., Cleary, M., Lim, L., and Linsley,
P. S. (2006b). Widespread siRNA "off-target" transcript silencing mediated by seed region sequence complementarity. RNA 12 , 1179-1187.
120

Chapter 5: References
Jackson, A. L., and Linsley, P. S. (2004). Noise amidst the silence: off-target effects of siRNAs? Trends Genet 20 , 521-524.
Jakymiw, A., Lian, S., Eystathioy, T., Li, S., Satoh, M., Hamel, J. C., Fritzler, M. J., and
Chan, E. K. (2005). Disruption of GW bodies impairs mammalian RNA interference. Nat
Cell Biol 7 , 1267-1274.
Jing, Q., Huang, S., Guth, S., Zarubin, T., Motoyama, A., Chen, J., Di Padova, F., Lin, S.
C., Gram, H., and Han, J. (2005). Involvement of microRNA in AU-rich elementmediated mRNA instability. Cell 120 , 623-634.
Johnston, R. J., and Hobert, O. (2003). A microRNA controlling left/right neuronal asymmetry in Caenorhabditis elegans. Nature 426 , 845-849.
Johnston, R. J., Jr., Chang, S., Etchberger, J. F., Ortiz, C. O., and Hobert, O. (2005).
MicroRNAs acting in a double-negative feedback loop to control a neuronal cell fate decision. Proc Natl Acad Sci U S A 102 , 12449-12454.
Kasschau, K. D., Xie, Z., Allen, E., Llave, C., Chapman, E. J., Krizan, K. A., and
Carrington, J. C. (2003). P1/HC-Pro, a viral suppressor of RNA silencing, interferes with
Arabidopsis development and miRNA unction. Dev Cell 4 , 205-217.
Kawamura, Y., Saito, K., Kin, T., Ono, Y., Asai, K., Sunohara, T., Okada, T. N., Siomi,
M. C., and Siomi, H. (2008). Drosophila endogenous small RNAs bind to Argonaute 2 in somatic cells. Nature.
Khvorova, A., Reynolds, A., and Jayasena, S. D. (2003). Functional siRNAs and miRNAs exhibit strand bias. Cell 115 , 209-216.
Kim, V. N. (2005). MicroRNA biogenesis: coordinated cropping and dicing. Nat Rev Mol
Cell Biol 6 , 376-385.
Kim, V. N. (2008). Sorting out small RNAs. Cell 133 , 25-26.
Kiriakidou, M., Tan, G. S., Lamprinaki, S., De Planell-Saguer, M., Nelson, P. T., and
Mourelatos, Z. (2007). An mRNA m7G cap binding-like motif within human Ago2 represses translation. Cell 129 , 1141-1151.
Kirino, Y., and Mourelatos, Z. (2007a). Mouse Piwi-interacting RNAs are 2'-O-methylated at their 3' termini. Nat Struct Mol Biol 14 , 347-348.
Kirino, Y., and Mourelatos, Z. (2007b). The mouse homolog of HEN1 is a potential methylase for Piwi-interacting RNAs. RNA 13 , 1397-1401.
Kleinman, M. E., Yamada, K., Takeda, A., Chandrasekaran, V., Nozaki, M., Baffi, J. Z.,
Albuquerque, R. J., Yamasaki, S., Itaya, M., Pan, Y.
, et al.
(2008). Sequence- and target-independent angiogenesis suppression by siRNA via TLR3. Nature 452 , 591-597.
Kloosterman, W. P., Wienholds, E., Ketting, R. F., and Plasterk, R. H. (2004). Substrate requirements for let-7 function in the developing zebrafish embryo. Nucleic Acids Res
32 , 6284-6291.
121

Chapter 5: References
Landgraf, P., Rusu, M., Sheridan, R., Sewer, A., Iovino, N., Aravin, A., Pfeffer, S., Rice,
A., Kamphorst, A. O., Landthaler, M.
, et al.
(2007). A mammalian microRNA expression atlas based on small RNA library sequencing. Cell 129 , 1401-1414.
Landthaler, M., Yalcin, A., and Tuschl, T. (2004). The human DiGeorge syndrome critical region gene 8 and Its D. melanogaster homolog are required for miRNA biogenesis. Curr
Biol 14 , 2162-2167.
Lee, R. C., Feinbaum, R. L., and Ambros, V. (1993). The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 75 , 843-854.
Lee, Y., Ahn, C., Han, J., Choi, H., Kim, J., Yim, J., Lee, J., Provost, P., Radmark, O.,
Kim, S., and Kim, V. N. (2003). The nuclear RNase III Drosha initiates microRNA processing. Nature 425 , 415-419.
Leung, A. K., Calabrese, J. M., and Sharp, P. A. (2006). Quantitative analysis of
Argonaute protein reveals microRNA-dependent localization to stress granules. Proc
Natl Acad Sci U S A 103 , 18125-18130.
Leuschner, P. J., Ameres, S. L., Kueng, S., and Martinez, J. (2006). Cleavage of the siRNA passenger strand during RISC assembly in human cells. EMBO Rep 7 , 314-320.
Lewis, B. P., Burge, C. B., and Bartel, D. P. (2005). Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets.
Cell 120 , 15-20.
Li, X., and Carthew, R. W. (2005). A microRNA mediates EGF receptor signaling and promotes photoreceptor differentiation in the Drosophila eye. Cell 123 , 1267-1277.
Lim, L. P., Lau, N. C., Garrett-Engele, P., Grimson, A., Schelter, J. M., Castle, J., Bartel,
D. P., Linsley, P. S., and Johnson, J. M. (2005). Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs. Nature 433 , 769-773.
Lin, H., and Spradling, A. C. (1997). A novel group of pumilio mutations affects the asymmetric division of germline stem cells in the Drosophila ovary. Development 124 ,
2463-2476.
Lin, X., Ruan, X., Anderson, M. G., McDowell, J. A., Kroeger, P. E., Fesik, S. W., and
Shen, Y. (2005). siRNA-mediated off-target gene silencing triggered by a 7 nt complementation. Nucleic Acids Res 33 , 4527-4535.
Lingel, A., Simon, B., Izaurralde, E., and Sattler, M. (2003). Structure and nucleic-acid binding of the Drosophila Argonaute 2 PAZ domain. Nature 426 , 465-469.
Lingel, A., Simon, B., Izaurralde, E., and Sattler, M. (2004). Nucleic acid 3'-end recognition by the Argonaute2 PAZ domain. Nat Struct Mol Biol 11 , 576-577.
Liu, J., Carmell, M. A., Rivas, F. V., Marsden, C. G., Thomson, J. M., Song, J. J.,
Hammond, S. M., Joshua-Tor, L., and Hannon, G. J. (2004). Argonaute2 is the catalytic engine of mammalian RNAi. Science 305 , 1437-1441.
122

Chapter 5: References
Liu, J., Rivas, F. V., Wohlschlegel, J., Yates, J. R., 3rd, Parker, R., and Hannon, G. J.
(2005a). A role for the P-body component GW182 in microRNA function. Nat Cell Biol 7 ,
1261-1266.
Liu, J., Valencia-Sanchez, M. A., Hannon, G. J., and Parker, R. (2005b). MicroRNAdependent localization of targeted mRNAs to mammalian P-bodies. Nat Cell Biol 7 , 719-
723.
Long, D., Lee, R., Williams, P., Chan, C. Y., Ambros, V., and Ding, Y. (2007). Potent effect of target structure on microRNA function. Nat Struct Mol Biol 14 , 287-294.
Lund, E., Guttinger, S., Calado, A., Dahlberg, J. E., and Kutay, U. (2004). Nuclear export of microRNA precursors. Science 303 , 95-98.
Luo, K. Q., and Chang, D. C. (2004). The gene-silencing efficiency of siRNA is strongly dependent on the local structure of mRNA at the targeted region. Biochem Biophys Res
Commun 318 , 303-310.
Ma, J. B., Ye, K., and Patel, D. J. (2004). Structural basis for overhang-specific small interfering RNA recognition by the PAZ domain. Nature 429 , 318-322.
Maroney, P. A., Yu, Y., Fisher, J., and Nilsen, T. W. (2006). Evidence that microRNAs are associated with translating messenger RNAs in human cells. Nat Struct Mol Biol 13 ,
1102-1107.
Martinez, J., Patkaniowska, A., Urlaub, H., Luhrmann, R., and Tuschl, T. (2002). Singlestranded antisense siRNAs guide target RNA cleavage in RNAi. Cell 110 , 563-574.
Martinez, J. a. T., T. (2004). RISC is a 5'phosphomonester-producing RNA endonuclease. Genes Dev 18 , 975-980.
Mathonnet, G., Fabian, M. R., Svitkin, Y. V., Parsyan, A., Huck, L., Murata, T., Biffo, S.,
Merrick, W. C., Darzynkiewicz, E., Pillai, R. S.
, et al.
(2007). MicroRNA inhibition of translation initiation in vitro by targeting the cap-binding complex eIF4F. Science 317 ,
1764-1767.
Matranga, C., Tomari, Y., Shin, C., Bartel, D. P., and Zamore, P. D. (2005). Passengerstrand cleavage facilitates assembly of siRNA into Ago2-containing RNAi enzyme complexes. Cell 123 , 607-620.
Matranga, C., and Zamore, P. D. (2007). Small silencing RNAs. Curr Biol 17 , R789-793.
Meister, G., Landthaler, M., Patkaniowska, A., Dorsett, Y., Teng, G., and Tuschl, T.
(2004). Human Argonaute2 mediates RNA cleavage targeted by miRNAs and siRNAs.
Mol Cell 15 , 185-197.
Meister, G., Landthaler, M., Peters, L., Chen, P. Y., Urlaub, H., Luhrmann, R., and
Tuschl, T. (2005). Identification of novel argonaute-associated proteins. Curr Biol 15 ,
2149-2155.
123

Chapter 5: References
Mi, S., Cai, T., Hu, Y., Chen, Y., Hodges, E., Ni, F., Wu, L., Li, S., Zhou, H., Long, C.
, et al.
(2008). Sorting of small RNAs into Arabidopsis argonaute complexes is directed by the 5' terminal nucleotide. Cell 133 , 116-127.
Mishima, Y., Giraldez, A. J., Takeda, Y., Fujiwara, T., Sakamoto, H., Schier, A. F., and
Inoue, K. (2006). Differential regulation of germline mRNAs in soma and germ cells by zebrafish miR-430. Curr Biol 16 , 2135-2142.
Miyoshi, K., Tsukumo, H., Nagami, T., Siomi, H., and Siomi, M. C. (2005). Slicer function of Drosophila Argonautes and its involvement in RISC formation. Genes Dev 19 , 2837-
2848.
Molnar, A., Schwach, F., Studholme, D. J., Thuenemann, E. C., and Baulcombe, D. C.
(2007). miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii. Nature 447 , 1126-1129.
Montgomery, T. A., Howell, M. D., Cuperus, J. T., Li, D., Hansen, J. E., Alexander, A. L.,
Chapman, E. J., Fahlgren, N., Allen, E., and Carrington, J. C. (2008). Specificity of
ARGONAUTE7-miR390 interaction and dual functionality in TAS3 trans-acting siRNA formation. Cell 133 , 128-141.
Mourelatos, Z., Dostie, J., Paushkin, S., Sharma, A., Charroux, B., Abel, L., Rappsilber,
J., Mann, M., and Dreyfuss, G. (2002). miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs. Genes Dev 16 , 720-728.
Napoli, C., Lemieux, C., and Jorgensen, R. (1990). Introduction of a Chimeric Chalcone
Synthase Gene into Petunia Results in Reversible Co-Suppression of Homologous
Genes in trans. Plant Cell 2 , 279-289.
Nielsen, C. B., Shomron, N., Sandberg, R., Hornstein, E., Kitzman, J., and Burge, C. B.
(2007). Determinants of targeting by endogenous and exogenous microRNAs and siRNAs. RNA 13 , 1894-1910.
Nottrott, S., Simard, M. J., and Richter, J. D. (2006). Human let-7a miRNA blocks protein production on actively translating polyribosomes. Nat Struct Mol Biol 13 , 1108-1114.
Nykanen, A., Haley, B., and Zamore, P. D. (2001). ATP requirements and small interfering RNA structure in the RNA interference pathway. Cell 107 , 309-321.
O'Donnell, K. A., and Boeke, J. D. (2007). Mighty Piwis defend the germline against genome intruders. Cell 129 , 37-44.
Ohara, T., Sakaguchi, Y., Suzuki, T., Ueda, H., and Miyauchi, K. (2007). The 3' termini of mouse Piwi-interacting RNAs are 2'-O-methylated. Nat Struct Mol Biol 14 , 349-350.
Okamura, K., Chung, W. J., Ruby, J. G., Guo, H., Bartel, D. P., and Lai, E. C. (2008).
The Drosophila hairpin RNA pathway generates endogenous short interfering RNAs.
Nature.
Okamura, K., Hagen, J. W., Duan, H., Tyler, D. M., and Lai, E. C. (2007). The mirtron pathway generates microRNA-class regulatory RNAs in Drosophila. Cell 130 , 89-100.
124

Chapter 5: References
Okamura, K., Ishizuka, A., Siomi, H., and Siomi, M. C. (2004). Distinct roles for
Argonaute proteins in small RNA-directed RNA cleavage pathways. Genes Dev 18 ,
1655-1666.
Olsen, P. H., and Ambros, V. (1999). The lin-4 regulatory RNA controls developmental timing in Caenorhabditis elegans by blocking LIN-14 protein synthesis after the initiation of translation. Dev Biol 216 , 671-680.
Orban, T. I., and Izaurralde, E. (2005). Decay of mRNAs targeted by RISC requires
XRN1, the Ski complex, and the exosome. RNA 11 , 459-469.
Osada, H., and Takahashi, T. (2007). MicroRNAs in biological processes and carcinogenesis. Carcinogenesis 28 , 2-12.
Overhoff, M., Alken, M., Far, R. K., Lemaitre, M., Lebleu, B., Sczakiel, G., and Robbins,
I. (2005). Local RNA target structure influences siRNA efficacy: a systematic global analysis. J Mol Biol 348 , 871-881.
Parker, J. S., Roe, S. M., and Barford, D. (2004). Crystal structure of a PIWI protein suggests mechanisms for siRNA recognition and slicer activity. Embo J 23 , 4727-4737.
Parker, J. S., Roe, S. M., and Barford, D. (2005). Structural insights into mRNA recognition from a PIWI domain-siRNA guide complex. Nature 434 , 663-666.
Parker, R., and Sheth, U. (2007). P bodies and the control of mRNA translation and degradation. Mol Cell 25 , 635-646.
Persengiev, S. P., Zhu, X., and Green, M. R. (2004). Nonspecific, concentrationdependent stimulation and repression of mammalian gene expression by small interfering RNAs (siRNAs). RNA 10 , 12-18.
Petersen, C. P., Bordeleau, M. E., Pelletier, J., and Sharp, P. A. (2006). Short RNAs repress translation after initiation in mammalian cells. Mol Cell 21 , 533-542.
Pham, J. W., Pellino, J. L., Lee, Y. S., Carthew, R. W., and Sontheimer, E. J. (2004). A
Dicer-2-dependent 80s complex cleaves targeted mRNAs during RNAi in Drosophila.
Cell 117 , 83-94.
Pillai, R. S., Artus, C. G., and Filipowicz, W. (2004). Tethering of human Ago proteins to mRNA mimics the miRNA-mediated repression of protein synthesis. RNA 10 , 1518-
1525.
Pillai, R. S., Bhattacharyya, S. N., Artus, C. G., Zoller, T., Cougot, N., Basyuk, E.,
Bertrand, E., and Filipowicz, W. (2005). Inhibition of translational initiation by Let-7
MicroRNA in human cells. Science 309 , 1573-1576.
Rana, T. M. (2007). Illuminating the silence: understanding the structure and function of small RNAs. Nat Rev Mol Cell Biol 8 , 23-36.
Rand, T. A., Petersen, S., Du, F., and Wang, X. (2005). Argonaute2 cleaves the antiguide strand of siRNA during RISC activation. Cell 123 , 621-629.
125

Chapter 5: References
Rashid, U. J., Paterok, D., Koglin, A., Gohlke, H., Piehler, J., and Chen, J. C. (2007).
Structure of Aquifex aeolicus argonaute highlights conformational flexibility of the PAZ domain as a potential regulator of RNA-induced silencing complex function. J Biol Chem
282 , 13824-13832.
Rehwinkel, J., Natalin, P., Stark, A., Brennecke, J., Cohen, S. M., and Izaurralde, E.
(2006). Genome-wide analysis of mRNAs regulated by Drosha and Argonaute proteins in Drosophila melanogaster. Mol Cell Biol 26 , 2965-2975.
Reinhart, B. J., Slack, F. J., Basson, M., Pasquinelli, A. E., Bettinger, J. C., Rougvie, A.
E., Horvitz, H. R., and Ruvkun, G. (2000). The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. Nature 403 , 901-906.
Reynolds, A., Leake, D., Boese, Q., Scaringe, S., Marshall, W. S., and Khvorova, A.
(2004). Rational siRNA design for RNA interference. Nat Biotechnol 22 , 326-330.
Rivas, F. V., Tolia, N. H., Song, J. J., Aragon, J. P., Liu, J., Hannon, G. J., and Joshua-
Tor, L. (2005). Purified Argonaute2 and an siRNA form recombinant human RISC. Nat
Struct Mol Biol 12 , 340-349.
Rossi, J. J. (2005). Mammalian Dicer finds a partner. EMBO Rep 6 , 927-929.
Ruby, J. G., Jan, C. H., and Bartel, D. P. (2007). Intronic microRNA precursors that bypass Drosha processing. Nature 448 , 83-86.
Russell, D. W., and Spremulli, L. L. (1978). Identification of a wheat germ ribosome dissociation factor distinct from initiation factor eIF-3. J Biol Chem 253 , 6647-6649.
Saito, K., Sakaguchi, Y., Suzuki, T., Siomi, H., and Siomi, M. C. (2007). Pimet, the
Drosophila homolog of HEN1, mediates 2'-O-methylation of Piwi- interacting RNAs at their 3' ends. Genes Dev 21 , 1603-1608.
Sanvito, F., Piatti, S., Villa, A., Bossi, M., Lucchini, G., Marchisio, P. C., and Biffo, S.
(1999). The beta4 integrin interactor p27(BBP/eIF6) is an essential nuclear matrix protein involved in 60S ribosomal subunit assembly. J Cell Biol 144 , 823-837.
Saxena, S., Jonsson, Z. O., and Dutta, A. (2003). Small RNAs with imperfect match to endogenous mRNA repress translation. Implications for off-target activity of small inhibitory RNA in mammalian cells. J Biol Chem 278 , 44312-44319.
Scacheri, P. C., Rozenblatt-Rosen, O., Caplen, N. J., Wolfsberg, T. G., Umayam, L.,
Lee, J. C., Hughes, C. M., Shanmugam, K. S., Bhattacharjee, A., Meyerson, M., and
Collins, F. S. (2004). Short interfering RNAs can induce unexpected and divergent changes in the levels of untargeted proteins in mammalian cells. Proc Natl Acad Sci U S
A 101 , 1892-1897.
Schmitter, D., Filkowski, J., Sewer, A., Pillai, R. S., Oakeley, E. J., Zavolan, M.,
Svoboda, P., and Filipowicz, W. (2006). Effects of Dicer and Argonaute down-regulation on mRNA levels in human HEK293 cells. Nucleic Acids Res 34 , 4801-4815.
126

Chapter 5: References
Schubert, S., Grunweller, A., Erdmann, V. A., and Kurreck, J. (2005). Local RNA target structure influences siRNA efficacy: systematic analysis of intentionally designed binding regions. J Mol Biol 348 , 883-893.
Schwarz, D. S., Ding, H., Kennington, L., Moore, J. T., Schelter, J., Burchard, J., Linsley,
P. S., Aronin, N., Xu, Z., and Zamore, P. D. (2006). Designing siRNA That Distinguish between Genes That Differ by a Single Nucleotide. PLoS Genet 2 , e140.
Schwarz, D. S., Hutvagner, G., Du, T., Xu, Z., Aronin, N., and Zamore, P. D. (2003).
Asymmetry in the assembly of the RNAi enzyme complex. Cell 115 , 199-208.
Seggerson, K., Tang, L., and Moss, E. G. (2002). Two genetic circuits repress the
Caenorhabditis elegans heterochronic gene lin-28 after translation initiation. Dev Biol
243 , 215-225.
Semizarov, D., Frost, L., Sarthy, A., Kroeger, P., Halbert, D. N., and Fesik, S. W. (2003).
Specificity of short interfering RNA determined through gene expression signatures.
Proc Natl Acad Sci U S A 100 , 6347-6352.
Sen, G. L., and Blau, H. M. (2005). Argonaute 2/RISC resides in sites of mammalian mRNA decay known as cytoplasmic bodies. Nat Cell Biol 7 , 633-636.
Si, K., and Maitra, U. (1999). The Saccharomyces cerevisiae homologue of mammalian translation initiation factor 6 does not function as a translation initiation factor. Mol Cell
Biol 19 , 1416-1426.
Song, J. J., Liu, J., Tolia, N. H., Schneiderman, J., Smith, S. K., Martienssen, R. A.,
Hannon, G. J., and Joshua-Tor, L. (2003). The crystal structure of the Argonaute2 PAZ domain reveals an RNA binding motif in RNAi effector complexes. Nat Struct Biol 10 ,
1026-1032.
Song, J. J., Smith, S. K., Hannon, G. J., and Joshua-Tor, L. (2004). Crystal structure of
Argonaute and its implications for RISC slicer activity. Science 305 , 1434-1437.
Souret, F. F., Kastenmayer, J. P., and Green, P. J. (2004). AtXRN4 degrades mRNA in
Arabidopsis and its substrates include selected miRNA targets. Mol Cell 15 , 173-183.
Stark, A., Brennecke, J., Bushati, N., Russell, R. B., and Cohen, S. M. (2005). Animal
MicroRNAs confer robustness to gene expression and have a significant impact on
3'UTR evolution. Cell 123 , 1133-1146.
Steiner, F. A., Hoogstrate, S. W., Okihara, K. L., Thijssen, K. L., Ketting, R. F., Plasterk,
R. H., and Sijen, T. (2007). Structural features of small RNA precursors determine
Argonaute loading in Caenorhabditis elegans. Nat Struct Mol Biol 14 , 927-933.
Tam, O. H., Aravin, A. A., Stein, P., Girard, A., Murchison, E. P., Cheloufi, S., Hodges,
E., Anger, M., Sachidanandam, R., Schultz, R. M., and Hannon, G. J. (2008).
Pseudogene-derived small interfering RNAs regulate gene expression in mouse oocytes. Nature.
127

Chapter 5: References
Tanzer, A., and Stadler, P. F. (2004). Molecular evolution of a microRNA cluster. J Mol
Biol 339 , 327-335.
Taxman, D. J., Livingstone, L. R., Zhang, J., Conti, B. J., Iocca, H. A., Williams, K. L.,
Lich, J. D., Ting, J. P., and Reed, W. (2006). Criteria for effective design, construction, and gene knockdown by shRNA vectors. BMC Biotechnol 6 , 7.
Thermann, R., and Hentze, M. W. (2007). Drosophila miR2 induces pseudo-polysomes and inhibits translation initiation. Nature 447 , 875-878.
Tomari, Y., Du, T., and Zamore, P. D. (2007). Sorting of Drosophila small silencing
RNAs. Cell 130 , 299-308.
Tomari, Y., and Zamore, P. D. (2005). Perspective: machines for RNAi. Genes Dev 19 ,
517-529.
Vinther, J., Hedegaard, M. M., Gardner, P. P., Andersen, J. S., and Arctander, P. (2006).
Identification of miRNA targets with stable isotope labeling by amino acids in cell culture.
Nucleic Acids Res 34 , e107.
Voinnet, O., and Baulcombe, D. C. (1997). Systemic signalling in gene silencing. Nature
389 , 553.
Wakiyama, M., Kaitsu, Y., and Yokoyama, S. (2006). Cell-free translation system from
Drosophila S2 cells that recapitulates RNAi. Biochem Biophys Res Commun 343 , 1067-
1071.
Wakiyama, M., Takimoto, K., Ohara, O., and Yokoyama, S. (2007). Let-7 microRNAmediated mRNA deadenylation and translational repression in a mammalian cell-free system. Genes Dev 21 , 1857-1862.
Wang, B., Love, T. M., Call, M. E., Doench, J. G., and Novina, C. D. (2006).
Recapitulation of short RNA-directed translational gene silencing in vitro. Mol Cell 22 ,
553-560.
Watanabe, T., Totoki, Y., Toyoda, A., Kaneda, M., Kuramochi-Miyagawa, S., Obata, Y.,
Chiba, H., Kohara, Y., Kono, T., Nakano, T.
, et al.
(2008). Endogenous siRNAs from naturally formed dsRNAs regulate transcripts in mouse oocytes. Nature.
Wightman, B., Ha, I., and Ruvkun, G. (1993). Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans.
Cell 75 , 855-862.
Wu, L., and Belasco, J. G. (2005). Micro-RNA regulation of the mammalian lin-28 gene during neuronal differentiation of embryonal carcinoma cells. Mol Cell Biol 25 , 9198-
9208.
Wu, L., Fan, J., and Belasco, J. G. (2006). MicroRNAs direct rapid deadenylation of mRNA. Proc Natl Acad Sci U S A 103 , 4034-4039.
128

Chapter 5: References
Yan, K. S., Yan, S., Farooq, A., Han, A., Zeng, L., and Zhou, M. M. (2003). Structure and conserved RNA binding of the PAZ domain. Nature 426 , 468-474.
Yekta, S., Shih, I. H., and Bartel, D. P. (2004). MicroRNA-directed cleavage of HOXB8 mRNA. Science 304 , 594-596.
Yi, R., Qin, Y., Macara, I. G., and Cullen, B. R. (2003). Exportin-5 mediates the nuclear export of pre-microRNAs and short hairpin RNAs. Genes Dev 17 , 3011-3016.
Yuan, Y. R., Pei, Y., Ma, J. B., Kuryavyi, V., Zhadina, M., Meister, G., Chen, H. Y.,
Dauter, Z., Tuschl, T., and Patel, D. J. (2005). Crystal structure of A. aeolicus argonaute, a site-specific DNA-guided endoribonuclease, provides insights into RISC-mediated mRNA cleavage. Mol Cell 19 , 405-419.
Zamore, P. D., Tuschl, T., Sharp, P. A., and Bartel, D. P. (2000). RNAi: double-stranded
RNA directs the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervals. Cell
101 , 25-33.
Zeng, Y., Yi, R., and Cullen, B. R. (2003). MicroRNAs and small interfering RNAs can inhibit mRNA expression by similar mechanisms. Proc Natl Acad Sci U S A 100 , 9779-
9784.
Zhao, T., Li, G., Mi, S., Li, S., Hannon, G. J., Wang, X. J., and Qi, Y. (2007). A complex system of small RNAs in the unicellular green alga Chlamydomonas reinhardtii. Genes
Dev 21 , 1190-1203.
Zhao, Y., and Srivastava, D. (2007). A developmental view of microRNA function.
Trends Biochem Sci 32 , 189-197.
129

Chapter 6: Biographical note
130

Chapter 6: Biographical note
Department of Biology
Massachusetts Institute of Technology
6 Chatham Street, Apartment #1
Cambridge, MA 02139
401-952-9519 laleman@mit.edu
EDUCATION
09/2001-06/2008 Massachusetts Institute of Technology, Cambridge, MA.
Ph.D. in Biology
09/1995-05/1999 Brown University, Providence, RI.
B.S. in Biology with Honors
RESEARCH EXPERIENCE
06/2002-present Doctoral Research : Department of Biology, Massachusetts Institute of Technology,
Cambridge, MA.
•
Research Advisors: Phillip Sharp, Ph.D. and Frank Solomon, Ph.D.
• Projects: “Comparison of siRNA-induced off-target RNA and protein effects”.
08/1999-08/2001 Research Technician : Department of Molecular Medicine, Children’s Hospital/Harvard
Medical School, Boston, MA & University of Connecticut Health Center, Farmington, CT.
•
Research Advisor: Bruce Mayer, Ph.D.
•
Project: “The biological relevance of interactions between the adaptor protein Nck and two of its related proteins: the non-receptor tyrosine kinase Abl and the adaptor protein Cbl”.
•
Managed and assisted in the overall operation of the lab, provided support for assigned projects and higher-level research staff.
06/1998-05/1999 Undergraduate Honors Research : Department of Molecular, Cell Biology &
Biochemistry, Brown University, Providence, RI.
• Research Advisor: Susan Gerbi, Ph.D.
•
Project: “The effects of mimosine and radiation on DNA replication in the polytene chromosomes of Sciara coprophila ”.
06/1997-08/1997 Research Assistant : Department of Hematology/Oncology, University of Miami, Miami,
FL.
•
Research Advisor: Neil Spector, M.D.
•
Project: “Cell growth effects of peripheral-acting benzodiazepines on human breast cancer cells”.
06/1994-08/1994 Research Assistant : Environmental Protection Agency, Atlanta, GA.
Sponsored by NASA and Quality Education for Minorities, SHARP PLUS Program
•
Project: “Sediments in the Aquatic Environment With Emphasis on Arsenic and Heavy
Metals in Lake Lanier”.
TEACHING EXPERIENCE
02/2005-05/2005 Teaching Assistant : Graduate Cell Biology, Massachusetts Institute of Technology,
Cambridge , MA.
• Graduate lecture course with complementary paper discussion sessions for both biology and non-biology graduate students. Approximately 40 students.
• Sole teaching assistant for the course. Led twice-weekly recitations/discussion sessions based on course material and research papers. Led exam review sessions.
Wrote exam questions and created answer keys for six problem sets. Graded exams,
131

Chapter 6: Biographical note and developed an online resource for accessing information about molecular and cell biology techniques pertinent to the course.
09/2002-12/2002 Teaching Assistant : Undergraduate Genetics, Massachusetts Institute of Technology,
Cambridge , MA.
• Introductory genetics course. Approximately 220 students.
•
Led twice-weekly recitations sessions. Led exam review sessions for the whole class and for the students in my two recitation groups. Held bi-weekly office hours. Wrote answer key for problem sets and exam questions. Graded seven problem sets and exam questions.
06/1999-07/1999 Teaching Assistant : Techniques in Biotechnology, FOCUS Program, Brown University,
Providence, RI.
• Intensive three-week laboratory course for pre-college program. 12 students.
•
Sole teaching assistant for the course. Assisted students with experiments and questions. Responsible for helping students develop an independent research project and an oral presentation on relevant topics, which students presented at the end of the course. Graded students’ oral presentations.
01/1998-05/1999 Teaching Assistant : The Foundations of Living Systems, Brown University, Providence,
RI.
•
Introductory biology course with approximately 550 students.
•
Led bi-weekly laboratory sessions, led exam review sessions for the whole class and for my recitation group. Held bi-weekly office hours. Graded problem sets and exam questions.
•
Served as a teaching assistant for two consecutive academic years.
INFORMAL TEACHING EXPERIENCE
02/2007 Invited Speaker : “Becoming a Biologist”, Urban Science Academy High School, West
02/2007
Roxbury Educational Complex, West Roxbury, MA.
• Oral presentation for approximately 300 students on my doctoral research project and how to pursue a career in the biological sciences.
Instructor : Anatomy and development of Zebrafish, Planeria and C. elegans Workshop,
Massachusetts Institute of Technology, Cambridge, MA.
• Led one of the workshops for the Biology Department’s High School Outreach
Program.
08/2006 MIT Cancer Center Tour Guide : “Discover Biology”, Freshman Pre-Orientation Program,
Massachusetts Institute of Technology, Cambridge , MA.
05/2004
01/2004
Participant : MIT’s Mobile Lab for High Schools, Massachusetts Institute of Technology,
Cambridge , MA.
•
Meeting between graduate students and high school teachers in the Boston area to discuss ways to increase teaching opportunities and interactions between high school biology classes and MIT Biology Department’s graduate students.
Volunteer : “Conversations with a scientist”, AP Biology Program, Belmont High School,
Belmont, MA.
•
Interviewed by high school students about my doctoral research, with emphasis on current biology techniques used in my research. Students asked questions and presented the information learned from our communications in their AP Biology course.
Grader : USA Biology Olympiad, Semifinal Exam, Harvard Medical School, Boston, MA. 03/2003
03/2003 Science Fair Judge : Graham and Parks Elementary Public School, Cambridge, MA.
132

Chapter 6: Biographical note
ADVISING & MENTORING EXPERIENCE
02/2007-present Co-founder of the Resources for Easing Friction and Stress (BioREFS) Mediation
Program : Department of Biology, Massachusetts Institute of Technology, Cambridge, MA.
•
Organized a department-wide mediation program designed to support and encourage graduate students during times of stress. Developed a program proposal, procured departmental funding and support, and recruited graduate student mediators.
09/2007-10/2007 Mediation Skills Workshop Training : Massachusetts Institute of Technology,
Cambridge, MA.
10/2006
•
A 32-hour formal training program in mediation skills and in methods of structured conflict resolution.
MIT Biology Department Representative : Society for Advancement of Chicanos and
Native Americans in Science (SACNAS) National Conference, Tampa, FL.
10/2006 MIT Biology Department Representative : minority recruiting visit to University of Miami and Florida International University, Miami, FL.
10/2005 Volunteer : MIT Converge Graduate Preview Weekend for minority students, Cambridge,
MA.
•
Hosted a prospective student and participated in Converge Preview Weekend social activities.
03/2005 Invited Panel Participant : “A Gathering of Science Scholars”, Minority National
Conference, State University of New York (SUNY) at Stonybrook, Stonybrook, NY.
•
Advised minority students on the graduate school application process.
08/2004 Volunteer : MIT Biology Summer Research Program (MSRP), Cambridge, MA.
•
Attended program social activities and discussed research opportunities with underrepresented minority college students.
11/2003 Invited Panel Participant : “Women Alumni in Science”, Women in Science and
Engineering (WiSE), Brown University, Providence RI.
10/2002 MIT Biology Department Representative : Society for Advancement of Chicanos and
Native Americans in Science (SACNAS) National Conference, Anaheim, CA.
COMMITTEE MEMBERSHIPS
01/2006-1/2008 Graduate Student Representative : Association of Biology Graduate Students (ABGS),
Department of Biology, Massachusetts Institute of Technology, Cambridge, MA.
•
Participated in the development and implementation of a survey tool for MIT Biology graduate students to provide feedback on the graduate school curriculum.
•
Organized meeting for minority graduate students to elicit input regarding minority recruitment and retention in the Biology Department at MIT.
03/2007, 03/2005 Graduate Student Representative : External Visiting Committee, Department of Biology,
Massachusetts Institute of Technology, Cambridge, MA.
01/2002 Co-organizer of a Prospective Graduate Student Visit : Department of Biology,
Massachusetts Institute of Technology, Cambridge, MA.
• Coordinated and organized activities for 40 prospective graduate students during a recruitment weekend.
AWARDS & HONORS
2007-present
2003-2007
National Science Foundation Graduate Research Fellowship
NIH National Research Service Award (NRSA) Pre-doctoral Fellowship
133

Chapter 6: Biographical note
2001-2002
1998
Leventhal Presidential Fellow (MIT)
Brown University Undergraduate Teaching and Research Assistantship Award
1997 American Cancer Society Summer Research Assistant Fellowship Award
MEETINGS & PRESENTATIONS
01/2007 Poster Presentation : “Comparison of siRNA-induced off-target RNA and protein effects”,
RNAi for Target Validation, Keystone Symposia Conference, Keystone, CO.
09/2005
07/1998
Oral Presentation : “Specificity of the mRNA:siRNA interaction in gene silencing”, Cold
Spring Harbor RNAi Meeting, Cold Spring Harbor, NY.
Poster Presentation : “DNA Replication in Sciara coprophila ”, Undergraduate Teaching and Research Assistantship Symposium, Brown University, Providence, RI.
PUBLICATIONS
Aleman, L. M ., Doench, J., Sharp, P.A. (2007). Comparison of siRNA-induced off-target RNA and protein effects. RNA 13 , 385-395.
Fujiwara, K., Poikonen K,. Aleman, L.
, Valtavaara, M., Saksela, K., Mayer, B.J., (2002). A Single-Chain
Atibody/Epitope System for Functional Analysis of Protein-Protein Interactions. Biochemistry 41 , 12729-
12738.
Miyoshi-Akiyama, T., Aleman, L.M.
, Smith, J.M., Adler, C.E., Mayer, B.J (2001). Regulation of Cbl
Phosphorylation by the Abl Tyrosine Kinase and the Nck SH2/SH3 Adaptor. Oncogene 20 , 4058-4069.
Adler, C.E., Miyoshi-Akiyama, T., Aleman, L.M.
, Tanaka, M., Smith, J.M. , and Mayer, B. J. (2000). Abl
Family Kinases and Cbl Cooperate with the Nck Adaptor to Modulate Xenopus Development. J. Biol. Chem.
275 , 36472-36478.
Xia, W., Spector, S., Hardy, L., Zhao, S., Saluk, A., Aleman, L., and Spector, N.L. (2000). Tumor Selective
G
2
/M Cell Cycle Arrest and Apoptosis of Epithelial and Hematological Malignancies by BBL22, a
Benzazepine. Proc. Natl. Acad. Sci. USA. 97 , 7494-7499.
134