PACKING SLIP THE MIDLAND CERTIFIED REAGENT COMPANY 3112-A West Cuthbert Avenue MIDLAND, TEXAS 79701 Customer Number: NGUYEN Q Customer Name: QUOL THANG NGUYEN PO Number: Terms: Date: (800) 247-8766 Ext Bill To: QUOL THANG NGUYEN UNIVERSITY OF CA-SAN DIEGO DISBURSEMENTS DIVISION 0955 9500 OILMAN DRIVE/ PO#20326798 LAJOLLACA 92093-0955 Oligo Name Oligo Number Length Grade 20326798 NET 30 9/21/05 Ship To: Scale QUOL THANG NGUYEN QUOL THANG NGUYEN UREY HALL ROOM 7108 MC0319 9500 OILMAN DRIVE SAN DIEGO CA 92093 Lot Number Order # 1 37mer RP 1 092605-00148 OPTS00031777 5 ' - ( TXRED)( C6Amino)TAGGGATCCTCTGTGGCCCAATTTGCAACCAGCCCTA( BHQ-2)-3' TARGET 2 27mer GF .05 291905-0004C 5 ' -CTGGTTG(IAAATTGGGCCACAGAGGAT-3 ' Thank You! Not For Drug Use, For Research Only OPTS00031777 THE M I D L A N D CERTIFIED REAGENT C O M P A N Y , INC, 3112-A West Cuthbert Ave. • Midland, TX 79701 • Voice: 800-247-8766 or 915-694-7950 Fax: 915-694-2387 • e-mail: robb^if-oiimto-com • Web site: iiiip://\v\\w.iiicrc.coni Molecular Beacon Analysis The Molecular Beacon (Lot 092605-00148; 5' TXRED- TAGGG ATCCTCTGTGGCCCAATTTGCAACCAG CCCTA -BHQ2 3^) and target (Lot 291905-0004C; 5'-CTGGTTGCAAATTGGGCCACAGAGGAT -3') were analyzed in our laboratories to determine the signal-to-noise ratio ofthis pair. The analysis was performed at RT on a Hitachi F-2000 Fluorescence Spectrophotometer, utilizing a 2 ml cuvette and a buffer containing 20 mM Tris-HCl, pH 8.0, 50 mM KCI, and 5 mM MgC^. The excitation wavelength used was 583 nm and the emission wavelength was set to 603 nm. Two milliliters of buffer was added to the cuvette and the arbitrary fluorescence units were noted for the buffer alone (Fbufter)Molecular Beacon was added to the cuvette to a final concentration of 50 nM. The increase in fluorescence due to background was allowed to stabilize and the value was recorded (Fdose)- A 4-fold molar excess ofthe target solution was added and the fluorescence was monitored for a total of 2970 sees. The highest value was recorded 11^ open/- The Signal to background to noise ratio was calculated as follows: (Fopen - Fluifrcr)/(Fclose " Fhuller) 'bufTe open S/N 0.0185 0.317 4.228 14.1 Documented b This Molecular Beacon Probe is sold under a license to The Midland Certified Reagent Company, granted by the Public Health Research Institute ofthe (4ty of New York, Inc. This product comes with only limited field-of-use rights for research puiposes only, under PHRl Patent Rights. '^)k THE MIDLAND CERTIFIED REAGENT COMPANY INC. (g^tttititatc of ^nalpsf;^ No. -GP The product described below was manufactured in ttie laboratories of The IVIidland Certified Reagent Company Inc. of Midland, Texas. The analytical data reported hereon were obtained in the laboratories of The Midland Certified Reagent Company Inc. by individuals qualified to perform the analytical procedures. Details of analytical procedures are available to bona fide customers free of charge on request. PRODUCT. LOT NUMBER. 291905-0004C This custom oligodeoxynucleotide was synthesized using cyanoethy! phosphoramidite chemistry. After removal ofthe protecting groups by hydrolysis with concentrated ammonium hydroxide, the product was desalted by gel filtration chromatography (hence GF grade). GF grade oligonucleotides are generally suitable for use as sequencing primers, primers for amplification of DNA or RNA, and for many other purposes. The oligonucleotide has been dried in the ammonium salt form, althought trace amounts of otherions may also be present. The quantity of material is given in nanomoles and in A260 Units. One A260 Unit is equivalent to approximately 30-35 micrograms of DNA. The molecular weight (MW) is calculated for the free acid form ofthe DNA. Order #:OPTS00031777 Name: TARGET, 27-mer Ordered By QUOL THANG NGUYEN Sequence: 5'-CTGGTTGCAAATTGGGCCACAGAGGAT-3' Mw(g/mol) = 8364.7Tm61.2 Number ot shipping Vials: 1 Quantity: Hg/vial =132.4 nmole/vial =15.8 A?,fin / vial =4.7 W^:- Released 1 Richard V. Case, Ph.D. W^i m THE MIDLAND CERTIFIED REAGENT COMPANY INC. ,£^tttvtitatt of ^mipsi;^ No. RP The product described below was manufactured in the laboratories of The Midland Certified Reagent Company Inc. of Midland, Texas. The analytical data reported hereon were obtained in the laboratories of The Midland Certified Reagent Company Inc. by individuals qualified to perform the analytical procedures. Details of analytical procedures are available to bona fide customers free of charge on request. PRODUCT LOT NUMBER. 092605-00148 i This custom oligodeoxynucleotide was synthesized using cyanoethyl phosphoramidite chemistry. After removal ofthe protecting groups by hydrolysis with concentrated ammonium hydroxide, the product was purified by Reversed Phase HPLC (RP grade). A copy ofthe HPLC elution profile is attached to this Certificate of Analysis. With the exception of oligonucleotides containing 5' Thiol Modifier C6, the trityl-positive fractions were pooled, dried, and detritylated, The oligonucleotide was purified from the frityl group by gel filtration chromatography. The product is ftimished as the dried ammonium salt form unless otherwise indicated on theOligonucleotide Synthesis Record.The quantity of material is given in nanomoles and in A260 Unit s. One unit is equivalent to approximately 30-35 micrograms o DNA. The molecular weight (MW) is calculated for the free acid form ofthe DNA. es^ Order #: OPTS00031777 Name:, 37-mer Ordered By QUOL THANG NGUYEN Sequence: 5'-(_TXRED)(_C6Amino)TAGGGATCCTCTGTGGCCCAATTTGCAACCAGCCCTA Q-2)-3' Mw(g/mol)= 12742.1Tm69.6 Number ot shipping Vials: 6 Quantity: Hg / vial =224.5 nmole/vial =17.6 ''M Released By: i-'^^jS^s CUSTOM OLIGONUCLEOTIDE SYNTHESIS RECORD Operator A ' 2 ^ '^ «i : 75"<^ 5 6 7 8 9 10 1112 6 H Date "t /?(// t f Time Lot #_0^2^O5HHi Customer Quoi T)^A»^ Kl^uyi"*^ 13 14 15 16 Oligo Name 17 1^<|)20 Verified by PHOSPHORAMIDITES: SUPPORT: A C G T 1 U NH, V-%^-Z LL 500A lOOOA Mfgr_^|£)ni__ Lot # &Si>l-2Zii> PURGE? Net Weight grams A //,( to @ c ^mole/g G/Z.l to @ c C ff,r to @ c prepared by 6H TJOAJO _@_ ORDER INSTRUCTIONS X= Am]r.r> Of TFA Lot # Q g ^ W T g base J1 ^ ](^^ ,OZ78^ X Loading ^0 JJL jimole - ^ NO by ^f) DNA Grade: GF AE PAGE T S P ( ^ X Port Date Tfi^ON ^-^7-6 Service: ND STD AE PAGE TSP REAGENTS: Ship: 1 2 4 10 & ALL_ WashACN ivo / Tetrazole go / Capping A ^0 Capping B ^Q Ship: M Tu W Th F S OD /_ DEPROTECTION: 5 Vial Vial ## (g), ^ ' ^ °C V | t i ^ ^ _ ^ i ^ _ j g ) p by / / Hiush /(3 ^ P by TRITYLS , Total #= ^00^ Oxidizer ^0 DEBLOCKING COLUMN Date:£2l^Mi^ Tube Abs a r > v No. 52553^(545) Final Detritylating PA C / DESALTING COLUMN Absorbance at 260 nm Date: loejof Time: l(;o S^/r— un by 2 ube# 3 1 2 3 4 5 by. # ^ 6 Read by rV //L Packaged b; rev. 5/24/95 POST SYSNTIISIS LABELING LOG Tech initials P^ Oligo Lot U: Dye /^Jxiof^^S^ d^4fM^M- Manufacturer Labeling pH ^ > ' ^ %iXl*^r- Date: ^ 1 ^ o < " Time: S^'KtJ Scale ^3'/Inlemal /1^ Fomi: h | l ^ / ITC / Other Dye Lot U: M T l l O ( Product tfr^£>03^ Buffer: (^aCOa/NaHC^O]^ Other Q>(^ Recovery procedure: Precipitation / B ^ c o l u ! ^ 092605-148.BOO 3.0 :2 i0 12 il 2i22 i'^ 2\ 6' 3.0 2"""T^E •• : D 2.5 2.5 2.0- 2.0 i !l 1.5 1.5 1.0 1.0 0.5 0.5 0.0 •-'- —' -0.0 0 Min 10 2 6 0 n m Date 10/05/85 Ratio/Equation Report Time 15:42:24 Page 1 of 1 Method file : <untitled> Information : Default Method Data File : <untitled> Overlai d Spectra: 0.4- /' / 0.35 H 0.3- / i. 0.25^ i °'^^ 1 < 0.15 r \\, V 0.1 H '-•••"~1— . ^ > ^ .^_^^ v_ 0.05- —-.-^-^-^.^ .^_- 0^ 1 250 .' • > • 300 350 400 450 500 550 -('^w- \ ^ ^ ^ ^- %- _^i ; ^ Wavelength (nm; Equation : Ratio = WL3/WL2 Where : WLl = Abs(260nm), WL2 = Abs(579nm), WL3 = Abs(592nm), Wt = Weight, V = Volume # Name Dilut. Factor Ratio Abs<260nm> 1.00000 1.00000 1.11800 1.14720 0.28704 0.38692 1 2 # Name 1 2 Report generated by Abs<57 9nm> Abs<592nm> 8.5186E-2 0.11919 9.5234E-2 0.13673 ROBE Signature; *** End Ratio/Equation Report *** Tll^F, ^ SCAN/n926-148 10/05/05 sec 0 30 60 90 120 150 180 210 240 270 300 330 360 390 420 450 480 510 540 570 600 630 660 690 720 750 780 810 840 870 900 930 960 990 1020 1050 1080 1 1 10 1 140 1 170 1200 1230 1260 1290 1320 1350 1380 1410 1440 1470 1500 1530 1560 1 590 1620 1650 1680 1710 1740 1770 1800 1830 I860 1890 1920 1950 1980 20 1 0 2040 207n 0.0 18)(;.wff<'^ 0. oigy ^^il-fo^ 1 . 663 2. 222 2. 429 2. 534 2.606 2. 654 2. 683 2. 700 2.726 2. 750 2. 759 2. 776 2. 7 8 2 2.809 2. 822 2. 838 2.837 2.856 2.867 ((J ^ ^ 2.867 A J 2 . 890 i'"^ 2. 906 2, 933 2.920 2,918 2. 937 2. 955 2. 953 2. 979 2. 977 2. 986 2.981 3.009 3.006 2. 962 2. 942 2. 969 3,014 3. 159 3.326 3.517 3,692 3,829 3,954 4, 001 4, 068 4.089 4, 105 4,117 4, 130 4.141 4.111 4. 132 4. 135 4. 128 4. 124 4.114 4. 129 4.145 4. 1 55 4. 183 4. 189 4, 188 4. 180 4. 1 82 4. 179 -n . 1 a/1 15:47 2100 2130 2160 2190 2220 2250 2280 2310 2340 2370 2400 2430 2460 2490 2520 2550 2580 2610 2640 2670 2700 2730 2760 2790 2820 2850 2880 2910 2940 2970 TIMK 4. 198 4. 187 4, 203 4. 21 5 4. 228''(c^t/^ 4. 187 4. 207 4. 193 4, 184 4, 193 4. 206 4. 198 4, 204 4. 207 4. 203 4. 197 4. 198 4, 208 4. 206 4, 218 4.214 4, 206 4. 204 4. 209 4, 218 4, 230 4, 216 4,222 4.215 4, 216 SCAN/0926-148 l^-J 0/05/05 16:38 Midland Certified Reagent Co. Method: STD-DNA1 Accelerating Voltage: 20000 Grid Voltage: 92.000 % Guide Wire Voltage: 0.050 % Delay: 375 ON Sample: 55 Original Filename: h:\masspec1\092605\00148-02.ms This File # 3 = H:\MASSPEC1\092605\00148-02.MS Comment: See file name for lot # Laser: 2400 Scans Averaged: 64 Pressure: 1.13e-06 Low Mass Gate: 700.0 Negative Ions: ON Collected: 10/5/05 5:20 PM 7000 6000 5000 4000 3000 2000 6000 7000 8000 9000 10000 Mass (m/z) 11000 12^00 13000 14000