The EMBO Journal Vol.16 No.13 pp.4107–4116, 1997
A viral sequence in the 39-untranslated region
mimics a 59 cap in facilitating translation of
uncapped mRNA
Shanping Wang1,2, Karen S.Browning3 and
W.Allen Miller1,4,5
1Molecular,
Cellular and Developmental Biology Program and
of Plant Pathology, and Biochemistry & Biophysics,
351 Bessey Hall, Iowa State University, Ames, IA 50011 and
3Department of Chemistry and Biochemistry, University of Texas,
Austin, TX 78712, USA
4Departments
2Present
address: Laboratory of Tumor Biology, Massachusetts General
Hospital Cancer Center, Building 149, Harvard University,
Charlestown, MA 02129, USA
5Corresponding
author
e-mail: wamiller@iastate.edu
For recognition by the translational machinery, most
eukaryotic cellular mRNAs have a 59 cap structure [e.g.
m7G(59)ppp(59)N]. We describe a translation enhancer
sequence (39TE) located in the 39-untranslated region
(UTR) of the genome of the PAV barley yellow dwarf
virus (BYDV-PAV) which stimulates translation from
uncapped mRNA by 30- to 100-fold in vitro and in vivo
to a level equal to that of efficient capped mRNAs. A
four base duplication within the 39TE destroyed the
stimulatory activity. Efficient translation was recovered
by addition of a 59 cap to this mRNA. Translation of
both uncapped mRNA containing the 39TE in cis and
capped mRNA lacking any BYDV-PAV sequence was
inhibited specifically by added 39TE RNA in trans.
This inhibition was reversed by adding initiation factor
4F (eIF4F), suggesting that the 39TE, like the 59 cap,
mediates eIF4F-dependent translation initiation. The
BYDV-PAV 59UTR was necessary for the 39TE to
function, except when the 39TE itself was moved to
the 59UTR. Thus, the 39TE is sufficient for recruiting
the translation factors and ribosomes, while the viral
59UTR may serve only for the long distance 39–59
communication. Models are proposed to explain this
novel mechanism of cap-independent translation initiation facilitated by the 39UTR.
Keywords: barley yellow dwarf virus/cap-independent
translation/eIF4F/59–39 interactions/plant gene
expression/ribosome binding
Introduction
Almost all eukaryotic cellular mRNAs contain a 59
m7G(59)ppp(59)N cap structure which is required for
efficient initiation of translation. According to the ribosome
scanning model of eukaryotic translation initiation, initiation factor eIF4F specifically recognizes the 59 cap
structure and, with the help of other initiation factors such
as eIF3, recruits the 43S ribosomal subunit initiation
complex that then scans 59 to 39 along the mRNA (Kozak,
1989; Merrick and Hershey, 1996). When the first (or
© Oxford University Press
second in the case of leaky scanning) AUG codon is
reached, the 60S ribosomal subunit joins and peptide
elongation ensues.
Although the ribosome scanning model explains the
mechanisms of various translational regulatory elements in
the 59-untranslated regions (UTRs) of mRNAs, numerous
examples exist of translational control elements in the
39UTRs of mRNAs. The 39 poly(A) tail, found on most
eukaryotic cellular mRNAs, stimulates translation initiation and stabilizes mRNA (Jacobson, 1996). The 59 cap
and poly(A) tail act synergistically to stimulate initiation
in vivo (Gallie, 1991) and in a yeast in vitro translation
system (Tarun and Sachs, 1995). In the case of viral RNAs
that lack a poly(A) tail, sequences in the 39UTR, such as
the pseudoknot-rich domain of tobacco mosaic virus
(TMV), appear to substitute functionally for a poly(A)
tail to stimulate translation in conjunction with the 59 cap
(Gallie and Walbot, 1990; Gallie, 1991). Other cis-acting
elements in 39UTRs control translation initiation either by
modulating poly(A) tail length during embryo development (Sheets et al., 1995) or via binding of a specific
regulatory protein that inhibits initiation (Standart and
Jackson, 1994; Curtis et al., 1995; Dubnau and Struhl,
1996). In all these examples, the mRNA must have a 59
cap in order for the 39 element to function. Thus, in
previously described mRNAs, cap recognition is likely to
be an essential component in the communication between
39 and 59 ends (Tarun and Sachs, 1995; Hentze, 1997).
Mammalian eIF4F complex is comprised of eIF4E (the
cap-binding subunit), eIF4G (p220) and the more loosely
associated eIF4A (helicase) (Merrick, 1994). Plant cells
contain two forms of the 4F complex: eIF4F, consisting
of 26 and 220 kDa subunits (homologous to eIF4E and
eIF4G, respectively), and eIFiso4F, consisting of 28 and
86 kDa subunits (Browning, 1996). eIF4A probably has
the same function in plants but does not co-purify with
eIF4F, so it is not considered a subunit of this complex
(Browning, 1996). In defined cell-free systems, capped
mRNAs have a reduced requirement for eIF4F compared
with uncapped mRNAs (Fletcher et al., 1990).
Many viral mRNAs lack a 59 cap or a poly(A) tail,
or both. They have evolved ways of ensuring efficient
translation of their genes from uncapped mRNAs
(Carrington and Freed, 1990; Tsukiyamakohara et al.,
1992; Sarnow, 1995), often at the expense of the host cell.
The most well-documented example is the translation
of picornavirus RNAs (Jackson and Kaminski, 1995).
Picornaviral RNAs lack a 59 cap structure and have an
extremely long, highly structured 59UTR, including many
AUG codons upstream of the start codon of the main
open reading frame (ORF). Rather than scanning from the
59 end, ribosomes bind internally in this long leader at
the internal ribosomal entry site (IRES) just upstream of
the start codon, in a cap-independent manner (Pelletier
4107
S.Wang, K.S.Browning and W.A.Miller
and Sonenberg, 1988; Sarnow, 1995). Although IRESmediated cap-independent translation does not conform to
the rule of 59 cap–eIF4E recognition, it still employs the
other canonical initiation factors including the eIF4G
subunit of eIF4F (Pestova et al., 1996), and follows the
scanning concept of ribosome binding to the 59UTR
followed by scanning in a 39 direction until the appropriate
start codon is reached for initiation of translation.
In contrast to the above examples, we showed previously
that the genomic RNA of the PAV barley yellow dwarf
virus (BYDV-PAV) harbors a sequence in the 39UTR that
confers cap-independent translation initiation at the 59
AUG of the mRNA in wheat germ extracts (Wang and
Miller, 1995). The BYDVs are ubiquitous, economically
important viruses of small grains (D’Arcy and Burnett,
1995). BYDV-PAV is a subgroup I luteovirus, whereas
some other BYDVs are members of the very divergent
subgroup II (Miller et al., 1995; Miller and Rasochova,
1997). The mechanism of translation initiation of BYDVPAV is remarkable because the 39 translation enhancer
(39TE) that confers cap-independent translation is located
5 kb downstream, and is separated by several large
untranslated ORFs, from the initiation codon. Furthermore,
unlike other translational control elements in the 39UTR,
such as poly(A) tails, the 39TE controls initiation at the
59 AUG in the absence of a 59 cap. The only other mRNA
known to resemble this, in function, is satellite tobacco
necrosis virus (STNV) RNA (Danthinne et al., 1993;
Timmer et al., 1993). This RNA differs from BYDV-PAV
in that its 39 stimulatory element is located immediately
39 of the only ORF on the RNA, and 600 nucleotides
downstream of the initiator AUG. The stimulatory elements of BYDV-PAV and STNV RNAs share no obvious
sequence homology. For both RNAs, cap-independent
translation has been reported only in cell-free extracts.
Like capped mRNAs, STNV RNA translation depends on
eIF4F or eIFiso4F, but the amount of factor needed for
maximal translation is one-tenth of that needed for capped
mRNAs (Timmer et al., 1993).
Here, we (i) localize the 39TE to a smaller region in
the BYDV-PAV genome than reported previously, (ii)
show that it functions in vivo but requires more of the
39UTR than in wheat germ extracts, (iii) provide evidence
that the 39TE facilitates initiation in an eIF4F-dependent
manner and (iv) show that the translation initiation and
39–59 communication functions can be uncoupled. These
data shed light on possible new mechanisms for a 39UTR
in mediating translation initiation.
Results
Localization of minimal 39TE sequence
Previously, we showed that a 500 base region in the
genomic RNA of BYDV-PAV facilitated translation of
uncapped mRNA in vitro (Wang and Miller, 1995). Here,
we show the ability of a smaller portion of this region to
stimulate translation of uncapped mRNA. The mRNAs
are in vitro transcripts containing the Escherichia coli
uidA (GUS) reporter gene flanked by various 59 and
Fig. 1. (A) Maps of transcripts. The genome organization of BYDVPAV RNA with numbered ORFs (Miller et al., 1988) is shown at the
top. A bold black line beneath the ORFs (numbered boxes) indicates
the 5677 nt genomic RNA. Maps below the genome depict transcripts
coding for GUS (ORF not to scale) containing viral sequence (bold
lines), vector or Ω sequence (thin lines) or poly(A) tails (A30) in their
UTRs. The 109 nt 39TE is the intergenic region (between dashed
lines) between ORFs 5 and 6. BF transcripts are identical to those
shown, except that they contain the four base duplication at the filled
and re-ligated BamHI site (B) within the 109 nt 39TE. Abbreviations:
Sc, ScaI4513; B, BamHI4837; P, PstI5009; Sm, SmaI5677 (numbered as in
Miller et al., 1988); R1, EcoRI; ICR1, EcoICRI; X1, XbaI. (B and C)
Wheat germ translation products of the indicated transcripts. Each
uncapped mRNA (0.2 pmol) was translated and their products
analyzed electrophoretically as in Wang and Miller (1995). The
relative radioactivity in the GUS product, as determined with a
Phosphorimager, is indicated below each lane. (B) Molecular weights
(in kDa) of translation products of brome mosaic virus (BMV) RNA
(lane 1) and GUS (68 kDa) are at the left. The translation efficiency in
lane 5 was defined arbitrarily as 100%. Templates used in lanes 2–5
were uncapped RNAs prepared by run-off transcription from plasmids
linearized with the indicated restriction enzymes. (C) All transcripts
were from EcoRI-cut plasmids, except for lanes 1 and 2, which were
from EcoICRI-cut plasmid. Transcripts with names ending in A1 are
polyadenylated. C, capped transcript; U, uncapped transcript.
4108
Cap-independent translation mediated by a 39 UTR
39UTRs (Figure 1A). Uncapped GUS mRNA that contains
the 109 nucleotide sequence spanning the intergenic region
between BYDV-PAV ORFs 5 and 6 in its 39UTR (bases
4817–4925 of the BYDV-PAV genome) was translated
with the same efficiency in vitro as transcripts that contain
the larger (500 nt) 39TE sequence (Figure 1B, lanes 3–5).
This construct yielded .50-fold more GUS protein than
transcripts lacking the intercistronic sequence (Figure 1B,
compare lanes 2 and 3). Deletion of bases upstream of
nucleotide 4837 (Wang and Miller, 1995) or downstream
of nucleotide 4873 (data not shown) within the 39TE
abolished stimulatory activity. Therefore, a subset (bases
4817–4925) of the previously reported 500 base fragment
is sufficient to confer translation enhancement of uncapped
mRNA in a wheat germ extract. We refer to this 109
nucleotide sequence as the in vitro-defined, or 109 nt, 39TE.
To confirm the specificity of the stimulation by the
39TE, a mutation was introduced by inserting a four base
duplication (GAUC) within the BamHI4837 site in the 39TE
(PGUS109BF; all clones with the BF designation contain
this BamHI fill-in mutation). This duplication abolished
the stimulatory activity of the 39TE (Figure 1C, compare
lanes 4 and 6). Addition of a 59 cap rescued translation
of these mutant transcripts to the level observed for
uncapped, 39TE-containing PGUS109 (Figure 1C, lanes 4
and 5). The presence of a poly(A) tail had little effect on
translation of any transcripts in wheat germ extracts
(Figure 1C), which is consistent with previously reported
observations (Gallie, 1991; Wang and Miller, 1995).
Activity of the 39TE in vivo
To assess the activity of the 39TE in vivo, GUS-encoding
transcripts with various 59 and 39 UTRs were electroporated into oat protoplasts, and translational efficiency was
measured by assaying for GUS activity. An uncapped
control transcript, containing a plasmid-derived 59UTR
and a 30 nt poly(A) tail yielded no significant GUS
activity (Figure 2A, VecGUSA1). When capped, this
mRNA expressed GUS at 50-fold above background,
consistent with the essential role for the 59 cap. Replacement of the plasmid-derived 59UTR with that from BYDVPAV stimulated GUS expression from capped mRNA
3-fold further (Figure 2A, PGUSA1). Addition of the
109 nt 39TE was not sufficient for translation of mRNA
in vivo (Figure 2A, compare PGUS109 and PGUS). The
presence of a poly(A) tail in addition to the 109 nt 39TE
resulted in a 10-fold increase above background in GUS
expression from uncapped mRNA (Figure 2A, compare
uncapped PGUS109A1 with uncapped PGUS109). However, addition of a 59 cap to this transcript stimulated
GUS expression by another order of magnitude (Figure 2,
compare capped and uncapped PGUS109A1). Construct
PGUS109BFA1, which contains the four base GAUC
duplication, yielded no GUS activity when lacking a cap,
but was fully active when capped (Figure 2A). These
results show that the 109 nt 39TE only partially, but
significantly, facilitated cap-independent translation
in vivo.
We tested the effect of additional viral sequence in the
39UTR on 39TE function in vivo. PAV bases 4515–5677
(the 39-terminal 1162 bases of the genome) were placed
in the 39UTR of the GUS reporter construct. Uncapped
transcript from this plasmid gave activity .100 times
Fig. 2. (A and B) GUS expression in protoplasts electroporated with
transcripts containing various 59 and 39 UTRs (see Figure 1A). GUS
activity is measured in nmoles (nm) of methylumbelliferone (MU)
produced per µg of cellular protein per minute in a 2 h reaction.
Transcripts containing a poly(A) tail (A1) are from EcoRI-linearized
plasmids; others are from plasmids linearized with SmaI. Transcript
PGUS is from EcoICRI-linearized pPGUS109. In (A), data represent
averages (6 SD) from three separate experiments, each of which was
performed in duplicate. In (B), data represent averages from two
separate experiments, each of which was performed in duplicate.
(C) Wheat germ translation products of transcripts used in (B) were
analyzed and quantified as in Figure 1. C, capped; U, uncapped
transcript.
background (Figure 2A and B, PGUS1162). Addition of
a cap stimulated expression no more than 2-fold (Figure
2A and B, compare capped and uncapped PGUS1162).
The four base duplication in the BamHI4837 site abolished
expression from uncapped transcript both in vitro
(Figure 2C, lanes 2 and 4) and in vivo (Figure 2B, compare
4109
S.Wang, K.S.Browning and W.A.Miller
uncapped PGUS1162BF with uncapped PGUS1162),
verifying the specificity of the 39TE effect. Furthermore,
the four base duplication had no effect on expression
of the capped transcript (Figure 2B, compare capped
PGUS1162BF with capped PGUS1162). Interestingly, the
stimulatory activity of the 1162 nt 39 end of BYDV-PAV
sequence did not require a poly(A) tail (Figure 2B,
compare PGUS1162 and PGUS1162A1). Thus,
sequence(s) different from the 39TE functionally substitutes for a poly(A) tail. In addition, full stimulation of
cap-independent translation requires more viral sequence
in vivo than in vitro. Because of this difference, rather
than define the 39TE as a precise sequence, we functionally
define it as the sequence that stimulates cap-independent
translation from the 39UTR and is rendered non-functional
by mutation at the BamHI site.
All the results above were obtained from RNA transcripts harboring the 59UTR from BYDV-PAV (indicated
by the ‘P’ preceding ‘GUS’ in the transcript name). The
requirement for the 59UTR from BYDV-PAV RNA was
examined by replacing it with the 59UTR (Ω sequence)
of TMV RNA. This sequence stimulates translation in vitro
(with or without a cap) and in vivo in a highly capdependent manner (Gallie, 1991; Sleat and Wilson, 1992).
Substitution of the BYDV-PAV 59UTR with Ω permitted
a low rate of translation of uncapped mRNA in vitro
(Figure 2C, lane 8). However, Ω in place of the BYDVPAV 59UTR abolished translation of uncapped mRNA
in vivo, even in the presence of the 1162 nt virus-derived
39UTR (Figure 2B, ΩGUS1162), but permitted efficient
translation of capped ΩGUS1162 RNA. Thus, Ω facilitates
translation in a cap-dependent manner only, and does not
cooperate with the 39TE to promote cap-independent
translation. Previously, we showed that a vector-derived
59UTR also failed to support 39TE activity in vitro (Wang
and Miller, 1995). Thus, the 39TE probably requires
at least a portion of the BYDV-PAV 59UTR for capindependent translation in these contexts, indicating
specific interactions between the 39 and 59UTR.
The fact that expression of the capped, poly(A)1,
Ω-containing mRNA which is considered to be an optimal
plant message is no higher than that of uncapped mRNA
containing the full BYDV-PAV 59 and 39UTRs (Figure
2B, compare uncapped PGUS1162 and capped
ΩGUS1162A1), demonstrates the very high levels of
expression that are conferred by this cap-independent
translation signal.
The 39TE mimics a 59 cap in its effect on RNA
stability
It is possible that the 39TE stimulates gene expression
in vivo, at least in part, by increasing RNA stability.
However, we showed previously that the 109 nt 39TE did
not affect RNA stability in wheat germ extracts (Wang
and Miller, 1995). To determine the effect of the larger,
in vivo-defined 39TE on RNA stability in vivo, RNA
transcripts with a wild-type or mutant (the four base
duplication) 1162 nt 39UTR were electroporated into oat
protoplasts under the same conditions as the GUS gene
expression experiments, and RNA degradation was monitored by Northern blot hybridization. The RNA transcripts
with either the wild-type or the defective 39TE did not
differ significantly in degradation rate (Figure 3A).
4110
Fig. 3. Relative stability of mRNAs electroporated in oat protoplasts.
(A) Northern blot hybridization detecting uncapped transcripts isolated
from oat protoplasts at the indicated times after electroporation. The
blot was hybridized with 32P-labeled antisense GUS transcript as
described in Materials and methods. (B) Kinetics of GUS enzymatic
activity accumulation at the indicated times after electroporation of oat
protoplasts. The GUS assay was performed as in Figure 2.
Northern blot hybridization detects only the physical
stability of total cellular GUS mRNAs, and cannot discriminate between translatable and untranslatable RNAs.
As a more accurate assay of RNA stability, the functional
RNA half-life was measured by the kinetics of GUS
synthesis. The activity of GUS (a very stable enzyme)
should stop increasing sooner for a functionally unstable
mRNA than for a stable one. Of the three mRNAs for
which GUS activity was detectable, none leveled off until
at least 30 h after electroporation (Figure 3B). This is
beyond the 20 h timepoint used in Figure 2. Uncapped
PGUS1162 mRNA appeared to be slightly less stable than
its capped counterpart, but showed a very similar stability
(shape of curve) to the capped P1162BF mutant. Thus,
the capped mRNA with the defective 39TE (PGUS1162BF)
and uncapped mRNA containing active 39TE (PGUS1162)
have similar ‘functional’ stabilities, suggesting that the
39TE either has no role in stabilizing mRNA or that it
contributes a similar amount to stability as does the
presence of a 59 cap. The similar physical stability of
uncapped PGUS1162 and uncapped PGUS1162BF (Figure
3A), but dramatic differences in GUS gene expression
(Figure 3B), indicate that the 39TE functions at the
translational level.
The 39TE decreases the requirement for eIF4F for
efficient translation of uncapped mRNA
One possible role for the 39TE in enhancing translation
of uncapped mRNA is to efficiently recruit essential
initiation factor(s) that facilitate(s) binding of the ribosomal small subunit, in a manner analogous to that of the
59 cap of mRNAs. The binding of eIF4F to the 59 cap
structure confers the selective translation of capped, as
opposed to uncapped, mRNA (Browning, 1996). The
translation-enhancing sequence from STNV RNA
Cap-independent translation mediated by a 39 UTR
Fig. 4. Effect of added eIF4F on translation of capped and uncapped mRNAs containing or lacking the functional 109 nt 39TE in wheat germ
extract. PGUS transcript was prepared by in vitro transcription from pPGUS109 that had been linearized with EcoICRI, which removes the 39TE.
PGUS109 was prepared from the same plasmid linearized with EcoRI. Transcript PGUS109BF is from the BamHI-filled mutant of pPGUS109
(pPGUS109BF), linearized with EcoRI. Translation reactions were performed as for Figure 1. Amount of added initiation factor: lanes 1, 6 and
11, 0; lanes 2, 7 and 12, 0.25 µg; lanes 3, 8 and 13, 0.5 µg; lanes 4, 9 and 14, 1.0 µg; lanes 5, 10 and 15, 2.0 µg. The translation efficiency of each
mRNA with no exogenous translation factor was defined as 1.
dramatically decreased the amount of the rate-limiting
initiation factor eIF4F, required for maximal translation
efficiency in vitro (Timmer et al., 1993). The eIF4F
requirements of mRNAs containing or lacking the 39TE
were compared. The already efficient translation of capped
39TE-lacking mRNA and of uncapped mRNA containing
the 109 nt 39TE was not stimulated by exogenous eIF4F
(Figure 4, lanes 1–10). Consequently, eIF4F was not ratelimiting for these mRNAs. In contrast, the endogenous
eIF4F levels were rate-limiting for uncapped mRNA with
the defective 39TE, because translation efficiency of this
mRNA increased correspondingly with the addition of
exogenous eIF4F (Figure 4, lanes 11–15). As a control,
bovine serum albumin (BSA) was added instead of eIF4F,
and was observed to have no effect on translation of any
mRNAs (data not shown). Thus, the 109 nt 39TE appears
to reduce the amount of eIF4F required for efficient
translation, a property that is normally conferred by a 59
cap (Browning, 1996).
The 109 nt 39TE inhibits translation of mRNAs
in trans by a mechanism that is reversed by
exogenous eIF4F
If the 39TE enhances translation by efficiently recruiting
eIF4F, either directly or via an unidentified trans-acting
factor, we predict that 39TE-dependent or cap-dependent
translation would be inhibited by the 39TE in trans. The
free 39TE RNA should act as a competitor for eIF4F or
other factors that mediate 39TE stimulation in cis. To test
this, a 109 nt transcript comprising only the in vitrodefined 39TE RNA was added in excess to wheat germ
extracts containing various mRNAs. Indeed, translation
of uncapped 39TE-plus mRNA (PGUS109) was inhibited
by the addition of 39TE RNA (Figure 5A, lanes 1–4).
Addition of the defective 39TE, which differs only by
having the GAUC duplication (39TEBF), had no inhibitory
effect (Figure 5A, lanes 5–7). This shows that the inhibition
by wild-type 109 nt 39TE was not simply a non-specific
effect of adding RNA to the wheat germ extract. Addition
of eIF4F to the reaction reversed the trans inhibition by
the 39TE (Figure 5A, lanes 8–12). Thus, either the 39TEmediated cap-independent translation requires eIF4F or
the mechanism is normally eIF4F-independent and added
eIF4F allows translation of PGUS109 to bypass the
39TE-mediated mechanism. To distinguish between these
possibilities, the effect of the 39TE on translation of
Fig. 5. Inhibition of translation by the 109 nt 39TE in trans, and
restoration by eIF4F. Uncapped PGUS109 (A) or capped ΩGUS (B)
mRNAs (0.1 pmol) were translated in wheat germ extracts as in
Figure 1, with the indicated amounts of added transcript comprising
the 109 nt 39TE (39TE) or mutant 39TE with the GAUC duplication at
the BamHI site (39TEBF) as competitor RNA. Amount of eIF4F
added: (A) lanes 1–8, none; lanes 9–12, 0.5, 1.0, 2.0 and 4.0 µg,
respectively; (B) lanes 1–10, none; lanes 11–14, 0.25, 0.5, 1.0 and
2.0 µg, respectively. The 109 nt 39TE RNA and 113 nt 39TEBF RNA
were synthesized in uncapped form from SmaI-linearized p39TE and
p39TEBF, respectively (Figure 1A). Translation was performed in
wheat germ extracts as described in Materials and methods.
capped mRNA lacking any BYDV-PAV sequence was
examined. Excess added wild-type 39TE RNA inhibited
translation of capped mRNA containing Ω as its 59UTR
(Figure 5B, lanes 1–5). Again, the defective 39TEBF RNA
had no effect on the translation of this capped mRNA
(Figure 5B, lanes 6–9), and addition of eIF4F restored
translation of ΩGUS mRNA in the presence of inhibitory
levels of 39TE (Figure 5B, lanes 10–14). Thus, the
109 nt 39TE competes with capped mRNA for factor(s)
required for cap-dependent translation and does not need
to interact with the BYDV-PAV 59UTR to do so. The
restoration of translatability of both mRNAs in the presence of inhibitory levels of 39TE by eIF4F strongly
4111
S.Wang, K.S.Browning and W.A.Miller
6A, compare lanes 5 and 3), similar to the results seen
when the mutant 39TE was located at the 39UTR (Figure
1C). Furthermore, in trans, free 109 nt 39TE (but not the
defective mutant form) inhibited translation of uncapped
mRNA that contained the 109 nt 39TE at the 59UTR
(Figure 6B).
To test the function of the 59-located 39TE in vivo,
polyadenylated transcripts containing wild-type or defective 39TE in the 59UTR were electroporated into oat
protoplasts. The wild-type 109 nt 39TE, but not the mutant
39TE, stimulated GUS expression to a level 30-fold
greater than background (Figure 6C, compare uncapped
109BFGUSA1 with uncapped 109GUSA1). Addition of
a 59 cap stimulated translation another 7-fold, similar to
what was observed when the 109 nt 39TE was located in
the 39UTR (Figure 2A, PGUS109A1). As a control, a
construct also lacking the BYDV-PAV 59UTR but with
the 109 nt 39TE in the 39UTR (ΩGUS109A1) gave no
GUS expression unless capped (Figure 6C). This is not
surprising because, as mentioned previously (Figure 2B),
a similar construct but with the full 1162 nt 39UTR
from BYDV-PAV (ΩGUS1162) also showed no capindependent translation. The 1162 nt 39UTR (full, in vivodefined 39TE) could not be tested in the 59UTR owing to
the presence of numerous AUG codons. Interestingly, the
59-located 109 nt 39TE stimulated translation of uncapped
mRNA to a level that was nearly one-half that of uncapped
PGUS1162 in protoplasts (Figure 6C). When located in
the 39UTR, the 109 nt 39TE (PGUS109A1) gave expression that was only about one-eighth that of PGUS1162
(Figure 2A). Thus, the 39TE may stimulate translation
more efficiently from the 59UTR. Most importantly, Figure
6 shows that interaction between the natural viral 59UTR
and 39TE is not essential for recruitment of the translation
machinery that gives cap-independent translation.
Fig. 6. Translation of transcripts having the 109 nt 39TE in place of
the viral 59UTR upstream of the GUS ORF. (A) In vitro translation in
wheat germ extracts. Prior to transcription, templates for transcripts in
lanes 3–6 were linearized with XbaI, and templates for transcripts in
lanes 7–10 were linearized with EcoRI, resulting in the poly(A) tail
indicated by A1. (B) Effect of addition of the 109 nt 39TE or 113 nt
39TEBF transcripts in trans on translation of uncapped 109GUS in
wheat germ extracts. 109GUS RNA was transcribed from XbaI-cut
p109GUSA. (C) GUS activity from the indicated transcripts 20 h after
electroporation into oat protoplasts, assayed as described in Materials
and methods and Figure 2.
implicates a role, either direct or indirect, for eIF4F in
cap-independent translation mediated by the 39TE in cis.
The 109 nt 39TE functions in the 59UTR
So far, by all tests, the 39TE functionally mimics a 59 cap.
If this is the case, like the cap, the 39TE should function
in the 59UTR. Hence, the 109 nt 39TE was moved to the
59 end of the GUS gene in place of the BYDV-PAV
59UTR (construct 109GUSA, Figure 1A). This mRNA
was translated cap-independently (Figure 6A, lanes 3 and
4). In contrast, the nearly identical construct, 109BFGUS,
differing only by the GAUC duplication, was not translated
in a cap-independent manner (Figure 6A, compare lanes
6 and 4). Capped mRNAs, even with the non-functional
39TE at the 59UTR, were still translated efficiently (Figure
4112
A highly conserved portion of the 39TE is present
in other plant viral genomes
To determine how widespread this 39 translation enhancer
phenomonon might be, we performed a BLAST search of
the GenBank database for homologous sequences. A 27
base sequence that spans the BamHI site and is absolutely
conserved in all 11 sequenced BYDV-PAV and BYDVMAV isolates (Chaloub et al., 1994) was used as the
sequence for comparison. An 18 nt portion of this sequence
was discovered to be conserved near the 59 ends of the
39UTRs of all subgroup I luteovirus genomes, RNAs 1 of
the bipartite dianthoviruses, and tobacco necrosis virus
RNA (TNV, the helper for STNV), but not STNV RNA
(Figure 7). This suggests that these other viruses may
employ this mechanism of translation. TNV RNA is
known to lack a 59 cap (Lesnaw and Reichmann, 1970),
but RCNMV RNA1 reportedly is capped (Xiong and
Lommel, 1989). As expected, BYDV-PAV RNA also
appears to lack a cap, and in vitro transcripts of a
full-length clone of the BYDV-PAV genome are more
infectious when lacking a 59 cap (Mohan et al., 1995;
Wang, 1996). The presence of a highly conserved sequence
at similar locations in the viral genomes, combined with
the fact that this sequence contains the BamHI site,
mutation of which destroys 39TE function, suggests that
the 18 base sequence in Figure 7 is involved directly in
the mechanism of cap-independent translation.
Cap-independent translation mediated by a 39 UTR
Fig. 7. Alignments of portions of 39UTRs of viral genomes showing their locations between the 39-proximal confirmed gene (encodes a structural
protein in all cases) and the 39 end of the genome. Underlined bases of consensus (bold) are complementary to the conserved sequence 5–10 bases
from the 39 end of 18S rRNA (Dams et al., 1988). Underlined bases in STNV RNA have been proposed to base-pair to a nearby, non-overlapping
region of 18S rRNA (Danthinne et al., 1993). Vertical bars indicate locations of additional bases (below line) which are looped out in order to
optimize alignments. In addition to the BYDV-PAV sequence of the given accession number, 10 other BYDV-PAV isolates share this sequence
(Chaloub et al., 1994). Abbreviations not used in text: BYDV-MAV, the MAV BYDV; TNV-A and -D, the A and D strains of TNV; SCNMV1,
RNA 1 of sweet clover necrotic mosaic virus; CRSV1, RNA 1 of carnation ringspot virus; Luteo I, subgroup I luteovirus; Necro, necrovirus;
Diantho, dianthovirus.
Discussion
The 39TE mimics a 59 cap, not a poly(A) tail
The 109 nt intergenic region (109 nt 39TE) between ORFs
5 and 6 of the BYDV-PAV genome confers a remarkably
high (30- to 100-fold) stimulation of translation of
uncapped mRNA in wheat germ extracts. The complete
abolition of the 39TE stimulatory activity by a small
mutation (four base duplication) within this sequence
demonstrates the high sequence specificity of the interaction between the mRNA and some component of the
translational apparatus. However, the 109 nt 39TE sequence
alone was insufficient for full stimulation in vivo, even in
the presence of a poly(A) tail. Poly(A) tails have little
influence on translation in wheat germ extracts, but interact
with the 59 cap to facilitate translation in vivo (Gallie,
1991; Jacobson, 1996; Hentze, 1997). The endogenous
levels of GUS activity in oat cells obscured any low level
of translation that might have been obtained from reporter
mRNAs lacking both a 59 cap and the 39TE, or both a
poly(A) tail and the 1162 nt viral 39UTR. This large
portion of the BYDV-PAV genome that spans the smaller
in vitro-defined 39TE was required to stimulate translation
of uncapped mRNA to a level of at least one-half that of
its capped counterpart in vivo. Because this sequence
obviated the need for a poly(A) tail, we propose that the
large 39UTR also contains a sequence that functionally
substitutes for a poly(A) tail such as the pseudoknot-rich
domain of TMV (Leathers et al., 1993) and the 39 stem–
loop of histone mRNAs (Gallie et al., 1996). This poly(A)
tail-like activity is functionally distinct from the cap-like
activity of the 39TE, as evidenced by the BamHI fill-in
mutant which had no 39TE activity but had full translation
activity in vivo when capped (Figure 2B, PGUS1162BF).
Our experiments to measure the RNA degradation rate
in wheat germ (Wang and Miller, 1995) and in vivo (Figure
3) indicated that there is no significant difference in the
stability of uncapped RNA containing the full, in vivodefined 39TE (PGUS1162) and capped 39TE mutant
(PGUS1162BF) transcripts. In one of the main eukaryotic
decay pathways, cellular mRNAs are deadenylated first,
followed by decapping and degradation in a 59 to 39
direction (Muhlrad and Parker, 1994; Beelman and Parker,
1995). Because decapped mRNAs are degraded rapidly
in vivo, the additional viral sequence needed for the 39TE
to function in vivo, but not in vitro, may serve to
confer RNA stability. It may do this simply by recruiting
translational machinery so efficiently that the mRNA is
inaccessible to nucleases. mRNAs undergoing efficient
translation are associated with poly(A)-binding protein,
eIF4F and other translation factors to form a circular
mRNP structure (Tarun and Sachs, 1996; Hentze, 1997),
and thus they should be more resistant to the 59 exonuclease
attack (Caponigro and Parker, 1995). The 39–59 communication required for 39TE function (in its normal 39UTR
setting) may exploit the factors that mediate the poly(A)
tail–59 cap interactions (Tarun and Sachs, 1996) in such
a way as to prevent recognition by the exonucleases that
target uncapped or non-polyadenylated mRNAs.
To summarize, the 39TE of PAV RNA has all the
following properties of a 59 cap. (i) It eliminates the need
for a 59 cap for efficient translation in vitro and in vivo
(in conjunction with the 59UTR). (ii) It can be replaced
by a 59 cap. (iii) It cannot be replaced by a poly(A) tail.
(iv) It requires a poly(A) tail or viral 39UTR sequence for
translation in vivo but not in wheat germ extracts. (v) It
stabilizes mRNA to the same extent as a 59 cap in vivo.
(vi) It reduces the concentration of eIF4F needed for
maximum translation. (vii) Its activity is inhibited by
added free m7G (Wang and Miller, 1995) or free 109 nt
39TE in trans (Figure 5). (viii) Free m7G (Fletcher et al.,
1990) or free 109 nt 39TE inhibit translation of capped
mRNAs lacking any BYDV-PAV sequence. (ix) All types
of inhibition above are relieved by exogenous eIF4F.
(x) The 109 nt 39TE functions when located at the 59 end
of mRNA. This last observation makes the important
distinction between the two functions that are mediated
by the 39TE: translation initiation (e.g ribosome recruitment) and 39–59 communication.
39–59 communication
When the 39TE is located at the 39 end of the mRNA,
interaction between the 59 and 39 ends must occur, given
4113
S.Wang, K.S.Browning and W.A.Miller
that ribosomes scan 59 to 39 and peptide synthesis initiates
at the 59-proximal AUG. The specific involvement of the
BYDV-PAV 59UTR in this interaction was suggested by
the findings that neither a vector-derived 59UTR (Wang
and Miller, 1995) nor the translationally efficient 59UTR
(Ω) of TMV (Figure 2B) supported 39TE function. However, we cannot rule out the possiblity that other 59UTRs
might also function. The interaction between the 39TE
and 59UTR of BYDV-PAV RNA could be either through
long-distance base pairing as proposed for STNV
(Danthinne et al., 1993) or mediated via trans-acting
factor(s). The first possibility is unlikely for BYDV-PAV.
First, computer analysis revealed no strong, conserved
Watson–Crick base pairing between the 59 and 39UTRs.
Secondly, the 39TE functions at widely varying distances
from the 59UTR and tolerates unrelated (GUS or viral)
intervening sequences, which would be expected to affect
such long-distance base pairing. Thirdly, the 39TE can
trans-inhibit translation of capped ΩGUS mRNA lacking
any BYDV-PAV sequence, arguing against specific base
pairing as a mechanism for inhibition. Instead, the 39TE
most probably interacts with a factor (or the ribosome
itself) required for translation of all capped mRNAs, in
order to facilitate the interactions between 39 and 59UTRs.
One possibility is that a trans-acting factor first recognizes
the 39TE and then interacts with an initiation factor, such
as eIF4F, which in turn interacts with the 59 end. This
would resemble the interaction between eIF4F and
poly(A)-binding protein as in normal poly(A) tail-mediated
translation initiation (Tarun and Sachs, 1996), with the
crucial difference that a 59 cap is not needed for 59
end recognition. Other proteins are known to interact
functionally with both ends of mRNAs (Schnierle et al.,
1992; Dubnau and Struhl, 1996; Tanguay and Gallie,
1996), but also in a cap-dependent manner.
Ribosome recruitment
Fig. 8. Possible models for ribosome recruitment by the 39TE consistent
with the data presented. (A) eIF4F (consisting of subunits eIF4E and
eIF4G) specifically binds the 39TE with high affinity, recruits the 40S
subunit as it does in normal cap-dependent translation and, perhaps with
participation of other factors, recognizes the 59UTR. (B) An unknown
factor (X) specifically binds the 39TE, and possibly the 59 UTR, prior to
recruiting eIF4F. Subsequent events occur as in (A). (C) A portion
(underlined in Figure 7) of the conserved region in the 39TE (mRNA)
base-pairs directly to the conserved bases 5–10 nucleotides upstream of
the 39 end of 18S rRNA. This base pairing may be facilitated by eIF4F
(shown as its subunits eIF4E and eIF4G), or eIF4F may bind after the
mRNA base-pairs to the 18S RNA. Following this binding, the ribosome
is delivered to the 59 end of the mRNA by a mechanism not shown,
perhaps by eIF4F. eIF4F (and other factors; Browning, 1996) then
participates in scanning until the first AUG is detected, at which
polypeptide synthesis initiates. The GAUC duplication at the BamHI site
disrupts base pairing to 18S rRNA, perhaps by formation of the
alternative secondary structure shown or by others (not shown). eIF4F
either does not recognize the mutated 39TE, or it does not bind because
the mRNA never base-pairs to the 18S RNA.
4114
Some of the same components proposed for 39–59 communication may also be involved in ribosome recruitment.
The simplest model would be that eIF4F has a high
affinity for the 39TE (Figure 8A). A structure within the
39TE may mimic a 59 cap to recruit the eIF4E subunit of
eIF4F, or the 39TE may bind eIF4G. The latter case would
resemble IRES-mediated cap-independent translation in
which eIF4G was found to bind the functional IRES RNA
with much higher affinity than defective mutant IRES
RNAs or non-IRES RNA (Pestova et al., 1996). Of course
the IRES differs from the 39TE by having the binding site
located in the 59UTR. eIF4F as well as eIF4B have been
reported to bind poly(A) tails directly (Gallie and Tanguay,
1994) or via poly(A)-binding protein (Tarun and Sachs,
1996) in order to facilitate initiation at the 59 AUG.
Although these interactions require a cap for 59 end
recognition, the same protein(s) may facilitate the 39–59
communication that allows the 39TE and viral 59UTR to
facilitate initiation at the 59 end in the absence of a cap.
Our second model invokes an unknown factor that
specifically binds the 39TE and possibly also the 59UTR
prior to recruiting eIF4F (Figure 8B). The trans inhibition
of translation by the 39TE, as well as reversal of trans
inhibition by eIF4F, could be explained by the 39TE RNA
interacting with the unknown trans-acting factor which
then binds eIF4F. This resembles yeast poly(A)-binding
Cap-independent translation mediated by a 39 UTR
protein Pab1p which binds eIF4F only in the presence of
poly(A) (Tarun and Sachs, 1996). To shed light on these
models, obvious objectives for future research are to
determine the relative binding affinities of 39TE and
39TEBF RNAs for eIF4F and other proteins in the wheat
germ extract.
A third, different possibility which can act in addition
to, or instead of, one of the previous models, is that the
39TE may base-pair directly to 18S rRNA. This would
resemble bacterial mRNA–ribosome binding (Shine–
Dalgarno) interactions. The highly conserved 18 base tract
in the 39TE contains the sequence GAUCCU (underlined
in Figure 7). This sequence has the potential to base-pair
to a region in 18S rRNA that is precisely the same number
of bases from the 39 end as is the prokaryotic messagebinding site (anti-Shine–Dalgarno sequence) in 16S rRNA
(Dams et al., 1988). Thus, ribosome binding may occur by
a prokaryotic-like mechanism, as proposed for ribosomal
recognition of picornaviral IRESs (Pilipenko et al., 1992),
ribosome jumping on adenovirus mRNAs (Yueh and
Schneider, 1996) and ribosome recognition of STNV RNA
(Danthinne et al., 1993) (Figure 8C). eIF4F may facilitate
this or eIF4F may simply bind after the event to promote
59 end recognition and 59 to 39 scanning to the initiator
AUG. In support of this model, the lethal GAUC duplication includes four of the six bases in the potential rRNAbinding sequence (Figure 7). The duplication may disrupt
39TE–18S rRNA interactions, for example by altering
secondary structure (Figure 8C). The homologous
sequence in the apparently capped RNA1 of red clover
necrotic mosaic virus (RCNMV; Xiong and Lommel,
1989) has a mismatch in this six base sequence. Deletion
of this homologous sequence did not greatly reduce
translation of uncapped RCNMV RNA1 transcript (data
not shown). This supports our model but begs the question
as to why this sequence is conserved in dianthoviral RNAs.
The 18 base sequence is conserved poorly if at all in
the 39UTR of STNV RNA, but computer alignment of
part of the stimulatory region of the STNV 39UTR with
the above viral RNAs also aligns the proposed rRNAbinding sequences (Danthinne et al., 1993) (Figure 7).
However, the STNV sequence identified by Danthinne
et al. (1993) would base-pair to a region much further
from the 39 end of 18S rRNA and requires disruption of
a very stable stem–loop in the rRNA (Dams et al.,
1988). Danthinne et al. (1993) also proposed that the 39
stimulatory sequence enhances translation by binding
ribosomes that have completed translation to facilitate
rapid recycling to the 59 end. This mechanism is ruled
out in the case of BYDV-PAV RNA by the ability of the
39TE to function when located in the 59UTR and absent
from the 39UTR.
Whatever the mechanism, it is clear that resolving the
mechanism(s) of cap-independent translation initiation
conferred by the BYDV-PAV 39TE will broaden our
understanding of the possibilities for translation initiation
in eukaryotes.
pT7GUSA(1), respectively] were described by Wang and Miller (1995).
To construct pGUS1162A, the A30-containing, SmaI–PvuII fragment
of pSP64poly(A) (Promega) was cloned into SmaI-cut pGUS1162.
pGUS109A was derived from pGUSA. First, the 109 nt sequence
corresponding to BYDV-PAV bases 4817–4925 was amplified from
pGUS1162 by PCR using primers: 59 GCGGAGCTCAGACAACACCACTAGCAC 39 and 59 GCGGAGCTCCATCGGCCAAACACAATAC
39. The product was cut with SacI (underlined, an isoschizomer of
EcoICRI) and ligated into SacI-digested pGUSA. To construct pGUS109,
the amplified 109 base fragment was inserted into SacI-digested
pGEM3Zf(1), giving rise to p39TE. Then the SmaI–EcoRI fragment from
p39TE was ligated to EcoICRI–EcoRI-digested pGUS109A. Plasmids
containing the GATC duplication at the BamHI4837 site (BF) were
constructed from corresponding ‘wild-type’ plasmids by cutting, Klenowfilling and re-ligating the BamHI site.
pΩGUS1162A was constructed via a series of intermediate plasmids.
A fragment corresponding to the Ω sequence and 59 end of the GUS
coding region was PCR amplified from pAGUS-Tn2 (Skuzeski et al.,
1990) with the primers: 59 GCGGCGGCCGCTAATACGACTCACTATAGGTATTTTTACAAC 39 and 59 TCGCGATCCAGACTGAATGC 39. Following digestion with NotI (underlined) and NcoI
(internal), the amplified fragment was cloned into NotI/NcoI-cut pSL1180
(Pharmacia), giving rise to pSLΩ2. Intermediate plasmid pSLΩGUSA
was constructed by subcloning the GUS gene and poly(A) tail from
pVecGUSA into the NcoI and EcoRI sites of pSLΩ2. The Csp45I–EcoRI
fragment of pGUS1162A was cloned into similarly cut pSLΩGUSA,
resulting in pΩGUS1162A. To construct pΩGUS109A, GUS along with
the A30 fragment was cut out from pVecGUSA with NcoI and EcoRI,
and cloned into NcoI–EcoRI-cut pSLΩ2.
Plasmids having the 109 nt 39TE at the 59 end of the GUS gene in
place of the wild-type BYDV-PAV 59UTR are called p109GUSA and
p109BFGUSA (Figure 1A). pT7GUS1 (Wang and Miller, 1995) was
digested with NcoI at the GUS start codon, filled in with Klenow
fragment and then digested with EcoICRI 39 of the stop codon. The
1.8 kb fragment containing the GUS coding sequence was ligated to
SmaI-cut pTE or pTEBF, giving rise to p109GUS and p109BFGUS,
respectively. The EcoRI site in these two constructs was mutated by
Klenow fragment fill-in. Then the Csp45I (in the coding sequence of
GUS)–ScaI [in the ampicillin resistance (bla) gene of the vector] fragment
was replaced with the corresponding fragment from pPGUS109A, giving
rise to p109GUSA and p109BFGUSA, respectively, so that the poly(A)
tail was added at the 39 end of the GUS gene. The plasmids were
digested with XbaI to synthesize the 109GUS and 109BFGUS RNAs.
They were cut with EcoRI to synthesize the 109GUSA1 and
109BFGUSA1 RNAs.
Materials and methods
Northern blot hybridization
RNA from electroporated oat protoplasts was isolated and 5 µg of RNA
was subjected to electrophoresis as described in Mohan et al. (1995).
32P-labeled antisense GUS gene RNA transcribed from pVecGUS using
SP6 polymerase was used as probe.
Plasmid construction
All constructs were verified by automated DNA sequencing. pGUS1162,
pGUSA and pVecGUSA [formerly pCIGUS, pGUSEA and
RNA synthesis
The plasmids were digested at appropriate sites as indicated in Figure
1A. Uncapped transcripts were synthesized with Megascript kit (Ambion,
TX). Capped transcripts were synthesized with T7 Message mMachine
(Ambion, TX). RNA concentrations were determined spectrophotometrically. RNA integrity was verified by 1% agarose gel electrophoresis.
In vitro translation
Subsaturating amounts (0.2 pmol) of capped or uncapped transcripts
were translated in wheat germ extracts (Promega) as described previously
(Wang and Miller, 1995). Protein products were quantified using a
Molecular Dynamics PhosphorImager and ImageQuant 3.0 software. In
competition experiments, the competitor, either 39TE RNA or 39TEBF
RNA, was first incubated with the wheat germ extract at room temperature
for 5 min before the tested mRNA was added to the translation reaction.
RNA electroporation in protoplasts and GUS assay
Oat (Avena sativa, cv. Stout) protoplasts were prepared, electroporated
with RNA and cultured as described by Dinesh-Kumar and Miller
(1993). GUS reporter gene assays were performed as in Dinesh-Kumar
and Miller (1993), except that 30 pmol (subsaturating amounts) of the
indicated transcripts were used instead of DNA. Cells were assayed for
GUS activity 20 h after electroporation except in the time course
experiment in Figure 3.
4115
S.Wang, K.S.Browning and W.A.Miller
Acknowledgements
The authors thank Chris Brown for valuable advice. This work was
funded by the National Science Foundation, grant No. MCB9420806,
and the Iowa Agricultural and Home Economics Experiment Station
(Journal Paper J-16857; Project 3330).
References
Beelman,C.A. and Parker,R. (1995) Degradation of mRNA in eukaryotes.
Cell, 81, 179–183.
Browning,K.S. (1996) The plant translation apparatus. Plant Mol. Biol.,
32, 107–144.
Caponigro,G. and Parker,R. (1995) Multiple functions for the poly(A)binding protein in mRNA decapping and deadenylation in yeast.
Genes Dev., 9, 2421–2432.
Carrington,J.C. and Freed,D.D. (1990) Cap-independent enhancement of
translation by a plant potyvirus 59 nontranslated region. J. Virol., 64,
1590–1597.
Chaloub,B.A., Kelly,L., Robaglia,C. and Lapierre,H.D. (1994) Sequence
variability in the genome-39-terminal region for 10 geographically
distinct PAV-like isolates of barley yellow dwarf virus: analysis of the
ORF6 variation. Arch. Virol., 139, 403–416.
Curtis,D., Lehmann,R. and Zamore,P.D. (1995) Translational regulation
in development. Cell, 81, 171–178.
Dams,E., Hendricks,L., Van de Peer,Y., Neefs,J., Smits,G.,
Vandenbempt,I. and De Wachter,R. (1988) Compilation of small
ribosomal subunit RNA sequences. Nucleic Acids Res., 16, r87–r173.
Danthinne,X., Seurinck,J., Meulewaeter,F., van Montagu,M. and
Cornelissen,M. (1993) The 39 untranslated region of satellite tobacco
necrosis virus RNA stimulates translation in vitro. Mol. Cell. Biol.,
13, 3340–3349.
D’Arcy,C.J. and Burnett,P.A. (eds) (1995) Barley Yellow Dwarf: 40
Years of Progress. APS Press, St Paul, MN.
Dinesh-Kumar,S.P. and Miller,W.A. (1993) Control of start codon choice
on a plant viral RNA encoding overlapping genes. Plant Cell, 5,
679–692.
Dubnau,J. and Struhl,G. (1996) RNA recognition and translational
regulation by a homeodomain protein. Nature, 379, 694–699.
Fletcher,L., Corbin,S.D., Browning,K.S. and Ravel,J.S. (1990) The
absence of a m7G cap on β-globin mRNA and alfalfa mosaic virus
RNA 4 increases the amounts of initiation factor 4F required for
translation. J. Biol. Chem., 265, 19582–19587.
Gallie,D.R. (1991) The cap and poly(A) tail function synergistically to
regulate mRNA translational efficiency. Genes Dev., 5, 2108–2116.
Gallie,D.R. and Tanguay,R. (1994) Poly(A) binds to initiation factors
and increases cap-dependent translation in vitro. J. Biol. Chem., 269,
17166–17173.
Gallie,D.R. and Walbot,V. (1990) RNA pseudoknot domain of tobacco
mosaic virus can functionally substitute for a poly(A) tail in plant and
animal cells. Genes Dev., 4, 1149–1157.
Gallie,D.R., Lewis,N.J. and Marzluff,W.F. (1996) The histone 39-terminal
stem–loop is necessary for translation in Chinese hamster ovary cells.
Nucleic Acids Res., 24, 1954–1962.
Hentze,M.W. (1997) eIF4G: a multipurpose ribosome adaptor? Science,
275, 500–501.
Jackson,R.J. and Kaminski,A. (1995) Internal initiation of translation in
eukaryotes: the picornavirus paradigm and beyond. RNA, 1, 985–1000.
Jacobson,A. (1996) Poly(A) metabolism and translation: the closed-loop
model. In Hershey,J.W.B., Mathews,M.B. and Sonenberg,N. (eds),
Translational Control. Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, NY, pp. 451–480.
Jefferson,R.A. (1987) Assaying chimeric genes in plants: the GUS gene
fusion system. Plant Mol. Biol., 5, 387–405.
Kozak,M. (1989) The scanning model for translation: an update. J. Cell
Biol., 108, 229–241.
Leathers,V., Tanguay,R., Kobayashi,M. and Gallie,D.R. (1993) A
phylogenetically conserved sequence within viral 39 untranslated RNA
pseudoknots regulates translation. Mol. Cell. Biol., 13, 5331–5347.
Lesnaw,J.A. and Reichmann,M.E. (1970) Identity of the 59-terminal
RNA nucleotide sequence of the satellite tobacco necrosis and its
helper virus: possible role of the 59-terminus in the recognition by
virus-specific RNA replicase. Proc. Natl Acad. Sci. USA, 66, 140–145.
Merrick,W.C. (1994) Eukaryotic protein synthesis: an in vitro analysis.
Biochimie, 76, 822–830.
Merrick,W.C. and Hershey,J.W.B. (1996) The pathway and mechanism
4116
of eukaryotic protein synthesis. In Hershey,J.W.B., Mathews,M.B.
and Sonenberg,N. (eds), Translational Control. Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY, pp. 31–69.
Miller,W.A. and Rasochova,L. (1997) Barley yellow dwarf viruses.
Annu. Rev. Phytopathol., 35, 167–190.
Miller,W.A., Waterhouse,P.M. and Gerlach,W.L. (1988) Sequence and
organisation of barley yellow dwarf virus genomic RNA. Nucleic
Acids Res., 16, 6097–6111.
Miller,W.A., Dinesh-Kumar,S.P. and Paul,C.P. (1995) Luteovirus gene
expression. Crit. Rev. Plant Sci., 14, 179–211.
Mohan,B.R., Dinesh-Kumar,S.P. and Miller,W.A. (1995) Genes and cisacting sequences involved in replication of barley yellow dwarf virusPAV RNA. Virology, 212, 186–195.
Muhlrad,D. Decker,C.J. and Parker,R. (1994) Deadenylation of the
unstable mRNA encoded by the yeast MFA2 gene leads to decapping
followed by 59→39 digestion of the transcript. Genes Dev., 8, 855–866.
Pelletier,J. and Sonenberg,N. (1988) Internal initiation of translation of
eukaryotic mRNA directed by a sequence derived from poliovirus
RNA. Nature, 334, 320–323.
Pestova,T.V., Hellen,C.U.T. and Shatsky,I.N. (1996) Canonical eukaryotic
initiation factors determine initation of translation by internal ribosomal
entry. Mol. Cell. Biol., 16, 6859–6869.
Pilipenko,E.V., Gmyl,A.P., Maslova,S.V., Svitkin,Y.V., Sinyakov,A.N.
and Agol,V.I. (1992) Prokaryotic-like cis elements in the capindependent internal initiation of translation on picornavirus RNA.
Cell, 68, 119–131.
Sarnow,P. (ed.) (1995) Cap-independent Translation. Current Topics in
Microbiology and Immunology. Vol. 203, Springer, Berlin.
Schnierle,B.S., Gershon,P.D. and Moss,B. (1992) Cap-specific mRNA
(nucleoside-O29-)-methyltransferase and poly(A) polymerase
stimulatory activities of vaccinia virus are mediated by a single
protein. Proc. Natl Acad. Sci. USA, 89, 2897–2901.
Sheets,M.D., Wu,M. and Wickens,M. (1995) Polyadenylation of c-mos
mRNA as a control point in Xenopus meiotic maturation. Nature, 374,
511–516.
Skuzeski,J.M., Nichols,L.M., Gesteland,R.F. and Atkins,J.F. (1990)
Analysis of leaky viral translation termination codons in vivo by
transient expression of improved β-glucuronidase vectors. Plant Mol.
Biol., 15, 65–79.
Sleat,D.E. and Wilson,T.M.A. (1992) Plant virus genomes as sources of
novel functions for genetic manipulations. In Wilson,T.M.A. and
Davis,J.W. (eds), Genetic Engineering with Plant Viruses. CRC Press,
Boca Raton, FL, pp. 55–113.
Standart,N. and Jackson,R.J. (1994) Regulation of translation by specific
protein/mRNA interactions. Biochimie, 76, 867–879.
Tanguay,R.L. and Gallie,D.R. (1996) Isolation and characterization of
the 102-kilodalton RNA-binding protein that binds to the 59 and 39
translation enhancers of tobacco mosaic virus RNA. J. Biol. Chem.,
271, 14316–14322.
Tarun,S.Z. and Sachs,A.B. (1995) A common function for mRNA 59
and 39 ends in translation initiation in yeast. Genes Dev., 9, 2997–3007.
Tarun,S.Z. and Sachs,A.B. (1996) Association of the yeast poly(A) tail
binding protein with translation initiation factor eIF-4G. EMBO J.,
15, 7168–7177.
Timmer,R.T., Benkowski,L.A., Schodin,D., Lax,S.R., Metz,A.M.,
Ravel,J.M. and Browning,K.S. (1993) The 59 and 39 untranslated
regions of satellite tobacco necrosis virus RNA affect translational
efficiency and dependence on a 59 cap structure. J. Biol. Chem., 268,
9504–9510.
Tsukiyamakohara,K., Iizuka,N., Kohara,M. and Nomoto,A. (1992)
Internal ribosome entry site within hepatitis-C virus RNA. J. Virol.,
66, 1476–1483.
Wang,S. (1996) Regulation of translation by the 39 untranslated region
of barley yellow dwarf virus-PAV RNA. Ph.D. Dissertation, Iowa
State University, Ames, IA.
Wang,S. and Miller,W.A. (1995) A sequence located 4.5 to 5 kilobases
from the 59 end of the barley yellow dwarf virus (PAV) genome
strongly stimulates translation of uncapped mRNA. J. Biol. Chem.,
270, 13446-13452.
Xiong,Z. and Lommel,S.A. (1989) The complete nucleotide sequence
and genome organization of red clover necrotic mosaic virus RNA-1.
Virology, 171, 543–554.
Yueh,A. and Schneider,R.J. (1996) Selective translation initiation by
ribosome jumping in adenovirus-infected and heat-shocked cells.
Genes Dev., 10, 1557–1567.
Received on February 17, 1997; revised on April 17, 1997