MAPPING THE STRUCTURAL CHANGE CAUSED BY TETRACYCLINE BINDING TO THE YKKCD ANTIBIOTIC SENSOR RNA A THESIS SUBMITTED TO THE GRADUATE SCHOOL IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE MASTER OF SCIENCE BY LAURA A. HOWELL DR. TIMEA GERCZEI-­‐ADIVSOR BALL STATE UNIVERSITY MUNCIE, INDIANA JULY 2013 MAPPING THE STRUCTURAL CHANGE CAUSED BY TETRACYCLINE BINDING TO THE YKKCD ANTIBIOTIC SENSOR RNA A THESIS SUBMITTED TO THE GRADUATE SCHOOL IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE MASTER OF SCIENCE BY LAURA A. HOWELL Committee Approval: ________________________________________________ ___________________________ Committee Chairperson Date ________________________________________________ ___________________________ Committee Member Date ________________________________________________ ___________________________ Committee Member Date Departmental Approval: ________________________________________________ ___________________________ Departmental Chairperson Date ________________________________________________ ___________________________ Dean of Graduate School Date BALL STATE UNIVERSITY MUNCIE, IN JULY 2013 ii Acknowledgements I would first like to thank the Ball State Chemistry department for giving me this opportunity. Through my undergraduate and graduate time here at Ball State University, I have had the support of many teachers. It has been a wonderful learning experience both in the classroom and research lab. I would also like to thank my research advisor, Dr. Timea Gerczei. I have learned so much from you in the research lab and I am so glad I choose you as my advisor. I have learned many useful techniques that I will be able to take into the work force with me. Without your help I would have not have made it through the writing process. I would also like to thank my committee members, Dr. Scott Pattison and Dr. Anita Gnezda. Dr. Pattison, I would like to thank you for always giving me confidence and keeping me calm through this whole process. Dr. Gnezda, I would like to thank you for helping me prepare for my defense and making sure all my formatting is correct. I would also like to thank my entire previous and current lab members: Nicholas Frecker, Steve Trick, Alysa Frank, Delores James, and Krystal Roark. Without the previous knowledge gained by these people, my project would not have been successful. I would like to thank my parents, Tim and Sharon Smith, for raising me to who I am today. Dad, I would like to thank you for teaching me over the years what hard work looks like. You have instilled in me to know that nothing comes easy and to work hard for it. It is you who has taught me to that I can do anything I put my mind too! Mom, I would like to thank you for continually being my support system. iii You have always believed in me and taught me to strive for my goals and dreams. You have always been there for me through my undergraduate and graduate career continually telling me that I could do it! I would also like to thank my husband, Brandon. Without you I would have not made it through this process. You have been there for me when I needed to vent or cry when I was overwhelmed. You have kept me on track by continually asking, “Shouldn’t you be working on your thesis.” You have also supported me and believed in me and I cannot thank you enough. I am truly blessed with such a great support system of family and friends. I would also like to thank Rachel Pelly for being a great friend through these last two and a half years. I am so glad I had you to help me get through the writing process. Without you I would have not kept myself sane! I will for sure miss our Jimmy John lunch dates! iv ABSTRACT THESIS: Mapping the Structural Change Caused By Tetracycline Binding to the ykkCD Antibiotic Sensor RNA STUDENT: Laura Ashley Howell DEGREE: Master of Science COLLEGE: Sciences and Humanities DATE: July, 2013 PAGES: 122 Riboswitches are naturally occurring RNA aptamers that form a precise three-­‐dimensional structure and selectively bind to cellular target molecules. Binding of the target molecule initiates an allosteric structural change in the riboswitch that in turn regulates expression of a relevant target gene. Most riboswitches specifically recognize the metabolic product of the gene that is being regulated. Expression may be regulated at either transcription or translation stage of gene expression. Most riboswitches are off switches meaning they turn off expression of metabolite producing gene when metabolite concentration is high enough. The ykkCD putative riboswitch appears to increases production of an efflux pump that expels toxic drugs from the cell by binding to the antibiotic tetracycline. Based on previous data collected the ykkCD putative riboswitch seems to regulate the efflux pump at the transcriptional level. To confirm this hypothesis we want to map the structural change that takes place upon binding of the antibiotic tetracycline to the mRNA. Nucleic acid footprinting studies will be used to map the v binding site of tetracycline and the allosteric change that takes place upon tetracycline binding. vi Table of Contents Acknowledgements…………………………………………………………………………………………..iii Abstract……………………………………………………………………………………………………………...v Table of Contents……………………………………………………………………………………………..vii List of Figures………………………………………………………………………………………………….....x List of Tables…………………………………………………………………………………………………..xiii Chapter 1: Background……………………………………………………………………………………….1 1.1 History of antibiotics and resistance…………………………………………………….1 a.) Discovery of antibiotics……………………………………………………………..1 b.) Antibiotic resistance………………………………………………………………….2 1.2 Riboswitches……………………………………………………………………………………….6 1.3 Gene expression regulation………………………………………………………………..14 a.) Transcription………………………………………………………………………….14 b.) Translation……………………………………………………………………………..17 c.) Gene expression regulation at transcription versus translation...19 1.4 Tetracycline binding triggers expression of the ykkCD efflux pump……..22 1.5 Recognition of tetracycline and its derivatives by the ykkCD sensor……27 1.6 Mapping the tetracycline binding site and the structural change caused by tetracycline binding………………………………………………………………………33 a.) Techniques used to map structural changes……………………………..33 b.) Techniques used for fragmentation of the RNA…………………………34 c.) Techniques used for visualization of cleavage patterns……………..37 vii d.) Identifying the tetracycline binding site……………………………………38 e.) Identifying the structural change caused by tetracycline binding…………………………………………………………………………………...39 Chapter 2: Methods…………………………………………………………………………………………..43 2.1 ykkCD putative riboswitch constructs………………………………………………..43 2.2 Mapping the tetracycline binding site…………………………………………………44 a.) DNA template preparation……………………………………………………….44 b.) RNA preparation……………………………………………………………………..48 c.) RNA end labeling……………………………………………………………………..50 d.) RNase protection assay of the ykkCD aptamer………………………….52 2.3 Mapping the conformational change caused by tetracycline binding……57 a.) Cell growth……………………………………………………………………………...58 b.) Total mRNA isolation………………………………………………………………59 c.) Primer design for primer extension………………………………………….62 d.) RNase protection assay of the ykkCD expression platform………...63 2.4 Commonly used protocols and buffers………………………………………………..66 Chapter 3: Results…………………………………………………………………………………………….73 3.1 4300 LI-­‐COR Sequencer Optimization………………………………………………...73 3.2 Studying the change in ykkCD pump mRNA levels in response to tetracycline and it’s derivatives……………………………………………………………….79 a.) Primer design and annealing methods……………………………………..79 viii b.) Tetracycline, anhydrotetracycline, and oxytetracycline seem to upregulate the expression of the ykkCD efflux pump……………...…83 3.3 Mapping the structure of the tetracycline binding site via nuclease protection………………………………………….……………………………………………………87 a.) Optimization of sequencing ladders and nuclease protection protocol……………………………………………………………………………………….87 3.4 Mapping the structure of the tetracycline binding site via hydroxyl (OH) radical footprinting…………………………………………………………………………………93 a.) Optimization of hydroxyl radical protocol………………………………..93 3.5 Mapping the structure of the tetracycline binding site via self-­‐cleavage of the RNA………………………………………………………………………………………………….95 a.) Optimization of in-­‐line probing………………………………………………..95 b.) Optimization of terbium fragmentation……………………………………97 Chapter 4: Discussion………………………………………….……………………………………………99 4.1 Upregulation of expression of the ykkCD efflux pump by tetracycline, anhydrotetracycline, and oxytetracycline…………………………………………………99 4.2 Mapping the structure of the tetracycline binding site……………………...103 a.) Nuclease protection……………………………………………………………….103 b.) Hydroxyl radical………………………………………….………………………...104 c.) Self-­‐ cleavage of RNA………………………………………….…………………..105 References………………………………………….………………………………………….………………107 ix List of Figures Figure 1: Three common ways bacteria become resistant…………………………………….4 Figure 2: Four mechanisms to render the antibiotic useless…………………………………5 Figure 3: Secondary Structure of 12 riboswitches and the metabolite they recognize………………………………………………………….………………………………….7 Figure 4: Gene expression regulation………………………………………………………………..12 Figure 5: Secondary structures of guanine and adenine riboswitches…………………13 Figure 6: Central dogma……………………………………………………………………………………14 Figure 7: Transcription initiation……………………………………………………………………...15 Figure 8: Transcription elongation……………………………………………………………………16 Figure 9: Terminator stem………………………………………………………………………………..17 Figure 10: Shine Dalgarno sequence………………………………………………………………….18 Figure 11: Translation elongation……………………………………………………………………..19 Figure 12: Gene expression regulation via transcription……………………………………20 Figure 13: Gene expression regulation via translation……………………………………….21 Figure 14: Secondary structure prediction of the Bacillus subtilis ykkCD RNA…….22 Figure 15: Pump mRNA levels increase in the presence of tetracycline………………23 Figure 16: Structure of tetracycline and its derivatives………………………………………24 Figure 17: ykkCD pump mRNA levels quantified via qRT-­‐PCR……………………………26 Figure 18: Denaturing PAGE gel of long and short RNA transcripts…………………….27 Figure 19: “Lock” and “Key” analogy of sensor recognition………………………………..28 x Figure 20: Secondary structure of the aptamer domain with mutants used in binding assays….……………………………………………………………………………..33 Figure 21: Primer extension……………………………………………………………………………..38 Figure 22: Hypothetical cleavage patterns of nuclease protection………………………39 Figure 23: Hypothetical cleavage pattern by a ds-­‐specific nuclease…………………….40 Figure 24: Hypothetical cleavage pattern by a ss-­‐specific nuclease…………………….41 Figure 25: Large format analytical gel……………………………………………………………….74 Figure 26: 4300 LI-­‐COR sequencing 10% gel……………………………………………………..76 Figure 27: 4300 LI-­‐COR sequencing gel-­‐excess dye or UTP………………………………...77 Figure 28: LI-­‐COR Odyssey Scanner…………………………………………………………………..77 Figure 29: 4300 LI-­‐COR sequencing gel-­‐optimized times…………………………………...78 Figure 30: Primer extension optimization-­‐Odyssey Scanner………………………………80 Figure 31: Primer extension optimization-­‐ethidium bromide…………………………….81 Figure 32: Denaturing agarose gel-­‐mRNA quality………………………………………………82 Figure 33: Reverse transcriptase optimization…………………………………………………..83 Figure 34: Primer extension……………………………………………………………………………..85 Figure 35: Primer extension-­‐zoomed into site…………………………………………………..86 Figure 36: Bar graph-­‐RT band intensities………………………………………………………….87 Figure 37: Phosphatase and kinase treatment…………………………………………………..88 Figure 38: Optimization of nuclease protection…………………………………………………89 Figure 39: Optimization of ladders……………………………………………………………………90 Figure 40: 4300 LI-­‐COR sequencer-­‐nuclease protection…………………………………….91 xi Figure 41: 4300 LI-­‐COR sequencer-­‐10% gel matrix…………………………………………...92 Figure 42: Hydroxyl radical PAGE……………………………………………………………………..93 Figure 43: Hydroxyl radical 4300 LI-­‐COR sequencer………………………………………….94 Figure 44: Optimization of in-­‐line probing………………………………………………………...96 Figure 45: Optimization of in-­‐line probing-­‐4300 LI-­‐COR sequencer……………………97 Figure 46: Terbium Fragmentation…………………………………………………………………...98 xii List of Tables Table 1: 12 major classes of riboswitches………………………………………………………….11 Table 2: ykkCD putative riboswitch constructs………………………………………………….43 Table 3: Linearization reaction…………………………………………………………………………48 Table 4: 500 μL transcription reaction………………………………………………………………50 Table 5: Phosphatase treatment………………………………………………………………………..51 Table 6: Kinase treatment………………………………………………………………………………...51 Table 7: RNase protection master mix….……………………………………………………………53 Table 8: Nuclease dilutions………………………………………………………………………………..53 Table 9: OH ladder master mix………………………………………………………………………….54 Table 10: T1 ladder master mix………………………………………………………………………...54 Table 11: Optimization of RNase T1 amount……………………………………………………..55 Table 12: Terbium fragmentation master mix…………………………………………………...56 Table 13: Licor 4300 Analyzer gel matrix………………………………………………………….57 Table 14: Antibiotic SIC levels and volumes used………………………………………………58 Table 15: DNase treatment on 100 μL sample……………………………………………………61 Table 16: General primer information………………………………………………………………63 Table 17: RNase protection master mix…………………………………………………………….64 Table 18: Nuclease dilutions……………………………………………………………………………..64 Table 19: AMV Reverse Transcription Master Mix……………………………………………..65 Table 20: LB media recipe………………………………………………………………………………...66 xiii Table 21: 1000x AMP recipe……………………………………………………………………………..66 Table 22: TE buffer…………………………………………………………………………………………..66 Table 23: APS recipe………………………………………………………………………………………...67 Table 24: 5x TBE buffer……………………………………………………………………………………67 Table 25: Urea dye recipe…………………………………………………………………………………67 Table 26: Ethidium Bromide recipe…………………………………………………………………..67 Table 27: Y1 buffer…………………………………………………………………………………………..68 Table 28: FA running buffer……………………………………………………………………………..68 Table 29: FA gel loading buffer…………………………………………………………………………68 Table 30: Hydroxyl radical buffer……………………………………………………………………..69 Table 31: Analytical denaturing PAGE……………………………………………………………….70 Table 32: Solution A recipe……………………………………………………………………………….72 Table 33: Solution B recipe……………………………………………………………………………….72 Table 34: KD and SIC values of antibiotics………………………………………………………...103
xiv Chapter 1: Background 1.1 History of antibiotics and resistance a.) Discovery of antibiotics Penicillin is the world’s first known antibiotic and is still widely in use today. Ernest Duchesne, a French medical student, first observed penicillin in 1896. It was not until 1928 that penicillin was accidently re-­‐discovered by Alexander Fleming. Fleming was studying colonies of the bacteria Staphylococcus aureus when he noticed a blue-­‐green mold that had contaminated his plates. What interested him is that the colonies next to the mold were eliminated. He grew a pure sample of the mold and found that it produced a substance that could kill a number of disease-­‐
causing bacteria. In 1929, Fleming published his results stating that this re-­‐
discovery could be useful in therapeutic treatment if the substance could be produced in large quantities. In 1939, Dr. Howard Florey and three colleagues began extensive research and demonstrated penicillin’s ability to kill infectious bacteria. In 1941, with the help of Andrew J. Moyer and Dr. Norman Heatley, Florey was able to increase the yields of penicillin ten times. Mass production of penicillin began in 1943 and it was shown to be the most effective antibacterial agent to date. Four years later bacteria were found to resist penicillin.1 b.) Antibiotic resistance Antibiotic misuse has become a growing problem in healthcare. Millions of people take antibiotics to fight bacterial infections every year. They have become the “go to” treatment for many infections; the CDC reports that nearly 50% of these are inappropriately prescribed. More than $1.1 billion is spent annually on unnecessary antibiotics.2 The overuse of antibiotics is not only a financial problem, but is also increasing the number of antibiotic resistant bacterial strains. Unfortunately, drug companies are not motivated in discovering new antibiotics. Drug development generally takes 10-­‐15 years and costs billions of dollars. Since antibiotics cure illnesses and are only taken for a short period of time, drug companies fear that they may not get their full investment back. To have a significant return in their investment drug companies focus on treatment of chronic conditions where the patient is expected to take the medication for a long period of time. Antibiotic resistance is a growing problem in the United States and is compromising the effectiveness of treatment when actually needed. According to the CDC, 70% of pneumococcal diseases, which include ear and sinus infections, pneumonia and meningitis, are resistant to at least one antibiotic. However, an 2 alarming 16% were resistant to at least three antibiotics. These infections are normally easy to treat, but with the increase in antibiotic resistance, hospitalization is becoming necessary. According to the CDC, an estimated $20 billion is spent on excess healthcare cost and 8 million additional hospital days are necessary.2 One of the main causes of antibiotic resistance is not finishing an antibiotic course. After a couple of days the antibiotic begins to wipe out the less resistant bacteria, this is why people begin to feel better. People then either stop or forget to take the antibiotic. This allows the more resistant bacteria to mutate to resist the antibiotic in the future.3 Soil tends to have very low concentrations of bacteria that cause infectious diseases. Due to this researchers have looked for naturally occurring antibiotics in the soil. They have studied the sub inhibitory concentrations of these antibiotics; results show that at a very low concentration they actually help bacterial growth. This discovery has led scientists to believe that not only are antibiotics bacterial weapons, but are also signaling molecules that regulate the homeostasis of microbial communities.4 This is just another reason to finish a full dose of antibiotics; low levels of antibiotics can actually increase bacterial growth. Bacteria can gain resistance through mutation of their genetic material or by acquiring pieces of DNA that code for resistance properties from other bacteria. The DNA that codes for the resistance can be transferred very easily, from bacterium to bacterium, making resistance spread easily.5 Bacteria have shown to be very efficient at adapting to their surroundings and defeating antibiotics. There are three 3 ways bacteria gain resistance; [1] transformation, [2] conjugation, and [3] transduction. Transformation allows the transfer of the resistance gene from a dead bacterium. Conjugation is the transfer of a plasmid, carrying the resistance gene to the bacterium. Transduction is the transfer of the resistant gene by a virus.6 Figure 1 summarizes these processes. Figure 1: Bacteria can transfer the resistant gene through transformation, conjugation, and transduction. These resistance genes code for proteins that make antibiotics useless, using four known mechanisms. They are [1] degrade [2] modify, [3] block or [4] pump the antibiotic out of the cell through the use of an efflux pump (Figure 2). 4 Figure 2: Four mechanisms to render the antibiotic useless. [A] Via enzymes the antibiotic is degraded. [B] The bacteria can modify the antibiotic’s target molecule. [C] They can block the antibiotic from entering the cell. [D] The antibiotic can be pumped out of the cell via an efflux pump. Efflux pumps are transporter proteins that are located in the cytoplasmic membrane of cells and expel unwanted toxins from the cell. They are found in Gram-­‐positive and Gram-­‐negative bacteria as well as eukaryotic organisms.7 Pumps can be specific for only one substrate or for multiple structurally different compounds; these are known as multiple drug resistance (MDR) pumps. The ykkCD pump belongs to the small MDR pump category; it functions as a heterodimer and is the focus of this study. Efflux pump production and operation requires a large amount of energy and therefore cells do not produce efflux pumps unless they are needed. The focus of this study is determining how antibiotics trigger production of efflux pumps by binding to toxin sensors. By understanding how bacteria are 5 becoming resistant to antibiotics, we may be able to design antibiotics that are not detected by toxin sensors and thus are not rendered useless by resistance genes, making antibiotics effective at healing diseases again. 1.2 Riboswitches RNA sensors, also known as riboswitches, are found in the 5’ untranslated region (UTR) of mRNA and act as receptors for specific metabolites. Riboswitches are highly conserved structural elements in the mRNA located upstream from the target gene. The riboswitch recognizes and binds to the metabolite once its concentration reaches a high enough threshold. The binding of the metabolite induces a structural change that will either turn on or turn off gene expression.8 Riboswitches are very significant for regulation of gene expression. They have a very conserved secondary structure and are able to specifically bind to many groups of molecules such as: Coenzymes, amino acids, nucleobases, and metal ions. The metabolite that is recognized by the riboswitch is closely related to the gene that is being regulated. There are 12 known subclasses of riboswitches; their size varies from 35 to 200 nucleotides. Figure 3 shows the variability of these secondary structures. Table 1 below shows the 12 subclasses of riboswitches.9 6 TPP Riboswitch
Thiamine Pyrophosphate
2A
1A
FMN Riboswitch
Flavin mononucleotide
2B
1B
AdoCbl Riboswitch
1C
Adenosylcobalamin
2C
7 SAM-I Riboswitch
S-Adenosyl Methionine
2D
1D
SAM-II Riboswitch
S-Adenosyl Methionine
2E
1E
SAM-III Riboswitch
S-Adenosyl Methionine
2F
1F
8 Lysine Riboswitch
Lysine
1G
2G
Glycine Riboswitch
Glycine
2H
1H
Purine Riboswitch
Purines
2I
1I
9 preQ1 Riboswitch
1J
Pre-queuosine
2J
glmS Riboswitch
1K
Glucosamine
2K
Figure 3: Predicted secondary structures of known riboswitches (1A-­‐1K). Riboswitches are specific to metabolites that are closely related to the gene expression they regulate (2A-­‐
2K). 10 Group Coenzymes Major Classes of Riboswitches Members Natural Ligand Size TPP TPP, thiamine pyrophosphate 100 FMN FMN, flavin mononucleotide AdoCbl, adenosylcobalamin SAM, S-­‐
adenosylmethionine SAM, S-­‐
adenosylmethionine SAM, S-­‐
adenosylmethionine Lysine 120 Bacteria, archaea, eukaryotes (fungi, plants) Bacteria 200 Bacteria 105 Mostly Gram+ bacteria 60 α-­‐ and β-­‐proteobacteria 80 Gram– bacteria 175 Glycine Guanine, hypoxanthine Adenine preQ1, pre-­‐quenosine-­‐
1 GlcN6P, glucosamine-­‐
6-­‐phosphate 110 70 70 35 γ-­‐proteobacteria, Thermotogales, Firmicutes Bacteria Gram+ bacteria Bacteria Bacteria 170 Gram+ bacteria AdoCbl SAM-­‐I SAM-­‐II SAM-­‐III (SMK) Amino Acids Nucleobases Self-­‐cleaving mRNA Distribution Lysine Glycine (I+II) Guanine Adenine preQ1 glmS Table 1: 12 major classes of riboswitches. Riboswitches consist of two domains: the aptamer region and the expression platform. The aptamer domain forms a precise three-­‐dimensional structure and selectively binds to a target molecule. The expression platform is responsible for gene regulation via an allosteric conformational change.8 Most riboswitches turn off gene expression. This allosteric change can result in formation of a transcription terminator stem or sequesters the ribosomal binding site thus turning off the production of a specific gene.10 In our case we believe the riboswitch is turning on 11 gene expression of the efflux pump once the antibiotic binds (Figure 4). Thus the structural change is expected to result in unfolding of the terminator stem or uncovering of the ribosomal binding site. [A] Antibiotic Resistance Gene mRNA [B] Antibiotic Resistance Gene mRNA Figure 4: [A] In the absence of an antibiotic, the resistance gene is not made. [B] The antibiotic binds to the mRNA upstream of the target gene once a concentration threshold is reached. An allosteric structural change occurs that allows the resistance gene to be produced. Riboswitches are very specific to their target molecule. To illustrate this phenomenon we compare the guanine and adenine riboswitches. The only difference structurally from guanine to adenine is a C to U nucleotide change in the conserved region of the aptamer domain. This mutation causes a substantial change in base discrimination between guanine and adenine and is responsible for altering the binding specificity of the riboswitch (Figure 5).11 12 B
A
U
G
U G G CACGCAA
A
GUGCGCU
U AG
A
A
U
U
5’
"
6
"
$
6
$
"
$
U C
U
A
CC
GG
UGG
G
UUUGAGG
U
A
U AACU CC
U AA
A
A
GC
GC
A
C
CC
A UGU
G
A
C
A
A U
6
"
6
(
(
Forms a G-C pair with guanine
(
6
(
3’
G
U C
U
A
GU
U
5’
"
6
(
6
6
CC
AG
G
AA
C
CC
A CUA
G
A
U
A
A U
6
"
$
"
"
3’ Forms a A-U pair with adenine
Figure 5: A & B) The predicted secondary structure of (A) guanine aptamer domain and (B) adenine aptamer domain. The arrow indicates where the C to U nucleotide mutation occurs that changes the specificity of the riboswitch.11 The ykkCD RNA is a small putative riboswitch that is suspected to act as an antibiotic sensor in Bacillus subtilis. It is adjacent to the opening reading frame (ORF) of the ykkCD MDR efflux pump.12 The ykkCD putative riboswitch is likely to be an antibiotic sensor because it meets the following criteria: [1] it is located upstream of an MDR efflux pump gene, [2] it is found in pathogenic bacteria, [3] more than 80% of its sequence is conserved, [4] occurs 19 times in Bacillus subtilis, and [5] it does not resemble the binding site for transcription factors.13 There is a precedent example of an antibiotic sensing riboswitch. A recent study has shown regulation by an artificial tetracycline binding aptamer when inserted into the 5’ UTR of a reporter gene and demonstrated riboswitch-­‐like characteristics.14 To ensure that the putative ykkCD riboswitch is truly a toxin sensor we must show that: [1] it specifically binds to an antibiotic(s), and [2] that the binding triggers an allosteric change, resulting in upregulation of the ykkCD efflux pump. 13 1.3 Gene Expression Regulation Gene expression may be regulated either at the transcription or translation stage of protein synthesis. RNA is synthesized from DNA via the transcription stage and the resulting RNA is used as a template for protein synthesis (translation) (Figure 6). Figure 6: Double stranded DNA is transcribed into single stranded RNA via transcription. Single stranded RNA is synthesized into protein via translation. a.) Transcription Transcription is the process of synthesizing single stranded RNA from double stranded DNA and contains three steps; initiation, elongation (or RNA synthesis), and termination. In order to initiate transcription the bacteria must contain a promoter sequence on the 5’ UTR. The most common promoter sequence found in 14 bacteria has two conserved sequence regions. The first conserved region is known as the “Pribnow box” and has the sequence TATAAT. It is found ~10 nucleotides upstream from the start of transcription. The second conserved region has a sequence of TTGACA and is ~35 nucleotides away from the start of transcription. RNA polymerase is recruited to the DNA template strand for RNA synthesis when both of these sequences are present (Figure 7). Figure 7: Schematic diagram of a prokaryotic promoter that recruits RNA polymerase to initiate transcription. During elongation the polymerase separates the base pairs of the double-­‐
stranded DNA (dsDNA) and forms a transcription bubble. Inside the transcription bubble is the RNA polymerase, DNA and the newly synthesized RNA. The dsDNA is “unzipped” to reveal the template strand and the polymerase travels along the template strand. The polymerase copies the template strand 3’ to 5’ creating an RNA strand 5’ to 3’ (Figure 8). The RNA strand temporarily binds to the DNA creating an RNA-­‐DNA helix of approximately 8 base pairs long. The RNA polymerase stays attached to the DNA until a termination signal is reached. 15 Figure 8: Schematic diagram of the elongation stage of transcription. The RNA “unzips” the dsDNA and creates an RNA-­‐DNA hybrid helix. Transcription continues until a termination signal is reached. Termination, in bacteria, is most commonly controlled by a stable secondary structure called the terminator stem. The RNA polymerase comes in contact with the terminator stem and cannot unfold it. This causes the RNA polymerase to stop; the polymerase is released from the DNA template, the RNA-­‐DNA helix hybrid dissociates, and the DNA rewinds. The terminator stem resembles a “hairpin” and is comprised of a palindromic guanine (G) and cytosine (C) rich region followed by an adenine (A) and uracil (U) rich region. The rich GC content of the stem creates a stable structure that stops the polymerase. The AU region following the stem ensures that the RNA is released (Figure 9). 16 Figure 9: The terminator stem is a stable secondary structure that stops the RNA polymerase and releases the newly synthesized RNA. The terminator stem is formed when the newly synthesized RNA is able to fold back on itself. The stability of the stem loop is determined by the length, the number of mismatches, and the base composition of the stem. G-­‐C base pairs contain three hydrogen bonds and are much more stable than A-­‐T or A-­‐U base pairs, which only contain two hydrogen bonds. Therefore the stem is G-­‐C rich to make for a much more stable structure. b.) Translation Translation is the synthesis of protein using an RNA template and has three steps; initiation, elongation (peptide/protein synthesis), and termination. Translation is initiated when the ribosome is recruited to the mRNA strand via a specific sequence. This sequence is known as the Shine-­‐Dalgarno sequence and is 17 found in prokaryotic mRNA. The sequence aligns the ribosome with the start codon, AUG and is normally located 8 base pairs upstream from the start codon (Figure 10). Figure 10: The Shine Dalgarno sequence is located upstream from the start codon. The ribosomal unit is recruited via the Shine Dalgarno sequence to initiate translation. During elongation the ribosome reads one three-­‐nucleotide long sequence at a time that correlates to a specific amino acid; these sequences are called single codons. Once the codon is read, a transfer RNA (tRNA) with a complementary anticodon binds to the mRNA. Only the tRNA that pairs with the codon can incorporate its amino acid into the growing peptide chain. The ribosome continues to read the sequence and catalyzes peptide bond formation between the amino acids brought in by the tRNAs (Figure 11). The chain continues to grow until a stop signal is reached. 18 Figure 11: During translation elongation the ribosome reads a single codon sequence. The tRNAs that are complementary to the mRNA sequence will bind and incorporate their amino acid to the growing polypeptide chain. Translation elongation continues until a stop codon is reached. Typical stop codons are UAG, UAA, or UGA on the mRNA strand. The stop codon does not have a complementary tRNA therefore no tRNA can bind to their codons. Instead, a protein called the release factor binds to the ribosome and positions a water molecule at the end of the amino acid chain. This hydrolyzes the polypeptide chain, releasing it from the tRNA. The ribosomal complex breaks into its subunits, releasing the polypeptide chain. c.) Gene expression regulation at transcription versus translation Transcription regulation most commonly occurs at the termination step. In the absence of an antibiotic the terminator stem stays intact and stops transcription. This does not allow for the open reading frame (ORF) of the gene to be transcribed. 19 Once an antibiotic binds to the aptamer domain it creates an allosteric conformational change; the terminator stem unfolds and an alternate secondary structure is formed. This allows for the production of the efflux pump mRNA (Figure 12). Figure 12: Gene expression regulation during transcription occurs most often at the termination step. When no antibiotic is present the terminator stem stays intact and the resistance gene is not produced. Once an antibiotic is introduced to the cell an allosteric conformational change occurs that unfolds the terminator stem and the resistance gene can now be produced. Translation regulation most commonly occurs at the initiation stage. Similar to transcription, in the absence of an antibiotic the ribosomal binding site is masked by a secondary structure and the ribosome cannot bind. Therefore the protein cannot be produced. Once an antibiotic is introduced into the cell and it binds to the aptamer domain it induces an allosteric change that opens up the ribosomal binding site. The ribosome can now be recruited and the protein can be produced (Figure 13). 20 Figure 13: Gene regulation during translation occurs most often at the initiation step. In the absence of an antibiotic the ribosomal binding site is masked by a secondary structure. Once an antibiotic is introduced to the cell an allosteric conformational change occurs that reveals the ribosomal binding site and the ribosome is recruited. The ykkCD sensor could either regulate expression of the pump at transcription or translation. To determine which mechanism is used we can examine the amount of pump mRNA produced in cells grown with and without antibiotics. If the ykkCD sensor regulates expression at transcription we should see an increase in pump mRNA in the presence of an antibiotic. If it is regulated at translation the pump mRNA levels should stay the same. It is likely that the ykkCD sensor indeed regulates expression by transcription termination for the following reasons [1] transcription regulation is very common in Gram-­‐positive bacteria and [2] based on secondary structure prediction of the Bacillus subtilis ykkCD RNA expression platform resembles a terminator stem (Figure 14).15 21 Figure 14: Secondary structure prediction of the Bacillus subtilis ykkCD RNA. 1.4 Tetracycline binding triggers expression of the ykkCD efflux pump To understand how the ykkCD riboswitch regulates gene expression we needed to identify its ligand. To do this Ambar Rana used real time quantitative polymerase chain reaction (qRT-­‐PCR) to quantify ykkCD pump mRNA levels in the presence and absence of different antibiotics. The following antibiotics were chosen as possible ligands: tetracycline, streptomycin, chloramphenicol, TPPC, and fosfomycin. They were good candidates, because they were shown to be transported by the ykkCD pump.14 Most riboswitch ligands are related to the gene that is being regulated. He 22 found that ykkCD pump mRNA levels increase in the presence of tetracycline. When streptomycin, chloramphenicol, TPPC, or fosfomycin were introduced into cells the pump mRNA levels remained the same (Figure 15). Figure 15: This bar graph shows the significant increase in pump mRNA levels when Bacillus subtillus cells are grown with tetracycline. To determine which functional groups of tetracycline were involved with recognition, Nicholas Frecker also used qRT-­‐PCR to quantify pump mRNA levels using tetracycline and its derivatives (Figure 16). The four derivatives were minocycline, doxycycline, anhydrotetracycline, and oxytetracycline. 23 Figure 16: Structure of tetracycline and it’s derivatives. Frecker extracted mRNAs from Bacillus subtilis cells that were grown with antibiotics at sub inhibitory concentrations (SIC). Cells were grown without antibiotics and at SIC antibiotic concentration levels to ensure that gene expression was altered while cells are still alive. Genomic DNA was removed by DNase treatment followed by RT-­‐PCR to determine ykkCD mRNA levels for both pump subunits (CD). As mentioned previously if expression of the ykkCD pump is regulated at transcription, we should see an upregulation in pump mRNA levels once an antibiotic is introduced into the cell. Frecker found that tetracycline and 24 minocycline upregulate gene expression (Figure 17). These results indicate that in fact the ykkCD sensor is regulated at the transcription level. a.) Tetracycline ! b.) Doxycycline ! c.) Minocycline ! 25 !
d.) Oxytetracycline !
Figure 17: ykkCD pump mRNA levels quantified via qRT-­‐PCR. a.) Tetracycline increased ykkC mRNA levels by a factor of 4 and ykkD levels by a factor of 1.7. b.) Doxycycline triggered no prominent increase in expression. c.) Minocycline increased ykkC mRNA levels by a factor of 2.5 and ykkD had an increase of 3.4. d.) Oxytetracycline actually shows a down regulation of pump mRNA levels. Not enough data has yet been gathered for the antibiotic anhydrotetracycline. We hypothesized that the ykkCD sensor was responsible for triggering ykkCD pump expression. The in vivo data that was collected is very useful, but it does not clarify whether the riboswitch has anything to do with increased pump mRNA levels. In vitro studies are needed to show whether the sensor is sufficient to trigger increased pump mRNA levels. To test this hypothesis, a run off transcription assay using a construct that contains only the ykkCD sensor and the pump gene was performed. Transcription was performed in the presence and in the absence of tetracycline. Recall that once a concentration threshold is reached tetracycline binds to the ykkCD sensor and is expected to unfold the transcription terminator stem to allow synthesis of the pump mRNA. This process results in a “long transcript”. In the absence of tetracycline the terminator stem stays intact and transcription will be stopped, tesulting in a “short transcript”. 26 Whitney Howe has shown that when runoff transcription assays were performed in the presence of tetracycline we see an increase in pump mRNA levels (“long transcript”) (Figure 18). Since the constructs only contained the ykkCD sensor and the pump gene we can assume that the increase in ykkCD pump mRNA levels is due to the ykKCD sensor.16 [Tetracycline]
Figure 18: Denaturing PAGE gel of long and short RNA transcripts produced in the presence of different tetracycline concentrations. The gel shows that as tetracycline levels increase the ratio of the long transcript increases while the ratio of the short transcript decreases.16 1.5 Recognition of tetracycline and it’s derivatives by the ykkCD sensor To fully understand how the ykKCD sensor functions, we need to understand how the sensor recognizes tetracycline. We can use the common analogy of the “lock and key” to describe the binding event. Just like a lock and key we need a 27 perfect fit between tetracycline (key) and the ykkCD sensor (lock) for expression to be triggered (Figure 19) a.) b.) Figure 19: The antibiotic tetracycline is a perfect fit to the ykkCD sensor. Once tetracycline binds to the sensor it will trigger production of the efflux pump mRNA. a.) When another antibiotic comes in that is not a fit with the sensor the efflux pump mRNA will not be produced. b.) If a nucleotide necessary for tetracycline recognition is mutated, pump expression is not triggered. Binding assays are great ways to study the ykkCD sensor and determine which part of the sensor recognizes tetracycline and its derivatives. Krystal Roark and Delores James used a combination of site-­‐directed mutagenesis and 28 fluorescence quenching assays to determine which nucleotides are essential for antibiotic binding. Tetracycline and its derivatives are naturally fluorescent structures. Once the antibiotic binds to the sensor its fluorescence decreases (fluorescence quenching). Roark and James used a number of different sensor mutants and determined their binding affinity (KD) to tetracycline. They compared the KD values of the mutant sensor-­‐tetracycline complexes to that of the wild type sensor-­‐tetracycline complex to determine how the mutant affected the binding of the antibiotic. If the KD of the mutant was at least an order of magnitude weaker than the KD value of the wild type sensor we assumed that the mutant weakened recognition of tetracycline. Therefore, the nucleotides involved were important for recognition of tetracycline by the sensor.17 17b By using this technique Roark and James mapped a putative binding site for tetracycline (Figure 20). It was determined that mutating the stem closest to the 5’ end resulted in a decrease in tetracycline binding. When the stem closest to the 3’ end was mutated it did not affect binding of tetracycline at all. Therefore the stem closest to the 5’ end is involved in tetracycline binding. This result is not surprising because it is an evolutionary conserved region of the sensor. Roark and James performed binding assays with four derivatives of tetracycline to determine which functional groups of tetracycline are important for antibiotic recognition. They determined that minocycline and anhydrotetracycline bind to the ykkCD sensor. Both anhydrotetracycline and minocycline switches the carbonyl and hydroxyl groups on the second and third rings. Since they still bind to 29 the ykkCD sensor it is expected that: [1] interactions with these functional groups are not energetically significant or [2] both function groups act as hydrogen bond acceptors and thus switching them does not prevent recognition. Oxytetracycline and doxycycline did not appear to bind to the ykkCD sensor, which is surprising because their structures are most similar to tetracycline. Both of these derivatives alter the upper portion of tetracycline. The only difference between these derivatives and tetracycline is the addition of a hydroxyl group on the third ring in both derivatives. Hydroxyl groups can function as hydrogen bond donors or acceptors and thus addition of a hydroxyl group can alter the hydrogen bonding properties of the molecule. Alternatively, addition of a OH group can simply increase the crowdedness of the upper half of the molecule so that it cannot properly position itself to the riboswitch binding site. 30 U8C,U9G,U10A
U8G, C12del
a.) Mutations that did not affect binding of tetracycline to the ykkCD sensor G93A,G94A,G95A
31 b.) Mutations that abolish the ykkCD sensor binding to tetracycline U8G,U9G,U10G
C46G,C47G
32 Figure 20: Binding assays performed by Roark and James determined the tetracycline-­‐
binding site on the ykkCD RNA. The secondary structure of the aptamer is shown with the different mutations performed. The red regions are 100% conserved, the blue regions are about 80% conserved, and the black regions are not conserved. A.) Mutants that did not affect binding of tetracycline. B.) Mutants that reduced binding of tetracycline.17a 17b 1.6 Mapping the tetracycline binding site and the structural change caused by tetracycline binding a.) Techniques used to map structural changes and ligand biding sites To understand how tetracycline is recognized by the RNA we need to map the interaction between tetracycline and the ykkCD sensor and show how the structure of the RNA changes upon tetracycline binding. To do this we can use crystallography, fluorescent resonance energy transfer (FRET), or nucleic acid footprinting. Crystallography is a high risk-­‐high reward technique, because growth of crystals is empirical and unpredictable. Structural data is collected by using a high energy x-­‐ray beam (synchrodron) and the diffraction pattern is analyzed. To make sense of the diffraction patterns a mathematical software is used to help determine the structure of the molecule. A collaboration has been set up to perform crystallography on the ykkCD-­‐tetracycline complex, but this study is beyond the scope of my master thesis. FRET is a very useful tool to analyze conformational changes in real time. FRET involves labeling the RNA with a donor and acceptor fluorophore at specific nucleotides. FRET is a mechanism that analyzes the energy transfer between these two fluorphores. FRET efficiency is high if the donor is close to the acceptor and low when they are far apart. Thus as RNA structure changes and the distance between 33 the donor and acceptor fluorophores change causes a change in FRET efficiency. As a result, clever placement of fluorophores allows following RNA structural change in real time. To place fluorophores at appropriate locations prior knowledge of the structural change is a necessity. The problem with using FRET without prior knowledge of the structure is that we do not know where to place the donor and acceptor fluorophores to test adequate structural change.18 Once we have an understanding of the structural change caused by tetracycline binding. FRET will be a feasible technique to analyze structural change. Nucleic acid footprinting is a common technique used to show the structural changes that occurs following cofactor binding or folding. Footprinting assays produce a series of bands and protected regions. Bands indicate a region of the RNA that was accessible for fragmentation. A protected region indicates a region of RNA that was not fragmented due to the presence of a stable structure or ligand binding. Mutagenesis shows us which nucleotides contribute energetically to tetracycline binding. Footprinting will confirm the ligand binding site along with the structural change. Therefore footprinting and mutagenesis compliment each other well and are often used together to gain full understanding of where a ligand binds and how ligand binding changes RNA structure gather.19 b.) Techniques used for fragmentation of the RNA There are multiple ways to produce RNA cleavage patterns: nuclease protection, hydroxyl radical, self-­‐cleavage by the RNA, and chemical protection. Each technique has their advantages and disadvantages. Some methods cleave the 34 backbone of the RNA while others modify the bases. By using a combination of these techniques we can determine ligand binding sites and structural changes caused by ligand binding. Different nucleases are available to cleave RNAs; some are very specific to the secondary structure of the RNA (double stranded or single stranded) and some are specific to RNA sequence. Using nucleases that are specific to RNA structure one can confirm the unfolding of stem loops or the formation of a stem loop. To identify the ligand-­‐binding site using nuclease protection, fragmentation needs to be performed with both a single and double strand specific nuclease. The combination of these results will reveal the binding site. A disadvantage to nuclease protection is its lower resolution. This is due to the nuclease being large and not being able to get close enough to the ligand-­‐binding site. The advantage is that nucleases can be used under a wide variety of conditions.20 Hydroxyl radicals are generated by the reduction of hydrogen peroxide by iron; this reagent cleaves the sugar phosphate backbone of the RNA where it is accessible and not part of a secondary or tertiary structure. They have a much higher resolution than nuclease protection, because the radicals are much smaller and can get closer to the ligand-­‐binding site. Hydroxyl radicals are not sensitive to the secondary structure and only show changes to the RNA backbone. If the ligand selectively interacts with the nucleobase part of the RNA and not with the backbone, ligand binding may not produce a cleavage pattern. Also hydroxyl radicals can be 35 quenched by certain buffer components (glycerol detergents) and thus their usage is somewhat restricted by buffer conditions.21 There are two techniques based on RNA self-­‐cleavage: in-­‐line probing and fragmentation with Terbium (Tb3+). In-­‐line probing takes advantage of RNA’s natural instability. The 2’ OH in RNA acts as a nucleophile to cleave the adjacent phosphodiester bond, resulting in fragmentation of the RNA. In-­‐line probing is restricted to certain buffer conditions, need about 20 mM Mg2+ in buffer, and requires flexibility of RNA.22 Tb3+ improves the efficiency of in-­‐line cleavage and has been shown to be useful for mapping metal binding sites in RNA. Tb3+ as Tb(OH)2+ replaces the magnesium (Mg2+) in RNA and makes the 2’ OH a better nucleophile, which improves self-­‐cleavage of Mg2+ sites important for RNA folding. At a low concentration of Tb3+ Mg2+ are replaced with Tb(OH)2+ and thus Mg2+ binding sites are revealed and improves self-­‐cleavage of Mg2+ binding sites. But at high concentration of Tb(OH)2+ the RNA is fragmented where the structure is accessible, similarly to fragmentation with hydroxyl radicals. Tb3+ will reveal the Mg2+ sites that are important for RNA folding.23 Chemical protection is a useful approach that is beneficial to identify which functional groups in a nucleotide are involved in ligand binding. Commonly, four reagents are used to modify specific functional groups to see the effect it has on ligand binding. The reagents used are; 1-­‐cyclohexyl-­‐3-­‐(2-­‐morpholinoethyl) carbodiimide metho-­‐p-­‐toluene sulfonate (CMCT), diethyl pyrocarbonate (DEPC), dimethyl sulfate (DMS), and kethoxal. This method gives very detailed visualization 36 of which function groups of the RNA interact with the ligand, but it requires significant optimization and is not an easy method to start with. It is much more useful as a secondary technique after the binding site is identified. 24 Thus we choose to start with nuclease protection and hydroxyl radical footprinting as our primary methods. Since nuclease protection is sensitive to the secondary structure and has a low resolution and hydroxyl radicals have a high resolution, they will complement each other well. By comparing these two footprints we can compare and analyze the changes due to tetracycline binding. c.) Techniques used for visualization of cleavage patterns Cleavage patterns can be visualized either by end-­‐labeling the RNA or by primer extension. The method used depends on the RNA being probed and the fragmentation method used. Short RNAs, meaning those with less than 200 nucleotides, can be enzymatically labeled at either the 5’ or the 3’ end and results in visualization of cleavage patterns. End-­‐labeling is considered simpler because it requires fewer manipulations to visualize the cleavage patterns. Primer extension is typically used for longer RNAs. A labeled DNA oligomer primer is annealed to a specific region on the RNA. Then a reverse transcriptase (RT) is used to convert the RNA into DNA that is labeled at the end (Figure 21). Since RT pauses every 200-­‐300 nucleotides the resulting labeled DNA will be maximum 200-­‐300 nucleotides long. With clever primer design we can zoom into regions of the RNA. The pausing and termination of the RT tends to give a high background that may obscure the visualization of the cleavage patterns. 24a We have chosen to use 5’ end-­‐labeled RNA 37 to visualize the tetracycline-­‐binding site due to the size of our RNA. To map the structural change caused upon tetracycline binding we have to use primer extension due to the size of the RNA template. Figure 21: The labeled primer reads the RNA template creating labeled DNA that is 200-­‐
300 nucleotides long. d.) Identifying the tetracycline binding site on the ykkCD RNA aptamer It has been shown that tetracycline triggers the expression of the ykkCD pump mRNA. Mutagenesis studies revealed a binding site for tetracycline, but this result should be verified via footprinting. RNase protection patterns were generated using end-­‐labeled RNAs that only contained the aptamer domain of the ykkCD sensor RNA. Nuclease protection assays were performed in the presence and absence of tetracycline. We used two different nucleases to visualize the tetracycline binding site: RNase V1 and RNase A. RNase V1 cleaves double-­‐stranded (ds) regions, while RNase A cleaves single-­‐stranded (ss) regions. Ligand binding protects the RNA from nuclease cleavage (protection pattern) (Figure 22). Once the cleavage pattern is analyzed we can then compare the results of nuclease protection to the mutagenesis study. If no variation between the studies is present we can assume that this is the binding site for tetracycline. Any variation between the cleavage pattern and the mutagenesis study is the result of structural change caused by tetracycline binding. 38 Figure 22: Protection appears where the ligand binding prevented cleavage of the RNA. e.) Identifying the structural changed caused by tetracycline binding When identifying the structural change caused by tetracycline binding we can use two RNA templates, mRNA or in vitro synthesized RNA that contains the aptamer domain, the expression platform and the efflux pump. To fragment the RNA the same nucleases are used as previously discussed. In the absence of tetracycline, ds specific nuclease is expected to cleave the terminator stem; no cleavage of the stem is expected by ss specific nucleases (Figure 23). In the presence of tetracycline the terminator stem is expected to unfold resulting in cleavage by RNase A and lack of cleavage by RNase V1 (Figure 24). By comparing the cleavage patterns in the absence of tetracycline with the cleavage pattern in the presence of tetracycline structural change caused by tetracycline binding is revealed. 39 The advantage of using in vitro transcribed RNA is that it can be produced in large quantities. Transcription can be performed in the presence and the absence of tetracycline to illustrate the structural change caused by tetracycline binding. The disadvantage is that RNAs are produced in the absence of cellular cofactors and thus we cannot be sure that they truly mimic structural changes that take place in vivo. Figure 23: Hypothetical cleavage pattern by a ds-­‐specific nuclease. 40 Figure 24: Hypothetical cleavage pattern by a ss-­‐specific nuclease. mRNA prepped from cells grown without antibiotics and with antibiotics at SIC are great to model in vivo structural change. The problem with this approach is that it may not result in strong enough cleavage patterns to map the structural change. The problem with using mRNA as templates is its low cellular concentration. mRNAs are about 10% of the total cellular RNA and the ykkCD ORF mRNA is only a small percent of this cellular mRNA. Thus when fragmentation of the RNA is performed by nucleases we are looking at visualizing a very small amount of RNA. If our visualization technique is not sensitive enough to reveal cleavage patterns, performing primer extension on mRNAs from cells grown without antibiotics and with antibiotics at SIC levels can still provide visual 41 confirmation of the real-­‐time qRT-­‐PCR data collected by Ambar and Frecker. Thus it’s a useful experiment to attempt. 42 Chapter 2: Methods 2.1 ykkCD putative riboswitch constructs Two RNA constructs were used in this study to (a) map the conformational change caused by tetracycline binding and (b) map the tetracycline binding site. The Y-­‐construct contains only the riboswitch aptamer domain and the T7 promoter and allows efficient transcription in vitro. The G-­‐construct contains the aptamer domain, the expression platform, the efflux pump coding region and the T7 promoter. The Y-­‐construct was used to map the tetracycline-­‐binding site. The G-­‐
construct was used to map the allosteric change caused by tetracycline binding. Table 2: Information for constructs-­‐Y and construct-­‐G Table 2: ykkCD putative riboswitch constructs Construct Nucleotide Length Molecular Weight (g/mol) Y 112 36,329.4 G 657 272,567 ε (L/cm*mole) 1,149,800 8,411,000 B subtilis promoter (-­‐35 17nt in between -­‐10 elements) ykkC aptamer from Bacillus subtilis spizizenii strain W23 expression platform ykkC efflux pump coding region GTAAAGTTTTCTAGGGTTCCGCGTGTCAATGAACATGGCCTGGTCCGAGAGAAAACACA
TACGCGTAAATAGAGGCGTGTATGCACACGGAGGGAAAAAAGCCCGGGAGAGTCAATCT
CATGAGAGACGACTGTCCGGGGTTTTTTTGTTTTCGGAGAATCTTACTGGAAAGAAAGG
AATGACTTGAAATGAAATGGGGATTAGTCGTGCTTGCCGCCGTTTTTGAGGTTGTTTGG
GTGGTAGGCTTAAAGCATGCTGACTCAGCTTTAACATGGAGCGGCACTGCCGTCGGCATC
ATAGTCAGCTTTTATCTTTTAATGAAGGCGACAAACAGTCTGCCTGTCGGAACCGTGTAT
GCCGTCTTTACCGGACTCGGCACGGCAGGAACAGTGCTGAGTGAAATCATTCTGTTTCAT
GAGCCGGTTGGATGGCCGAAGCTTTTGCTAATCGGCGTGCTCTTAGTCGGTGTAATCGGG
TTGAAGCTTGTGACACAGGATGAGACAGAGGAAAGAGGAGGCGAGGCATAATGCTGCAC
TGGATCAGTTTATTGTG 2.2 Mapping tetracycline binding site To map the tetracycline-­‐binding site, the riboswitch aptamer domain was used. The T7 promoter allows efficient in vitro RNA transcription to synthesize RNA in high concentrations. Following transcription the RNA is end labeled to visualize RNase protection patterns of the tetracycline-­‐binding site. a.) DNA template preparation Escherichia Coli DH5α competent cells were transformed with vector DNA. One colony was inoculated into 40 mL luria broth (LB) /Ampicillin (AMP) media and grown overnight with vigorous shaking. Plasmid DNA isolated was purified from the cell cultures using QIAGEN Plasmid Plus Midi kit according to the description of manufacturer. Since DNA was synthesized using bacterial cells all extracellular components need to be removed. The QIAGEN Plasmid Plus Midi kit was used to remove the cell membrane, cellular proteins, DNA and RNA from the plasmid DNA using a silica-­‐based anion-­‐exchange chromatography column, taking advantage of 44 DNA’s highly negative charge. DNA was analyzed by running 5 μL of DNA on a 1% agarose gel. The concentration of DNA was quantified using a Nanodrop 1000 spectrophotometer at 260 nm absorbance. Plasmid DNA preparation yields a concentration of 300-­‐500 ng/μL DNA in 200 μL. The plasmid DNA was linearized using a restriction endonuclease. This was done prior to transcription to ensure that the polymerase stops at the end of the desired construct. Linearized DNA was analyzed using agarose gel electrophoresis to ensure that the entire DNA was linearized. Supercoiled DNA travels faster than linearized DNA thus efficiency of DNA linearization can be judged on an agarose gel. A phenol chloroform (PC) extraction was performed to remove the restriction endonuclease followed by a plasmid precipitation to remove any excess phenol/chloroform. DNA was resuspended in 100 μL Tris-­‐EDTA (TE) buffer (Refer to 2.4). Linearized DNA concentrations yields are between 300-­‐500 ng/μL in 100 μL. Detailed procedures are listed as follows: Transformation: 1. Add 1-­‐10 μL of Y-­‐DNA to 100 μL DH5α competent cells a. Typically used 10 μL to yield a better transcription efficiency 2. Sit on ice for 20 minutes 3. Heat shock cells in 42 °C water bath for 2 minutes 4. Sit on ice for 2 minutes 5. Add cells to 900 μL of pre-­‐warmed LB media (refer to 2.4) 6. Grow cells in shaker for 1 hour @ 130 rpm @ 37 °C 7. Transfer the cells into a centrifuge tube 8. Spin the cells down for 1 to 2 minutes 9. Remove about 900 μL of LB media 10. Resuspend the cells in the remaining 100 μL of LB 11. Plate cells on a LB/100 μg/mL AMP plate 12. Grow overnight at 37 °C a. Do not exceed 20 hours of growth time 45 Two Part Inoculation: 1. To a sterile test tube add a. 1 mL LB media b. 1 μL 1000X AMP (Refer to 2.4) c. Pick up 3-­‐5 colonies from cell culture plates using a pipette tip 2. Loosely replace sterile lid back on test tube 3. Place test tube in shaker for 4-­‐6 hours @ 260 rpm @ 37 °C 4. To a sterile 125 mL Erlenmeyer flask add a. 40 mL LB media b. 40 μL AMP c. All inoculation from test tube 5. Loosely replace sterile foil cap 6. Place Erlenmeyer flask in shaker overnight at the same settings a. Do not exceed 20 hours of growth time Plasmid Plus Midi Kit (Qiagen): High-­‐yield protocol 1. Place inoculation flask in 4 °C fridge for 30 minutes 2. Pour cell into a 50 mL centrifuge tube 3. Spin down cells for 10 minutes at 3000-­‐5000 rpm a. Remove LB media 4. Resuspend pellet in 4 mL Buffer P1 a. Vortex and pipette up and down until no clumps remain 5. Add 4 mL of Buffer P2, mix by inverting and incubate @ room temperature for 3 minutes a. Do not allow lysis to proceed for more than 5 minutes 6. Add 4 mL of Buffer S3 to the lysate and mix immediately by inverting 4-­‐6 times 7. Transfer lysate to QIAfilter cartridge and incubate at room temperature for 10 minutes 8. Gently insert plunger to QIAfilter cartridge and filter cell lysate to a new 50 mL centrifuge tube 9. Add 2 mL of Buffer BB to the filtered lysate and invert 4-­‐6 times 10. Prepare the vacuum manifold and QIAGEN Plasmid Plus Midi spin column 11. Transfer the lysate to QIAGEN Plasmid Plus Midi spin column with the tube extender attached to the vacuum 12. Turn the vacuum on and allow the lysate to be drawn through the column a. Once the lysate is drawn through turn the vacuum off 13. Wash DNA with 700 μL Buffer ETR and centrifuge for 1-­‐2 minutes a. Discard the flow-­‐through 14. Wash DNA with 700 μL Buffer PE and centrifuge for 1-­‐2 minutes a. Discard the flow-­‐through 15. Completely remove residual wash buffer from the column by 46 centrifuging for 1 minute at 10,000 rpm 16. Place the column into a clean 1.5 mL centrifuge tube 17. To elute the DNA add 200 μL of elution buffer (EB) to the center of the column a. Set for 1 minute 18. Centrifuge at max speed for 1 minute Quantifying DNA Concentration: Nanodrop 1000 spectrophotometer (Cole-­‐
Parmer) 1. The pedestal is cleaned with RNase free H2O 2. Blank with 2 μL of Buffer EB a. Click blank 3. Measure blank sample to ensure pedestal is cleaned a. Click measure 4. Wipe blank with kimwipe 5. Measure 2 μL of sample a. Click measure 6. Record the concentration, typical yields are between 300-­‐500 ng/μL in 200 μL Agarose Gel Electrophoresis: 1% agarose gel is prepared as follows: 1. Add 1 g of agarose to 100 mL of 1x tris-­‐acetate-­‐EDTA (TAE) buffer in a Erlenmeyer flask 2. Microwave the flask until the contents are boiling (about 1 minute) 3. Allow the flask to cool 4. Add 10 μL of ethidium bromide (EtBr) 5. Pour into the mold and add the combs 6. Allow the gel to polymerize for 15 minutes 7. Prepare samples by adding 5 μL of DNA with 1 μL of 6x loading dye 8. Load samples into well and run gel for 20 minutes at 100 volts using 1x TAE running buffer DNA Template Preparation For Runoff Transcription (DNA Linearization): Linearization reaction volumes can range from 100-­‐500 μL. BamHI, BSA, and Buffer 3 (New England Biolabs) are the reagents used for this reaction. A 500 μL reaction was prepared as follows: 47 Table 3: Linearization reaction Table 3: Linearization Volume (μL) Reagent 50 μL 10x Buffer 3 50 μL 10X BSA 50 μL BamHI Plasmid DNA 350 μL Total Volume 500 μL Incubate at 37 °C overnight Agarose Gel Electrophoresis: Gel is run as before, procedure on pg. 47 DNA Phenol Chloroform (PC) Extraction: Refer to 2.4 for procedure DNA Plasmid Precipitation: Refer to 2.4 for procedure b.) RNA Preparation RNA was synthesized using T7 RNA polymerase. A phenol chloroform extraction was done to remove the enzyme from the transcription mixture. A plasmid precipitation was done to remove any excess phenol or chloroform and to concentrate the transcription reaction. The RNA pellet was resuspended in 100 μL RNase free H2O. The transcribed RNA needs to be purified to remove all unincorporated NTPs, template DNA, and degradation products. There are two methods of purification that were used; gel purification and column purification via QIAGEN RNeasy kit. To use the kit the RNA must be at least 300 nucleotides long, therefore gel purification was used for the Y-­‐construct and column purification was used for the G-­‐construct. For gel purification the transcription mixture was mixed with 100 μL urea dye (refer to 2.4). The sample was loaded onto a 10 % denaturing 48 polyacrylamide gel (PAGE). The bands separate based on molecular weight. The top band was the purified RNA and was viewed by UV shadowing. The RNA was excised from the gel and eluted by electroelution. Electroelution was used to extract the RNA from the gel. By applying a negative current the gel separates from the RNA. Buffer exchange was done overnight. The eluted RNA was concentrated by vacuum suction (Centrivap Concentrator). The sample’s purity was evaluated by resolving the RNA on a 10% denaturing PAGE. Purified RNA appears as a single band. Typical gel purified RNA yields were between 100-­‐200 ng/μL in 100 μL. Detailed procedures are listed as follows: Transcription: Linearized DNA template needs to have a minimum concentration of 0.025 μg/μL to achieve high yield transcription. Typical yields of linear DNA are between 0.300-­‐0.500 μg/μL. To calculate the volume needed a simple M1V1=M2V2 equation is used. A sample calculation using a linear DNA concentration of 0.366 μg/μL and a total volume of 500 μL is shown below: (0.366 μg/μL)(V1)=(0.025 μg/μL)(500 μL) V1= 35 μL of linear DNA 49 Table 4: 500 μL transcription reaction Table 4: Transcription Reagent 1 M Tris pH 8.0 80 mM rNTP 100 mM DTT 1% Triton 50,000 U/mL T7 RNAP 100 mM MgCl2 40 U/μL Linear DNA RNase free H2O Total Volume Concentration 20 mM 4 mM 5 mM 0.1% 1 U/ μL 24 mM 1 U/μL Volume (μL) 10 25 25 5 50 120 5 35 225 500 Incubate for 1.5 hours at 37 °C RNA Phenol Chloroform (PC) Extraction: Refer to 2.4 for procedure. RNA Precipitation: Refer to 2.4 for procedure Analytical Denaturing PAGE: Refer to 2.4 for procedure Gel Purification: Nucleic acid footprinting requires very pure RNA, thus gel purification is performed. Refer to 2.4 for procedure. c.) RNA end labeling RNA that is being used for nucleic acid footprinting needs to be end-­‐labeled to visualize the cleavage patterns. 5’ end labeling was performed using commercially available IR dye labeled NTP that is fluorescent at 700 nM (IR_700_UTP) (Li-­‐COR). To label in vitro synthesized RNA the terminal phosphate must be removed first. It is then replaced with the IR_700_UTP by a T4 polynucleotide kinase (Fermentas). To do nucleic acid footprinting the RNA must be 50 very pure therefore another gel purification was done on the sample to remove any unincorporated IR_700_UTP or degradation products. Phosphatase Treatment: FastAPTM thermosensitive alkaline phosphatase, 10x FastAPTM buffer, and RNase inhibitor (Fermentas) were used for this reaction. Mix the following in a 1.5 mL centrifuge tube: Table 5: Phosphatase Treatment Table 5: Phosphatase Treatment Volume (μL) Reagents Phosphatase Buffer 10 5 Phosphatase 1 RNase Inhibitor 9 RNase free H2O 75 Clean RNA 100 Total Volume 1. Mix by pipetting 2. Incubate for 10 minutes at 37 °C 3. Heat inactivate the phosphatase for 5 minutes at 75 °C 4. Remove 5 μL to be ran on a small urea gel Kinase Treatment: T4 polynucleotide kinase (PNK) and buffer (New England BioLabs) were used for this reaction. The NTP used is an IR_700_UTP dye (Li-­‐COR). Mix the following to the previous tube:Table 6: Kinase Treatment Table 6: Kinase Treatment Volume (μL) Reagents 95 Phosphatase Treatement 5 Labeled NTP 5 Kinase RNase Inhibitor 1 Total Volume 106 51 1. Mix by pipetting 2. Incubate for 30 minutes at 37 °C 3. Remove 5 μL to be ran on analytical denaturing PAGE Gel Purification: Refer to 2.4 for procedure. Typical concentration yields between 2.000-­‐6.000 μM/μL. d.) RNase protection assay of the ykkCD aptamer Footprinting patterns were generated by using two nucleases, Cobra Venom nuclease (RNase V1)(Ambion) and RNaseA (Sigma-­‐Aldrich), hydroxyl radical formation, and self-­‐cleavage of the RNA. RNase V1 is double strand specific and cleaves after every nucleotide in ds-­‐RNA. RNaseA is single strand specific and cleaves after every nucleotide in ss-­‐RNA. To analyze the footprinting pattern two ladders need to be generated, alkaline (OH) ladder and T1 ladder. The alkaline ladder cleaves after each nucleotide while T1 ladder cleaves after every G nucleotide using ribonuclease T1. Amounts of nucleases used were optimized on an analytical denaturing PAGE. Hydroxyl radicals were generated by the reduction of hydrogen peroxide by iron, which cleaves the sugar phosphate backbone of the RNA. Self-­‐
cleavage of the RNA takes advantage of RNAs natural instability. Two self-­‐cleavage protocols were used; in-­‐line probing and fragmentation with Tb3+. RNase Protection Assay: 1. 72 hours before digestion is done mix the YRNA tetracycline complex a. Refold RNA i. 2 minutes in boil block ii. Quick spin iii. 10 minutes on ice b. Add 19.5 μL of 0.625 μM end labeled y-­‐RNA to a centrifuge tube c. Add 0.5 μL of 1 μg/μL tetracycline d. Incubate at 4 °C for 72 hours 52 2. Prepare the master mix below: Table 7: RNase Protection Master Mix Table 7: RNase Protection-­‐Master Mix Volume (μL) Reagents 2 10x RNA Structure Buffer 0.2-­‐4 μg end labeled y-­‐RNA ~19.5 of 0.625 μM or yRNA tetra complex 21.5 Total Volume 3. Aliquot 4.5 μL into 5 centrifuge tubes 4. Add the correct amount of nuclease to each tube following the dilutions below: Table 8: Serial dilution is used to optimize the amount of nuclease needed for footprinting analysis. Table 8: Nuclease Dilutions Amount of Nuclease Tube No nuclease is added; control 1 1 μL RNase V1 2 1 μL from tube 2 (5 fold dilution) 3 1 μL RNaseA 4 1 μL from tube 4 (5 fold dilution) 5 5. Incubate the nuclease cleavage for exactly 15 minutes at room temperature 6. To stop the reaction add an equal amount of 1x formamide dye (Li-­‐COR) 7. Freeze samples at -­‐20 °C until ready to be used OH Ladder 1. Prepare the following master mix below: 53 Table 9: OH Ladder Master Mix Table 9: OH Ladder-­‐Master Mix Volume (μL) Reagents 1x Alkaline Hydrolysis Buffer 9 0.25 μg end labeled y-­‐RNA 6 15 Total Volume 2. Aliquot 5 μL into 3 centrifuge tubes 3. Heat each sample at 100 °C a. Remove first tube after 2 minutes, second tube after 5 minutes, and third tube after 15 minutes 4. Add 10 μL of 1x formamide to each tube 5. Prepare an untreated sample by adding 1 μL of end labeled y-­‐RNA to 8 μL of 1x formamide dye 6. Freeze samples at -­‐20 °C T1 Ladder 1. Prepare the following master mix below: Table 10: T1 Ladder Master Mix Table 10: T1 Ladder-­‐Master Mix Volume(μL) Reagents 17 1x RNA sequencing buffer 10 0.25 μg end labeled y-­‐RNA 27 Total Volume 2. Aliquot 9 μL into 3 centrifuge tubes 3. Heat the samples to 50 °C for 5 minutes a. Reduce to room temperature 4. Add the correct amount of 1000 U/μL T1 nuclease to each tube following the dilutions below: 54 Table 11: Optimization of RNase T1 amount Table 11: T1 Nuclease Dilutions Tube Amount of T1 No T1 is added; control 1 1 μL T1 2 1 μL from tube 2 3 5. Incubate the nuclease cleavage exactly 15 minutes at room temperature 6. To stop the reaction add an equal amount of 1x formamide dye 7. Heat the samples at 100 °C for 5 minutes 8. Freeze samples at -­‐20 °C Hydroxyl Radical Formation: 1. Prepare the following solutions fresh everyday a. 50mM Fe(NH4)2(SO4)2*6H2O b. 100 mM EDTA c. 250 mM ascorbic acid d. 2.5% hydrogen peroxide e. 1 M thiourea 2. Add 2 μL of RNA to 19 μL of hydroxyl radical buffer (refer to 2.4) 3. In a separate tube sequentially mix 4 μL of Fe(NH4)2(SO4)2*6H2O, 4 μL EDTA, and 4 μL of ascorbic acid. Add 4 μL of hydrogen peroxide, pipette up and down twice to mix and immediately add 4 μL to the RNA-­‐buffer mix. 4. Incubate the sample for 3 minutes 5. At the end of 3 minutes remove 8 μL and add to a tube with 8 μL of thiourea 6. Incubate the sample for an additional 2 minutes 7. At the end of 2 minutes remove 8 μL and add to a tube with 8 μL of thiourea 8. Incubate the sample for an additional 5 minutes 9. At the end of 5 minutes add 8 μL of thiourea to the tube 10. Perform and ethanol precipitation (refer to 2.4) on each sample In-­‐line Probing: 1. RNA-­‐Tetracycline complex is set up 72 hours prior 2. 1 μL of the RNA-­‐Tetracycline complex is mixed with 4 μL of 5x buffer 3. Tubes are set on bench top for 42 hours 55 Fragmentation with Tb3+: 1. Refold RNA a. 2 minutes in boil block b. Quick Spin c. 10 minutes on ice 2. Three concentrations of TbCl3 are prepped from a 100 mM stock solution; 0.3 mM, 5 mM, and 25 mM. 3. Prepare the following mix at each concentration of TbCl3: Table 12: Terbium fragmentation master mix Table 12: Terbium Fragmentation Volume Reagents 2 μL Refolded RNA 2 μL 5x Rxn Buffer 2 μL TbCl3 4 μL RNase Free H2O 10 μL Total Volume 4. Incubate samples at 37°C for 15 minutes 5. At 15 minutes remove 5 μL from each tube and add to a new tube with 0.5 μL of EDTA 6. Allow the remaining 5 μL to incubate for an additional 1.5 hours 7. Add 0.5 μL of EDTA to the remaining tubes at the end of 1.5 hours Analytical Denaturing PAGE: Samples were analyzed using analytical denaturing PAGE. Refer to 2.4 for procedure. Sequencer Gel: Licor 4300 DNA Analyzer is used to analyze the footprinting pattern. Plates are set up using 0.25mm spacers. 1. Prepare the gel mixture as follows: 56 Table 13: Licor 4300 DNA Analyzer Gel Table 13: Licor Sequencer Gel Volume Reagents 20 mL 6.5% Matrix Solution (Li-­‐COR) 150 μL APS 15 μL TEMED 2.
3.
4.
5.
Pour the solution in the syringe and degas the solution Inject the solution between the plates and insert the comb Allow the gel to polymerize for 1.5 hours Pre-­‐run the gel for 20 minutes at 1500 volts. Prepare Samples and Run Gel 6. Boil samples at 100 °C for 3 minutes 7. Load 1 μL of sample into wells 8. Run the gel for 8 hours at 1500 volts. 9. Once the gel is complete visualize the band intensities and quantify using Image Quant. 2.3 Mapping Conformational Change To map the structural change caused by tetracycline binding to the ykkCD RNA expression platform, two RNA templates may be used. One template was ykkCD mRNA isolated from cells grown with and without tetracycline. The second template was ykkCD-­‐ykkC pump construct transcribed in vitro with and without tetracycline. RNase protection assay followed by a primer extension was performed to map the allosteric change that occurs. Detailed protocol of each procedure is as follows: 57 a.) Cell Growth Plate Cells: mRNA was grown from Bacillus subtilus. Streak an LB only plate with glycerol stock Bacillus subtilus strain NRRL B-­‐765. Incubate the cells overnight at 37 °C for no more than 20 hours. Grow Cells: In a 250 mL sterile Erlenmeyer flask add 50 mL LB media. Using a pipette tip pick up one colony and drop it into the flask. The cells were grown in a shaker at 260 rpm for 18-­‐24 hours at 37 °C. Cells Grown with and without Antibiotics: Cells were grown without antibiotics and with Tetracycline (5000 μg/mL), Oxytetracycline (5000 μg/mL), Doxycycline (5000 μg/mL), Anhydrotetracycline (1000 μg/mL), and Minocycline (5000 μg/mL) using SIC levels. Prepare cultures following the procedure below: Table 14: Antibiotic SIC levels and volumes used Table 14: Antibiotics SIC Levels Concentration Antibiotic 12 μg/mL 15 μg/mL Tetracycline 20 μg/mL Oxytetracycline Anhydrotetracycline 0.3 μg/mL 0.5 μg/mL 0.7 μg/mL 1.0 μg/mL Doxycycline 0.01 μg/mL Menocycline 1.
2.
3.
4.
Add 25 mL of LB to sterile flask Add 250 μL of overnight bacillus culture Add the volumes above in table 13 for each antibiotic Grow cells overnight in shaker at 220 rpm for 19 hours Volume (μL) 60 75 100 7.5 12.5 3.5 5 50 58 b.) Total mRNA isolation To confirm that the entire cell cultures exhibit reduced growth an OD measurement was taken. We should see 50-­‐60% less growth in the culture grown with antibiotics than the non-­‐antibiotic sample to ensure that the gene expression was altered. To analyze the ykkCD pump mRNA a total RNA extraction must be done from the cell cultures to remove any cellular components. The Qiagen RNeasy Mini Kit was used to perform the total RNA extraction. All extracellualar components are removed using a silica-­‐based anion-­‐exchange chromatography column. A DNase treatment was done on the mRNA to remove any genomic DNA, which would interfere with analysis. The DNase treatment was followed by a phenol chloroform extraction and plasmid precipitation. Typically 50-­‐100 μL of total RNA was recovered at a concentration of 50-­‐300 ng/μL. To determine if the quality of the mRNA was high enough, denaturing agarose gel analysis ws performed. If the mRNA is of good quality we should see two very distinct bands that represent the 16S and 18S subunits of the ribosomal RNA (rRNA). mRNA is not visible on the gel and since nearly 80% of the cellular RNA is made up of rRNA, if the rRNA is of good quality, we can assume that the mRNA is also of good quality. Total RNA Extraction: Qiagen RNeasy Mini Kit 1. Calculate the volume of each cell culture needed to achieve an equal number of cells using the equation below: a. Volumesample=(ODuntreated/ODsample) x 3 mL 2. Centrifuge 1.5 mL of each sample at 5000 rpm at 4 °C for 3-­‐5 minutes a. Discard the supernatant 3. Add another 1.5 mL of each sample and centrifuge again at the same conditions a. Discard the supernatant 59 4. Continue until the full amount of cells for each sample are pelleted 5. Add 10 μL of β-­‐mercaptoethanol (Sigma Aldrich) and 5 μL lysozyme (Fisher) to 1 mL of Y1 buffer (Refer to 2.4) for each sample a. Make sure to do in a hood 6. Add the solution mixture made in step 4 to the pellets and resuspend 7. Incubate samples in 30 °C water bath for 30 minutes 8. Centrifuge samples at 10,000 rpm for 5 minutes a. Repeat until a solid pellet is formed, discard the supernatant 9. Add 350 μL Buffer RLT to each sample 10. Vortex for about 1 minute 11. Centrifuge samples at 10,000 rpm for 2 minutes 12. Transfer supernatants to new centrifuge tubes 13. Add 350 μL of cold 70% ethanol to each sample, mix by pipetting 14. Transfer to a spin column provided 15. Centrifuge at 10,000 rpm for 20 seconds, discard the flow-­‐through 16. Add 700 μL Buffer RW1 to each sample 17. Centrifuge at 10,00 rpm for 20 seconds, discard the flow-­‐through 18. Add 500 μL Buffer RPE to each sample 19. Centrifuge at 10,000 rpm for 20 seconds, discard the flow-­‐through 20. Add 500 μL Buffer RPE to each sample 21. Centrifuge at 10,000 rpm for 2 minutes 22. Place the column in a new 1.5 mL centrifuge tube 23. Add 50 μL RNase-­‐free H2O, allow to sit on the column for at least 1 minute 24. Centrifuge at 10,000 rpm for 1 minute 25. Add an additional 50 μL of RNase-­‐free H2O and centrifuge again DNase Treatment: All genomic DNA must be removed from the mRNA to not interfere with analysis. Excess genomic DNA would show extra bands that give a false/positive result during quantification. 10x DNase Buffer and DNase 3 U/μL (New England Biolabs) are used for this reaction: Add the following to the 100 μL mRNA sample: 60 Table 15: DNase treatment on 100 μL sample Table 15: DNase Treatment Volume (μL) Reagents 100 mRNA 10x DNase Buffer 11 1 DNase 112 Total Volume 1. Incubate at 37 °C for 1 hour 2. Add 1 μL 0.5 M EDTA at pH 8.0 a. Quick Spin 3. Incubate at 75 °C for 10 minutes 4. Cool to room temperature RNA Phenol Chloroform Extraction: Refer to 2.4 for procedure. Ethanol Precipitation: Refer to 2.4 for procedure with the following change: mRNA was only resuspended in 50 μL RNase free H2O to yield a higher concentration. Typical yields were 50-­‐300 ng/μL. Formaldehyde Denaturing Gel Electrophoresis 1. Add 100 mL Formaldehyde (FA) running buffer (refer to 2.4) to 1 g agarose 2. Heat mixture until boiling, about 1-­‐2 minutes 3. Let it cool and then add 5 μL EtBr 4. Pour into mold and let polymerize 5. Prepare 10 μL mRNA samples a. Add 2 μL RNase free H2O and 3 μL FA loading buffer to the mRNA (refer to 2.4) b. Heat samples in 65 °C water bath for 5 minutes c. Cool samples on ice for 1-­‐2 minutes 6. Cover gel with FA running buffer 7. Load samples into wells 8. Run gel at 45 V for 1 hour 9. Image gel using BioRad Molecular Imager Gel Doc™ 61 Column Purification on G-­‐RNA (Qiagen RNeasy Mini Kit): To purify the G RNA for primer extension a column purification can be used since the size is larger than 300 nucleotides. 1. Add 350 μL Buffer RLT and mix by pipetting 2. Add 250 μL 96% ethanol and mix by pipetting a. Do not centrifuge, immediately proceed to step 3 3. Transfer the sample to the RNeasy mini spin column that is placed in a 2 mL collection tube a. Centrifuge for 15 seconds at 8,000 rpm and discard the flow-­‐
through 4. Add 500 μL Buffer RPE to the RNeasy spin column a. Centrifuge for 15 seconds at 8,000 rpm and discard the flow-­‐
through 5. Add another 500 μL Buffer RPE to the RNeasy spin column a. Centrifuge for 2 minutes at 8,000 rpm to ensure all is removed from the membrane and discard the flow-­‐through 6. Put the RNeasy spin column in a new 2 mL collection tube a. Centrifuge for an 1 minutes at full 13,000 rpm 7. Place the RNeasy spin column in a 1.5 mL centrifuge tube 8. Add 30-­‐50 μL of of RNase free H2O to the center of the spin column and allow to sit for 1 minute a. Added 30 μL to achieve a higher concentration 9. Centrifuge for 1 minute at 8,000 rpm to elute the RNA 10. Check the concentration of RNA by NanoDrop, typical yields are between 300-­‐500 μg/μL in 30 μL c.) Primer design for primer extension Two primers were designed for use in primer extension analysis. The primers were synthesized with IRDye® 700 (Integrated DNA Technologies (IDT)) at the ‘ end. The first primer, RT_tetrasite, was used to map the tetracycline-­‐binding site. The second primer, RT_confchange, was used to map the conformational change caused by tetracycline binding. The primer sequences are below: RT_tetrasite: 5’ CCTTTCTTTCCAGTAAGATTCTCCG 3’ Reverse Compliment: CGGAGAATCTTACTGGAAAGAAAGG 62 The RT_tetrasite primer anneals in the expression platform region. The region is shown below with the primer sequence in bold. TCAATCTCATGAGAGACGACTGTCCGGGGTTTTTTTGTTTTCGGAGAATCTTACTGGAA
AGAAAGGAATGACTTGAA RT_confchange: 5’ ACCACCCAAACAACCTCAAA 3’ Reverse Compliment: TTTGAGGTTGTTTGGGTGGT The RT_confchange primer anneals in the ykkC efflux pump coding region. The region is shown below with the primer sequence in bold. ATGAAATGGGGATTAGTCGTGCTTGCCGCCGTTTTTGAGGTTGTTTGGGTGGTAGGCT
TAAAGCATGCTGACTCAGCTTTAACATGGAGCGGCACTGCCGTCGGCATCATAGTCAGCT
TTTATCTTTTAATGAAGGCGACAAACAGTCTGCCTGTCGGAACCGTGTATGCCGTCTTTA
CCGGACTCGGCACGGCAGGAACAGTGCTGAGTGAAATCATTCTGTTTCATGAGCCGGTTG
GATGGCCGAAGCTTTTGCTAATCGGCGTGCTCTTAGTCGGTGTAATCGGGTTGAAGCTTG
TGACACAGGATGAGACAGAGGAAAGAGGAGGCGAGGCATAATGCTGCACTGGATCAGTT
TATTGTG Table 16: General primer information Table 16: Primer Information Melting Temperature (°C) Molecular Weight Primer 55.3 8,287.8 RT_tetrasite 54.9 6,730.9 RT_confchange ε (L/cmŸmole) 251,680 226,780 d.) RNase protection assay of the ykkCD expression platform To analyze the allosteric structural change caused by tetracycline binding a reverse transcription (RT) protocol was used. We will use the RT_confchange primer previously discussed. The primer will anneal to the mRNA efflux pump sequence if it is expressed. Reverse transcriptase synthesizes 200-­‐300 nucleotide 63 long DNA sequences complimentary to the mRNA upstream of the primer annealing site. This is the region where cleavage pattern is visualized. RNase Protection: To map the allosteric structural change RNase cleavage patterns are generated using RNase V1(Ambion) and RNaseA (Sigma-­‐Aldrich). 1. Prepare the master mix below: Table 17: RNase protection Master Mix Table 17: RNase protection-­‐Master Mix Volume (μL) Reagents 5 10x RNA Structure 5 1 μg tRNA ~40 mRNA 50 Total Volume 2. Aliquot 10 μL of master mix into 5 centrifuge tubes 3. Add the correct amount of nuclease to each tube following the dilutions below: Table 18: Serial dilution is used to optimize the amount of nuclease needed for footprinting analysis. Table 18: Nuclease Dilutions Amount of Nuclease Tube No nuclease is added; control 1 1 μL RNase V1 2 1 μL from tube 2 (10 fold dilution) 3 1 μL RNaseA 4 1 μL from tube 4 5 4. Incubate the nuclease cleavage for exactly 15 minutes at room temperature 5. To stop the reaction add 20 μL precipitation solution (Ambion) 6. Flash freeze sample in liquid nitrogen for 8 minutes 7. Centrifuge samples at 14,000 rpm for 10 minutes 64 8. Carefully remove the supernanent 9. Add 20 μL of 70% cold ethanol and immediately remove 10. Vacuum for about 1 minute to remove any excess ethanol 11. Resuspend pellet in 5.5 μL of RNase free H2O Primer Extension: To visualize the cleavage pattern a reverse transcription was performed. Avian Myeloblastosis Virus (AMV) Reverse Transcriptase (New England BioLabs) and 10x AMV RT Buffer will be used for this reaction. RNase inhibitor (New England BioLabs) and a dNTP set (Thermo Scientific) will also be used. Follow the protocol below: 1. Add 2 μL of mRNA to 0.5 μL of 1 μM primer 2. Anneal the primer by placing samples in the boil block for 2 minutes a. Follow with a quick spin 3. Place the samples on ice for 10 minutes 4. Add the following to each tube containing the annealed mRNA and primer: Table 19: AMV Reverse Transcription Master Mix Table 19: AMV Reverse Transcription Volume (μL) Reagents 5x AMV RT Buffer 1 0.125 100 mM dGTP 0.125 100 mM dATP 0.125 100 mM dCTP 0.125 100 mM dTTP 0.2 AMV_RT 0.93 RNase Free H2O 2.88 Total Volume 5.
6.
7.
8.
9.
Incubate samples for 1 hour at 40 °C Put 8 μL of sample into a new tube with 8 μL 1x formamide dye Boil samples for 3 minutes and load on a small urea gel with a DNA ladder Image gel on LI-­‐COR Odyssey Imager Stain gel with in 100 mL 0.5x TBE and 10 μL EtBr for 10 minutes 65 10. Image gel on BioRad Molecular Imager Gel Doc™ 2.4 Commonly Used Protocols and Buffers Table 20: LB media recipe Table 20: LB Media, prepared in 2L Erlenmeyer flask Amount Reagents 500 mL RNase free H2O Tryptone (f casin) 10 g 5 g Yeast Extract 10 g NaCl Dissolve by stirring on a stir plate Fill to 1 L RNase free H2O Autoclave LB media 1 L Total Volume Table 21: 1000x AMP recipe Table 21: 1000x AMP Amount Reagents 100 mg Ampicillin RNase Free H2O Fill to 1 mL 1 mL Total Volume Table 22: TE Buffer pH 8.0 Table 22: TE Buffer Volume Reagents 400 μL 1 M tris HCl 80 μL 8 M EDTA RNase Free H2O Fill to 40 mL 40 mL Total Volume Sterilize using Millipore 50 mL centrifuge filter 66 Table 23: APS recipe Table 23: APS Reagents APS RNase Free H2O Total Volume Amount 0.1 g Fill to 1 mL 1 mL Table 24: 5x TBE buffer pH 8.0 Table 24: 5x TBE Buffer 5x Stock Concentration Reagents 445 mM Tris Base 445 mM Boric Acid EDTA (pH 8.0) 10mM RNase free H2O Total Volume Amount 54 g 27.5 g 20 mL Fill to 1 L 1 L Table 25: Urea Dye recipe Table 25: Urea Dye Reagents Urea TBE Bromophenol Blue (BPB) RNase free H2O Total Volume Concentration 6 M 0.5x Amount 0.36 g 100 μL 10 μL Fill to 1 mL 1 mL Table 26: 1% Ethidium Bromide recipe Table 26: 1% Ethidium Bromide (EtBr) Amount Reagents 1 g Ethidium Bromide 100 mL RNase Free H2O 100 mL Total Volume EtBr should be stored in foil and at 4 °C 67 Table 27: Y1 Buffer Table 27: Y1 Buffer Amount Reagents 4.72 g D-­‐sorbitol 8 mL 0.5 M EDTA Fill to 20 mL RNase free H2O Adjust pH to 7.4 with 1 M HCl Fill to 40 mL RNase free H2O 40 mL Total Volume Table 28: FA running buffer Table 28: FA Running Buffer Volume (mL) Reagents 50 10x FA Buffer 37% Formaldehyde 10 440 RNase free H2O 500 Total Volume Table 29: FA gel loading buffer Table 29: FA Gel Loading Buffer Reagents 500 mM EDTA pH 8 37 % Formaldehyde 100 % glycerol 100 % N,N-­‐dimethyl formamide 10x FA Buffer RNase free H2O Total Volume Volume 80 μL 720 μL 2 mL 3.084 mL 4 mL Fill to 10 mL 10 mL 68 Table 30: Hydroxyl radical buffer Table 28: Hydroxyl Radical Buffer Volume (μL) Reagents 384 500 mM HEPES Buffer pH 7.8 240 100 mM MgCl2 480 500 mM NH4Cl 120 100 mM DTT 776 RNase free H2O 2000 μL Total Volume DNA Phenol Chloroform (PC) Extraction: 1. Add equal volume of phenol chloroform (Fisher Scientific) to the DNA that was in the original sample a. 500 μL of linearized DNA prepared, therefore 500 μL PC was added 2. Vortex for 20 seconds and centrifuge for 2 minutes 3. Discard the bottom layer 4. Add the equal volume of chloroform a. 500 μL of linearized DNA prepared, therefore 500 μL chloroform was added 5. Vortex for 20 seconds and centrifuge for 2 minutes 6. Discard the bottom layer 7. Add the equal volume of isopropanol that was in the original sample a. 500 μL of linearized DNA prepared, therefore 500 μL isopropanol was added 8. Add 1/10 of the volume of 3M NaOAc that was in the original sample a. 500 μL of linearized DNA prepared, therefore 50 μL 3M NaOAc was added. 9. Vortex 20 seconds 10. Precipitate at -­‐20 °C overnight DNA Ethanol Precipitation: 1. Centrifuge DNA at 13,500 rpm for 30 minutes at 4 °C 2. Carefully remove supernatant 3. Add 75% cold Ethanol, do not add more than 50 μL 4. Centrifuge DNA at 13,500 rpm for 5 minutes at 4 °C 5. Carefully remove supernatant 6. Place parafilm over centrifuge a. Poke holes with pipette tips 7. Place in vacuum for 5 minutes to remove excess ethanol 69 8. Resuspend pellet in 100 μL TE Buffer concentration is checked using NanoDrop 1000 spectrophotometer RNA Phenol Chloroform (PC) Extraction: Procedure is the same as DNA except instead of adding isopropanol and 3M NaOAc make the following changes: 1. Add 250 mM of NaCl from a stock concentration of 4M a. (250 mM)(500 μL)=(4,000 mM)(V2) V2= 31.25 μL 2. Add 2.5x more than the initial volume of 95% ethanol a. (2.5)(500 μL)= 1,250 μL RNA Ethanol Precipitation: This procedure is done the same as before except RNA is resuspended in 100 μL of RNase free H2O. Denaturing PAGE: A 50 mL centrifuge tube is used to mix the following: Table 31: Analytical Denaturing PAGE recipe (2 gels) Table 31: Denaturing PAGE Amount Reagents 4.09 g Urea 40% acrylamide 3.98 mL 1.59 mL 5x TBE RNase free H2O Fill to 10 mL 10 mL Total Volume While the urea is dissolving prepare the 0.75 mm plates. Check for leaks using 75% ethanol. Once the urea has dissolved add 100 μL APS and 10 μL TEMED (Fisher Scientific), vortex. Pour the solution to fill both of the plates and insert combs. Allow gel to polymerize, approximately 20 minutes. Fill apparatus chambers with 0.5x TBE buffer. Pre-­‐run gel for 30 minutes at a constant wattage, settings on 1000 volts, 150 mA, and 15 watts. 70 Gel Purification: Prepare samples 1. Add 100 μL of Urea Dye to the RNA 2. Boil the sample for 10 minutes, spin down 3. Run the gel at a constant wattage, settings on 1000 volts, 150 mA, and 15 watts 4. Run the gel until the dye runs out, approximately 11 minutes Band Excision 5. View the band using UV shawdowing 6. Excise the RNA band using a sterile razor blade Electroelution 1. Clamp the bottom of the dialysis tubing 2. Add 3 mL of 0.25x TBE buffer 3. Place the excised band into the bag and clamp the top, trying to avoid bubbles 4. Place the tubing into the electrophoresis apparatus 5. Run for 1 hour at 55 V 6. Switch positive and negative and run for less than a minute to prevent RNA from sticking to dialysis tubing Buffer Exchange via dialysis and vacuum concentration of RNA 1. Place the tubing in a 500 mL sterile beaker with a stir bar a. Add 500 mL of RNase free H2O 2. Change the water after 2 hours of dialysis then allow buffer exchange to continue overnight 3. Transfer RNA to centrifuge tubes a. Get approximately 2-­‐3 tubes 4. Parafilm the top with holes and place in the vacuum until liquid is gone resuspend the pellet in 100 μL of RNase free H2O Dialysis tubing preparation: 1. Cut off a long piece of spectrapor membrane tubing (Scientific Products). Boil the tubing for 10 minutes in solution A: 71 Table 31: Solution A recipe Table 31: Solution A Reagents 0.5 M EDTA (pH 8.0) Sodium bicarbonate RNase free H2O Total Volume Concentration 1 mM 2 % Amount 800 μL 8 g Fill to 400 mL 400 mL 2. Rinse tubing in RNase free H2O 3. Boil the tubing for 10 minutes in solution B: Table 33: Solution B recipe Table 33: Solution B Reagents 0.5 M EDTA (pH 8.0) RNase free H2O Total Volume Concentration 1 mM Amount 800 μL Fill to 400 mL 400 mL Store tubing at 4 °C in RNase free water 72 Chapter 3: Results 3.1 4300 LiCor Sequencer Optimization To successfully identify the binding site of tetracycline and map the conformational change that occurs upon tetracycline binding, we need to resolve fragmented RNA on a large format gel. To optimize techniques we used an 8 x 8 inch 10% denaturing PAGE, but to obtain sufficient resolution and interpret footprinting patterns, a large format gel is needed. Most commonly a large sequencing gel is used, in our case a 35 cm x 45 cm and 0.4 mm thick gel, but there are several problems with using this method. After the gel was run it must be transferred to a saran wrap, without creating tears or bubbles, and taken to a LI-­‐
COR Odyssey Imager for band intensities to be visualized. It is very difficult not to create bubbles while doing this process (Figure 25). The gel can also be transferred to a chromatography paper and then dried, which gets rid of any bubbles and is much easier to transfer to the scanner. The problem with doing this in our case is
that the chromatography paper used for gel drying is fluorescent in the IR range and the resulting image shows a green background that obscures footprinting patt
Figure 25: Large footprint gel that has been transferred to a saran wrap and imaged using an LI-­‐COR Odyssey Imager. Visible tears and bubbles interfere with the visualization of footprinting patterns. The second option is to use an automated sequencer, the 4300 LI-­‐COR Sequencer. This equipment has much higher sensitivity and thus allows detection of weaker bands. As samples are run data is collected in real-­‐time, which eliminates the issues with transferring, drying, and scanning the gel on another imager. The problem with using this sequencer is it has not been used in about 6 years and onsite expert help is not available to provide training. We essentially have taught ourselves how to troubleshoot and the machine was operated with the help of an offsite technician from the manufacturer. We had to run a set of diagnostic tests that were sent over to the company technician to troubleshoot each error. Other 74 times the sequencer was run remotely through the company website to update the software. In the process of running gels we fixed the following errors: “Wedge error” “Wedge error”, indicated that the detector was out of focus. To fix this error the plates were cleaned, the side rails flushed against the heater and the plates were positioned evenly against the buffer reservoir. These adjustments eliminated the “wedge error”. Focusing The gel visually appeared out of focus and footprinting patterns were not visible (Figure 26). The company technician inquired about the type of gel matrix we were using. At the time a self-­‐made 10% denaturing PAGE solution was used. Due to compatibility with the machine, a 6.5% gel matrix made by LI-­‐COR was suggested. All further runs used this gel matrix along with the companies’ formamide dye. By using the 6.5% gel matrix the focusing has been better. 75 Figure 26: 4300 LI-­‐COR sequencing gel ran with 10% denaturing PAGE solution. “Gel Leakage” There was noticeable leakage from the upper gasket tank, which automatically shuts down the machine due to the potential risk of shocking the user with high voltage. The company technician suggested replacing the buffer gasket tubing to prevent any potential leaks. The buffer gasket tubing has eliminated the “Gel Leakage” error. Optimizing Run Time The first trials were run for 5 hours but the visualization was masked by excess dye or unincorporated UTP (Figure 27). To ensure that our samples were good quality the same samples were ran for 30 minutes and then imaged with the LI-­‐COR Odyssey Imager. Due to the lower sensitivity this is not optimal for analysis but it did give insight that our samples were of good quality (Figure 28). 76 Figure 27: Samples run for 5 hours on 4300 LI-­‐COR Sequencer Figure 28: Samples run for 30 minutes and imaged on LI-­‐COR Odyssey Scanner. 77 We decided to run the samples again but for 8 hours to try and increase separation along with loading the samples one lane apart. The resulting image was much better (Figure 29). At this point we were ready to continue with our experiments and run more samples. Figure 29: Samples run for 8 hours and loaded one lane apart on the 4300 LI-­‐COR Sequencer. “Probable Gel Leakage” error Following suggestions of the user manual we made sure that the top of the back plate was clean, excess acrylamide was not in or around the side rails, and we cleaned the bottom of the plates. This did not solve the problem. After drying and 78 cleaning the bottom reservoir it appeared to be cracked. Once the new reservoir arrives we will continue running sequencing gels. 3.2 Studying the change in ykkCD pump mRNA levels in response to tetracycline and its derivatives a.) Primer design and annealing methods To study how expression levels of the ykkCD pump ORF changes a primer had to be designed that annealed to the ykkC efflux pump coding region. Primer design is very important for the following reasons: [1] the reverse transcriptase pauses after every 200-­‐300 nucleotides thus the primer has to anneal within 200 nucleotides of the region of interest and [2] the primers need to be long enough to give a high enough melting temperature (Tm) to selectively bind to a specific sequence. A program called Primer3 was used that generates several primers that zoom into different regions of the RNA. We selected the primer discussed previously, RT_confchange. The primer sequence was, 5’ ACCACCCAAACAACCTCAAA 3’ and anneals to the RNA in the ykkC efflux pump region. To visualize the footprinting patterns a primer extension protocol had to be optimized. To successfully amplify the DNA the primer has to properly anneal to the RNA. There are two methods that can be used to anneal the primer to the RNA. One method involves quickly heating and cooling the RNA-­‐DNA mixture (heat shock), while the other allows the temperature to slowly decrease after heating (slow cool). 79 Both methods are commonly used so we wanted to determine which method worked best for our primer. As seen in Figure 28 both methods produce labeled DNA band. At first it seems that either method will work, but after staining the gel with ethidium bromide it is clear that by using the heat shock method the quantity of DNA amplified is much greater (Figure 30 and 31). We have choosen to use the heat shock method to ensure that the primer successfully anneals to the RNA. Slow Cool
Heat Shock
RT
RT Bands Figure 30: Primer extension optimization. DNA bands are RT synthesized and are labeled with IR_700 dye at the 5’ end. Two methods were used to anneal the primer to the RNA, heat shock and slow cool. Gel is scanned using LI-­‐COR Odyssey Imager. 80 Slow Cool
Heat Shock
RT
Figure 31: Ethidium bromide stained gel imaged using BioRad Molecular Imager Gel Doc™. Using the heat shock method a larger amount of amplified DNA is present. As mentioned previously mRNA isolated from cells grown with and without antibiotics were used for this study. To ensure that gene expression is altered, only SIC level antibiotic concentration that showed a reduction in growth of about 50-­‐
60% was prepped. The mRNA was then extracted from the cell cultures and the genomic DNA present in the total RNA extraction was moved to prevent any “false/positive” annealing of the primer. To make sure that the RNA is of good quality the samples are analyzed on a denaturing agarose gel prior to primer 81 extension. Figure 32 is an example of two mRNA samples, one grown with no antibiotics and the other grown with tetracycline. Tetracycline
No Antibiotic
mRNA
Figure 32: mRNA samples ran on a denaturing agarose gel. Only samples that showed two distinct bands, corresponding to the 16S and 18S rRNA, were used for gene expression analysis. Since mRNA concentrations are very low, mRNA had to be concentrated and reaction conditions optimized to obtain strong band intensities. Once RT reaction conditions were optimized band intensities increased and samples were ready to be run on a larger format (Figure 33). 82 [B] No Antibiotic
Tetracycline
RT
Tetracycline
RT
Tetracycline
RT
No Antibiotic
No Antibiotic
[A] Figure 33: Denaturing PAGE scanned using LI-­‐COR Odyssey Imager. [A] Initial reaction conditions. [B] Optimal RT conditions. RT reaction conditions were optimized leading to a significant increase in band intensity. b.) Tetracycline, anhydrotetracycline, and oxytetracycline seem to upregulate the expression of the ykkCD efflux pump The optimized reverse transcriptase protocol was used to analyze the change in expression of the ykkCD efflux pump in the presence of tetracycline and it’s derivatives. To ensure that comparison of band intensities reflects difference in gene expression we had to ensure that the same amount of mRNA is used in each experiment. The primer anneals 220 nucleotides in from the promoter of the ykkC 83 mRNA. After reverse transcription samples were resolved on the 4300 LI-­‐COR sequencer. Indication of an RT band is present in the range of 200-­‐400 nucleotides long for tetracycline, anhydrotetracycline and doxycycline. This matches the expected nucleotide length of 220 nucleotides. Since the primer anneals at the ykkC ORF the RT band intensities correspond to the ykkC mRNA concentrations. When ykkC mRNA levels are upregulated a stronger band intensity is expected. Since no detectable band intensities were observed in the absence of antibiotic or with doxycycline and minocycline we concluded that no significant ykkC pump mRNA is present under these conditions (Figure 34 and 35). 84 MW Ladder
No Antibiotic
Tetracycline
Anhydrotetracycline
Oxytetracycline
Minocycline
Oxycycline
Primer Extension
200-400 NT RT Bands
Excess Primer
Figure 34: 4300 LI-­‐COR Sequencer image shows upregulation of gene expression by the antibiotics tetracycline, anhydrotetracycline, and oxytetracycline. 85 200-400 NT RT Bands
Figure 35: Enlarged region of RT bands. Band intensities were quantified using a program called Quantity One. Band Excess Primer
intensities are in direct correlation with gene expression levels. Bar graph shows the band intensities based on three separate experiments. Figure 36 indicates an increase in efflux pump mRNA levels in cells grown with tetracycline, oxytetracycline, and anhydrotetracycline. 86 Figure 36: Bar graph indicating up-­‐regulation of ykkC gene expression in tetracycline, anhydrotetracycline, and oxytetracycline. 3.3 Mapping the structure of the tetracycline binding site via nuclease protection a.) Optimization of sequencing ladders and nuclease protection protocol Nuclease protection is used to map the tetracycline-­‐binding site of the ykkCD putative riboswitch. The RNA template used is the ykkC RNA aptamer, including the tetracycline-­‐binding site. The RNA template is in vitro synthesized via transcription. As mentioned previously to visualize the footprinting patterns the template RNA had to be labeled at the 5’ end. Labeling techniques had to be optimized to successfully visualize the footprinting patterns. RNAs were labeled using a company synthesized IR_700_UTP to increase incorporation of the IR_700 dye. To label RNA 87 at the 5’ end labeling, a phosphatase and a kinase treatment was used. Figure 37 shows efficient 5’ end labeling of the RNA. Figure 37: [1] Previously labeled RNA with self synthesized IR_700 UTP [2] The labeled RNA, using the company synthesized UTP, is checked on the gel before excising the band to make sure it has moved out of the well and to ensure labeling. Now that our RNA template was appropriately labeled the nuclease protection protocol needed to be optimized. A set of ladders, OH and T1 were used to matchup cleavage bands with specific nucleotides. The OH ladder cleaves after every nucleotide while the T1 nuclease ladder cleaves after every G nucleotide in ss RNA. To generate footprinting patterns, or to fragment the RNA, two nucleases were used, RNase V1 (ds specific) and RNase A (ss specific). A serial dilution is performed for each nuclease to ensure appropriate fragmentation. A denaturing PAGE is used to visualize cleavage patterns (Figure 38 and 39). Small denaturing PAGE were great for protocol optimization but samples had to be resolved on a 88 larger format sequencing gel to analyze footprinting patterns. After optimization the samples were ready to be run on the 4300 LI-­‐COR Sequencer. 0.2 U/uL
100 U/uL
20 U/uL
1 U/uL
Control
RNase V1 RNase A
Figure 38: Optimization of nuclease protection. Samples were loaded onto a small format gel to determine RNA quality and to optimize the amount of nuclease used. A no cleavage (NC) sample was loaded as a control. The band intensities were adequate for analysis; but nuclease amounts used needed further optimization. 89 200 U/ul
1000 U/uL
10 minutes
5 minutes
2 minutes
Untreated
Control
T1 Ladder
OH Ladder
Figure 39: Denaturing PAGE gel of OH and T1 ladder. To analyze the footprinting patterns created by nuclease protection, samples were run on the 4300 LI-­‐COR Sequencer (Figure 40). After the first run it was clear that our nuclease was not cleaving the RNA, because the RNA concentration was too high. Since band intensities were adequate, a ten-­‐fold dilution of RNA was done to increase nuclease cleavage. Furthermore, to try and increase band separation a 10% gel matrix solution was used (Figure 41). 90 100 U/ul
20 U/ul
0.2 U/ul
No Cleavage
Control
1 U/uL
Digestion
RNase A
RNase V1
OH Ladder
2 minutes
5 minutes
15 minutes
1000 U/uL
200 U/uL
40 U/uL
8 U/uL
No Cleavage
T1 Ladder
Figure 40: Nuclease protection samples ran on a 6.5% 4300 LI-­‐COR Sequencer gel. RNA concentration seems to be too high for the nuclease to sufficiently “cut” the RNA. 91 1.25 U/ul
4 U/ul
20 U/ul
100 U/ul
0.04 U/ul
0.008 U/ul
0.2 U/ul
1 U/uL
No Cleavage
15 minutes
10 minutes
5 minutes
Control
OH Ladder
40 U/uL
200 U/uL
1000 U/uL
No Cleavage
T1 Ladder
Digestion
RNase A
RNase V1
Figure 41: Nuclease protection samples, using a ten-­‐fold dilution of RNA, ran on a 10 % 4300 LI-­‐COR Sequencer gel. Since the 10% gel matrix was home made a significant background prevented detailed analysis of samples. We will re run samples using a 6.5% company made gel. 92 3.4 Mapping the structure of the tetracycline binding site via hydroxyl (OH) radical footprinting a.) Optimization of hydroxyl radical protocol As mentioned previously hydroxyl radical fragmentation is not sensitive to secondary structure, but is a great compliment to nuclease protection. The hydroxyl radical protocol had to be optimized to ensure appropriate fragmentation occurred. To optimize the protocol different reaction times were used: 3, 5, and 10 minutes. Samples were resolved on a denaturing PAGE. It is clear that the RNA was completely digested (Figure 42). 10 minutes
5 minutes
3 minutes
Hydroxyl Radical
Figure 42: OH radical samples, prepped at different time intervals, ran on a denaturing PAGE. RNA seems to have been completely “chewed” up. 93 After analyzing the denaturing PAGE it seemed that the reaction mixture completely degraded the RNA. We feared that our reaction mixture was not completely RNase free so to help with this problem we included an RNase inhibitor to prevent RNA degredation not caused by OH radicals but by contaminating nucleases. The samples were then run on the 4300 LI-­‐COR Sequencer (Figure 43). 3 minutes w/inhibitor
5 minutes w/inhibitor
10 minutes w/inhibitor
10 minutes
5 minutes
3 minutes
Hydroxyl Radical
Figure 43: OH radical samples prepped with and without RNase inhibitor ran on the 4300 LI-­‐COR Sequencer. 94 3.5 Mapping the structure of the tetracycline binding site via self-­‐cleavage of the RNA. a.) Optimization of in-­‐line probing Generating footprinting patterns via self-­‐cleavage (in-­‐line probing) appears a very simply process but optimization of the protocol still needs to be done for each RNA. 5’ end labeled RNAs were prepped with and without tetracycline and incubated at room temperature for 2 days (Figure 44). They were resolved on a large footprinting gel. Comparison with untreated RNA clearly shows that no cleavage patterns were generated. In line probing is not a widespread used technique to fragment RNA. It appears to work for a few laboratories and is not adopted by others. Thus we decided not to further explore this technique. 95 Tetracycline
No Antibiotic
Control
In-line
Figure 44: In-­‐line probing samples prepped without antibiotic and with tetracycline resolved on a denaturing PAGE. A control sample is loaded along with these samples to determine if any self-­‐cleavage occurred. 96 Tetracycline
No Antibiotic
Control
In line Probing
Figure 45: In-­‐line probing samples prepped without antibiotic (NA) and with tetracycline (T) ran on 4300 LI-­‐COR Sequencer. A control sample (C) is run as well to determine if any self-­‐cleavage occurred. b.) Optimization of Tb3+ footprinting Self-­‐cleavage of the RNA using Tb3+ has more potential than inline probing because extensive optimization of the protocol is possible. Since it has been seen using previous techniques that adequate RNA concentration needs to be optimized for fragmentation, the protocol was duplicated using stock RNA concentration and a ten-­‐fold dilution. Different concentrations of Tb3+ and time intervals were used to determine optimum conditions. Tb3+ concentrations of 0.3, 5, and 25 mM were used 97 and the reaction was allowed to go for 15 minutes and 2 hours (Figure 46). Noticeable cleavage is seen, but more time points need to be taken to determine optimal time for Tb3+ fragmentation. 0.3 mM, 2 hours
5 mM, 2 hours
25 mM, 2 hours
0.3 mM, 15 minutes
5 mM, 15 minutes
25 mM, 15 minutes
Control Stock
0.3 mM, 15 minutes (D)
5 mM, 15 minutes (D)
25 mM, 15 minutes (D)
0.3 mM, 2 hours (D)
5 mM, 2 hours (D)
25 mM, 2 hours (D)
Control Dilute (D)
Terbium Fragmentation
Figure 46: Tb3+ footprinting samples were resolved on 4300 LI-­‐COR Sequencer. Noticeable cleavage is seen, but protocol need to be further optimized.
98 Chapter 4: Discussion 4.1 Upregulation of expression of the ykkCD efflux pump by tetracycline, anhydrotetracycline, and oxytetracycline Mapping the structural change that takes place in the expression platform upon tetracycline binding has a challenge, choosing the optimal RNA template. It has previously been shown that the RNA template containing the aptamer domain, the expression platform, and the ykkCD ORF is not the perfect choice. This RNA template is transcribed in vitro and may not show the structural changes that are taking place in vivo. Alternatively, total mRNA from Bacillus Subtilis cells grown without antibiotics and with tetracycline and its derivatives can be isolated and is a great in vivo template. mRNA can be subjected to cleavage by ds and ss specific nucleases. The only problem with using this template is that its concentration is very low. mRNAs are about 10% of the total cellular RNA and the ykkCD ORF mRNA is only a small percent of this cellular mRNA. Based on analysis of primer extension bands using mRNA as template it is clear that band intensities are not adequate to visualize any cleavage generated by the nucleases, therefore it cannot be used to map the structural change caused upon tetracycline binding. An RNA template can be synthesized in vitro using Bacillus subtilis polymerase to analyze the
conformational change of the expression platform. This allows the RNA structures to more closely resemble structure found in vivo. This RNA template would enable s polymerase from Bacillus subtilus has been prepped and the transcription protocol is optimized, this analysis will be a great project for a future member of the lab. Even though mRNA cannot be used to map the structural change caused by tetracycline it is a great in vivo method to determine how gene expression levels change in response to antibiotics. It is clear that increase in the ykkC efflux pump mRNA levels occur in the presence of tetracycline, anhydrotetracycline, and oxytetracycline. No pump mRNA was detected in the absence of antibiotic and in the presence of minocycline and doxycycline. Roark and James have shown that tetracycline binds to the ykkCD sensor. Frecker has also shown using qRT-­‐PCR that tetracycline increased the ykkC mRNA levels by a factor of 4 and the ykkD mRNA levels by a factor of 1.7. The KD value of the ykkCD RNA-­‐tetracycline complex, was determined to be 10.7±4.5 nM. Frecker used a tetracycline concentration of 27.7 μM when performing qRT-­‐PCR. During primer extension the tetracycline concentration used was the same, 27.7 μM (Table 34). It is reasonable to assume that the cellular tetracycline concentration is within an order of magnitude of this value. Since the concentration is at least 10 times greater than the KD value the ykkCD mRNA should be fully saturated with tetracycline and therefore gene expression is expected to increase. Since in fact this does occur, we can confidently say that tetracycline is recognized by the ykkCD RNA sensor and efflux pump mRNA is produced in the presence of tetracycline. 100 Roark and James also indicated that the ykkCD sensor recognizes minocycline and anhydrotetracycline. The KD value of ykkCD RNA-­‐minocycline complex is 97.4±17.2 nM, which is a significantly higher value than tetracycline, indicating reduced binding. The concentration of minocycline used for both qRT-­‐
PCR and primer extension was 22 nM (Table 34). Based on binding isotherms the ykkCD RNA is expected to be about 30% saturated with minocycline and thus no significant upregulation is expected. This is consistent with the results of primer extension. Frecker showed that minocycline increased gene expression of the ykkC mRNA by a factor of 2.5 and the ykkD mRNA by a factor of 3.4. This discrepancy could be due the fact that Frecker’s method is much more sensitive than primer extension. The KD value of anhydrotetracycline is 24.5±9.2 nM, which is similar to tetracycline. The concentration of anhydrotetracycline used for primer extension was 648 nM (Table 34). This is much higher than the saturation level, typically set above 10 times the KD value. Frecker is in the process of repeating qRT-­‐PCR assays using anhydrotetracycline but data is unavailable to date, yet thus we cannot compare our data to his qRT-­‐PCR analysis. In agreement with binding data primer extension shows a clear increase of ykkC pump mRNA levels in the presence of anhydrotetracycline and therefore we can confidently say that anhydrotetracycline is recognized by the ykkCD RNA sensor and efflux pump mRNA is produced in the presence of anhydrotetracycline. 101 Roark and James also indicated that the ykkCD sensor does not recognize doxycycline and oxytetracycline. Frecker also indicated no increase in gene expression by doxycycline. Dr. Timea Gerczei has repeated binding assays to determine the KD values. The KD value of doxycycline is above 1 μM, a much weaker binding affinity than that of the ykkCD RNA-­‐tetracycline complex. The concentration used for both qRT-­‐PCR and primer extension was 1.6 μM (Table 34). This is not close to the saturation level and therefore no upregultion is expected. Consistent with binding and qRT-­‐PCR data, doxycycline also did not show any upregulation of gene expression by primer extension. Therefore we can confidently say that the ykkCD sensor does not recognize doxycycline and will not increase production of the ykkCD efflux pump mRNA. Primer extension has shown upregulation of gene expression in the presence of oxytetracycline. This does not agree with the qRT-­‐PCR. Although, the qRT-­‐PCR data was performed on only one sample and needs to be repeated in duplicate to get conclusive results. To reconcile this discrepancy we have to compare the oxytetracycline concentration used to produce mRNA from primer extension with the KD value of the ykkCD RNA-­‐oxytetracycline complex. The KD value based on recent binding assays was estimated to be 4-­‐5 μM. The concentration used for qRT-­‐
PCR and primer extension is 40.3 μM (Table 34). Since cells were very tolerant to oxytetracycline, even though oxytetracycline is barely recognized by the ykkCD RNA, at 40.3 μM oxytetracycline concentration is at the saturation level and therefore increase in gene expression is expected. Primer extension does in fact 102 show an increase in gene expression. This is not surprising due to the SIC value of oxytetracycline being so much larger than the KD. Table 34 : KD values of ykkCD RNA-­‐antibiotic complexes determined using in vitro transcribed ykkCD RNA using fluorescent quenching compared to SIC values for different antibiotics. Antibiotic KD SIC Value Tetracycline 10.7±4.5 nM 27.7 μM Minocycline 97.4±17.2 nM 22 nM Anhydrotetracycline 24.5±9.2 nM 648 nM Doxycycline 1 μM 1.6 μM Oxytetracycline 4-­‐5 μM 40.3 μM Due to the comparisons made between the binding assays, qRT-­‐PCR, and primer extension we can conclude that tetracycline, anhydrotetracycline, and oxytetracycline increase the production of ykkCD efflux pump mRNA in the presence of these antibiotics. In the absense of antibiotics the ykkCD efflux pump mRNA was not produced, which was expected. Minocycline and doxycycline also did not show production of the ykkCD efflux pump mRNA. 4.2 Mapping the structure of the tetracycline binding site a.) Nuclease Protection Nuclease protection is a great choice to use as the first method for identifying ligand-­‐binding site. Nuclease protection is well established and can be used under a wide variety of conditions and it is sensitive to change in the secondary structure. We chose two nucleases; one that can cleave ss regions while the other can cleave ds 103 regions. To determine the ligand binding site using nuclease protection both of these nucleases need to be used and the combination of these results will reveal the binding site. In addition, since nucleases are large they do not uncover if the ligand binds to the backbone or the base of the RNA. We have had problems visualizing cleavage of the RNA and believed it to be our RNA concentration was too high. Once we lowered the RNA concentration our sequencer broke and we were unable to get adequate data. This protocol can still be optimized but additional methods need to be used to map the binding site with high resolution and show precise positioning of ligand. b.) Hydroxyl Radical Hydroxyl radical fragmentation is a great secondary method because it complements nuclease protection. Hydroxyl radicals cleave the sugar phosphate backbone of the RNA where it is accessible. Since radicals are much smaller than nucleases, they can get closer to the ligand-­‐binding site. Since nuclease protection has a low resolution while hydroxyl radicals have a high resolution they are great complementary primary methods. After our first attempt at hydroxyl radical fragmentation we feared that our reaction mixture was not completely RNase free, since we got complete degradation of the RNA To help, we included RNase inhibitor into the reaction mixture. Based on our preliminary results, I believe our total RNA concentration needs to be increased to produce an interpretable footprint. To do this we can supplement our RNA with tRNA or increase the ykkCD RNA. 104 c.) Self-­‐cleavage of RNA Self-­‐cleavage of RNA is a very simple process and can be done in two manners; in-­‐line probing or enhanced self-­‐cleavage by Tb3+. We have shown that in-­‐
line probing does not work for our RNA. The problem with this method is that it either works or not, there is not much room for optimization. Self-­‐cleavage by using Tb3+ seems to be the most useful technique for our lab. But the technique needs to be further optimized once the 4300 LI-­‐COR Sequencer becomes available. From our first trial we can see that by using a TbCl3 concentration of 25 mM for 2 hours, whether using stock or dilute RNA, the RNA is “chewed” up completely. We can also see that by using our dilute RNA the cleavage bands occur sooner, within 15 minutes. But cleavage patterns completely disappear after 2 hours. When using concentrated RNA the reaction needs to proceed longer to see any cleavage bands, none were seen within 15 mintues. We will use dilute RNA to perform further experiments at TbCl3 concentrations of 0.3 mM and 5 mM. We will also incorporate more time intervals, 15, 30, and 60 minutes, to improve the quality of the footprinting pattern. Going forward our first method of choice for RNA fragmentation is enhanced self-­‐cleavage by Tb3+. Further optimization needs done but it seems to be a very promising technique. Hydroxyl radical fragmentation requires a higher RNA concentration while nuclease protection requires a lower RNA concentration. Due to technical problems with the sequencer these samples were prepared but could not be resolved on the LI-­‐COR Sequencer. Thus their analysis is beyond the scope of 105 my thesis. Once the replacement part for the sequencer arrives these samples can be resolved on a gel and footprinting patterns can be analyzed. 106 References 1. about.com The History of Penicillin. http://inventors.about.com/od/pstartinventions/a/Penicillin.htm (accessed May 12). 2. CDC Antimicrobial resistance in U.S. healthcare and community settings. http://www.cdc.gov/media/releases/2011/f0407_antimicrobialresistance.html (accessed May 12). 3. eMedExpert Interesting facts about antibiotics. http://www.emedexpert.com/tips/antibiotics-­‐facts.shtml (accessed May 12). 4. Linares, J. F. G., I.; Baquero, F.; Martinez, J.L., Antibiotics as intermicrobial signaling agents instead of weapons. PNAS 2006, 103 (51), 6. 5. CDC Why are bacteria becoming resistant to antibiotics. http://www.cdc.gov/narms/faq.html -­‐ bacteria (accessed May 12). 6. Tenover, F. C., Mechanisms of Antimicrobial resistance in bacteria. The American Journal of Medicine 2006, 119 (6), S3-­‐S10. 7. Webber, M. A. P., L.J.V, The importance of efflux pumps in bacterial antibiotic resistance. Journal of Antimicrobial Chemotherapy 2002, 51 (1), 3. 8. Coppins, R. L. H., K.B.; Groisman, E.A, The intricate world of riboswitches. Curr Opin Microbiology 2007, 10 (2), 176-­‐181. 9. Patel, S. A., Ribozymes, riboswitches and beyond;regulation of gene expression without proteins. National Rev Genet 2007, 8 (10), 76-­‐90. 10. Batey, M. A., Riboswitches: emerging themes in RNA structure and function. Annual review of biophysics 2008, 37, 117-­‐33. 11. Mandal, M. A. B., R., Adenine riboswitches and gene activation by disruption of a transcription terminator. Nature Structural and Molecular Biology 2004, 11 (1), 29-­‐35. 12. Jack, D. L. S., M.L.; Tchieu, J.H.; Paulsen, I.T.; Saier M.H., A broad-­‐specificity multidrug efflux pump requiring a pair of homologous SMR-­‐type proteins. JOurnal of Bacteriol 2000, 182 (8), 2311-­‐2313. 13. Winkler, W. C. a. B., R.R., Regulation of bacterial gene expression by riboswitches. Annual review of biophysics 2005, 59, 487-­‐517. 107 14. Bauer, G. F., B.; Suess, B., Molecular analysis of a synthetic tetracycline-­‐
binding riboswitch. RNA 2005, 11 (4), 503-­‐511. 15. McCaffrey, R. L. F., P.; O'Riordan, M.; Lee, K.; Havell, E.A.; Brown, P.O.; and Portnoy, D.A., A specific gene expression program triggered by Gram-­‐positive bacteria in the cytosol. PNAS 2004, 101 (31), 11386-­‐11391. 16. Howe, W. The mechanism of gene expression regulation by the ykkCD putative riboswitch. Ball State University, Muncie, In, 2009. 17. (a) Roark, K. Mapping the structure of the "on" and "off" states of the ykkCD putative riboswitch in Bacillus subtilis. Ball State University, Muncie, IN, 2009; (b) James, D. Understanding the specificity of tetracycline recognition by a putative RNA toxin sensor: the ykkCD riboswitch. Ball State University, Muncie, IN, 2011. 18. Didenko, V. V., DNA probes using fluorescene resonance energy transfer (FRET): designs and applications. Biotechniques 2001, 31 (5), 1106-­‐1121. 19. Petri, V. B., M., Quantitative nucleic acids footprinting; thermodynamic and kinetic approaches. Curr Opin Microbiology 1997, 8 (1), 36-­‐44. 20. Goldrick, M. K., D., RNA analysis by nuclease protection. Current Protocols in Neuroscience 2003, 5, 5.1.1-­‐5.1.30. 21. Tullius, T. D. a. D., B.A., Hydroxyl radical "footprinting": high-­‐resolution information about DNA-­‐protein contacts and application to lambda repressor and Cro protein. PNAS 1986, 83 (15), 5469-­‐5473. 22. Regulski, E. E. B. R. R., In-­‐line probing analysis of riboswitches. Methods of Molecular Biology 2008, 419, 53-­‐67. 23. (a) Hargitai, M. R. a. M.-­‐F., K., Use of terbium as a probe of tRNA tertiary structure and folding. Cambridge University Press 2000, 6, 1672-­‐1680; (b) Harris, D. A. a. W., N.G., Probing RNA structure and metal-­‐binding sites using terbium (III) footprinting. Current Protocols in Nucleic Acid Chemistry 2003, 13, 6.81-­‐6.8.8. 24. (a) Ziehler, W. A. E., D.R., Probing RNA structure with chemical reagents and enzymes. Current Protocols in Nucleic Acid Chemistry 2000, 6.1.1-­‐6.1.21; (b) Merryman, C. a. N., H.F., RNA: Protein Interactions. Oxford University Press: New York, 2002; p 237-­‐253. 108