Computational and Biological Studies of Mechanical
Prophylaxis against Deep Venous Thrombosis
by
GUOHAO DAI
B.S. Mechanics and Engineering Science
Peking University, 1992
M.S. Biomechanics
Peking University, 1995
Submitted to the Harvard-MIT Division of Health Sciences and Technology
in partial fulfillment of the requirements for the Degree of
DOCTOR OF PHILOSOPHY IN MEDICAL ENGINEERING
at the
MASSACHUSETTS INSTITUTE OF TECHNOLOGY
June 2001
© 2001 Massachusetts Institute of Technology. All rights reserved.
Signature of Author
Harvard-MIT Division of Health Science and Technology
May, 2001
Certified by
Roger D. Kamm
Professor of Bioengineering
Thesis Supervisor
Accepted by
- ~ ' Ma
thaL.Gray
Edward Hood Taplin Professor of Medical and Electrical ngineering
Co-director, Harvard-MIT Division of Health Sciences and echnology
MASSACHUSETTS
INSTITUTE
OFTECHNOLOGY
ARCHIVES8
AUG 14
2001
LIBRARIES
Computational and Biological Studies of Mechanical
Prophylaxis against Deep Venous Thrombosis
by
Guohao Dai
Submitted to the Harvard-MIT Division of Health Sciences and Technology
On May, 15, 2001 in partial fulfillment of the requirements for the Degree of
DOCTOR OF PHILOSOPHY IN MEDICAL ENGINEERING
ABSTRACT
Deep vein thrombosis (DVT) of the lower extremity and induced pulmonary embolism
are common complications resulting from prolonged periods of bed-rest or
immobilization of the limbs. One of the most effective methods of prophylaxis against
DVT is external pneumatic compression (EPC). In spite of its wide acceptance as an
effective means of prophylaxis, its mechanism remains poorly understood and optimal
compression conditions have not been defined. Understanding the biological
consequences of EPC is an important goal for optimizing the performance of
compression device and providing guidance for clinical use. In the first part of this
thesis, a computational model of the leg was developed to simulate hemodynamic
conditions under EPC and the influence of different modes of compression were
analyzed and compared. Then, a new in vitro cell culture system was developed that
can be used to examine the effect of hemodynamic conditions during EPC on
endothelial cell (EC) function. The biologic response was assessed through changes in
cell morphology and the expression of various pro-thrombotic and anti-thrombotic
factors related to EC. The results show that intermittent flow associated with EPC upregulates EC fibrinolytic potential and vasomotor function. Using DNA microarray
technology, the data of thrombo-regulatory factors indicates that EC gene expression
shifts toward anti-thrombotic vs. pro-thrombotic under EPC. Finally, Nitric Oxide
(NO), an important regulator of vasomotor and platelet functions was studied in detail
under various cycles of EPC. The results show that NO production and eNOS mRNA
respond differentially to modes of EPC. Further exploration using the system can
potentially reveal the optimum combination of forces to better regulate
thromboresistant effects desired for DVT prophylaxis.
Thesis Supervisor: Roger D. Kamm
Title: Professor of Bioengineering
Thesis Committee
Roger D. Kamm, Ph.D., Massachusetts Institute of Technology
Forbes C. Dewey, Ph.D., Massachusetts Institute of Technology
Jonathan P. Gertler, M.D., Massachusetts General Hospital
Roslyn W. Orkin, Ph.D., Harvard Medical School
3
4
Acknowledgements
When this thesis is approaching to be finished, I cannot begin to think how much I
have learned during my years at MIT. My advisor, Prof. Roger Kamm, is my primary
teacher during these years. I am grateful for his guidance throughout my graduate
education from engineering skills, scientific thinking, teaching methods to
independent research. I have benefited from his insight, experience, and support for
these years. It would be an honor to continue working with him.
Thanks to my thesis committee members. I am indebted to Dr. Roslyn Orkin who
taught me the cell culture and molecular biology techniques. I still remember how
little I knew when I started. But with her patience and guidance, I was able to enter a
new field quickly. I am also deeply grateful for Dr. Jonathan Gertler who introduced
me to the realities of clinical research. I begin to get truly exited about vascular
medicine by working with him. Thanks also go to Prof. Forbes Dewey for his
insightful suggestions and scientific guidance.
Many members of the Vascular Research Division at Mass General Hospital have
helped to make my experirirents possible and the work enjoyable at the same time.
Without them, this thesis would not have been realized. Olga Tsukurov worked side
by side with me and taught me a lot of molecular biology techniques. Michael Chen
helped me greatly at essentially all the stages of the experiments. Nancy Conroy and
Phil Petteruti provided me with endothelial cell cultures too numerously to count. I am
grateful for their help and friendship.
I have been amazed at the personal support I have received from many friends
throughout my graduate school experience. I am thankful for the students at Fluid
Mechanics Lab who made life enjoyable and unforgettable over the years. Constantine
Hrousis helped with the ABAQUS when I started. Michael Capland provided me
space and equipment at MIT for the nitric oxide assay. I also have appreciated hours
of laughter and baseball shared with Edwin Ozawa, Barbara Ressler, Yaqi Huang,
Darryl Overby, Hayden Huang, Davide Marini and Federico Frigerio. They helped to
5
keep me looking forward during some long work days and boosting my spirits with
sense of humor.
The most important education I received is from HST MEMP program. I enjoyed all
the courses and activities I have taken at HST and thanks to all of the administration,
faculties and my fellow HST students who made this journey most memorable. I must
thank Prof. Roger Mark for his advice and encouragement for my decision to pursue
medicine in the future. I must also thank Dr. Valerie Stelluto, course director of
Introduction to Clinical Medicine, who guided me through the overwhelmed period
and taught me the compassionate care in medicine.
The work was funded by Aircast Inc. I thank them for their financial and technical
support which made all my research possible. Special thanks to Jack McVicker and
Bill Conte. They helped greatly with the VenoFlow system and made our experiments
go smoothly.
Thanks also go to Claire Sasahara. I am grateful for her diligence in helping me with
all of the administrative assistance.
My family members have always provided unconditional love and support for me. I
owe my parents an enormous debt of gratitude. They have done their best to provide
me every opportunity to get better education and have remained my greatest
cheerleaders throughout my life.
Finally and most importantly, I would like to thank my wife, Maggie, for making these
years the most wonderful time in my life with her love, support and understanding.
And I know life couldn't be better without Maggie.
6
Table of Contents
ACKNOWLEDGEMENTS
TABLE OF CONTENTS
........................
5
........................................
7
LIST OF FIGURES ........................................
9
LIST OF TABLES .......................................................................................................................................
11
13
CHAPTER 1 INTRODUCTION ........................................................................................
BACKGROUND: DEEP VENOUS THROMBOSIS ........................................
PATHOGENESIS OF VENOUS THROMBOSIS ........................................
DVT PROPHYLAXIS
..............................................................................
..................
13
..................
14
..................
15
MECHANISMS OF EPC ..........................................................
GOAL OF THESIS .
17
.........................................................
20
THESISORGANIZATION
..........................................................
20
CHAPTER 2 DEVELOPMENT OF FINITE ELEMENT MODEL.
FINITE ELEMENT MODEL (FEM) OF THE LOWER LEG
..................................
..........................................................
23
23
MODES OF EXTERI AL COMPRESSION ..........................................................
25
EXPERIMENTS TO MEASURE THE ELASTIC MODULUS OF THE HUMAN LEG ..............................................
27
RESULTS OF THE FEA ..........................................................
30
SIMULATION OF VENOUS FLOWS GENERATED BY EXTERNAL COMPRESSION .......................................
35
RESULTS OF BLOOD FLOW SIMULATION ...................................................................................................
39
DISCUSSION....................................................................
50
CHAPTER 3 ENDOTHELIAL CELLS IN THROMBOSIS AND HOMEOSTASIS ....................... 57
ROLE OF THE ENDOTHELIAL CELL IN REGULATING 'THROMBOSIS............................................................
57
ENDOTHELIAL FUNCTIONS REGULATED BY FLUID SHEAR STRESS AND CYCLIC STRAIN .........................
64
CANDIDATEGENES.............................................................................
................ 67
CHAPTER 4 DEVELOPMENT OF AN IN VITRO CELL CULTURE SYSTEM ........................... 69
INTRODUCTION
....................................................................
DEVELOPMENT OF THE VENOUS FLOW SIMULATOR (VFS)
69
...................................................................
69
PHYSICAL DESCRIPTION AND CHARACTERISTICS OF THE VFS ............................................................
71
EXPERIMENTAL DESIGN.............................................
74.
ESTABLISHMENT OF VFS CELL CULTURES ..............................................................................................
77
NORTHERN BLOT ANALYSIS .....................................................................................................................
78
CHAPTER 5 RESULTS AND DISCUSSION OF CELL CULTURE EXPERIMENTS ..............
7
79
RESULTS....................................................................................................................................................
DISCUSSION...........................................................................
CHAPTER 6 SCREENING COAGULATION RELATED GENES USING AFFYMETRIX
GENE ARRAY ...........................................................................
INTRODUCTION
TODNA MICROARRAY
........................................
..................................
MATERIALS AND METHODS ...........................................................................
79
87
95
95
98
POSITIVE CONTROL ...........................................................................
100
RESULTS ...................................................................................
101
DISCUSSION...........................................................................
104
SUMM ARY ...............................................................................................................................................
106
CHAPTER 7 NITRIC OXIDE PRODUCTION BY ENDOTHELIAL CELLS UNDER EPC ...... 109
INTRODUCTION
...........................................................................
109
NITRIC OXIDE AND NITRIC OXIDE SYNTHASE ..........................................................................
109
NO CHESMITRY
................................ ..........................................
112
NITRITRE/NITRATE DETERMINATION ...........................................................................
113
EXPERIMENT SETUP ........................................
1 14
...................................
STATISTICAL ANALYSIS ...........................................................................
116
RESULTS............................................................................................
116
CONCLUSION AND DISCUSSION ........................................
123
...................................
CHAPTER 8 SUMMARY ...........................................................................
129
SUMMARY...........................................................................
129
FUTUREDIRECTIONS........................................
133
...................................
BIBLIOGRAPHY ...........................................................................
8
137
List of Figures
Figure 1-1
Sketch of External Pneumatic Compression ......................................... 16
Figure 2-1
Finite element model of a cross-s.ection of the lower leg showing ........ 25
regions of bone, tissue, vein, fascia and skin.
Figure 2-2
Three types of compression modes used in the simulation.................... 26
Figure 2-3
Verify FEM by comparing to analytic solution of compression of a..... 27
thick wall tube.
Figure 2-4
Figure 2-5
Apparatus used to measure the Young's modulus of the lower leg........ 28
Finite element simulation of the experiment. .............................
29
Figure 2-6
Comparison of experiment data to results from the FEA with.............. 29
different values of the Young's modulus for tissue.
Figure 2-7
Tissue deformation caused by external pneumatic compression ........... 30
Figure 2-8
The relation between venous cross-sectional area and compression...... 31
pressure for the two distributions of pressure.
Figure 2-9
Maximum principal strain along the vessel wall after compression ...... 33
Figure 2-10 Maximum principal stain distribution along the inner circumference ... 34
of the vein.
Figure 2-11 (a) Axially-uniform pressure along the leg ........................................... 38
(b) Graded-sequential pressure along the leg
Figure 2-12 Normalized venous cross-sectional area following the application ....... 40
of external pressure as a function of distance from the "ankle".
Figure 2-13 Calculated blood flow velocity at the thigh ......................................... 43
Figure 2-14 Calculated wall shear stress as a function of distance from the "ankle" 45
Figure 3-1
Endothelial thromboregulation by secreting or expressing ................... 64
variety of molecules.
Figure 4-1
(a) Schematic drawing of venous flow simulator (VFS) ...................... 72
Figure 5-1
(b) Test chamber used to produce tube compression.
Measured pressure, flow rate, and calculated shear stress in the VFS ... 80
Figure 5-2
Color contour map showing calculated tube wall strain........................ 81
Figure 5-3
Endothelial morphology after 6 hours of experiment............................ 82
Figure 5-4
Northern blot analysis of mRNA expression of candidate genes........... 83
9
after 6 hours experiment period at peak shear of 10 dyn/cm2 .
Figure 5-5
Northern blot analysis of mRNA expression of candidate genes ...........84
after 1 hour experiment period at peak shear of 40 dyn/cm 2 .
Figure 5-6
Northern Blot of mRNA expression of tPA, PAI-1, Annexin II ............85
eNOS, ET-1 and GAPD.
Figure 5-7
Densitometric analysis of mRNA expressio of tPA, PAI-I ................... 86
and Annexin II.
Figure 5-8
Densitometric analysis of mRNA expression of eNOS and ET-1 ..........87
Figure 6-1
Schematic view of Affymetrix GeneChip ............................................ 97
Figure 6-2
Each gene is identified by 20 perfect match oligonucleotides ...............99
and 20 mismatch oligonucleotides.
Figure 6-3
Affymetrix gene chip hybridization protocol. ......................................100
Figure 6-4
Northern blot analysis of eNOS and tPA mRNA expression ............... 101
Figure 7-1
Nitrite calibration curve...................................................................... 114
Figure 7-2
Cumulative nitrite production in conditioned media .......................... 117
Figure 7-3
Kinetics of NO production in response to resting period ..................... 118
Figure 7-4
Nitrite production after 6 hours experimental period with and ............ 119
without 100mM NG-amino-L-arginine (L-NAA).
Figure 7-5
Cumulative nitrite levels in flow only group (F) in presence of ........... 120
1mM S-Methyl-L-thiocitrulline,
I mM dexamethasone and
ImM N'-Nitro-L-arginine Methyl Ester.
Figure 7-6
(a) Northern blot analysis of mRNA expression of eNOS ................... 121
(b) Densitometric analysis of eNOS mRNA expression.
Figure 7-7
NO production rate between 0 and 1 hour (left), between ................... 122
1 and 6 hour (right) under different EPC cycles.
Figure 7-8
eNOS mRNA expression under different cycles of EPC .................... 123
10
List of Tables
Table 2-1 Wall shear stress under different flow conditions ...................................... 36
Table 2-2 Percent of vessel wall subjected to certain level of shear stress (Young's
modulus of muscle = 1.2x 104Pa)........................................
......................
49
Table 2-3 Percent of blood left in the lower leg ................................. ...................... 49
Table 2-4 Percent of vessel wall subjected to certain level of shear stress (Young's
modulus of muscle = 0.6x 104Pa)........................................
. .....................................
50
Table 2-5 Percent of blood left in the lower leg ........................................................ 50
Table 3-1 Summary of endothelial cell response to hemodynamic shear stress ......... 65
Table 4-1 Conditions in each of the four flow circuits.
..............................
70
Table 4-2 Conditions used in the present experiments............................................... 70
Table 4-3 Comparative compliance of human saphenous vein and silastic tube ........73
Table 6-1 Changes of mRNA expression in endothelial pro-thrombotic genes ........ 102
Table 6-2 Changes of mRNA expression in endothelial anti-thrombotic genes ....... 103
Table 7-1 Three isoforms of nitric oxide synthase (NOS) ....................................... 110
Table 7-2 Conditions in each of the experimental groups........................................ 115
11
Chapter 1 Introduction
Background: Deep Venous Thrombosis
Deep Venous Thrombosis (DVT) is the development and growth of thrombi in the
deep veins of the leg. In the slower moving blood of the veins, the thrombi have a
much richer admixture of erythrocytes and are therefore known as red, coagulative
thrombi [1]. Venous thrombosis, once formed, is almost invariably occlusive. Thrombi
are important for two reasons: (1) they cause obstruction of veins which leads to
localized pain, inflammation and edema, (2) they provide possible sources of emboli.
Venous thrombi may cause congestion and edema in dependent parts, but a far graver
consequence is that thrombi may dislodge from distal sites in the vascular tree, travel
to the lung and cause Pulmonary Embolism (PE), one of the most common causes of
death in hospitalized patients [2]. Depending on the size and location of the embo!ic
mass, it may cause pulmonary infarction, acute right heart failure, cardiovascular
collapse or even sudden death [].
DVT and PE constitute major health problems that result in significant morbidity and
mortality. It is estimated
that they are associated
with 300,000-600,000
hospitalizations a year and as many as 50,000 deaths each year as a result of
pulmonary embolism [2]. DVT and PE are common in many medical and surgical
conditions. For example, the incidence of DVT in trauma has been found to be 65% in
autopsy studies [3] and 58% in patients studied by venography [4]. Furthermore, DVT
accounts for peri-operative morbidity and death in up to 30% of orthopedic, trauma
and neurosurgical procedures and has a significant morbidity in all aspects of surgical
and oncological care [5].
13
Pathogenesis of Venous Thrombosis
Thrombosis reflects a disturbance of normal homeostatic balance. In health, the blood
remains free from clots, yet allows for the rapid formation of a solid plug to repair any
type of injury to the blood vessels. This process is referred to as normal homeostasis.
Thrombosis, on the other hand, is a pathological process in which a clotted mass of
blood is formed within the non-injured vascular system; it represents, to a considerable
extent, a pathologic extension of normal homeostasis.
Several groups of patients, for example, those undergoing various types of surgery are
at high risk of developing venous thromboembolic disease. Other common causes of
DVT include trauma, obesity, malignancy, immobilization, cardiac disease and stroke.
Virchow [6] was the first to summarize the following factors which are thought to
influence thrombus formation: (1) Vessel wall damage, (2) Blood hypercoagulability,
(3) Alterations in blood flow.
Vessel wall damage
When the endothelium of a vessel is damaged, exposing the subendothelium to blood,
platelet adhesion and aggregation are triggered and tissue factor is activated, thereby
promoting blood coagulation. Damage to vessels contributes to venous thrombosis as
a result of trauma or in patients undergoing surgery.
Bloodcoagulability
Changes in the blood itself can affect coagulability and thereby promote thrombus
formation. With increasing age, we all have increased blood coagulability. Some
patients, however, have genetic deficiencies in anti-thrombin III, protein C, protein S
or Factor
V Leiden, that make them particularly
14
susceptible
to venous
thromboembolism. Changes in blood coagulability also occur secondary to a variety of
medical conditions [1].
Alterations in blood flow
Changes in blood flow (e.g. venous stasis) have been shown to increase the risk of
thrombosis. In subjects with competent venous valves, venous return from the legs is
enhanced by contraction of the calf muscles, which helps to propel blood towards the
heart. But stasis can occur in states of immobility when the blood is allowed to pool in
the intramuscular sinuses of the calf that become dilated during prolonged bed rest.
Autopsy studies have revealed that the prevalence of DVT is high in patients confined
to bed for a week or more prior to death [2]. Patients are exposed to these same risks
when confined to bed either before or after surgery. Elderly, bedridden patients,
especially those with varicose veins and incompetent valves have a tendency to suffer
from venous dilation in the legs, and this can also lead to venous pooling and stasis.
Venous obstruction is another cause of stasis as in patients with pelvic tumors or
proximal vein thrombosis. It is thought that when blood flow slows, there is more time
for the accumulation of clotting factors and the small thrombi formed can not been
washed away if there is insufficient flow. Therefore, venous stasis is often associated
with DVT.
DVT prophylaxis
The prevalence of DVT and PE is sufficiently high that prophylactic procedures are
typically used in patients considered to be at risk. There are basically two methods of
prevention: pharmacological (e.g., heparin, warfarin) and mechanical (e.g. elastic
stockings, external pneumatic compression, early ambulation etc.). Systemic
anticoagulants can be effective but often are contra-indicated in situations such as
15
major trauma, neurological and radical pelvic surgery where risk of hemorrhage is of
particular concern.
Of the mechanical interventions, one of the most
effective methods of prophylaxis against DVT is external
pneumatic compression (EPC) (Figure 1-1). An EPC
device usually consists of an inflatable cuff and a
pressure control unit. The cuff is placed around the
patient's
lower legs and is inflated and deflated
periodically. The pressure and time cycle varies among
different design. Typically, the cycle consists of a rapid
pressure rise from zero to 40~50mmHg, after which the
pressure is held constant for about 810
seconds.
Pressure is then released and a rest period of about 50
Figure 1-1 External
Pneumatic Compression
second follows before the next pressure pulse is applied.
The compression collapses the veins, enhances blood flow in the deep veins.
Therefore, it discourages stasis and venous pooling of blood in the lower extremities.
The efficacy of EPC has been well documented in medical literature. Intraoperative
and postoperative intermittent pneumatic compression was found to be highly
effective in the prevention of DVT in abdominal surgery [7], neurosurgery [8] and is
highly effective following various orthopedic procedures [9, 10].
Compared to traditional anti-coagulant therapies, EPC has been shown not cause
major bleeding complications [11] and is particularly useful in patients at high risk of
bleeding, e.g. those undergoing neurosurgery and major orthopedic surgery or in
situations where pharmacological agents are contraindicated as in multiple trauma.
EPC has become widely favored both because of its high success rate and relative
absence of side effects.
16
Intermittent compression devices are inexpensive and should be considered in all atrisk surgical patients. On the other hand, they can be somewhat cumbersome and
inconvenient, potentially leading to less than optimal compliance rates by patients and
nursing staff. The cumbersome nature of these devices has been overcome by the more
modern versions. Because of all the benefits, NIH consensus statement [2]
recommends wider use of EPC prophylaxis except in certain situations where the
devices can not be applied, such as in patients with lower leg fractures.
Mechanisms of EPC
The use of intermittent pneumatic leg compression to reduce the frequencies of
thromboembolic complications is based on sound physiological rationale. The
prevention of venous thrombosis is associated with the observation that high flow
pulsatility helps to empty the deep veins periodically, thus overcoming venous stasis.
Increased blood flow velocity can dilute local coagulation factors, break up small
thrombi and prevent the aggregation of platelets. These hemodynamic effects are
thought to be the primary mechanisms of EPC. However, the exact nature of the
biologic response is not well understood. In the following, we will review our current
understanding of those factors that thought to contribute to the efficacy of EPC. These
include enhanced fibrinolytic activity, stimulated nitric oxide production and increased
tissue factor pathway inhibitor.
Enhancedfibrinolyticactivity
Previous investigations have demonstrated the ability of external compression to
increase the fibrinolytic activity of systemic blood [12-14] and found that the degree
of fibrinolytic enhancement depended on the mode and timing of external compression
[12]. It was proposed that hemodynamic action might stimulate fibrinolytic activity
17
via production of tissue type plasmnogen activator (tPA) by the vascular endothelium.
However, whether or not EPC can enhance fibrinolytic activity is still under debate. In
other studies, no changes of tPA or plasminogen activator inhibitor (PAI-1) antigens
were observed [15]. These studies indicated that the antithrombotic effect of
mechanical prophylaxis is probably due primarily to its ability to increase venous peak
velocity and flow but not due to enhanced fibrinolytic activity. Furthermore, in those
studies that demonstrated enhanced fibrinolytic activity, the mechanism by which this
occurs has not been clearly identified. Comerota et al showed [i6] that the mechanism
of increased fibrinolytic activity is due to a reduction in PAI-I in the absence of
changes in tPA with a resulting increase of tPA activity. However, in other studies
[ 17], increased tPA production is thought to be the cause of enhanced fibrinolysis.
StimulatedNitric Oxideproduction
In addition to its use as prophylaxis against deep venous thrombosis, compression of
the limbs has several beneficial effects in treatment of venous ulcers, chronic venous
hypertension and chronic venous insufficiency [18-20]. Under these situations,
vasodilation and improved microcirculation were thought to be contributing factors.
Experiments have shown significant vasodilation in arteries and veins during the
application of intermittent pneumatic compression, and have shown that the
vasodilation could be completely blocked by nitric oxide synthase (NOS) inhibitor
[21]. These findings demonstrate that the production of nitric oxide (NO) may be
involved in the positive influence of intermittent pneumatic compression on peripheral
circulation.
NO, as the primary endothelial derived relaxation factor (EDRF), is not only is a
potent vasodilator, but also plays an important role in preventing thrombosis
formation. Its primary mode of action is to inhibit platelet activation and aggregation
[22, 23]. In addition, NO has also been shown to inhibit tissue factor expression,
18
synthesis and activity [24, 25], as well as to increase tissue plasminogen activator
(tPA) release [26]. All of these effects contribute to the anti-thrombotic properties of
NO. It is likely that hemodynamic changes caused by EPC increase production of NO
by endothelial cells [21], this may be one of the factors in DVT prophylaxis and
treatment of venous insufficiency.
Increasedtissuefactor pathway inhibitor
Compared to the large number of studies that focus on fibrinolytic activity, there is
relatively little data on the effect of EPC in the early events of blood coagulation,
specifically, the tissue factor pathway that initiates the coagulation process when
tissue is damaged. The tissue factor dependent pathway is regulated primarily by
tissue factor pathway inhibitor (TFPI), which is synthesized primarily in the
endothelial cells [27]. Chouhan et al [28] showed that EPC results in an increase in
plasma TFPI and a decline in Factor VIIa. The observed increases in TFPI with
decrease in Factor VIIa suggest that EPC induces an inhibition of the earliest events in
the activation of blood coagulation by the tissue factor pathway. Inhibition of the
tissue factor pathway, the major physiological initiating mechanism of blood
coagulation, may be an important mechanism for the antithrombotic effect of
intermittent pneumatic compression.
In summary, there is increasing evidence that external pneumatic compression affects
Virchow's triad in three ways: it eliminates stasis and alters blood coagulability
through regulating endothelial functions. While Virchow's triad remains true, we
propose that it may be considerably more complex than previous thought in that there
exists an intricate relationship between hemodynamic factor, endothelial
thromboregulatory functions and coagulation factors.
19
Goal of thesis
There have been many studies aimed at improving the performance of EPC in terms of
hemodynamic conditions [ 12, 26, 29, 30]. However, the biological correlations of EPC
are still unknown in spite of its wide acceptance as an effective means of prophylaxis
against DVT. Understanding the biological consequences of EPC can potentially lead
to an optimization of the EPC and the device used to produce it and provide guidance
for clinical use. In this thesis, we investigate the biological correlations of EPC
hemodynamics in the following ways,
1. A finite element model of the leg was developed and used to study the influence of
different modes of EPC on venous. In this part of the work, we also determined the
hemodynamic conditions to be used in the follow-up in vitro cell culture experiments.
2. Endothelial cells are known to play an important role in maintaining the
homeostasis, and many of the functions are influenced by shear stress and cyclic
strain. This thesis explores the hypothesis that hemodynamic changes caused by EPC
could change endothelial antithrombotic properties, which contribute to the efficacy of
EPC. This does not preclude that hemodynamic factors, by themselves, decrease the
risk of thrombus formation. An in vitro cell culture system which can mimic the
hemodynamic conditions of EPC is developed. Cell culture and molecular biology
techniques are used to study the changes of various coagulation related genes under
EPC.
Thesis organization
In chapter 2, a computational model of the leg is developed and used to study the
influence of different EPC modes on venous hemodynamics. The effects of different
20
types of compression modes are compared. Typical hemodynamic conditions from the
simulation were used in the follow-up in vitro cell culture experiments.
In chapter 3, the role of endothelial cells in thromboregulation and the influence of
shear stress on those functions are reviewed. We then discuss the candidate genes
selected for study in our in vitro cell culture experiment.
In chapters 4 and 5, we describe the development of the in vitro cell culture system to
mimic the hemodynamic conditions of EPC, then investigate the influences of
pulsatile flow and vessel compression on endothelial fibrinolytic and vasomotor
functions.
In Chapter 6, broader aspects of endothelial thromboregulation are discussed and
studied using Affymetrix gene array technology. A couple of coagulation related
genes are identified that respond to EPC hemodynamic conditions.
Finally we consider nitric oxide and nitric oxide synthase in chapter 7. We explore
their regulation under various hemodynamic conditions in more detail. Finally, in
chapter 8 we summarize the conclusions developed in the thesis, and presente
suggestions for future work.
21
Chapter 2 Development of Finite Element Model
The purpose of this chapter is to simulate venous blood flow and vessel collapse
conditions caused by external compression in order to predict the distribution of wall
strain and wall shear stress produced in the veins by various modes of external
compression. Venous blood flow has been studied extensively using one-dimensional
unsteady flow through a network of collapsible tubes [31, 32]. My thesis extends
previous studies by developing a finite element model of the leg. Combined with the
unsteady fluid dynamics model, it thus allows us to investigate the different
distributions of EPC pressurization, and the prediction of shear stress and vessel wall
strains at the level of the venous endothelium. These predictions will be used as
reference values for our in vitro cell culture experiment. Ultimately, it could be used in
conjunction with biological experiments to optimize the mode of compression with
respect to endothelial thromboregulation and thereby produce a more effective clinical
procedure for preventing venous thrombosis.
Finite Element Model (FEM) of the Lower Leg
Model assumption
The intent of these simulations is not to produce a precise anatomical model of the
venous tree, which is both complex and highly variable between subjects, but rather to
simulate a 'typical' system of muscular veins emptying into the deep venous system
and draining primarily via the popliteal and deep femoral veins.
In order to simulate venous blood flow, it is necessary to first determine the
dependence of venous cross-sectional area on venous pressure and externally-applied
pressure. For this purpose, the leg was modeled as a two-dimensional structure
comprised of five parts: blood, venous wall, bone, muscle, skin and fascia (the thin but
23
stiff membranes that separate the different muscular regions). These were arranged as
indicated in Figure 2-1.
The decision to assume a two-dimensional structure is based on several factors. While
it would be more realistic to take three-dimensional effects into account, to do this in a
realistic manner would be prohibitively difficult and computationally expensive. The
purpose of these calculations was to improve upon previous studies [31, 32] by
replacing a tube law loosely based on venographic data, by one computed based on an
approximation of the leg structure. In doing so, the effects of non-uniform
circumferential distributions of pressure and non-homogeneous composition can be
studied. Several additional assumptions have been made in the course of the FEA of
this structure:
* The plane strain approximation is used.
* Skin and fascia are treated as thin membranes, capable of transmitting in-plane
forces but not moments. So-called 'truss elements' are used for this purpose. The
elastic (Young's) modulus used for skin is 2 x 106 Pa [33], and for fascia, 3.4 x 108
Pa [34].
* The Young's modulus of the vein is taken to be 1.33 x 105 Pa [35], the wall
thickness-to-radius ratio, 0.2, and the diameter, 1 cm at the popliteal vein.
*
All materials are assumed to have a Poisson's ratio of 0.5 on the assumption that
compression takes place on a time scale too small to permit much redistribution of
interstitial fluid.
* Bone is taken as rigid and incompressible. The tissue elements surrounding the
bone are assumed to be fixed in space.
* Pressure load is imposed on the inside surface of the vein to simulate venous blood
pressure.
* Two-dimensional solid elements (6-node quadratic and 8-node bi-quadratic) are
used in the muscle region.
24
Vein
,3
8s
1
2
3
3-node quadratic truss
(for skin and fascia)
8-node biquadratic
Figure 2-1 Finite element model of a cross-section of the lower leg showing regions
of bone, tissue, vein, fascia and skin.
Modes of External Compression
Three different distributions of external compression are applied to the leg using the
FEM: Circumferentially-symmetric
(C) and asymmetric (A): either Anterior-Posterior
or Collateral (Figure 2-2). Simulations were conducted with compression on the lateral
aspects of the calf; as these gave results similar to anterior-posterior compression, only
the latter are reported. The cross-sectional area of the vein was determined as a
25
function of external and internal pressure. All calculations were performed using a
commercial finite element analysis (FEA) code (ABAQUS Version 5.2, HKS, Inc.
Pawtucket, RI).
Circumferential
Collateral
Anterior-Posterior
Figure 2-2 Three types of compression modes used in the simulation
As a means of validation, initial simulations were performed using a circumferentially
-symmetric compression of a thick-walled tube (Figure 2-3). Using the mesh shown in
the figure, excellent agreement was found between the FEA and the result obtained
from application of the analytic solution in a series of small, step-wise load
applications [36].
26
e
ram
L.U
Young'sModulus=2x04
PoissonRatio=0.49
0.8
0.6
0.4
0.2
00n
U.U
n,
U.,"
,,
U.4
n
,,
U.
U.
,n
I.U
Outsidecompressionpressure(from0-50 mmHg)
Figure 2-3 Verify FEM by comparing to analytic solution of compression of a
thick-walled tube.
Experiments to measure the elastic modulus of the human leg
As no value for the elastic modulus of relaxed skeletal muscle could be found in the
literature, a simple experiment was conducted to obtain an estimate for this parameter.
The approach used was to apply a known force to the lower leg, measure the resulting
displacement, then simulate the experiment with the FEA using the methods described
above, but with different values for the Young's modulus of muscle. The value for
modulus that produced the closest agreement with the measurement was subsequently
used in the calculations of venous collapse.
To simplify the calculations used to infer the elastic modulus, an attempt was made to
produce a two-dimensional
deformation. For this purpose, a block (2 cm x 2 cm x 6
27
cm) was positioned against the mid-calf with its long axis parallel to the axis of the
leg, and a force was applied via a low-friction pulley and weight as shown in Figure 2-
4. Displacements were measured directly. Healthy volunteers between the ages of 21
and 30 were asked to sit on a chair and to relax their leg. The cylinder was carefully
brought in contact with the mid-portion of the calf with minimal force and weights
were gradually added. Approximately 5 measurements were made during increasing
force, the entire experiment lasting approximately 5 minutes. The measured forcedisplacement relationship was found to be nearly linear and the slope of the line was
associated with the elastic modulus of the leg.
I
-*-
Block
Lower leg
::'1----
Weight
Figure 2-4 Apparatus used to measure the Young's modulus of the lower leg.
The FEM simulation of this experiment is also done with different modulus parameter.
As shown in the Figure 2-5, the model leg is under the load as the same condition as
the experiment and the dimension is also set to the same size as the volunteer's
leg.
With different values of the elastic modulus, the FEM simulation is done and the
displacement-pressure relation is plotted as following along with the experiment data
(Figure 2-6).
28
Figure 2-5 Finite element simulation of the experiment.
1
Experimental Data
0.9
/
0.8
/
E=l.xl 0 4
0.7
E=l .2x1 04
E=1.5x104
Es
0.6
E=2.0x 104
-
/
E 0.5
i,'
.. 0.4
0.3
0.3
0.2
0.1
0
0
25
50
Pressure (mmHg)
Figure 2-6 Comparison of experiment data to results from the FEA with different
values of the Young's modulus for tissue. Each symbol represents data from a
different subject.
29
From such a comparison, the elastic modulus of the muscle was determined to be 1.2 x
104 Pa. This value for the elastic modulus was used in most simulations. However, in
the expectation that older or less healthy subjects might have less muscle tone and
therefore a lower Young's modulus, additional simulations were performed with the
modulus reduced by half.
Results of the FEA
Figure 2-7 Tissue deformation caused by external pneumatic compression. (left)
Symmetric compression, (right) Asymmetric compression
The elastic modulus of the leg obtained experimentally was used in the FEA to
determine the degree of collapse produced by the different compression. As shown in
the Figure 2-7, collateral and anterior-posterior compression both generate greater
collapse than does circumferential compression. The results shown in Figure 2-8
illustrate how the cross-sectional area of the vein is influenced by the mode of
compression. When external pressure is small, circumferentially-symmetric (C)
compression produces somewhat greater area changes than does asymmetric (A)
compression. However, as pressure increases, vessel area with A compression drops
rapidly with increasing pressure and soon generates greater collapse than C
30
compression. The greater reduction in cross-sectional
area achieved with A
compression derives from the tendency to promote asymmetric vessel collapse as
opposed to a more symmetric area reduction found with C compression.
1
Compression
Circumferentially-uniform
0.9
0.8
0.7
0.6
0.5
0.4
0.3
0.2
0.1
0
0
10
20
30
40
50
Compression Pressure (mmHg)
Figure 2-8 The relation between venous cross-sectional area and compression
pressure for the two distributions of pressure, asymmetric (A) and circumferentially
symmetric (C). Also shown are th, corresponding vessel cross-sectional shapes at
several levels of compression.
31
The results of Figure 2-8 were obtained with venous pressure set to zero. Normally,
however, venous pressure varies and can become significantly elevated during
external compression. With C compression, the area is simply a function of the
difference between external and venous pressures (Pe-P,), and the results of the FEA
can be expressed by the single curve in the figure.
With A compression, A/Ao is not a function of (P,-Pv) alone; rather, it depends upon
the two pressures individually. The following formula was found to fit the FEA
results,
A
= (1+ ip,2 )
oo
Where
la,=3.43x10l-', act2=6.33, 3=0.0314, a4=1.92, P,=2.55
x 10
3,
3,B=1.46,with all
pressure specified in mmHg (1 r..,nHg=133 Pa).
The strain field of the vessel wall is shown in Figure 2-9 and the magnitude of stains at
the internal vessel lumen is shown in Figure 2-10 for both C and A compressions. The
patterns are different in that circumferential compression produces significantly
greater strains at lower pressures than A compression, but eventually leads to less
strain over most of the vessel circumference when fully-collapsed. The patterns of
strain are similar, though, at maximal compression, with the largest (negative) strains
being found near the edges of the buckled vein with lower and more uniform strains
along the rest of the wall.
32
8P3
VALUE
-INPIITY
-2.00E-01
-- 1.64E-01
- -1.27E-01
-- 9.09e-02
-5. 45R-02
C
I
J
7111i,
PRW-'
W-1
r-I-WV
Figure 2-9 Maximum principal strain along the vessel wall after compression
33
Maximum principal strain (from 0-0.2)
Asymmetric compression
c-=s--
Maximum principal strain (from 0-0.21)
Symmetric compression
Figure 2-10 Maximum principal stain distribution along the inner circumference of
the vein as determined from the FEA shown at three levels of compression for
(upper panel) asymmetric (A) compression and (lower panel) circumferentiallysymmetric (C) compression. Inner curve represents the contour of vessel wall.
Outer curve indicates the maximum principal strain, the distance to the inner
contour represents the magnitude of the strain.
34
Simulation of Venous Flows Generated by External Compression
The one-dimensional equations governing flow in a collapsible tube are used to
calculate the blood flow in the model venous network. This formulation is valid when
the longitudinal gradient in area is small, (1/A)(aA/ax) << 1. This is generally true
-+
except possibly in the immediate vicinity of the knee where gradients can be relatively
steep. Following the approach used in a previous study [37], these are the equation of
mass conservation:
dA
d(uA)
dt
dx
-o0
and the momentum theorem:
(du
du
dP
at
ax
dx
n
,.
A
where u is flow velocity, A is vessel cross-sectional area, I is wetted perimeter, 'L is
wall shear stress. P is the local venous pressure, a function of Pe, and A, according to
the results of FEA,
P = f(P,,,,A)
Wall shear stress Trwis expressed as a function of the local flow characteristics and is
approximated as either fully-developed laminar flow or fully-developed turbulent
flow. The formulae are based on the expressions appropriate for vessels that are either
circular in cross-section, elliptical, or collapsed. Shear stress used in the computation
is listed in Table 2-1, which is the same as previous studies [37].
35
Table 2-1 Wall shear stress under different flow conditions
Flow condition
Cf
Fully developed laminar flow
a> 1
PA/2
84
0.36 < a < 1
8J
2
(ia)-'
(iiaI2)'
i 11
70
!L
7 pC
a < 0.36
)1
(ha'2
Turbulent flow
a > 0.27
a--0725
0.25
It((a
0.079 -7)
2. 025
a< 0.27 0.079(2
whereC
puvw__
2
a
. '
/
AO
pU22,
0.25
( Aol
A
)
12
-o."
1)25
lu(l(a
)-
P
co
These approximate equations for shear stress are used during the computation. At each
computational time and location, the Reynolds number based on hydraulic diameter is
checked to determine whether the flow is laminar or turbulent and the corresponding
formula is used. It turns out that in this study, the Reynolds number is always below
the critical value, so only the laminar flow expressions are used. Unsteadiness can also
influence the shear stress. To determine if this needs to be considered, we can estimate
the time required for the Stokes boundary layer thickness, 6
4V-
to become
comparable to the tube radius. For a vein having an 8 mm diameter, 6 > R when
t a 0.25 s. Noting that (i) during collapse, the radial dimension is even smaller, (ii) the
36
25
period of elevated flow is approximately 1-2 sec and (iii) any estimate of shear stress
that takes account of unsteadiness, short of a full solution of the Navier-Stokes
equation, will be subject to error, we have decided not to attempt any correction to the
quasi-steady shear stress calculations.
The MacCormack two step, predictor-corrector scheme is used to solve the equations.
The network used in an earlier study [31] was used here to simuiate the veins
extending from the 'ankle' to the 'thigh'. The network is described by the distributions
of total cross-sectional area, wave speed (both at zero stress), and total number of
vessels in parallel, all expressed as functions of axial distance along the leg.
External compression is applied between the ankle and the knee using two different
axial pressure distributions characteristic of those currently used in clinical devices
and that can be produced using a two-segment compression sleeNe or cuff.
Axially-uniform -- a time-varying pressure is applied uniformly between the ankle ,nd
knee. Pressure application is rapid, reaching its maximum value of 50 mmHg in 0.5 s,
then held constant for 4 s, consistent with previous estimates of pressure and timing to
produce maximal flows and vessel collapse Circumferential distributions are either C
or A as discussed above (Figure 2-1 1 (a)).
37
pI
Uniform Pressure
·
·
·
·
·
t·
·
·i
-·
LIIf
t
t
t
-
--
tii
Ankle
Thigh
Knee
O
Flow direction
Figure 2-11(a) Axially-uniform pressure along the leg
Graded-sequential -- the region between the ankle and knee is divided into two equal
segments. The distal half is compressed first, attaining a maximum pressure of 55
mmHg in 0.5 s; the proximal half is compressed following a 0.3 s delay to a slightly
smaller pressure of 45 mmHg. Once attained, maximal pressures are held in the
respective regions for 4 s (Figure 2-1 1(b)).
p
Two compartment, graduated, sequential
t
1
I
1
1
'
1
1
L---
I
Ankle
T
T
t
I-
.
1.1..
Knee
_W Flow direction
Figure 2-11 (b) Graded-sequential pressure along the leg
38
Thigh
In these simulations, parameter values have been chosen to mimic those currently
employed in the Aircast VenaFlow unit (Aircast, Inc., Summit, NJ). Slower rise times
are typically used in other commercial units; however, these have previously been
shown to be less effective in terms of generating high flow rates and high shear
stresses throughout the lower leg [29, 31]. It was assumed that a two-compartment
device was used to generate graded-sequential compression as a practical matter, again
consistent with units currently in clinical use. Peak pressures are similar to those used
in all commercially-available systems. Thus, to limit the parameter space, only rapid
compressions to pressures sufficient to produce maximal venous emptying were
simulated.
Results of blood flow simulation
The flow simulation results are presented in three formats to highlight the
effectiveness of the method in producing vessel collapse, to generate high flow
velocities, and to enhance the level of shear stress throughout the veins of the lower
leg. Figure 2-12 shows the vein at several stages during compression by each of the
four combinations
of circumfere, .ially-symmetric
(C) and asymmetric (A)
compressions, and axially-uniform and graded-sequential distributions along the leg
axis. By a time of 1-2 s, the vessels in each case have essentially reached a steady,
collapsed configuration. The degree of collapse with C compression is less than with
A compression, consistent with the earlier results of the FEA. With axially-uniform
compression, collapse occurs first near the knee, producing a localized constriction
through which the blood in the rest of the lower leg must empty, thereby reducing both
the rate of emptying, and the degree of collapse at the end of compression.
39
1
0
0.5
8
X (m)
Figure 2-12(a)
1
0
0
0
0.2
0.4
X (m)
Figure 2-12(b)
40
0.6
0.8
1
0.5
0.2
0.6
8
0.6
0.8
x (n)
Figure 2-12(c)
0.5
0.5
0.2
0.4
X (m)
Figure 2-12(d)
Figure 2-12 Normalized venous cross-sectional area following the application of
external pressure as a function of distance from the "ankle"; time interval between
the curves is 0.2 s. (a) C compression with uniform longitudinal pressure
application. (b) C compression with two-compartment, graded-sequential pressure
application, (c) A compression with the uniform longitudinal pressure application.
(d) A compression with the two-compartment, graded-sequential pressure
application.
41
The calculated flow velocity at the end of the simulated vein (near the "thigh") is
plotted with different compression modes and pressure applications in Figure 2-13. It
is seen that regardless of the axial distribution of pressure, A compression generates
significantly higher blood flow velocities than circumferential compression. Since the
duration of elevated flow is about the same for all three methods, the difference in
peak flow velocity is apparently due to the greater degree of collapse that results from
non-uniform circumferential pressurization. The differences in peak flow rate between
axially-uniform and graded-sequential compressions are relatively small in these
comparisons; however, graded-sequential is clearly superior to uniform compression
at points within the calf due to the surge of blood flow produced by the initial
compression of the lower segment that propagates throughout the upper calf region.
42
II
U.L
Symmetric compression
Asymmetric compression
0.7
0.6
cn
0.5
'u 0.4
0.3
0.2
0.1
0
4
Time (s )
Figure 2-13(a)
43
---
AA
U.6
- Symmetric compression
0.7
0.6
i 0.5
._
o 0.4
3 0.3
0.2
0.1
n
"0
1
2
3
4
Time (s)
Figure 2-13(b)
Figure 2-13 Calculated blood flow velocity at the thigh. (a) Uniform pressure
application. (b) Two-compartment, graded-sequential pressure application.
Figures 2-14 show the distribution of shear stress along the veins at several times
during compression. These plots show somewhat greater differences between C and A
compression than the flow rate plots, reflecting the combined effect of higher flow rate
and greater venous collapse with the latter (compare peak values during uniform axial
compression of less than 50 dyn/cm 2 in C compression to values over 200 dyn/cm 2
with A). The benefits of graded-sequential compression become evident in these plots
44
in that there are two spatial peaks in shear stress at the proximal ends of the two
independent compression zones, one of which lies within the muscular region of the
calf.
Ae··
EU
200
150
CA
c(
100
50
nv_
()
0.2
0.4
X (m)
Figure 2-14(a)
45
0.6
0.8
250
200
C-,-
50
I100
00
0.2
0.4
X (m)
Figure 2-14(b)
46
0.6
0.8
250
200
"150
r./
100
50
A
0
0.2
0.4
X (m)
Figure 2-14(c)
47
0.6
u.
'OU
200
;150
co
I 100
50
0
B
X (m)
Figure 2-14(d)
Figure 2-14 Calculated wall shear stress as a function of distance from the "ankle";
time interval between the curves is 0.2 s. (a) C compression with uniform pressure
application. (b) C compression with the two compartment, graded-sequential
pressure application. (c) A compression with the uniform pressure application. ( d)
A compression with the two compartment, graded-sequential pressure application.
Also of potential importance is the total endothelial surface area exposed to elevated
shear stress since the cells respond to shear only when it exceeds a certain threshold.
As discussed below, various studies have shown this threshold value to be in the range
of about 10-20 dynes/cm2 . In Table 2-2 are presented the computed surface areas
exposed to supra-threshold shear stresses of 10, 20 and 40 dynes/cm2 . The greatest
48
differences are seen between C and A compression, with A proving to be generally
more effective in increasing the level of shear stress.
Table 2-2 Percent of vessel wall subjected to certain level of shear stress
(Young's modulus of muscle = 1.2x1O4Pa)
Symmetric
Asymmetric
Uniform
Graded
Uniform
Graded
2
57%
64%
6
64%
79%
r w > 20dyn/cn12
14%
6%
55%
60%
r., > 40dyn/cm 2
1%
0%
10%
tw > Iodynlcm
9%
Table 2-3 presents a comparison of the percent of blood remaining in the lower leg (x
< 0.4 m) at different stages during compression as a measure of the effectiveness of
each mode of compression in preventing the pooling of venous blood. At the end of
compression, A is seen to be more effective in eliminating blood than C, but the
differences between uniform and graded compression are generally small and without
consistent trend.
Table 2-3 Percent of blood left in the lower leg
Young's modulus of muscle = 1.2xlO4 Pa
Symmetric
Asymmetric
Uniform
Graded
Uniform
Graded
at 1 s
55%
56%
45%
35%
at 2 s
45%
43%0
35%
26%
at 4 s
42%
42%o
31%
24%7
The same comparisons found in Tables 2-2 and 2-3 are presented in Tables 2-4 and 2-
5 but with the Young's modulus of the leg muscle decreased by a factor of two,
simulating the effect of reduced muscle tone. It is interesting to note that while
49
reducing the Young's modulus of muscle tends to reduce the differences between C
and A compression modes, it increases the differences seen between uniform and
graded compression with graded becoming significantly more effective by both
measures.
Table 2-4 Percent of vessel wall subjected to certain level of shear stress
(Young's modulus of muscle = 0.6xl04Pa)
Symmetric
r
z>Odyn/cm
2
z, > 20dyn /cm2
t w > 40dyn/cm2
Asymmetric
Uniform
Graded
Uniform
Graded
57%
75%
59%0
77%
537%
65%o
53%o
66%
9%
9%
13%o
11%
Table 2-5 Percent of blood left in the lower leg
Young's modulus of muscle = 0.6xlO4Pa
Symmetric
Asymmetric
Uniform
Graded
Uniform
Graded
at 1 s
54%
36%
48%
31%
at 2 s
43%o
27%
38%o
24%
at 4 s
35%
23%
32%o
21%
Discussion
Despite the widespread use of external pneumatic compression (EPC) for DVT
prophylaxis in high-risk populations, there remains a lack of consensus concerning the
optimal mode of pressurization. This is reflected in the wide variety of devices
50
currently available that differ in terms of the extent of coverage (foot only, calf only,
calf and thigh), the number of separate cuffs (1, 2, or 4) and the timing and rate of
compression. The lack of consensus likely is due to several factors. One is that the
different approaches to EPC have not been rigorously tested against each other.
Another is the lack of a fundamental understanding of the mechanism by which the
protection is conferred. Early studies focused on the prevention of stasis and the
potential role of fluid shear stress in dislodging incipient thrombi. This notion,
however, neglects the biological factors such as fibrinolysis which are strongly
influenced in endothelial cell cultures by fluid shear stress. Other antithrombotic and
prothrombotic aspects of the vascular wall cell response to mechanical stress have
been minimally investigated. It is reasonable to assume, given the complex scheme of
thrombosis regulation by the vascular wall, that other antithrombotic endothelial
functions are also affected by mechanical stimulus.
Previous studies [12, 29, 31] have investigated the effects of pressure level, rate of
pressurization, and, in the case of multi-segmented compression devices, the relative
pressure levels and timing of compression. These were studied and optimized with
respect to the objectives of producing the greatest degree of vessel emptying, the
highest flow velocities, and the highest shear stresses throughout the venous network
of the lower leg. These previous investigations led to the conclusions that gradedsequential methods of compression were hemodynamically superior to uniform
compression, that pressures of about 45 mmHg should be applied as rapidly as
possible (reaching maximum pressure in less than 0.5 s), and that the sequence of
compression should be such that the delay between segmental inflations should be no
more than about 0.25 s.
These studies, however, were based primarily upon mechanical considerations, and
failed to recognize the potential importance of enhancing antithrombotic and
51
fibrinolytic function of the endothelium in the prevention of DVT. This raises the
question as to whether the previously defined "optima" are indeed optimal with regard
to cellular antithrombotic function. In addition, other modalities of leg compression
involving asymmetric circumferential pressures have recently been introduced with
the potential for greater flow enhancement with the same or lower levels of
pressurization. The focus of the present study was therefore on the potential role of
tissue deformations and fluid dynamic shear stress to then better direct studies of
endothelial function relating to fibrinolysis and thrombosis regulation. A secondary
consideration was the influence of non-uniform distributions of pressure around the
leg circumference that might better promote vessel collapse.
Flows generated by external compression are characterized by a rapid rise to peak
velocities, as measured in the popliteal or femoral veins, of nearly 1 m/s. At these
velocities, wave speed flow limitation (flow speed equaling the local speed of wave
propagation [38] prevents further acceleration of the blood. The flow acceleration is
associated with collapse of the vessels at the proximal end of the compression zone
that impedes subsequent emptying. It was the formation of the restrictive throat, and
the desire to minimize its deleterious effects, that led to the introduction of graded,
sequential, and graded-sequential compression modalities. Following the period of
elevated flow that typically lasts about I s, the vessels reach a state of near maximal
collapse which, even in steady-state, decreases distally due to the pressure drop in the
collapsed veins associated with the much lower baseline flow through the capillary
bed.
In comparing the A and C distributions of pressure, the former was found to be
superior by most measures. This difference is primarily attributable to the fact that A
compression applies the pressure in a manner that promotes vessel collapse, producing
a situation in which the veins have a smaller cross-sectional area at a given pressure
52
for all but the very smallest pressure levels (Figure 2-8). Thus even though the total
force (pressure integrated over the surface area) applied to the leg is less with A than
C, the effectiveness in producing vessel collapse is greater. While peak flow rates are
roughly the same with the two methods, the greater collapse produced by A
compression (Figure 2-12) leads to considerably higher shear stresses (Figure 2-14),
and greater collapse for both uniform and graded-sequential pressure applications.
Shear stress likely affects DVT in two ways; by dislodging incipient thrombi before
they are large enough to significantly compromise respiratory function, and through
their effect on the production and release of fibrinolytic agents by the venous
endothelium. It is difficult to estimate the level of stress needed to dislodge a small
aggregate from the wall of the vessel, but it is likely the peak shear stress that is of
greatest consequence. The highest shear stresses, approaching 250 dyn/cm2 , are
produced with A uniform compression. However, these high levels are concentrated at
the knee and affect primarily the popliteal vein rather than the muscular veins where
most thrombi are thought to originate. For this reason, graded-sequential compression
is likely to be more effective with regard to dislodging small thrombi because, despite
the lower peak shear stresses generated at the knee, the level of shear in the mid-calf
region, where most thrombi are thought to originate, is considerably higher (Figure 214). If account for the amount of blood been removed from the leg (Table 2-2,3,4,5),
graded, sequential compression empty the veins more completely than uniform
compression. These results suggest that sequential gradient compression produces the
type of hemodynamic alterations needed to reduce the risk of DVT by achieving a
sustained increase in venous blood flow and more completely emptying of the veins in
the leg.
The numerical results presented here show a considerable increase in the shear stress
(to over 200 dyn/cm2 ) that is mainly concentrated near the knee; the amount of
53
elevation is highest with uniform and A compression modes. However, what might be
more important is to increase shear throughout the leg veins. Although the graded
response to shear has not yet been studied, if the response were to saturate either due
to finite cellular stores for secretion or limits to the rate of synthesis of hew product, it
might be more important to elevate shear above some threshold level in many cells
rather than elevate it to even higher levels in a relatively small number. In this thesis,
our in vitro cell culture studies (chapter 4 and 5) support this view. From the results,
there exist a threshold of shear that endothelial cell can response to. If the peak shear
stress is below 10 dyn/cm2 , there are no changes of mRNA expression in all the
candidate genes. Therefore, elevating peak shear stress above certain threshold in
relatively large area of endothelial cells is important in terms of overall
thromboregulation. Because of the venous architecture of the lower leg, the many
muscular veins empty primarily through a single vessel, the popliteal vein. Therefore,
the region of highest shear stress in Figure 2-14 corresponds to a relatively small
endothelial surface area. By contrast, the lower region (x < 0.3) represents many
parallel vessels with total circumference, according to the network characteristics used
in the calculation, 4 times as great as at the level of the knee. In view of this, the shear
distribution of Figure 2-14(d) corresponding to graded-sequential compression might
well elicit a greater biologic response than the localized increase of uniform
compression (Figure 2-14(c)). A comparison of Figure 2-14 (a), (b) and (c), (d)
demonstrate that A compression is significantly more effective at all locations than C
compression, for the reasons discussed above.
Another factor to consider is the potential for damage to the endothelium due to high
shear stresses, or the activation of platelets, either of which could promote thrombus
formation. It is difficult to extrapolate from the present calculations to predict either of
these events. In particular, platelet activation involves a complex interaction of local
shear stress and platelet-endothelial interactions, factors that lie beyond the scope of
54
the present work. The present studies, however, point to possible deleterious effects of
certain types of compression that deserve further study.
In contrast to the situation in arteries that are normally distended by positive
transmural pressures, venous collapse produces strains that vary widely around the
vessel circumference (Figure 2-9 and 2-10). Further, the magnitude of strain is a
function not only of the pressure difference acting across the vessel, but also the
distribution of pressure around the limb. Interestingly, both compression modes, C and
A, produce strains of comparable magnitude, up to about 20%. The distributions
differ, however, as does the dependence on level of external pressure. Because of this
complex behavior, it is difficult to identify conditions that might optimize fibrinolytic
or antithrombotic vascular wall cell response. But since the levels of strain are
comparable to those that elicit a tPA response in endothelial cultures [39], the
deformation of the wall needs to be considered in terms of the overall response of the
venous endothelium. Whether intermittent vessel collapse elicits endothelial gene
expression will be studied in the following chapters (chapter 4 and 5).
55
Chapter 3 Endothelial cells in thrombosis and homeostasis
It has been recognized for over 150 years that abnormalities in blood flow, vessel wall
and coagulation factors may contribute to thrombosis (Virchow's triad). EPC devices
increase blood flow and eliminate venous stasis in the lower leg, therefore, decrease
the risk of thrombosis. This simplified view is now modified by the recognition that
the process of thrombus formation (thrombogenesis) and thrombus inhibition
(thromboresistance) requires complex interactions involving the vascular endothelium,
platelet aggregation and clotting factors. In this complex process of thrombus
regulation, the vascular endothelium plays a critical role. It produces many substances
which are closely associated with thrombosis, homeostasis and fibrinolysis [40]. It is
now well known that changes of hemodynamic conditions can regulate endothelial cell
function [41]. These findings suggest that many mechanisms of EPC can be further
understood from how endothelial cell thromboregulatory function is influenced by
hemodynamic forces. In this chapter, we review the role of endothelial cells in
thrombosis and homeostasis, and then examine the influence of hemodynamic forces
on endothelial cell functions. Finally, we present the candidate genes related to
coagulation that we will investigate in this thesis.
Role of the endothelial cell in regulating thrombosis
Endothelial cells modulate several aspects of the homeostasis-coagulation sequence.
On the one hand, they possess anti-platelet, anti-coagulant, and fibrinolytic properties;
on the other hand, when injured or activated they exert procoagulant function. The
balance between endothelial antithrombotic and prothrombotic activities often
determines whether thrombus formation, propagation or dissolution occurs [40].
57
The intact endothelium has long been considered to serve as an anti-coagulatory
barrier separating blood from the vessel wall contents and through control of its
permeability, regulating the traffic of blood borne elements. It has become clear that
by synthesizing and secreting a number of potent substances, the endothelium plays a
key role in controlling the vascular tone, coagulation states, and the structure of the
blood vessels. Furthermore, the endothelium appears to sense variations in shear stress
and transduce those signals into biological responses which can have significant
physiological and pathophysiological implications including angiogenesis,
inflammation, thrombosis, and vasomotor function [42]. In the following paragraphs,
we list some of the endothelial cell's thrombo-regulatory mechanisms.
Antiplateletfactors
Prostacyclin PGI2 is a multifunctional molecule. It is a potent inhibitor of platelet
activation, secretion and aggregation [43]. It induces vascular smooth muscle cell
relaxation, blocks monocyte-endothelial interaction, and reduces smooth muscle cell
lipid accumulation. PGI2 is synthesized primarily by vascular endothelial cells and
smooth muscle cells. Its synthesis is catalyzed by a series of enzymes including
cyclooxygenase (COX-1, 2).
Nitric Oxide NO is an important mediator in the regulation of vasomotor function,
immune response and neurotransmission [22]. NO also inhibits platelet activation and
aggregation. The role of NO in vasorelaxation was discovered when Furchgott &
Zawadzki noted that blood vessels depleted of endothelium failed to relax when
treated with acetylcholine [44]. They postulated that endothelium elaborates the
factors (EDRF) responsible for acetylcholine induced vasorelaxation. The major
component of EDRF was subsequently found to be NO. Biosynthesis of NO is
catalyzed by nitric oxide synthase (NOS) that converts L-arginine to L-citrulline and
NO. NO is diffusible and is thought to be released primarily into the abluminal side
58
where it causes smooth muscle cell relaxation by activating guanylyl cyclase and
increasing cytosolic cyclic guanosine monophosphate. NO may also diffuse into the
luminal side where it enters platelets and inhibits platelet adhesion, activation and
aggregation.
PGI2 and NO are produced simultaneously during endothelial cell activation, and they
act synergistically not only to inhibit platelet adhesion and aggregation, but also to
reverse platelet aggregation [45]. The synergistic inhibition of platelet activation by
these two molecules is of considerable importance in maintaining blood fluidity and
controlling thrombus formation. Both of these two molecules also induce vascular
smooth muscle cell relaxation.
Ecto-ADPase Endothelial surfaces possess an enzyme activity that degrades ADP to
AMP. This enzyme is given the term ecto-ADPase. As ADP released from activated
platelets is an important mediator for recruiting and amplifying platelet aggregation,
ecto-ADPase may play a physiologic role in limiting the extent of platelet aggregation
[46].
Vasomotorfunction
Vasodilation Endothelial cells secrete NO and PGI2 , contributing to the regulation of
blood pressure and blood flow. By expressing angiotensin converting enzyme (ACE),
the endothelium plays a role in the control of angiotensin II action, a potent
vasoconstrictor [47].
Vasoconstriction
The endothelium has been shown to synthesize and secrete
endothelin- I (ET-1), a 21-amino acid peptide which is the most potent vasoconstrictor
known both in vivo and in vitro [48]. ET-1 is proteolytically cleaved from a
59
preproendothelin- 1 peptide to yield Big ET- 1 and further cleaved to the 21 amino acid
residue ET-1. Recent work has demonstrated that release of ET-1 is preferentially
towards the basement membrane side rather than the luminal side of the vessel. These
findings make ET-1 an excellent candidate for the local regulation of vascular tone
and structure via its effect on smooth muscle of the vessel wall [49].
Anticoagulantfactors
Thrombomodulin Thrombomodulin (TM) is an integral membrane glycoprotein
expressed on the surface of the endothelial cell that functions as a receptor with a high
affinity for thrombin and forms complexes that serve as a potent catalyst of the
thrombin-induced activation of protein C. Activated protein C complexes to protein S,
and together they catalyze the inactivation of factors Va and VIIIa, thereby serving to
inhibit thrombin formation. [50]. TM has also been demonstrated
to be involved in
internalization and clearance of extracellular thrombin [51]. TM removes circulating
thrombin by endocytosis following binding whereby thrombin is degraded and TM is
recycled to the surface [52]. By competing for thrombin, TM inhibits a number of
procoagulant activities of thrombin, such as clotting of fibrinogen, activation of factors
V and XIII, inactivation of protein S, and platelet aggregation. In addition, TM binds
factor Xa and inhibits its activation of prothrombin. These characteristics make TM an
important regulator of the endothelium's anticoagulant properties.
Endothelial surface heparin sulfate Proteoglycans are present on endothelial cells
and in subendothelial matrix. Recent studies have shown the presence of anticoagulant
active heparin sulfate proteoglycan on the surface of endothelium [53], which
functions as a cofactor for antithrombin III. Heparan sulfate proteoglycan (HSPG) is
synthesized by endothelium and binds antithrombin III. The antithrombin III - HSPG
complexes on the endothelial surface bind and inactivate thrombin [54].
60
Tissue factor pathway Tissue factor pathway inhibitor (TFPI) is a protease inhibitor
present in low concentration in plasma. The factor VIIa/tissue factor complex is
inhibited by TFPI in the presence of factor Xa. TFPI prevents further participation of
TF in the coagulation process by forming a stable quaternary complex TF-Factor VIIa-
Factor Xa-TFPI. TFPI is synthesized primarily in the liver but also synthesized by
endothelial cells. [27].
Endothelial cells also express low levels of tissue factor (TF), which serves as the
nonenzymatic cofactor for factor VII/VIIa in the initiation of blood coagulation. Blood
coagulation is initiated in response to vessel damage in order to preserve the integrity
of the vascular sysitem. Tile cascade of coagulation lzyrmogen activations which leads
to clot formation is initiated by exposure of flowing blood to TF. Factor VII binds to
TF and is rapidly activated. Factor VIIa undergoes an active site transition upon
binding TF in the presence of Ca2+. This results in rapid autocatalytic activation of
Factor VII to Factor VIIla, thereby amplifying the response by generating more TFFactor VIIa complexes [27].
Endothelial Cell Protein C Receptor EPCR is an endothelial cell specific
transmembrane glycoprotein capable of high-affinity binding for protein C. EPCR
greatly accelerates protein C activation mediated by the thrombin / thrombomodulin
complex. Activated protein C interacts with its cofactor protein S on phospholipid
surfaces, and proteolytically inactivates factors Va and VIIIa, thus limiting thrombin
formation. The EPCR presents on endothelial cells of relatively large veins and
arteries [55], and is a key factor for the protein C pathway which is am important
regulation mechanism of blood coagulation [56].
61
FibrinolyticFactors:
Tissue type plasminogen activator Endothelial cells are the major site of synthesis of
tissue type plasminogen activator (tPA). tPA cleaves plasminogen and converts it into
its active form plasmin, which dissolves the fibrin clot. Endothelial cells also
synthesize fibrinlytic inhibitors to maintain the balance of the fibrinolytic system.
Plasminogen activator inhibitor (PAI-1) is the major inhibitor of tPA in plasma. When
bound to PAl-1, tPA losses its activity. Clearance of fibrin deposited on the vascular
wall by the fibrinolytic system is very important in maintaining the homeostasis
balance. Patients with an inherited increase of fibrinolytic activity have severe
bleedings. In contrast, a decreased fibrinolytic activity may be associated with
tltombotic disease [57, 58].
The endothelial cell surface also offers binding sites for a number of the components
of the fibrinolytic system. The presence of endothelial cell surface receptors for tPA
has been reported by several groups [59-61]. Binding of tPA to EC has been reported
to promote its fibrinolytic activity [60]. Recently, one such tPA binding site has been
identified as Annexin II [62, 63]. Annexin II mediates the assembly of plasminogen
and tPA on cell surfaces, therefore supports formation of a ternary complex to enhance
plasminogen activation. Endothelial cell-bound tPA is also protected from its
physiologic inhibitor PAI- 1.
Urokinase-type plasminogen activator u-PA is expressed by endothelial cells
involved in wound repair or angiogenesis. It is usually thought that u-PA is important
in cell migration and tissue remodeling. However, u-PA is obviously important to
vascular homeostasis as well since mice genetically deficient in u-PA develop
inflammation induced thrombi [64] and manifest thrombotic tissue injury in response
to lipopolysacharide (LPS) [65]. The u-PA receptor (u-PAR) is expressed by EC and
u-PA bound to cells via u-PAR exhibits increased plasminogen activating efficiency
62
[66] and is relatively protected from inhibition by PAI-I and PAI-2 [67]. Yet, mice
genetically lacking u-PAR develop normally and do not exhibit spontaneous vascular
occlusion. Hence, u-PAR has yet to be shown to participate in maintaining
homeostasis.
ProthromboticFactors
Von Willebrand Factor vWF is a glycoprotein produced by endothelial cells and
megakaryocytes. It plays a major role in homeostatic plug formation by serving as a
ligand for platelet adhesion to denuded vascular walls, and as a bridge molecule for
platelet aggregation [68]. It has been found that platelet adhesion absolutely requires
vWF. vWF binds concurrently tc both sub-endothelial collagen and platelet GP Ib-IX.
VWF also binds to platelet glycoprotein IIb-IIIa to support agonist induced platelet
aggregation [69]. The importance of vWF in hemostasis is attested to by severe
bleeding disorders that result from a deficiency of vWF. On the other hand, raised
vWF levels have been associated with increased thromboembolic events, in patients
with deep venous thrombosis [70].
In summary, the endothelial cell acts as a perfect antithrombotic surface by secreting a
variety of molecules involved in fibrinolysis, platelet function, and coagulation
factors. Under certain conditions, the endothelium can also turn into a prothrombotic
surface, initiating the blood coagulation process to stop bleeding. A schematic
overview of this complicated process is shown in Figure 3-1.
63
WI"
.
-111'1212-:.111-1EZ.-:
PAF
1 ,
I
Tissue factor
vWF
'I
ET-1
I
Factor V
Xa
Vila
PAl-1
VII
Fibrinois
la,Xa,Xla, lXa
VlIla,V
'a
A
Protein St
PGI2
NO
Protein C
Plasminogen Plasmin
Vlla/TF/Xa
,t
APC
Thrombin
EPCR
TM
Fibrin
Antithrombin
Heparin-like
t
TFPI
uPA
tPA
uPA-R Annexin 11
uP-R
Annexin II
,
21
'M
Figure 3-1 Endothelial thromboregulation by secreting or expressing variety of
molecules. For a detailed function of each one, see text in this chapter.
Abbreviations: ET-1: endothelin-l;
PAF: platelet acting factor; vWF: von
Willebrand factor; PAI-I: plasminogen activator inhibitor-l; PGI2: prostacyclin;
NO: nitric oxide; EPCR: endothelial protein C receptor; TM: thrombomodulin; TF:
tissue factor; TFPI: tissue factor pathway inhibitor; uPA: urokinase plasminogen
activator; tPA: tissue plasminogen activator; uPA-R: urokinase plasminogen
activator receptor.
Endothelial functions regulated by fluid shear stress and cyclic strain
It is now widely recognized that endothelial cells respond to hemodynamic forces. The
endothelium is exposed to several types of hemodynamic forces including fluid shear
stress, cyclic strain and pressure. Of these, the shear stress and cyclic strain have been
extensively studied and shown to influence many aspects of endothelial functions.
64
Shear stress
Fluid shear stress transforms polygonal, cobblestone-shaped endothelial cells of
random orientation into elongated endothelial cells aligned in the direction of flow
[71]. It has been shown that shear stress of physiological and elevated magnitudes
decreases endothelial turn over by decreasing both proliferation [72] and apoptosis
[73]. These levels of shear stress also increase the production of vasodilators, [74-80],
paracrine growth inhibitors [81], fibrinolytics [82-84], antioxidants [85, 86], suppress
production of vasoconstrictors [87, 88] paracrine growth promoters [89, 90],
inflammatory mediators [91], and adhesion molecules [92, 93]. Table 3-1 lists of
various endothelial cell functions that can be regulated by shear stress. It has become
clear now that shear stress regulates a much wider variety of functions than those
listed here.
Table 3-1 Summary of endothelial cell response to hemodynamic shear stress
Reference
Endothelial cell morphology
[71]
Vasomotor agents
Endothelin- I (ET- 1)
[94]
Endothelin-converting enzyme (ECE)
[79]
Angiotensin-converting enzyme (ACE)
[95]
Nitric Oxide (NO)
[96]
Prostacyclin (PGI 2)
[77]
C-type natriuretic peptide (CNP)
[79]
Antioxidant enzymes
Cyclooxygenase (COX-1,2)
,
~ ~~~
65
.
~
~.i ~ ~.i.
[78]
~
.
~~~~
Manganese-containing superoxide dismutase (Mn SOD)
[78]
Copper/zinc-containing superoxide dismutase (Cu/Zn SOD)
[85]
Growthregulators
Platelet-derived growth factor (PDGF-A,B)
[89]
Transforming growth factor (TGF-fl)
[81]
Monocyte chemotactic peptide (MCP- 1)
[93]
Vascular cell adhesion molecule (VCAM-1)
[93]
Inflammatory mediators
Adhesion molecules
Thrombosis/fibrinolysis
Tissue-type plasminogen activator (tPA)
[83]
Thrombomodulin (TM)
[97]
Endothelialproliferation
[72]
Endothelialapoptosis
[73]
Cyclic Strain
Cyclic strain has been shown to change the cytoskeleton structure of endothelial cells.
It was shown that within 15 min after initiation of cyclic strain, actin stress fibers were
aligned perpendicular to the force vector, and by 12 hr of cyclic strain, EC were
elongated and oriented in the same direction as the actin filaments [98]. Several
endothelial functions are under the influences of cyclic strain. For example, cyclic
strain has been found to influence the expression of tPA [99], plasminogen activator
inhibitor-I (PAI-I) [100], endothelial nitric oxide synthase (eNOS) [101], ICAM-I
[102], PDGF-B [103], tissue factor (TF) [104] and monocyte chemotactic protein-1
(MCP-1) [105]. Recent studies demonstrated that cyclic strain can mediate monocyte
66
adhesion by inducing endothelial cell expression of E-selectin, ICAM-1, and VCAMin a time-dependent manner [106].
Candidate Genes
In this thesis, we investigated the influence of hemodynamic forces on endothelial
thromboregulation by examining the effects of these forces on coagulation related
genes. Components of the endothelial fibrinolytic system (tPA, PAl-I and Annexin-I)
and the regulation of platelet and vasomotor functions (eNOS and ET-1) were studied
using traditional Northern Blot analysis of mRNA expression. These factors were
chosen because of their essential role in vascular homeostasis and their suggested
involvement in the mechanisms of EPC (see Chapter 1). However, this does not
preclude the importance of other factors. For example, recent clinical studies show
that tissue factor pathway is involved in the antithrombotic effect of intermittent
pneumatic compression (Chapter 1). Instead, all the other coagulation related genes
reviewed in this chapter are investigated using Affymetrix gene array. From there we
obtain a rapid screening of the genes that are influenced by EPC hemodynamics
(Chapter 6).
67
Chapter 4 Development of an in vitro cell culture system
Introduction
In Chapter 3, we reviewed the role of endothelial cells in the regulation of thrombosis
and homeostasis. Furthermore, many of the functions are under the influence of
hemodynamic forces. In order to understand the biological correlaties of EPC and
establish the optimal mode of compression, it is necessary to study endothelial cell
function under hemodynamic conditions which mimic those in vivo when EPC is
applied. In this chapter we present a new in vitro cell culture system that can be used
to examine the effect of flow conditions existing in vivo during EPC on endothelial
function. Specifically, the effects of pulsed flow and partial vessel collapse occurring
on a one minute cycle are considered. The biologic response is assessed through
changes in cell morphology, the expression of fibrinolytic factors and change in
vasomotor function.
Development of the Venous Flow Simulator (VFS).
An in-vitro cell culture system that simulate venous flow was designed to replicate the
hemodynamic shear stress and vessel wall strain associated with induced blood flow
during different modes of EPC. Although the mechanical forces on the endothelium
are quite complex, and the vessels at different locations experience very different
flows, shear stresses and strains (Chapter 2), there are two hemodynamic mechanisms
which are thought to regulate endothelial thrombogenicity and vasomotor tone: fluid
shear stress and mechanical deformation of the vessel wall. The VFS is designed to be
able to simulate different levels of shear stress and vessel collapse individually or
simultaneously.
69
For this purpose, four completely independent flow circuits are provided in the VFS to
produce varying but known combinations of conditions of flow (pulsatile or a slow,
steady perfusion) and collapse. Conditions in each of the four flow circuits, and the
range of conditions provided by each, are indicated in Table 4-1.
Table 4-1 Conditions in each of the four flow circuits.
Condition
Abbreviation
Flow rate
Silastic tube
Control
Cntrl
Steady perfusion of 3
None
Pulsatile flow only
F
Intermittent pulsed
Intermittent pulsed
flow (0-12.5ml/s)
None
Compression only
C
Pulsatile flow +
compression
FC
ml/min
Steady perfusion
ml/min
Intermittent pulsed
flow (0-12.5ml/s)
50% compression
50% compression
Table 4-2 Conditions used in the present experiments.
Parameter
Value
Medium Viscosity
0.04 cP, same as blood
Maximal flow rate (F & FC only)
12.5 ml/s
Peak shear stress
F: 40 dyn/cm 2 ; FC: -80 dyn/cm 2
Duration of maximal flow
4s
Period of each cycle
60 s
Degree of tube compression (C and FC only)
Major diameter reduced by 50%
Duration of experiment
I or 6 hrs
70
Physical description and characteristics of the VFS
A schematic of the system is shown in Figure 4-1(a). The silastic tubes in which the
monolayer of endothelial cells is cultured are mounted inside two plexiglass chambers
as shown in the diagram. One of the chambers (shown in Figure 4-1(b)), for circuits C
and FC (Table 4-1), contains a pusher plate attached to a bellows. The bellows can be
periodically inflated by an air pump to push the plate downward and compress the
tubes. An adjustable pin inserted through the bottom of the tube holder limits
displacement of the plate so as to control the extent to which the tube is collapsed. The
other chamber, for circuits Cntrl and F (Table 4-1), is identical to the first except that
it lacks the pusher plate and bellows since the two tubes in it are not compressed. Cell
culture medium is driven by either the air pump for circuits F and FC, or the steadyflow perfusion pump for Cntrl and C. The air pump (adapted from Aircast Venaflow,
Aircast, Inc., Summit NJ) operates so as to produce a short period (4 sec) of pressure
in the air space above the medium contained in a reservoir upstream of the test
chambers, followed by a rest period of 56 sec. The flow rate is controlled by a
combination of the applied pressure and the flow resistance upstream of the test
chamber. This produces a short period of high flow through the tubes containing the
cultured cells alternating with a much longer period of zero flow, intended to mimic
the application of external compression to the lower leg. Check valves located up and
down-stream of the test chamber ensure that the medium flows uni-directionally. The
air pump has two individually-controlled outputs, one is used to push the plate, the
other to drive the pulsatile flow. The combination of tube compression and flow type
leads to the four test groups indicated in Table 4-1. All timing and pressures are under
computer control and may be adjusted to any desired value within the ranges specified
in the table.
71
Pressure
Monitoring
Flow
Monitoring
(a)
plate
Bearing
Silastictube
(b)
Figure 4-1 (a) Schematic drawing of venous flow simulator (VFS). Four totally
independent flow circuits are shown, corresponding to the four cases in Table 4-1.
The air pump simultaneously drives the pulsed flow and the bellows to produce
collapse. The reservoirs upstream of the test chambers are maintained at the proper
CO2 partial pressures. (b) Test chamber used to produce tube compression. Air
inflates the bellows, driving down the pusher plate to a position determined by
small pegs inserted through the bottom to the desired level. Inlet and outlet are
designed to minimize flow disturbance.
72
Each group is in its own independent flow loop which provides a sterile nourishing
environment and also allows sampling of the media for biochemical assay. The entire
system (except air pump and flow meter) is placed inside an incubator to maintain a
constant temperature (370 C) environment. Gas from the incubator (with proper CO2
content) is used to maintain proper gas tensions in the medium. Time-varying flow
rates are continuously monitored with a transit time ultrasonic flowmeter (Model
T109R, Transonic Systems, Ithaca, NY). At the same time, pressure upstream of the
test section is monitored by a pressure transducer (Model 2200S, Gould Inc.,
Cleveland, OH). Both signals were digitized by a data acquisition system (DAQ-516,
National Instruments Inc., Austin, TX) and stored for later processing on a computer
(Apple G3 PowerBook, Cupeitino, CA).
Fabrication and measurement techniques used to produce the silicone rubber tubes
have been developed in our laboratory previously, and have been shown to support
attachment, growth and differentiation of endothelial cells [107, 108]. The diameter,
thickness and compliance of the tube can be achieved to mimic those observed in
human arteries and veins [108]. In the VFS, the properties of tubes are chosen to
mimic human sapheneous vein (Table 2). Timing and pulsatile flow rate are also
selected to fall in the range of those predicted to occur in the deep veins of the lower
leg during use of a typical commercial pneumatic compression device.
Table 4-3 Comparative compliance of human saphenous vein and silastic tube
I
_
_
__
_
_
_
__
Human saphenous vein
Silastic tube
4.5 + 0.7[108]
4.6 ± 0.5
Diameter (mm)
4-7[109]
5
Thickness (mm)
0.2-0.5[109]
0.5
Compliance (%/mmHg x 10-2)
73
Experimental design
The characteristics of venous blood flow in vivo and the mechanical forces and strains
produced by EPC were considered when establishing the experimental protocol. In
vivo, the endothelium is subjected to a complex time-dependent and spatiallydependent stress (Chapter 2). In a typical EPC setting, the veins experience a period of
relatively low flow (the refilling phase), followed by a short period of high flow
during compression. Vessels proximal to the compression zone (e.g., the femoral vein)
experience a surge of flow with each compression, accompanied by a slight dilation
due to the increased internal pressure. Vessels beneath the cuff experience less flow
augmentation, but the flow speeds are increased by partial venous collapse due to
compression. In Chapter 2, we have simulated by computational modeling the
conditions occurring during EPC and thereby produced estimates of flow rates, degree
of vessel collapse, and wall shear stress throughout the venous network of the lower
extremity. Although complicated, several features relating to the flow and vessel strain
can be identified that are common to most veins. In all cases, flow remains low, near
zero for the entire period of vessel refilling. All vessels experience a brief period of
elevated flow during the compression phase. Vessels in the region beneath the
compression cuff also undergo some degree of collapse. With these features in mind,
the following factors were identified that might potentially alter fibrinolytic and
vasomotor functions and will be reproduced in experiments using the VFS.
1. Elevated levels of shear stress. During EPC, the endothelium experiences a wide
range of shear stress. These levels depend on location within the venous network and
the compression modes. Shear stress can attain values as high as 150 dyn/cm 2 (near
knee). Shear stress is determined by a combination of flow rate and vessel collapse
during the compression phase.
74
2. Vessel wall strain. Veins beneath the compression cuff collapse while those
proximal to it distend during the compression phase. Strains ranging up to 10% have
been predicted. Vessel collapse is accomplished by means of a pusher plate. The
distance between the plate and the lower rigid support determines the degree of vessel
collapse in any given experiment.
Fluid induced shear stress on cultured endothelial cells can be completely and
accurately assessed by analysis of the flow using Womersley's theory [110] from the
measured pressure and flow rate data.
--+-__
--
The momentum equation governing unsteady, pulsatile flow in a tube can be written
as,
du
=
dt
1 dP
ul d du\
padx
prr
rd)
where u(r,t) is the x-component of flow velocity, Rtis fluid viscosity, p is fluid density.
From Womersley's theory of pulsatile flow, analytical solution of above equation at a
given frequency is obtained,
cR
2
J(ay-j)
Jo(a)
[
jua 2 [1
c,R4 [1
jla
1
2J,(a'f~j)
a -jJ(a7 )
c=
R-J, (a -j)
, ago(a r )
75
where a is Womersley number,
a=R
For zero frequency, the above equation reduces to Poiseuille's relation,
4yQ
.rR 3
For any given flow profile, the solution can be expressed as the sum of the Fourier
series,
u(r,t) = u0 (rt) +
Q(t) = Qo(t) +
E
n(r)e"'
n---
Qn(r) e
j 'o"
nmo
-r(t) = ro(t) +
r, (r)et"'
n-o
Therefore, the above equations define the relationships between velocity u, flow rate
Q and wall shear stress x. From measured time-varying flow rate, one can derive the
other variables from these relations.
Wall strain at the level of the endothelium can- be calculated based on computed
deformations of the silastic tube using ABAQUS.
76
Establishment of VFS cell cultures
Endothelial cells from human umbilical veins (from umbilical cords obtained from the
obstetrical unit at the MGH under strict NIH guidelines regulated by the MGH
subcommittee on Human Studies) were isolated as previously described [111], by
enzymatic treatment (0.1% collagenase (CLS II, Worthington, Frechold, NJ), 0.5%
human serum albumen (Fraction V; Sigma Chemical Co. St. Louis, MO). Primary
cultures were established, maintained and passaged on 1% gelatin coated tissue culture
plastic. EC were cultured in M199 (GIBCO, Rockville, MD), supplemented with Lglutamine (2 mmol/L, GIBCO), 10% fetal calf serum (Hyclone Laboratories Inc,
Logan, UT), heparin (150.g/ml, Sigma). penicillin and streptomycin (100 U/ml,
100mg/ml respectively, GIBCO) and EC growth supplement (ECGS, 50Rg/ml, Becton
Dickenson, Franklin Lakes, NJ). Cells were confirmed to be endothelial by their
standard morphologic appearance, the presence of Factor VIII-related antigen (von
Willebrand factor) and the specific uptake of Di-I-acetylated LDL (Biomedical
Technologies Inc, Stoughton, MA) These criteria have also been used to assess
whether EC in experimental cultures retain differentiated characteristics.
Silicone rubber tubes were first ultrasonically cleaned, autoclaved, and placed in the
tube holder. The surface of the tubes was then coated with fibronectin (0.01%,
Collaborative Research Inc., Bedford, MA) overnight to enable the attachment of EC.
HUVECs (passage 2 through 4) were seeded at a confluent densities of 105/cm2 and
the tube holder is rotated slowly to assure uniform lumenal cell seeding. After 24
hours incubation, cells were examined visually with an inverted phase contrast
microscope to confirm the presence of a confluent layer of cells. The system was set
up and EC cultured in the VFS were subjected to the above experimental conditions.
Serum-free medium was used during the experimental period (M199, supplemented
with 2mM L-glutamine and 1% ITS liquid media supplement(Sigma)). Dextran
(Sigma) was used to increase viscosity of the medium. At the end of each experiment,
77
tubes were examined by phase-contrast microscopy and photographed. The tubes were
gently rinsed twice with Hanks' balanced salt solution (HBSS, GIBCO). TrypsinEDTA (0.05%, GIBCO) was applied and the detaching cells were monitored at room
temperature under microscopy. Aiiquots of cell suspension examined by trypan blue
exclusion showed viability > 90% in all the experiments performed. Cell pellets were
stored @ -80 0 C until use.
Northern Blot analysis
Northern hybridization analysis was used to assay for gene expression associated with
elevated flow or vessel collapse. Following standard procedures, total RNA from
guanidine isothiocyanate (GTC) extracts of experimental and control silicone rubber
tube cultures were isolated by centrifugation through cesium chloride, then separated
by 1.2% formaldehyde-agarose
gel electrophoresis, transferred to nylon membranes,
and hybridized in the presence of 49% formamide, at 420 C, to specific
32
P-labeled
cDNA probes tPA, PAI-I, Annexin II, eNOS and ET-I. The autoradiographs on a
Kodak X-OMAT AR x-ray film were obtained and quantitated using laser scanning
densitometry (Molecular Dynamics, Sunnyvale, CA) with Image Quant 3.0 software.
The intensity of GAPD (glyceraldehyde-3-phophate dehydrogenase) band in each lane
was used for normalization to correct any differences in RNA loading.
78
Chapter 5 Results and Discussion of cell culture experiments
The in vitro cell culture system that can simulate the hemodynamic conditions under
EPC was designed and constructed in Chapter 4. In this Chapter, the hemodynamic
profile of the system and the result of endothelial cell culture in the system will be
presented.
Results
Flow character
The experimental conditions were achieved in the VFS to mimic conditions
experienced in vivo during EPC. Typical flow and pressure measurement are shown in
Figure 5-1. Each square-shaped pressure pulse generated by the air pump, is followed
by a surge of increased flow rate. Flow accelerates quickly, reaches and then maintains
a constant peak flow rate (12.5 ml/s), then returns to a relatively long (56
sec) period
of zero flow when the pressure is dropped to zero. This type of flow is similar to that
associated with the application of an EPC to lower leg. Shear stress calculated from
measured flow is plotted in Figure 5-1, showing that the shear stress trace essentially
follows the flow trace with a peak level of 40 dyn/cm 2.
79
0
10
20
30
40
50
60
70
0
10
20
20
30
30
40
40
50
50
60
s0
70
70
..
E
0
a:
0
0
Time (s)
Figure 5-1 Measured pressure (top) flow rate (middle) and calculated shear stress
(bottom) in the VFS for condition F. Shear stress is calculated using the Womersley
theory based on the measured time-varying flow rate.
Endothelial cells are also subjected to deformation when tubes are compressed. Finite
element simulation of the wall strain by ABAQUS is plotted in Figure 5-2. The vessel
wall strain varies from 0 to 10% when the tube is compressed by 50% as shown in the
figure.
80
0.10
0.08
0.06
0.04
0.02
0.00
-0.02
-0.04
-0.06
-0.08
-0.10
Figure 5-2 Color contour map showing calculated tube wall strain computed using
the finite element code ABAQUS and the properties of silicon rubber. Note that
maximal principal strain ranges between 0 and 10%. Endothelial cells cultured in
the inner layer of the tube are subjected to the same level of deformation. Note that
at the upper and lower walls of the tube, cells are stretched by about 10%.
Cell morphology
All experimental monolayers were examined by phase contrast microscopy before and
after the experiment. In both experimental and control tubes, the endothelial cells
remain attached and viable after being subjected to intermittent pulsatile flow and tube
compression (Figure 5-3). In general, cells aligned in the direction of flow after 6
hours in all circuits with high flow (F&FC). Alignment was most prominent with FC,
but was never observed in the C and Control groups.
81
'I
( i L,
FC
C
F
Control
( [ ll]
I .['Ill (I ,'
I
iii it
l/,
\( )"
.\!mntr\in lI.
IC', ll J CI' (~ Jll['
4
1J\II
~ I ,ll.. J i'.:
fii. ',!', ,.''
'!" 11I
.
li}<\ \ c'',i,'
nili Ii
I \\''C
,.' '
'~
'1.!
11C ill
1 1/
IC
i'I !I
II I
1t'
',,
I',I '
t L'- ilj
1N/ 'Ni/CN
p'",'-l,',ll
d'.'
.
I
NC
' , 't'
I"CI!"
I!
' i'1i
i ,!I Jl.'
I<,. lI
l' \ I
-- 1 l \\
I 2Ltil-' >:'4
ilkiJl '\J'i/Cllt
i I l)tll \k'l!
t '',
'-,J[!.' TC",11,ll
ll,'11--:-_()'l".
l,
i IL ' 11C, [" \
~l tl~_' titlln l.J.tm
iI
iCl '\fL'LI-IlillII \\iiCll p'K1 '.JlC'
J ilC'!,',1T ' Ic, A
~
i
1'
,1,I
(JiClI
'1/I
X~ l.
, '
NI
J11 lll J Ji
!
'1t! l)1/, i,'ltr:/\ ,l', ,'f Jtl1'H\
\.r~tt'1ii
i(t'iCi iI
, C(.'
1", ',[:*ll'_'t_[
",
,
,r.' '- c II,,l,,"i,~pt
I
C
2 C'
d
tilL'
' il
i' "" ,'.
1I
!.
tPA
PAl-1
Annexin
II
eNOS
ET-1
GAPD
FC
C
F
Control
Fi2ure 5-4 Northern blot analysis of rnRNA expression of candidate genes after 6
hours experiment period at peak shear of I() dvn/cr,.
significant changes in any of the genes listed.
83
Notice that there are no
.· .·:
i.l- ·
tPA
··
PAI-1
Annexin
II
eNOS
'.1, -,"11"',~~~··
~~:·
I
ET-1
__·I
GAPD
;:
.X
.'-,
t-i3|1! K~~~
i,
,
,
FC
4
j
I
....
C
F
Control
Figure 5-5 Northern blot analysis of mRNA expression of candidate genes after I
hour experiment period at peak shear of 40 dvn/cm.
significant chanLes in anv of the genes listed.
84
Notice that there are no
tPA
PAI-1
Annexin
II
.L .-
eNOS
ET-1
5I·'~V*
"
·m r-
-~
0,·.
*
. J
v-·
--
-·
7·
·
-----
-
,
-
GAPD
·'.
,
-,
2 -~
·6
,
,
-
,
W
-
.,
.
::_*
I
" ,·1
" 111r
C
,
- I
#
FC
...
*.
.
8
F
Control
Figure 5-6 Northern Blot of mRNA expression of tPA. PAI-I Annexin II. eNOS
ET- I and GAPD (top to bottom) after 6 hours experiment period at peak shear of
4() dvn/cm: in F group.
ane
-4 (left to right) represents FC. C. F and C(ontrol
group respectivel.
85.
At peak shear of 40 dyn/cm2 and 6 hours, the results are shown in Figure 5-6. Changes
in level of expression relative to the control group, measured using laser densitometry,
are summarized in Figure 5-7 & 5-8. There is an up-regulation of tPA expression by a
factor of 1.95±0.19 in F tubes, the elevation in FC is even greater than F group with a
factor of 2.45±0.46. eNOS expression is increased by a factor of 2.08±0.25 in F tubes
and of 2.11±0.21 in FC tubes. Compression of the tube slightly up-regulates tPA
expression (not significant) but causes no detectable change in eNOS expression.
Gene expression for PAI-1, Annexin II and ET-1 show no significant changes under
any of these experimental conditions.
..
Q
Im tPA
1*
Z 2.5 ...............................
oPA2-
.
P I-1
E
Annexin
o6
2
1.5
co
_
Ji;
1.5
12tlllt'rtr~ T
%
E
ff 1 t 1-1 T
IM111
1
i
0
co 0.5
a)
v
......
... .
Iii
0
n
w
-. i
Il
i
_
FC
C
F
Control
Figure 5-7 Densitometric analysis of mRNA expressio of tPA, PAI- I and Annexin
II from the result shown in Figure 5-6. Peak shear stress in F group is 40 dyn/cm 2 ,
and the experiment period is 6 hours. All data are first normalized to GAPD, then
to control group. (n=3, *p<0.05, **p<O.01).
86
2.5
r
o
E
II
I*
4
2
o
*
*;
I
................
,, 1.5
c:T
eI, I |I I|T
|eNOS
,-
!
I
I K11I-- I
I
I---------------
C>
ca
·0
O
1
----------------
T
:.,I --I,
E
o
·)
c-
- ---------
0.5
0
V
FC
C
F
Control
Figure 5-8 Densitometric analysis of mRNA expression of eNOS and ET-I from
the results shown in Figure 5-6.. Peak shear stress in F group is 40 dyn/cm2 , and
the experiment period is 6 hours. All data are first normalized to GAPD, then to
control group. (n=3, *p<0.05, **p<0.01).
Discussion
The antithrombotic efficacy of external pneumatic compression device is well
documented throughout the medical literature. Despite the widespread use of these
devices, remarkably little is known of the precise mechanism of action. In addition to
the hemodynamic effect of EPC, enhancement of fibrinolysis has been postulated to be
important [12, 13]. However, whether there is an enhancement of fibrinolysis is still
under debate. Jacob et al [17] found that EPC causes significant changes in systemic
fibrinolysis. Conversely, in O'Brien et al's study [112], no difference in postoperative
fibrinolysis was observed between control and compression groups. Since the
87
fundamental mechanisms of EPC have yet to be clearly delineated, the optimal mode
of compression (e.g. timing, pressure levels, cuff design) have yet to be established.
No good experimental model currently exists to address these issues. Clinical studies
are complicated by population heterogeneity and clinical variables making
interpretation of data extremely difficult. The goal of this chapter is to better
understand the mechanisms of EPC by use of a simple in vitro system in which the
relevant variables can be closely controlled. In this chapter, we have described the
design and characteristics of a cell culture system to simulate mechanical forces
encountered by vascular wall cells during external leg compression. We have
characterized the apparatus with respect to its biomechanical and hemodynamic
properties, including compliance, wall thickness, flow, viscosity, and shear stress
level. The VFS has been proven to support the EC culture, both morphologically and
functionally.
Endothelium is now recognized to play significant roles in the regulation of vascular
tone, inhibition of smooth muscle cell growth, platelet activation, and as a mediator of
the body's inflammatory and immunological responses. Many of these functions
appear to be modulated by biomechanical forces (Chapter 3). However, few in vitro
studies have -addressed the true complex nature of these forces or their potential
clinical relevance. In general, vascular endothelial cells have been cultured on flat
surfaces and subjected to shear stress in parallel plate flow chambers [113, 114], or in
cone plate viscometers [115]. In other studies, endothelial cells grown on a flexible,
flat surface have been subjected to cyclic strain [39, 103, 105]. The VFS is the first
three-dimensional in vitro device to simulate hemodynamic conditions resulting from
intermittent external compression. It provides a means of subjecting cultured
endothelial cells to the isolated or combined effects of hemodynamic shear, wall
strain, and vessel collapse. The system permits experimental control of the multiple
88
parameters to which these cells are exposed such as the timing cycle of intermittent
compression, peak shear stress level, duration of flow, etc. making it possible to
systematically examine the relationship between mechanical forces and endothelial
function. in this initial set of experiments, the timing and pulsatile flow rate are
selected to represent a typical commercial EPC device. However, the VFS can be used
to simulate a wide range of conditions to find those that produce the optimal
fibrinolytic or other desired response. Once these conditions are found, then the
computational model (Chapter 2) could be used to determine the external compression
parameters that might produce them. Ultimately, clinical studies would be needed to
prove that the optimal mode of compression obtained this approach will actually
improve the clinical outcomes.
The results indicate that cells elongate and align in the direction of flow after 6 hours
in circuits with high flow (F & FC), while cells cultured in low flow circuits (C &
Control) are not elongated and are more randomly orientated. Scanning electron
microscopy of blood vessels have shown that in areas of uniform laminar flow in vivo,
endothelial cells exhibit an ellipsoidal shape and align in the direction of flow [116,
117]. The aligned cells in our system therefore more closely mimic the morphology of
endothelium in vivo, suggesting, perhaps, a more general similarity in functionality.
In the initial set of experiments, the peak shear stress was set to 10 dyn/cm 2 , which is
at the lower end of the shear stress level predicted by model (Chapter 2), to study the
lowest level of shear stress to which endothelial cell can respond. The results showed
that there are no significant changes in any of the genes being investigated. This
indicates that peak shear stress, when under a certain threshold level, is not sufficient
to alter the expression of tPA, PAI- I, Annexin II, eNOS and ET- I. Notice that in the
FC group, peak shear can reach as high as 20 dyn/cm 2 , however, even in this group,
there are no significant changes. The result observed under intermittent pulsatile flow
89
conditions is somewhat different from those experiments done at constant flow, e.g.,
Diamond et al [82] showed that a constant shear stress of 25 dyn/cm 2 up-regulates tPA
expression and protein production, and Uematsu et al [75] showed that a constant
shear stress of 15 dyn/cm2 up-regulates eNOS expression in BAEC. The difference
may be due to the fact that endothelial cells subjected to simulated EPC experience
shear stress for a shorter period of time than under the constant shear stress. These
results suggest that both peak shear stress level and the amount of time that endothelial
cell are under shear are important for the regulation of several gene products.
For experiments with peak shear set at 40 dyn/cm2, the results show that at 1 hour,
there are no significant changes in all the candidate genes (Figure 5-5). However, after
6 hours, both tPA and eNOS mRNA expression are up-regulated by flow, while PAI-
1, Annexin II and ET-I show no response to flow or vessel strain (Figure 5-7 & 8).
This suggests that hemodynamic conditions generated by EPC enhance endothelial
cell fibrinolytic and vasomotor function. Increased levels of tPA can decrease the
baseline level of fibrin formation, which might contribute to the decreased incidence
of DVT. Upregulation of eNOS suggests increased nitric oxide production, causing
vasodilation and inhibiting platelet adhesion and aggregation. While we cannot
conclude that increased tPA and eNOS mRNA observed in our system reflect
increased protein production, in several studies, upregulation of tPA mRNA was found
to be associated with increased protein [ 1 18]. Production of nitric oxide by endothelial
cells is the topic of Chapter 7.
The fact that a lower level of peak shear does not induce changes in genes expression
but a high level of shear does, indicates that reaching a high peak shear stress level by
EPC is important. Studies have shown that peak shear stress is determined
by the cuff
inflation rate. Therefore, to generate a certain level of shear stress, a faster inflation
rate is desired when design the device.
90
The greater increase of tPA mRNA in FC than F may be the result of higher shear,
since when the tube is compressed, cross-section area decreases, and shear stress will
be higher than before compression for the same level of flow by about a factor of 2.
This situation mimics what happens in the vicinity of the knee, where the veins are
partially collapsed while at the same time, they must convey the blood being
discharged from the calf. Computational studies have shown that shear stress at this
location can exceed 150 dyn/cm2 (Chapter 2).'The increased tPA mRNA response
seen in these experiments under highly pulsatile flow on a one minute cycle are
surprisingly similar to results from previous studies with steady shear stress [83].
Of particular note is the result that in compression only (C), there is little or no change
in any of the genes considered, and in FC and F, similar trends of upregulation are
seen in tPA and eNOS These findings suggest that it is pulsatile shear stress, not
vessel compression that is responsible for these changes. This has important
implications for the design of EPC systems, that the objective should be to increase
shear stress above a certain level rather than to achieve vessel collapse. For example,
from the results of Chapter 2, both anterior-posterior compression and
circumferentially-uniform
compression at 50 mmHg were found to generate the same
degree of vessel collapse and vessel wall strain, however, the difference in shear stress
level was considerable.
In some clinical studies [17], compression was found to induce prompt and specific
increases in fibrinolytic function. Fibrinolytic activity decays rapidly once
compression has been stopped, which is in conflict with Knight and Dawson [119],
who noted a persistent enhancement of fibrinolytic activity up to 18 hours after
cessation of compression. Our in-vitro cell culture studies suggest that EPC provides
at least the benefit of up-regulation ot endothelial thromboresistance
91
genes tPA and
eNOS if EPC is applied for enough long time. But, if applied for less than one hour,
these beneficial effects are not significant. It is not clear whether there is a rapid initial
release of tPA with the onset of EPC. Enzyme linked immunosorbent assay (ELISA)
developed in our lab and commercially available ELISA are not sensitive enough to
detect tPA protein levels in the cultured media due to the dilution factors from the
relatively large volume in the VFS. Therefore, this question remains to be answered.
Similar tendencies of fibrinolytic enhancement have been observed in exercise. For
example, a rise in the fibrinolytic activity after exercise has been reported by many
authors and attributed mainly to the acute release of tPA from the vascular
endothelium [120]. However, the cause of increased fibrinolytic activity is still
controversial. Some researchers found that when comparing physical active and
inactive men, tPA activity increased more in active men and that they have a lower
PAI-I activity [121]. Comerota et al showed [16] that the mechanism of increased
fibrinolytic activity is because of a reduction in PAI-1 but no changes in tPA with a
resulting increase of tPA activity. Our cell culture studies showed that PAI-I does not
respond to EPC hemodynamics
in vitro under all the conditions tested. Instead, tPA
responds to changes of hemodynamic conditions may play a role in the enhanced
fibrinolytic activities.
There are several factors that make it difficult to directly compare the result of in vitro
data and clinical studies. Medical and surgical patients comprise a heterogeneous
population and the fibrinolytic cascade is affected by so many clinical variables that
interpretation of data obtained from hospitalized patients is difficult at best. Most
clinical studies were conducted with hospital patients and blood samples were taken
and assayed for fibrinolytic parameters during and after EPC. The results can be
complicated by several factors: (1) Blood sample site, which could be too remote from
the sites of release of tPA to allow detection of local release. (2) Upon release, tPA
92
can bind to the cell surface and serum proteins. Therefore, the blood level of tPA may
not reflect actual tPA release. (3) Some clinical studies only measured fibrinolytic
activity, which is determined not only by tPA but also by PAI-I levels. (4) The
fibrinolytic system accounts for only a portion of plasminogen activator activity;
studies [122] have show that uPA and the factor XII-dependent fibrinolytic
proactivator system account for the remaining activities.
Another question relevant to clinical use of EPC is the efficacy of alternative
compression sites. For example, in a recent study of patients with multiple injuries,
Shackford and colleagues observed that 35% of limbs felt to be at high risk for deep
venous thrombosis were unavailable for pneumatic compression [123]. Under these
circumstances, compression is usually applied to the available lower extremity alone.
Some use upper extremity compression as an alternative [119] with some success. A
number of questions arise from these rather unorthodox applications. First. does
pneumatic compression of the uninvolved lower extremity provide protection against
deep venous thrombosis in the contra-lateral fractured extremity? Second, does upper
extremity compression provide significant systemic thromboembolic prophylaxis at
all. Knight et al's studies [119] showed that despite the presence of venous stasis in
the legs, intermittent compression of the arms during and after surgery reduced the
incidence of DVT in the legs to half that in control patients and maintained blood
fibrinolytic activity at preoperative values. Their studies suggest that the release of
fibrinolytic activators is essential to the prophylactic action of EPC. The results of the
in vitro cell culture studies are consistent with this view in that enhanced fibrinolysis
is at least partially responsible for the efficacy of EPC in addition to the hemodynamic
effects. However, an alternative compression sites are still inferior to the compression
of the leg since it lacks the direct benefit of hemodynamic improvement. Furthermore,
some other factors released by endothelial cells (eg. Nitric Oxide, Chapter 7) have a
relatively short half life in the blood. Therefore, the effects of these molecules are very
limited in remote sites.
93
94
Chapter 6 Screening coagulation related genes using Affymetrix
gene array
In Chapter 5, only fibrinolytic and vasomotor pathways are considered. We know
from numerous other studies, however, that endothelial cells actively regulate many
other aspects of homeostasis, all of which might be important in the mechanisms of
prophylaxis against DVT by EPC. Ideally, it would be necessary to study all the
coagulation related genes and observe their patterns of expression under EPC
hemodynamics. When large number of genes need to be studied, traditional Northern
Blot and RT-PCR are no longer suitable because they are time-consuming and can
only detect genes one at a time. With the development of gene array technology,
screening a large number of genes at once is now possible. In this chapter, we further
investigate the endothelial thromboregulation under EPC by using the Affymetrix
gene array technology
We have hypothesized that EPC alters many biologic attributes of vascular wall cells
involved in thromboresistance, including the fibrinolytic, coagulation factors and
vasomotor control systems. We initially tested our hypothesis by examining the
response of endothelial cell pro- and anti-coagulant genes (discussed in Chapter 3)
using DNA microarray technology. This hypothesis, however, does not preclude the
recognition that the interaction of the vascular wall with circulating elements, e.g.
platelets, macrophages, and p!asma borne moieties are also critical to the development
of thromboresistance.
Introduction to DNA microarray
New DNA microarray technology allows expression monitoring of thousands of genes
on a single chip [124] in one experiment and is an excellent tool for studying large95
scale expression. Expression levels in a number of different tissues or situations
provide a first step toward functional characterization of new entities. The approach is
based on using arrays of DNA targets (cDNA or oligonucleotides) for hybridization to
a 'complex probe' prepared with RNA extracted from a given cell line or tissue. The
probe is produced by reverse transcription of mRNA and radioactive or fluorescent
labeling. The experiment provides simultaneous measurement of abundance for each
of the sequences represented on the array, thereby providing an indication of the
expression levels of the corresponding genes in the original sample. The method is
fast, and thousands of data points can be collected simultaneously.
Currently, there are several implementations of DNA microarray technology,
including nylon macroarrays, nylon microarrays, glass microarrays and
Oligonucleotide chips. The one we used, from Affymetrix Inc., is based on
Oligonucleotide chip technology. It contains six thousands of different
oligonucleotides on a small glass or silicon chip. Each gene is represented by a set of
oligonucleotides chosen along its known sequence, and supplemented by a set of
control oligonucleotides. The complex probe is labeled by fluorescence, hybridized in
a small volume, and read by using a laser scanning device (Figure 6-1).
96
Affymetrix GeneChip microarray
Figure 6-1 Affymetrix GeneChip. A small portion of gene chip is shown here in an
enlarged view. Six thousand genes can be put on a small size chip, each gene is
characterized by a set of oligonucleotide probes. After hybridization, fluorescent
intensity can be read using a laser scanning device and the data are processed by
computer.
The main advantages of the gene chip are that it is fast, and that thousands of data
points can be collected simultaneously. The disadvantage is that the cost of complex
expression
chips is in the thousand-dollar
range and said to be non-reusable.
a
complete set of instruments (hybridization system, scanner, and software) carries a
price tag close to $200,000. In this thesis, for the purpose of initial screening, only one
set of gene chips were used to test control and experimental conditions. Nevertheless,
it provided much useful information and guidance for future research.
97
Materials and Methods
The DNA microarray experiment was performed with HUVEC cultured in VFS under
combined intermittent flow and compression for 6 hours and control cells exposed to
low steady flow with no compression (same as FC and Control group in Chapter 4).
The choice of those hemodynamic conditions and time point is based on previous
observations that genes responsible for thromboresistance in endothelial cells were
changing their expression under those conditions and at this time point.
The DNA microarray hybridization experiment was performed using the Affimetrix
GeneChip HU6800. A complete listing of genes contained with GeneChip HU6800
can be found at http://www.hugeindex.org.
For each gene in the Affymetrix GeneChip, the microarray typically contains 20
perfect match (PM) oligonucleotides
with 25 base pairs long and 20 mismatch (MM)
oligonucleotides at the same length with only one mismatched base in the middle
(Figure 6-2). The use of multiple oligoes allows cross hybridization among related
genes to be detected and increases the sensitivity of the assay.
RNAs are reported as detected as present in the target when they hybridize to the PM
probes producing significant signal intensities after the signal intensities from the MM
probes have been subtracted. For transcripts not present in the target, the average
signal intensity for the MM probes is closer to that of PM probes. The expression level
of transcript is calculated using PM:MM difference, PM/MM ratio information and by
averaging that information over the entire set of probes. The absolute call of a probe
set is an analytical determination of whether or not a transcript is Present/Detected (P),
Absent/Undetected (A), or Marginal (M) (At the threshold of detection).
98
Perfect
match
oligo
AATGGGTCAGAAGGACTCCTA
Perfect match oligo AATGGGTCAGAAGGACTCCTATGTG
Mismatch oligo AATGGGTCAGAACGACTCCTATGTG
.. .TGTGATGGTGGGAATGGGTCAGAAGGACTCCTATGTGGGTGACGAGGCC...
Figure 6-2 20 perfect match oligonucleotides and 20 mismatch oligonucleotides are
used to identify each gene. Each oligonucleotide is 25 base pairs long. Mismatched
oligonucleotides has one mismatched base in the middle.
In the process of gene transcripts detection, total RNA is converted to biotin labeled
cRNA. The Affymetrix detection procedure involves a linear amplification process
that increases the sensitivity of assay. Produced cRNA is fragmented and hybridized to
a gene chip. Signal intensity and signal specificity are evaluated (Figure 6-3). The
intensity of the fluorometric signal is expressed in arbitrary units ranging from 0 to
approximately 10, 000. The arbitrary scale used in analysis can distinguish genes with
expression levels of approximately 100 representing a few mRNA copies per cell
[125]. Very low abundance mRNAs (i.e. < 3 copies/cell)
may not be detected. To
allow reliable data comparison the expression levels of all samples have been globally
normalized to all probe sets and scaled to a target intensity of 100 using GeneChip
Analysis Suite 3.1. Global normalization multiplies the output of the experimental
array by a normalization factor that makes its average intensity equal to the average
intensity of the baseline. The average intensity of an array is calculated by averaging
all the expression levels of every probe set on the array, excluding the highest and
lowest 2 % of the values. The expression levels for transcripts producing negative
intensities (MM>PM) are converted to zero and assigned an Absent/Undetected
(A)
designation. The methods for preparation of cRNA and subsequent steps leading to
hybridization and scanning of the Hu6800 GeneChip Arrays were provided by the
manufacturer (Affymetrix, Santa Clara, CA).
99
mRNA
Reverse transcription1
cDNA
In vitro transcription
Biotin labeling
cRNA
Hybridizel
GeneChip
Stain hybrid with
streptavidin-phycoerythrin
conjugate
GeneArray scanner
Data analysis
Figure 6-3 Affymetrix gene chip hybridization protocol
Positive control
We chose tPA and eNOS as positive control genes which change their expression
under the hemodynamic conditions we established for our experiment. Total RNA
from experimental cells was extracted by standard protocol and divided into two parts.
One part was assessed for changes in tPA and eNOS expression by Northern blot
technique, the second part was processed according to the Affymetrix protocol for
DNA microarray hybridization analysis.
100
Results
Differences in tPA and eNOS expression as assessed by Northern blot were
quantitated and showed a 2.3 fold and 2.4 fold increase, respectively (Figure 6-4)
tPA
eNOS
W"
GAPD
:
FC
j
Control
Figure 6-4 Northern blot analysis of eNOS and tPA mRNA expression. The other
half of the RNA was used in Affymetrix gene array analysis.
After the changes of tPA and eNOS expression in the experimental cells were
confirmed (Figure 6-4), our analysis of the Affymetrix protocol for DNA microhybridization analysis identified approximately 17 genes associated with direct
endothelial pro-/anti-thrombotic
regulation.
Results by gene type and
experimental/control response are detailed in Tables 6-1 & 6-2 below. It should be
noted in the tables that signal intensities calculated by the analytical software program
for some factors fall below an average background
value. They are defined in the
Table 6-2 by 0*. Thus, it was not possible to calculate the fold change for these
factors. In the overall analysis, it is important to consider actual intensity values in
101
addition to the fold change. Intensity values of less then 50 are less reliable than
higher intensity values.
Table 6-1 Changes of mRNA expression in endothelial pro-thrombotic genes
Signal intensity:
Experiment/Control
Experiment/Control
Ratio
21 / 237
0.1
12/ 53
0.23
Endothelin converting enzyme
(ECE)
302 / 598
0.51
von Willebrand factor (vWF)
1097 / 1481
0.74
Endothelin-1 (ET- 1)
614 / 815
0.75
Thrombospondin
170 / 204
0.83
2746 2491
1.1
1230/964
1.3
Thromboxane A2 receptor
Tissue factor (TF)
Plasminogen activator inhibitor
(PAI-
1)
Platelet endothelial cell adhesion
molecule- 1 (PECAM- 1)
Table 6-1 listed the mRNA expression level of endothelial pro-thrombotic genes. The
results show that there is a down-regulation relative to control in three genes:
thromboxane A2 receptor, tissue factor and endothelin converting enzyme (ECE).
Other genes did not show significant changes. The results of anti-thrombotic genes are
listed in Table 6-2. Among those, the expressions of five genes are upregulated by
EPC hemodynamic condition: tissue factor pathway inhibitor (TFPI), endothelial cell
protein C receptor (EPCR), urokinase plasminogen activator receptor (uPA-R),
thrombomodulin (TM ) and tissue plasminogen activator (tPA). Overall, there exists a
102
pattern of endothelial thrombotic potentials shift toward improved antithrombotic
potential. Relative to controls, the experimental cells demonstrated up-regulation of a
couple of anti-thrombotic characterized genes and down-regulation of several prothrombotic associated genes. There are also some genes which do not change their
expression much in response to EPC.
Table 6-2 Changes of mRNA expression in endochelial anti-thrombotic genes
Signal intensity:
Experiment/Control
Experiment/Control
Ratio
Cyclooxygenase-2 (COX-2)
296 / 368
0.8
Annexin II
478 / 519
0.9
Endothelial nitric oxide synthase
877/ 809
1.1
230 / 177
1.3
71/49
1.4
Tissue factor pathway inhibitor
(TFPI)
863/468
1.8
Endothelial cell protein C receptor
238/125
2.0
298/141
2.1
(eNOS)
Heparan sulphate proteoglycan
Urokinase-type plasminogen
activator (u-PA)
(EPCR)
uPA receptor (u-PAR)
Tissue plasminogen activator (tPA)
124/0*
Thrombomodulin
246/0*
(TM)
103
Strongly present in
exp., absent in
control
Strongly present in
exp., absent in
control
Discussion
Utilizing DNA microarray technology, we studied the endothelial thromboregulation
in response to in vitro simulation of EPC. Our results imply that the vascular wall
endothelial cell is responsive to hemodynamic forces across a multiple selection of
thrombosis modulating genes as measured by initial expression of these genes in a 6
hour period of combined compression and hemodynamic shear stress. Although this
set of screening test was done only once, the implication of multiple arms of the
coagulation regulatory system responding is clear, and further investigations are
worthwhile to probe the other pathways of coagulation besides fibrinolysis and
vasomotor functions.
Thromboresistance of the endothelial cell wall is a consequence of many factors that
dynamically interact with each other (Chapter 3). We can broadly define these factors
as affecting fibrinolysis, coagulation cascades, platelet interactions, and vasomotor
control. Many of these factors have overlapping functions but for purposes of
discussion we will segregate them somewhat artificially.
FibrinolyticFactors
tPA, PAI-i and Annexin II form the primary fibrinolytic component in vascular
homeostasis and play an important role in maintaining endothelial thromboresistance
properties. From the results of gene microarray, we do not see changes in expression
of neither Annexin II nor PAI-1, but tPA shows considerable change suggesting
potential increase of endothelial fibrinolytic capacity. These results are consistent with
our previous studies in Chapter 5.
Another arm of fibrinolytic system is u-PA and u-PA receptor. Although there are still
some controversial on their role in homeostasis, u-PA has been shown to be important
104
to vascular homeostasis (Chapter 3). Expression of u-PA is upregulated although the
intensity of the signal is low. The receptor for u-PA (u-PAR) is upregulated by a factor
of 2. Overall, these results suggest that EPC stimulates a fibrinolytic enhancement of
endothelial cells.
Platelet Function
COX-2 is one of the enzymes responsible for prostacyclin (PGI,) production [126] and
endothelial nitric oxide synthase (NOS) is the enzyme involved in nitric oxide (NO)
synthesis. Both PGI2 and NO share the similar action in that they induce vasodilation,
inhibit platelet activation and aggregation (Chapter 3). Gene array analysis showed
that there are no significant changes in COX-2 or eNOS. The result of eNOS
expression from microarray is different from that of Northern blot (Figure 6-4), which
showed an up-regulation of eNOS by EPC. Since we have done extensive studies in
eNOS (Chapter 7) and observed eNOS up-regulation many times, we believe that the
result of Affymetrix gene chip shown here is not correct. Instead, the results obtained
from gene array should only be used as screening tool and not as conclusive results.
Further investigation is necessary to clarify the cause of this discrepancy.
CoagulationFactorsand Endothelial-CoagulationFactorInteractions
Many of the factors produced by endothelial cells participate the regulation of
coagulation factors. Among them, tissue factor pathway inhibitor, endothelial protein
C receptor and thrombomodulin are upregulated and tissue factor expression is
decreased. These results suggest that anti-thrombotic mechanisms of EPC involve the
regulation of tissue factor pathway and thrombomodulin/protein C activation, which
comprise two of the most important thromboregulatory mechanisms of endothelial
cells besides fibrinolysis and platelet regulation. The result of TFPI is consistent with
the recent clinical studies which show that EPC results in an increase in plasma TFPI
(Chapter 1), therefore indicate inhibition of the TF pathway, the major physiological
105
initiating mechanism of blood coagulation, may be important in the antithrombotic
effect of EPC. The involvement of thrombomodulin/protein C pathway has not been
reported in the literature. The results listed here suggest that this pathway may also
contribute to the efficacy of EPC and therefore deserves further investigation.
Vasomotor Modulators
Endothelin-l (ET-1), a potent vasoconstrictor released by endothelial cells, is
converted into its active form by endothelin converting enzyme (ECE) [127]. Gene
array data show that there is no change in ET-1 expression while the expression of
ECE is downregulated. Thromboxane A2 is a vasoconstrictor and platelet activator
[128] and the expression of thromboxane A2 receptor (TXA2R), is down-regulated.
These changes indicate that EPC causes vascular tone shifts toward vasodilation which
is a desired effect of DVT prophylaxis.
Summary
The results presented in this chapter do not constitute proof of a phenotypic shift
related to the interrelation of compression and shear forces on vascular wall cells.
Nonetheless, we believe that the significant changes of multiple gene effects, as
demonstrated by microarray technology, lead considerable credence to our hypothesis
that EPC functions not only by local avoidance of stasis but also by significant
biologic effects on the local and systemic homeostatic milieu in the limb. It remains to
be demonstrated that the DNA effects observed are translatable into functional results,
however, our data give us considerable enthusiasm for going forward in that direction.
Of several thromboregulatory mechanisms by endothelial cells, the fibrinolytic system
has primarily been studied in the clinical setting and has been implicated in one of the
mechanisms of EPC. Regulation of platelet function has also been implicated in some
106
studies. Our results support this view that multiple pathways contribute to the
mechanisms of EPC besides hemodynamic improvement. In addition, the gene array
data presented in this chapter suggest that two other pathways, tissue factor pathway
and thrombomodulin / protein C pathway, may involved in this process.
The use of the microarray technology also merits specific discussion. The technology
is evolving and exact criteria for presuming substantive effect remains on to
discussion. Better characterization of the thresholds for significant change will
doubtlessly evolve from the currently somewhat arbitrary set points. Nonetheless, the
microarray method is sufficiently evolved that presence or absence, or qualitative
differences in signal intensity, can substantially justify further investigations.
107
I~~~~~~~~~~~~~~~~~~L
Chapter 7 Nitric oxide production by endothelial cells under
EPC
Introduction
In Chapter 6, we demonstrated that vascular endothelial cell is responsive to
hemodynamic forces across a multiple selection of thrombosis modulating genes. In
this chapter, we investigate NO regulation by EPC hemodynamics in more detail. We
use the VFS system described before (Chapter 4) to examine the response of HUVEC
to intermittent flow or vessel collapse, or a combination of the two with respect to NO
production and endothelial nitric oxide synthase (eNOS) mRNA expression. We also
examined NO production in the presence of various NOS antagonists to identify the
NO source and considered different modes of EPC to explore how this might influence
NO dynamics.
Nitric Oxide and Nitric Oxide synthase
NO production is catalyzed by NO synthase (NOS), which oxidize L-arginine to Lcitrulline. The reaction requires multiple cofactors, including flavine adenine
dinucleotide (FAD), flavin mononucleotide (FMN), NADPH, and tetrahydrobiopterin
[129]. Three major isoforms of NO producing enzymes have been identified in various
cell types. One subtype is the inducible nitric oxide synthase (NOS II), which is
regulated at the transcriptional level [130], requires several hours to be expressed and
produces high levels of NO for extended periods. NOS II can be induced in
macrophages, hepatocytes, vascular SMC, endothelial cells, and mesangial cells on
stimulation with cytokines and or bacterial lipopolysaccharides [131]. The other two
isoforms are constitutively expressed, release low level of NO immediately on
stimulation. These isoforms are termed nNOS (NOS I), found in neurons, epithelial
cells, pancreatic islet, skeletal muscle, human keratinocytes, and retina tissue and
109
eNOS (NOS III), found in vascular endothelium, epithelial cells, cardiac myocytes,
platelets, monocytes, hippocampal neurons, and macrophages [132].
The three isoforms share only 50-55% sequence identity with each other. However, in
certain regions of the proteins there is high sequence identity, particularly in domains
that contain binding sites for various cofactors, including flavin adenine dinucleotide,
flavin mononucleotide, tetrahydrobiopterin, heme and calmodulin [131]. Generally,
nNOS and eNOS are considered constitutive enzymes whereas iNOS is highly
regulated by cytokines. However, under certain circumstances, the expression of
nNOS and eNOS is inducible. For example, fluid flow up-regulates the expression of
eNOS; indeed, six shear-stress responsive elements have been identified in the
promotor region of eNOS. Treatment with neurotoxic agents increases nNOS
expression in the hippocampus. Generally, iNOS is considered to be an enzyme that is
induced during immune response. However, under certain circumstances, it may be
constitutively expressed. For example, the enzyme has been identified in human
bronchial epithelium, alveolar macrophages, and rat kidney under conditions where
immune activation is not apparent [129].
Table 7-1 Three isoforms of nitric oxide synthase (NOS)
Isoforms
Other names
NOS I
nNOS
Neurons, also epithelial cells, skeletal muscle
Cell, keratinocytes, retina, ...
NOS II
iNOS
Macrophages, also hepatocytes, smooth muscle
eNOS
Endothelium, also epithelial cells, cardiac myocytes,
fibroblast, platelets, monocytes, hippocampal neurons,
NOS III
Expression in various cell types
Cell, endothelial cells, ...
and macrophages, ...
110
eNOS expressed in endothelial cells, is the predominant NOS isoform in the vessel
wall. Under basal conditions, eNOS is inactive and remains membrane bound.
Receptor mediated agonist stimulation (eg, acetycholine, bradykinin and substance P)
leads to rapid enzyme activation by depalmitoylation, binding of Ca2 */calmodulin,
displacement of caveolin, and release from the plasma membrane [133]. Shear stress is
an important physiological stimulator of eNOS activity, causing rapid membrane
release and activation by Akt-dependent serine phosphorylation [134, 135], and
upregulating eNOS gene expression by transcriptional activation of the eNOS
promoter [136]. After vessel injury or in disease states, iNOS expression may be
induced in atherosclerotic plaque [137]. In normal blood vessels, nNOS is present in
neurons in the adventitia and may be expressed by medial smooth muscle cells (SMC)
under pathophysiological conditions [138].
In the vascular wall, NO activates soluble guanylate cyclase in vascular smooth
muscle cells, leading to elevation of cGMP, activation of cGMP-dependent protein
kinase, and vasorelaxation [139]. In addition to regulating vascular tone, a substantial
body of evidence suggests that NO has many important effects: (1) Antiplatelet
effects. NO inhibits platelet adhesion and aggregation and thrombin-induced
expression of platelet-activating factor [22, 23]. (2) Anti-thrombotic effects. Besides
inhibiting platelet aggregation, NO has been shown to inhibit tissue factor expression
[24, 25], as well as to increase tPA release [26]. (3) Antiproliferative effects. NO
donors potently inhibit VSMC proliferation, migration, and extracelllular matrix
synthesis [140]. (4) Anti-inflammatory effects. NO donors inhibit activation and
nuclear translocation of NF-kB, block cytokine-stimulated endothelial adhesion
molecule expression and reduce adhesion and activation of neutrophils and monocytes
[141]. In particular, inhibition of monocyte chemotactic protein -1 (MCP-I) protein
expression appears to be an important aspect of NO's anti-inflammatory effect in
atherosclerosis [142]. (5) antioxidant effects. Continuous, low level NO production
may directly inhibit lipid oxidation by scavenging free radicals [143].
111
NO chesmitry
NO is a molecule with relative short half life in aqueous solution. Once generated, NO
will rapidly and spontaneously interact with molecular oxygen (02) to yield a variety
of nitrogen oxides [144],
2NO+ 02 -- 2NO2
2NO + 2NO2
-
2N 203
2N20 3 + 2H2 0 -- 4NO2-+ 4H +
The overall stoichiometry for solution decomposition of NO has been determined to
be,
4NO +
2 + 2H20 -- 4NO2-+ 4H +
NO2-(nitrite)is the only stable nitrogen oxide formed following NO decomposition in
an aqueous solution in vitro [144]. However, NO3'(nitrate) is predominant in vivo
environment such as plasma or urine. Ignarro et al have demonstrated that virtually all
NO2- derived from NO is rapidly converted to NO3- in vivo via its'oxidation by certain
oxyhemoproteins such as oxyhemoglobin or oxymyoglobin [144].
The final stable products of NO are NO2-and NO3 -. Most of NO becomes NO2- in a
simple aqueous solution in vitro such as tissue culture media, but most of NO becomes
NO 3 in vivo. In any case, assay of (NO2- + NO3-) indicates the total NO production.
112
Nitritre/Nitrate determination
Nitrite (NO2 -) levels were measured with a quantitative fluorometric assay. The assay
was further modified from [145] to improve the sensitivity. This assay is based on the
reaction of nitrite with 2,3-diaminonaphthalene (DAN, Aldrich, Milwaukee, WI)
under acidic condition to form the highly fluorescent product l-(H)-naphthotriaz!L. A
volume of 80ml of freshly prepared DAN reagent (25mM in 0.62M HCI) was added
into each 800ml media sample and mixed immediately. After a 10 min incubation at
200 C, the reaction was terminated with the addition of 40ml 2.8N NaOH. Formation
of 1-(H)-naphthotriazole was measured using a Spectrofluorophotometer (model RF5000, Shimadzu Corporation, Kyoto, Japan) with excitation at 380nm and emission at
405nm. Nitrite concentrations were determined relative to a standard curve. Sodium
nitrite (Sigma) was used as the standard for calibration of the assay between 5nM and
10OOnM.This assay gives a linear fluorescence intensity with regard to nitrite
concentration, the sensitivity of this assay is 5nM (Figure 7-1). Total nitrite production
values were normalized to the number of cells in each group. To assess the nitrate
(NO3) component, in separate tests, nitrate in HUVEC conditioned media was
converted to nitrite using 5OmUnitrate reductase from Aspergillus Niger (Sigma) and
10mM b-NADPH for 1 hour at room temperature. This protocol converted over 95%
of nitrate to nitrite. After this step, nitrite was then determined by above mentioned
procedures. We obtained the same result as the one without nitrate reductase
conversion, confirming that the nitrate component could be neglected in the HUVEC
culture and nitrite level reflects the NO production.
113
_,3
1U
u)
..
r T r B r lt.
I
'
:III
II--ia'
r ' i
i i
2
C 10
(a)
-C)
en
0
101
:
LL
.
. . . . ..
0
III·
IV
100
.
.
.
.
.
.
:
.
-1 ,- I , - -7
.
. . f
10 2
101
10 3
104
Nitrite Concentration (nM)
Figure 7-1 Nitrite calibration curve, fluorescence intensity is proportional to nitrite
concentration. Fluorescence intensity was read at excitation of 380nm and
absorption of 405nm. The sensitivity of this assay is 5nM.
Experiment setup
HUVEC were cultured in VFS as described in Chapter 4. Four test groups indicated in
Table 7-1 are the same as those in Chapter 4. Another group in which there is no flow
and no vessel compression was set aside as additional control (Static Control group).
114
Table 7-2 Conditions in each of the experimental groups
Condition
Pulsatile flow +
compressionps fow
Abbreviation Flow rate & Shear stress
FC
Silastic tube
Intermittent pulsed flow:
short pulse of peak flow 50% compression
at 12.5ml/s for 4 sec
at 1.ml/s for 4 sec
of the tube,
followed by 56 sec of
maximum wall
zero flow. Calculated
peak shear stress is 80
dyn/cm2.
Intermittent pulsed flow:
short pulse of peak flow
at 12.5ml/s for 4 sec
Pulsatile flow only
F
followed by 56 sec of
zero flow. Calculated
peak shear stress is 40
None
dyn/cm2.
Compression only
C
Steady perfusion of 6
ml/min, shear stress
50% compression
c controStatistrainis+10%
0.3dyn/cm2
Perfusion Control
Cntrl
Steady perfusion of 6
ml/min, shear stress 0.3
None
dyn/cm2
Static control
Static
No flow
None
To test whether the measured nitrite levels in the conditioned media reflected
increased NO production, we used a specific inhibitor NG-amino-L-arginine(L-NAA)
(Sigma) for that pathway. HUVEC cultures were incubated with 100mM of L-NAA
for 60 min before and during exposure to experimental conditions. To examine which
NOS isoform was responsible for the flow-induced nitrite production, we incubated
cultures with specific NOS inhibitors 24 h before and during the 6 hr of exposure to
experimental conditions. In the present study, mM S-Methyl-L-thiocitruline was
used as an inhibitor for NOS I (nNOS) [146], mM dexamethasone for NOS II (iNOS)
115
[147] and ImM Nv-Nitro-L-arginine Methyl Ester (all from Sigma) for NOS III
(eNOS) [148].
To examine the influence of different EPC cycles on NO production and eNOS
mRNA expression, the system previously described (Chapter 4) was slightly modified.
Three air pumps configured with different time cycles (4 sec of high flow every 30
sec, 60 sec and 120 sec, respectively) were used in these experiments.
To further clarify the kinetics of NO production, HUVEC in F group were subjected to
1 hour EPC, allowed to rest with no flow for 2 hour, and then re-exposed to EPC for
an additional 1 hour. Culture media were sampled for NO determination at the end of
each one hour period.
Statistical analysis
Data were expressed as means + SE. When data from more than two groups were
compared, one-way analysis of variance (ANOVA) followed by post-hoc Shaffe's test
was used. Differences were considered statistically significant when p<0.05.
Results
As shown in Figure 7-2, Intermittent pulsatile flow generated by EPC stimulates NO
production in HUVEC. Nitrite levels increased rapidly within the first hour of
exposure to flow. During this time, nitrite levels in FC and F groups were more than
two times compared with C and Control groups, while in the stationary control group,
there was essentially no nitrite production. Interestingly, no significant difference in
nitrite levels was observed between CF and F groups, or between C and Control
groups. Two phases of nitrite production rate in cultures exposed to flow could be
116
discerned: phase A (0-lhr) which was characterized by a rapid nitrite release, and
phase B (1-6 hr), which was characterized by diminished but sustained nitrite release.
Average nitrite production rates during phase A were 12.5nmol/(million cells)/hour,
whereas the corresponding nitrite levels in phase B were 2.2nmol/(million
cells)/hour.
Nitrite production rates in each phase were calculated as the slope of the cumulative
nitrite production.
an
--=- FC
25
-.- F
C.
'r.
§ 20
--C
3 15
--
0
--
Control
Static
Control
5
0
0
1
2
3
4
5
6
Time (hours)
Figure 7-2. Cumulative nitrite production in conditioned media collected each hour
(n=3 for each group). Data were normalized to number of cells in each group.
ANOVA followed by Shaffe's test was used to compare different groups. F and FC
groups are significantly different from C and Control groups (p<0.01), C and
Control groups are significantly different from Static Control group (p<0.01).
117
Figure 7-3 shows the kinetics of NO production in response to a resting period of 1
hour. There was no increase of nitrite level during the 2 hours resting period. When
intermittent flow of EPC was reapplied, nitrite levels significantly increased. The
nitrite production rate after flow was reapplied was similar to the nitrite production
rate during the first 1 hour of exposure. However, since NO production seems stopped
during the resting period, the cumulative NO production at the end of 4 hours
experimental period is about the same as the one under continuous intermittent flow.
Restart flow
Resting
for 2 hour
Flow
for I hour
-F
for 1 hour
-I---
-r6Lt-
25
I-
;n
20
-L
o
z
0
--
15
H
10
cj
F-
5
0
0
1
2
3
4
Time (hours)
Figure 7-3 Kinetics of NO production in response to resting period. Cells in F
group were exposed to intermittent pulsed flow for 1 hour, and then flow was
stopped for 2 hours and restarted for an additional 1 hour. (n=3)
118
In order to determine if the observed increase in nitrite level under flow conditions
reflected increased NO production, experiments were done using L-NAA, a NOS
inhibitor. Treatment with L-NAA for 60 min before and during exposure to flow
completely blocked the flow induced nitrite accumulation (Figure 7-4).
30
._
25
*
.-0
_I=
20
o
15
U)
=3
15-
10
5
dC:
Aim
Mmigma~
o
Static
Control
Static
Control
+ L-NAA
Control
Control
+ L-NAA
1F
F
+ L-NAA
Figure 7-4 Nitrite production after 6 hours experimental period with and without
100mM NG-amino-L-arginine (L-NAA) (n=3). Significantly different between
treated and untreated groups, *(p<0.05), **(p<0.01)
HUVEC cultures under flow were incubated with specific inhibitors for NOS isoform
I, II and III, respectively, to determine the enzyme involved in flow-induced NO
production. S-Methyl-L-thiocitrulline and dexamethasone had no observable effect on
119
NO production in medium from HUVEC culture under EPC, while N"-Nitro-Larginine Methyl Ester which blocks NOS isoform III (eNOS) dramatically diminished
the production of NO (Figure 7-5).
40
35
0
30
25
20
"S
15
'3 10
O-
5
0
1
2
-
3
4
5
6
Time (hours)
Figure 7-5 Cumulative nitrite levels in flow only group (F) in presence of lmM S-
Methyl-L-thiocitrulline,
mM dexamethasone and
mM N'-Nitro-L-arginine
Methyl Ester (n=3). Significantly different than other groups *(p<0.01).
Northern blot analysis of mRNA expression shows no changes in eNOS gene
expression at 1 hour (data not shown). Expression of eNOS is, however, increased at
the 6 hour time point by factors of 2.08±0.25 in F tubes and of 2.11±0.21 in FC tubes
relative to control. There is no significant change in the compression only (C) group.
120
I
,
-J
eNOS
I
-1,11.1
sny
I-
t
GAPD
FC
z
E
O
F
C
Control
Static
Conrol
2.5
T
2
1.5
T
T
1
0
0CC,o 0.5
E
c
0
FC
F
C
Control
Static
Control
Figure 7-6 (a) Top: Northern blot analysis of mRNA expression of eNOS and
GAPD at 6 hours. (b) Bottom: Densitometric analysis of eNOS mRNA expression.
All data (n=3) were first normalized to GAPD then to Control group. FC and F
groups are significantly greater than other groups (p<0.05).
Experiments using different modes of EPC indicate that NO production and eNOS
mRNA expression responded differently to the time cycle of compression. There is no
121
significant difference in NO production during 0 to 1 hour. However, during 1 to 6
hours, the production rate with a cycle period of 60 sec is 2.2+0.33 nmol/(million
cells)/hour, while the rates with 30 sec and 120 sec periods are 1.7±0.2 & 0.77+0.18
nmol/(million cells)/hour, respectively (Figure 7-7). Northern blot analysis showed
that up-regulation of eNOS mRNA expression can be influenced by the different
cycles of EPC. Of the three modes of EPC tested, the group with pulsed flow every 30
s expressed the highest level of eNOS mRNA, followed by the group with a period of
60 s and 120 s (Figure 7-8).
3
D' 15
0
o
0
012
0o
2
-59
C
6
3
0
120 sec cycle
60 sec cycle
120 sec cycle
30 sec cycle
60 sec cycle
30 sec cycle
1-6 hour
0-1 hour
Figure 7-7 NO production rate between 0 and 1 hour (left), between 1 and 6 hour
(right) under different EPC cycles. Significantly different compared with the group
of 120 sec cycle. (n=3, *p<0.05).
122
I
cNOS
i=h·'.,41,\
pC~C-
GAPD
IL-
~
-
~~~~~~~
*
'
3.5
zCc
E
T
3
co
0
z
2.5
ao
cn
.0
V)
co
0
*
2
T*
1.5
1
E
C
a)
0
0.5
0
...
.
4s
Pulsed flow period
Cycle period
120s
4s
4s
____I___
60s
_
30s
__
_
Control
Figure 7-8 (a) Top: Northern blot analysis of mRNA expression of eNOS under
different EPC cycles at 6 hours. (b) Bottom: Densitometric analysis of eNOS
mRNA expression. (n=3, *p<0.05, **p<0.01).
Conclusion and Discussion
The VFS system was designed to study the influence of vessel collapse and
intermittent pulsed flow, two conditions associated with EPC, on endothelial function.
By this means, the cells are simultaneously
subjected to the patterns of wall shear
stress and vessel wall strain experienced in vivo during EPC. Using this system. we
investigated endothelial NO production under the influence of EPC. The important
123
observations of this study are that intermittent pulsed flow generated by EPC
stimulates NO release by cultured HUVEC and also up-regulates eNOS expression at
6 hr. We also demonstrated that the NOS enzyme responsible for EPC induced
generation of NO is the constitutively expressed eNOS isoform. Both NO production
and expression of eNOS mRNA are dependent on the time cycles of EPC.
Consistent with earlier studies [149], we found shear stress to be a potent stimulator of
NO release by endothelial cells. Compared to controls with a low, steady flow with no
collapse, we observed a much higher initial rate of NO release followed by a sustained
elevated release. Previous studies in endothelial cells [149] have shown that NO
increases biphasically, with an initial burst that is independent of shear stress (1.8-25
dyn/cm2) followed by a sustained, shear stress dependent phase. The signaling
mechanisms that lead to different shear stress- or flow-induced NO responses are not
yet identified. It has been proposed that endothelial cells respond to mechanical
stimuli which activate eNOS by at least two separate pathways, Ca2'/Calmodulin
dependent and Ca 2 /Calmodulin independent pathway [74, 150]. The Ca2+/Calmodulin
dependent pathway mediates the rapid, transient response to fluid shear stress
involving activation of nitric oxide synthase and ion transport. By contrast, the
Ca2*/Calmodulin independent pathway mediates a slower response involving the
sustained activation of NOS and changes in cell morphology and gene expression
[149]. It therefore appears that endothelial cell NO production rate exhibits two
distinct phases following the onset of flow, first a burst of release and then a relatively
slower rate of release under sustained flow.
With EPC, the flow is highly pulsatile with short periods of elevated flow alternating
with long rest periods of zero or low flow. It is therefore likely that both of the
pathways mentioned above are involved in the activation of eNOS, although the effect
of time-varying flow patterns cannot be discerned from the previous work. To
124
consider this effect, we measured NO release over a range of different patterns of high
flow and no flow in an attempt to identify conditions of maximum effect. Only those
patterns that can be produced by EPC were considered, so each consisted of a short
period of elevated flow followed by a much longer period of zero flow, corresponding
to the time for the vein to refill via the capillary bed. Our results indicate that the
highest level of eNOS mRNA expression was achieved in the group with pulsed flow
every 30 s, the group with pulsed flow every 60 s exhibited the highest level of NO
production during the 6 hr experiment. It is possible that because of the extended
resting period, there may be a relatively greater contribution from the Ca2+/Calmodulin
dependent pathway leading to enhanced activation of eNOS, which has a higher rate
of release of NO than Ca2+/Calmodulin independent pathway. In the 30 sec group,
although endothelial cells are exposed to shear stress for a longer total amount of time,
the Ca 2*/Calmodulin independent pathway may predominate, leading to a pattern of
behavior more closely aligned to that seen with constant shear stress. Regardless of
mechanism, these results showing variable NO production and eNOS expression under
various types of EPC suggest that different EPC cycles may influence the pattern and
amount of NO release and thereby have impact,
the capability of the method to
prevent DVT. Of the three patterns of flow we have tested, the 30 s cycle period
appears better suited for long-term use because it up-regu:dtes eNOS mRNA
expression whereas the 60 s cycle maximizes short-term NO release.
It is interesting to observe that even a very low level of flow (0.3dyn/cm
2
in C and
Control group) stimulates HUVEC to produce a much greater level of NO than static,
no flow conditions, indicating that endothelial cell production of NO exhibits an
exquisite sensitivity to flow. This is consistent with other studies showing that
endothelial cells produce NO under shear stress as low as 0.2dyn/cm2 [151]. How
endothelial cells sense such low shear is not clear. Experiments on endothelial cells
have shown that fluid flow altered the boundary layer concentration of ATP, resulting
in ATP-mediated increases in intracellular Ca2 + [152], which might be responsible for
125
the activation of NOS. Clinically, the results imply that venous blood flow, even at
low flow rate, offers better protection than no blood flow because it stimulates
moderate levels of NO production. However, it appears from our experiments that this
low level of shear is insufficient to up-regulate eNOS expression and might therefore
be a short term effect that could be quickly exhausted.
Intermittent pulsatile flow, on the other hand, not only stimulates NO release
throughout the experimental period but also up-regulates eNOS mRNA expression at 6
hrs. Since NO production increases immediately after the onset of flow, even prior to
eNOS mRNA up-regulation, it must be due to direct activation of eNOS enzyme
rather than increased protein. Although the importance of eNOS up-regulation
compared to NO production
is not fully understood,
it is believed that eNOS up-
regulation contributes to the long term vasomotor regulatory function of EC under
flow. For example, eNOS mRNA transcription levels increase in response to chronic
exercise [153] and acetylcholine-stimulated NO production is markedly enhanced in
large coronary arteries and micro-vessels after chronic exercise compared with
control. On the other hand, decreased eNOS expression has been implicated in
endothelial dysfunction in atherosclerosis [154, 155].
Vessel collapse, and the associated wall strain of up to 10%, alone seems to exert little
influence on NO production and eNOS expression. This is similar to Ziegler's study
[ 156], which showed that shear stress represents the major mechanical factor inducing
an increase in eNOS expression in BAECs. Also, the shear stress effect appears to
saturate at high levels of shear. In group FC, even though the peak shear (80 dyn/cm 2)
is considerably higher than in the flow only group (F, 40 dyn/cm 2) due to the reduction
in cross-section area during compression, NO production follows nearly an identical
trend.
126
L-NAA blocked flow-induced increas.es in nitrite indicating that these nitrite
measurements reflect increased NO production and that nitrite measured is not an
artifact of the assay system due to the presence of cell debris in conditioned media.
Specific inhibitors for NOS isoform I and II do not inhibit NO production from
cultures exposed to EPC, strongly suggesting that EPC induced NO production in
HUVEC was not due to the induction of iNOS or nNOS.
Subjecting EC to repeated EPC flow separated by resting period demonstrate the
kinetics of NO production under these conditions. The clinical correlation is that
whether this is beneficial to the patient. In hospitals, EPC is frequently removed from
the patient's extremitis
because of patient discomfort, bathing and the need to
transport the patient throughout the hospital. One recent study documented that
patients for whom intermittent pneumatic compression had been ordered spent less
than 50% of their time actually wearing these devices [157]. Restarting the EPC cycle
after a rest period potentially increase the temporary NO production rate as compared
with continuously application, but carry the risk of almost zero NO production during
the resting period.
Our cell culture results are consistent with previous studies in animal models [21],
which showed that pneumatic compression causes vasodilation in arteries and veins.
In those experiments, vasodilation reached maximum at 30 minutes after initiation of
compression and could be completely blocked by an inhibitor of NOS. In a different
study [158], in which intermittent pneumatic compression with different inflation rates
but the same peak pressure duration was applied to the legs of rats, the results showed
that faster inflation rates cause greater vasodilation. When the duration of peak
pressure was varied while holding the inflation rate constant, the degree of
vasodilation was unchanged. However, cuff inflation rate and peak-pressure duration
do not correlate directly with shear stress, blood flow rate and duration, which makes
127
it difficult to make a direct comparison to the present study. Direct flow measurements
are essential for a fundamental understanding of the link between hemodynamics and
NO release or up-regulation.
The observed characteristics of NO production under EPC in this work may have
clinical implications for using EPC in different ways in different situations. In its short
term, rapid release of NO follows EPC. In the longer term, EPC has the beneficial
effect of up-regulating several thrombo-resistance genes (eg, eNOS, tPA), thus
implying that at differing levels of recovery, ambulation, peri-operative trauma etc, the
utility and mode of EPC might be optimally and strategically varied. We also studied
the influence of different modes of EPC on NO release and eNOS mRNA expression,
which is helpful for improving the design of device. Combined with the in vitro cell
culture studies, future clinical studies on healthy volunteers and patients are essential
to establish the optimized protocol of EPC prophylaxis.
128
Chapter 8 Summary
Summary
In this thesis, we studied both the hemodynamic and biological effects of external
pneumatic compression for prophylaxis against deep vein thrombosis. We gained
further understanding of the role of endothelial cells in this process and defined the
hemodynamic conditions that cause these changes. We also explored various
thromboregulatory mechanisms that are under the influence of EPC.
EPC today is very different from when it was first introduced many years ago, and is
more effective, lightweight and comfortable. Better understanding of venous
hemodynamics and venous pathophysiology greatly improved the design of the
device. Parallel to this is our knowledge of blood coagulation and thrombosis. We now
know that coagulation requires complex interactions among the vascular endothelium,
platelet aggregation and clotting factors. Furthermore, there is new evidence for the
complex interaction between hemodynamic environment an-' endothelial function. In
this thesis, we explored the hypothesis that in additional to its hemodynamic
improvement, EPC decrease the risk of DVT by regulating endothelial
thromboresistant properties.
Early EPC devices were designed to apply alternating positive and negative pressure.
The rationale was to assist arterial inflow by applying intermittent suction to the
extremity based on a wrong assumption. Later it was found that suction was harmful,
it tended to produce hemorrhages, pain, ischemia and swelling. The suction was
subsequently abandoned, and devices were developed that produced only intermittent
compression [159]. The compression devices had various cycle times and rates of
inflation. Some devices produce relatively slow inflation rate because of the time
129
required for the pneumatic pump to fill. The slow inflation rate means that they can
not mimic the natural action of the physiological venous and lymphatic pumps.
Nevertheless, they have been reported to be as effective as low dose heparin [7]. They
may, however, be ineffective in preventing the more dangerous thrombi in the
proximal veins [160]. Another disadvantage of most of these devices is that since the
whole cuff is synchronously inflated, proximal vessels tend to be compressed first thus
trapping blood in the periphery and compromising venous return from the distal part
of the limb. To overcome these disadvantages, cuffs with multiple sequentially
inflating segments have been designed. Although these still do not mimic all aspects
of natural foot and calf pump action, they have been proven to be superior
hemodynamically. There have been conflicting reports of its efficacy in preventing
proximal deep venous thrombosis, nevertheless it may be more effective in this respect
than simple intermittent compression [7].
Results from our FEM simulation and cell culture studies suggest that generating a
shear stress above a certain threshold is important in order to upregulate several
endothelial thromboregulatory
genes. Therefore, a faster inflation rate is desired when
designing the device. Modes of compression also influence peak shear stress.
Asymmetric compression (Anterior-posterior or Collateral) that generates much higher
shear stress levels than symmetric compression (Circumferential) is therefore superior
in this aspect. For the vascular surface area that are subjected to shear stress above
threshold of 20 dyn/cm 2, asymmetric compression yield 55-60% while only 6-14% in
symmetric compression. In terms of emptying veins in the leg, rapid, graduated,
sequential compression
achieves this effect more completely than uniform
compression.
In Chapter 4, we developed a new in vitro cell culture system that can be used to
examine the effect of hemodynamic conditions on endothelial functions during EPC.
130
Blood flow, shear stress and vessel collapse conditions from FEM simulations in
Chapter 2 were taken into consideration in the experimental design. The system has
been proven to capable of simulating desired hemodynamic conditions and supporting
the culture of endothelial cells. Using this system, we studied the response of
endothelial cells to simulated hemodynamic conditions in terms of cell morphology,
the expression of fibrinolytic and vasomotor factors. We found that endothelial cells
respond to intermittent pulsatile flow but not vessel collapse at certain time and shear
stress level. Intermittent pulsatile flow a peak shears
2
40 dyn/cm 2 upregulates tPA
and eNOS mRNA expression at 6 hours. At the same time, EPC has little effect on
several prothrombotic genes including PAI-I and ET-1. This indicates that EPC can
affect endothelial thromboresistance properties which partially explain the
mechanisms of EPC for DV'r prophylaxis. The results also suggest the causes of
enhanced fibrinolytic activity observed clinically. It may be the elevation of tPA rather
than reduction in PAI-
that leads to the enhanced fibrinolytic activity.
We then extended our hypothesis to examine other thrombo-regulatory pathways that
are under the influences of hemodynamic forces. Using Affymetrix gene array
technology, a wide selection of thrombosis modulating genes was screened. We
determined that four important endothelial thrombo-regulatory
pathways are
influenced by EPC hemodynamics. Specifically, fibrinolysis, platelet and vasomotor
functions, tissue factor pathway and thrombomodulin/protein
C pathway are all
involved in the mechanisms of EPC. Fibrinolytic activity and vasomotor functions
have long been proposed as two of the mechanisms of EPC and recent study also
suggested the role of tissue factor pathway [28]. However, the role of
thrombomodulin, endothelial protein C receptor and u-PA receptor in EPC has not
been reported previously. We think further investigations, both in vitro and clinical,
are necessary in order to clarify whether these mechanisms are involved in the
mechanism of EPC.
131
In Chapter 7, we explored the kinetics of NO production under simulated EPC
hemodynamic conditions. Particularly, three different modes of EPC cycles were
tested against each other for their effects on NO production and eNOS upregulation.
We found that following the start of flow, endothelial cells produce a burst of NO
followed by sustained release at a lower rate. This acute increase in NO production
and chronic NO production under EPC may be one of the main effects of EPC in
treating venous ulcers, chronic venous hypertension and insufficiency. The antiplatelet effects of NO contribute to prophylaxis against venous thrombosis. Production
of NO goes to zero immediately when the flow stopped and returns to its initial
production rate after a short resting period. Of the three EPC cycles we have tested,
the ont with pulsed flow every 60 sec generates the highest level of NO while the one
with the pulsed flow every 30 sec upregulates eNOS mRNA the most at 6 hours. The
clinical impact of these variations in cycle time is unknown, but these results point the
way to future studies on healthy volunteers and patients to evaluate the optimized
protocols. Note, however, that it may not be possible to maintain the same levels of
peak shear stress with the shorter cycle due to incomplete venous filling.
We have come to understand that EPC exerts multiple effects on the circulation and
homeostasis. Hemodynamic enhancement comes first; EPC increases blood flow and
eliminates venous stasis. Increased blood flow dislodges small thrombi formed locally
and dilutes the accumulation of coagulation factors. High shear stress may also inhibit
platelet adhesion to the endothelial cell surface. These effects tend to decrease the
possibility of thrombogenesis. Hemodynamic effects act instantly upon the start of
flow and last as long as the flow is continued. This suggests pumping should ideally
start during surgery when stasis is inevitable and may lead to thrombosis. Biological
factors do not act instantaneously, but some can be very fast. NO and PGI2 are
released several minutes after flow starts and their action on vasomotor regulation and
132
inhibit platelet aggregation are also rapid. EPC also has long term beneficial effect by
upregulating several thromboresistance genes including tPA, u-PAR, eNOS, TFPI,
TM and EPCR.
Upregulation of thromboresistant genes has several beneficial effects. First. it tends to
improve thromboregulation in endothelial cells and generally improves endothelial
function as seen in exercise. Second, in contrast to the hemodynamic effects, gene
upregulation persists even after the flow is stopped. This implies that the device may
be removed temporarily if necessary provided the long-term effects have been
initiated. Finally, the increased production of anti-thrombotic molecules as a result of
gene upregulation may have systemic, rather than just local effects. Therefore, in case
when one of the lower extremities was unavailable for EPC, compression can be
applied to the available lower extremity alone. Although not as beneficial as direct
compression of the limb at risk, some studies have shown that remote expression does
decrease the risk of DVT [ 19]. Further understanding of biological effects of EPC,
both short term and long term, may provide guidance of different utility and mode at
differing clinical situations.
Future Directions
This thesis explored the hypothesis that EPC regulates endothelial cell
thromboresistant properties, thereby, contributing to its efficacy in preventing DVT.
The findings in this thesis have led to a new understanding of EPC mechanisms and
have numerous clinical implications. New questions have been raised some of which
remain unanswered but are important nevertheless to the design and clinical use of
EPC. In this section, we will examine our hypothesis and proposed future experiments.
133
First, only limited hemodynamic conditions and thromboregulatory mechanisms have
been studied in detail. The VFS is capable of simulating a wide range of hemodynamic
conditions, and gene array experiment revealed that various coagulation pathways are
involved in the prevention of DVT. Further experiments directed toward a more
thorough and systematic investigation of the profile of coagulation related genes as a
function of time are necessary in order to fully understand the mechanisms of EPC.
For this purpose, the development of a high throughput assay for mRNA expression is
essential. The Affymetrix gene array used in this study is a powerful method to study
thousands of genes at once. However, it is extremely expensive and not readily
accessible. Some recently developed methods are particularly promising for this
purpose. DNA microarrays which contain only selected genes that are interested such
as glass slide or nylon membrane nmicroarrayare better choice than Affymetrix gene
chip since they are available at a much lower costs. Another method to use is multi-
probe ribonuclease protection assay which has the distinct advantages of sensitivity
and the capacity to simultaneously quantify several mRNA species in a single sample
of total RNA. Finally, many of the observed changes in gene expression found in this
thesis should also be further investigated by measuring protein level or through the use
of functional assays since the change of mRNA level does not necessarily reflect the
function which is ultimately important to thromboregulation.
The hypotheses in this thesis focused on the role of endothelial function in
thromboregulation. We did not consider the entire process of thrombosis formation,
which is the result of interaction between endothelial cells, platelets and various
coagulation factors. The VFS could be used in subsequent studies of endothelial cellsplatelet interactions under EPC hemodynamic conditions. For example, platelets can
be introduced into the VFS, imaging and molecular biology techniques can be used to
study the adhesion of platelets to endothelial cell surface as well as expression of
various cell surface receptors.
134
Finally, in this thesis, we focused mainly or. endothelial fibrinolysis and vasomotor
function, and consider in much less detail the other thromboregulatory pathways, e.g.
tissue factor pathway and thrombomodulin/protein C pathway and do not address the
relative contribution of each pathway to venous homeostasis. Increasing evidence
points to the fact that endothelial cell derived procoagulant and anticoagulant activities
are differentially expressed throughout the vascular tree. For example, TM is more
important in maintaining the homeostatic balance of the lungs and the heart than it is
in the liver, where the fibrinolytic pathway is important in mediate blood fluidity in all
three vascular beds. Neither thrombomodulin nor fibrinolysis is essential in
maintaining balanced homeostasis in the blood vessels of the brain [161]. The question
is, which one is more important in the thromboregulation of the deep vein in the leg?
There is still insufficient data in the literature to answer this question and a detailed
discussion of this problem is beyond the scope of this thesis. However, we believe that
further understanding of this question will not only bring us closer to the clinical
interpretation of in vitro cell culture data, but also may suggest that the mode of
treatment by EPC might be designed to meet the .,pccificneeds of an individual
patient with a particular coagulation profiles.
135
F
Bibliography
1.
Cotran, R.S., et al., Robbins pathologic basis of disease. 6th / ed. 1999,
Philadelphia: Saunders. xv, 1425.
2.
NIH, Prevention of venous thrombosis and pulmonary embolism. Natl Inst
Health Consens Dev Conf Consens Statement, 1986. 6(2): p. 1-8.
3.
Sevitt, S. and N. Gallagher, Venous thrombosis and pulmonary embolism: a
clinico-pathological study in injured and burned patients. Br. J. Surg., 1968.
55: p. 481-505.
4.
Geerts, W.H., et al., A prospective study of venous thromboembolism after
major trauma. N Engl J Med, 1994. 331(24): p. 1601-6.
5.
Clagett, G.P., et al., Prevention of venous thromboembolism. Chest, 1992.
102(4 Suppl): p. 391S-407S.
6.
Virchow, R.L.K., Thrombose and Emolie. 1856, Frankfurt, Germany.
7.
Nicolaides, A.N., et al., Intermittent sequential pneumatic compression of the
legs and thromboembolism-deterrent
stockings in the prevention of
postoperative deep venous thrombosis. Surgery, 1983. 94(1): p. 21-5.
8.
Skillman, J.J., et al., Prevention of deep vein thrombosis in neurosurgical
patients: a controlled, randomized trial of external pneumatic compression
boots. Surgery, 1978. 83(3): p. 354-8.
9.
Hull, R.D., et al., Effectiveness of intermittent pneumatic leg compression for
preventing deep vein thrombosis after total hip replacement [see comments].
Jama, 1990.263(17): p. 2313-7.
10.
Francis, C.W., et al., Comparison of warfarin and external pneumatic
compression in prevention of venous thrombosis after total hip replacement.
Jama, 1992.267(21): p. 2911-5.
11.
Woolson, S.T., Intermittent pneumatic compression prophylaxis for proximal
deep venous thrombosis after total hip replacement. J Bone Joint Surg Am,
1996. 78(11): p. 1735-40.
137
12.
Salzman, E.W., et al., Effect of optimization of hemodynamics on fibrinolytic
activity and antithrombotic efficacy of external pneumatic calf compression.
Ann Surg, 1987. 206(5): p. 636-41.
13.
Allenby, F., et al., Effects of external pneumatic intermittent compression on
fibrinolysis in man. Lancet, 1973. 2(7843): p. 1412-4.
14.
Tarnay, T.J., et al., Pneumatic calf compression, fibrinolysis, and the
prevention of deep venous thrombosis. Surgery, 1980. 88(4): p. 489-96.
15.
Christen, Y., et al., Effects of intermittent pneumatic compression on venous
haemodynamics and fibrinolytic activity. Blood Coagul Fibrinolysis, 1997.
8(3): p. 185-90.
16.
Comerota, A.J., et al., The fibrinolytic effects of intermittent pneumatic
compression: mechanism of enhanced fibrinolysis. Ann Surg, 1997. 226(3): p.
306-13; discussion 313-4.
17.
Jacobs, D.G., et al., Hemodynamic and fibrinolytic consequences
of
intermittent pneumatic compression: preliminary results. J Trauma, 1996.
40(5): p. 710-16; discussion 716-7.
18.
Allsup, DJ., Use of the intermittent pneumatic compression device in venous
ulcer disease. J Vasc Nurs, 1994. 12(4): p. 106-11.
19.
McCulloch, J.M., et al., Intermittent pneumatic compression improves venous
ulcer healing. Adv Wound Care, 1994. 7(4): p. 22-4, 26.
20.
Smith, P.C., et al., Sequential gradient pneumatic compression enhances
venous ulcer healing: a randomized trial. Surgery, 1990. 108(5): p. 871-5.
21.
Liu, K., et al., Intermittent pneumatic compression of legs increases
microcirculation in distant skeletal muscle. J Orthop Res, 1999. 17(1): p. 8895.
22.
Moncada, S., R.M. Palmer, and E.A. Higgs, Nitric oxide: physiology,
pathophysiology, and pharmacology. Pharmacol Rev, 1991.43(2): p. 109-42.
23.
Stamler, J., et al., N-acetylcysteine potentiates platelet inhibition by
endothelium-derived relaxing factor. Circ Res, 1989. 65(3): p. 789-95.
138
24.
Gerlach, M., et al., Nitric oxide inhibits tissue factor synthesis, expression and
activity in human monocytes by prior formation of peroxynitrite [see
comments]. Intensive Care Med, 1998. 24(11): p. 1199-208.
25.
Yang, Y. and J. Loscalzo, Regulation of tissue factor expression in human
microvascular endothelial cells by nitric oxide. Circulation, 2000. 101(18): p.
2144-8.
26.
Labropoulos, N., et al., Optimising the performance of intermittent pneumatic
compression devices. Eur J Vasc Endovasc Surg, 2000. 19(6): p. 593-7.
27.
McVey, J.H., Tissue factor pathway. Baillieres Best Pract Res Clin Haematol,
1999. 12(3): p. 361-72.
28.
Chouhan, V.D., et al., Inhibition of tissue factor pathway during intermittent
pneumatic compression: A possible mechanism for antithrombotic effect.
Arterioscler Thromb Vasc Biol, 1999. 19(11): p. 2812-7.
29.
Kamm, R., et al., Optimisation of indices of external pneumatic compression
for prophylaxis against deep vein thrombosis: radionuclide gated imaging
studies. Cardiovasc Res, 1986. 20(8): p. 588-96.
30.
Janssen, H., C. Trevino, and D. Williams, Hemodynamic alterations in venous
blood flow produced by external pneumatic compression. J Cardiovasc Surg
(Torino), 1993. 34(5): p. 441-7.
31.
Kamm, R.D., Bioengineering studies of periodic external compression as
prophylaxis against deep vein thrombosis-part I: numerical studies. J Biomech
Eng, 1982.104(2): p. 87-95.
32.
Olson, D.A., R.D. Kamm, and A.H. Shapiro, Bioengineering studies of
periodic external compression as prophylaxis against deep vein thrombosispart II: experimental studies on a stimulated leg. J Biomech Eng, 1982. 104(2):
p. 96-104.
33.
Lanir, Y., Skin Mechanics, in Handbook of Bioengineering, R. Skalak and S.
Chien, Editors. 1987, McGraw-Hill: New York. p. 11.1-11.25.
139
34.
Yamada, H., Strength of Biological Materials, ed. F.G. Evans. 1970,
Baltimore: Williams & Wilkins.
35.
Fung, Y.C., Mechanical properties and active remodeling of blood vessels, in
Biomechanics: Mechanical properties of living tissues. 1993, Springer-Verlag:
New York. p. 321-391.
36.
Timoshenko, S. and J.M. Gere, Mechanics of materials. 1972, Monterey,
Calif.: Brooks/Cole Engineering Division. xiii, 552.
37.
Kamm, R.D. and A.H. Shapiro, Unsteady flow in collapsible tubes. Journal of
Fluid Mechanics, 1979.95: p. 1-78.
38.
Shapiro, A.H., Steady flow in collapsible tubes. J. Biomech. Engineering,
1977.99: p. 126-147.
39.
Sumpio, B.E., et al., Regulation of tPA in endothelial cells exposed to cyclic
strain: role of CRE, AP-2, and SSRE binding sites. Am J Physiol, 1997. 273(5
Pt 1): p. C1441-8.
40.
Wu, K.K. and P. Thiagarajan, Role of endothelium in thrombosis and
hemostasis. Annu Rev Med, 1996. 47: p. 3 15 -3 1 .
41.
Malek, A.M., S.L. Alper, and S. Izumo, Hemodynamic shear stress and its role
in atherosclerosis. Jama, 1999. 282(21): p. 2035-42.
42.
Cines, D.B., et al., Endothelial cells in physiology and in the pathophysiology
of vascular disorders. Blood, 1998. 91(10): p. 3527-61.
43.
Moncada, S. and J.R. Vane, Pharmacology and endogenous roles of
prostaglandin endoperoxides, thromboxane A2, and prostacyclin. Pharmacol
Rev, 1978. 30(3): p. 293-331.
44.
Furchgott, R.F. and J.V. Zawadzki, The obligatory role of endothelial cells in
the relaxation of arterial smooth muscle by acetylcholine. Nature, 1980.
288(5789): p. 373-6.
45.
Radomski, M.W., R.M. Palmer, and S. Moncada, The anti-aggregating
properties of vascular endothelium: interactions between prostacyclin and
nitric oxide. Br J Pharmacol, 1987. 92(3): p. 639-46.
140
46.
Marcus, A.J., et al., Inhibition of platelet function by an aspirin-insensitive
endothelial cell ADPase. Thromboregulation by endothelial cells. J Clin Invest,
1991.88(5): p. 1690-6.
47.
Dzau, V.J., Multiple pathways of angiotensin production in the blood vessel
wall: evidence, possibilities and hypotheses. J Hypertens, 1989. 7(12): p. 9336.
48.
Yanagisawa, M., et al., A novel potent vasoconstrictor peptide produced by
vascular endothelial cells. Nature, 1988. 332(6163): p. 411-5.
49.
Yoshimoto, S., et al., Effect of carbon dioxide and oxygen on endothelin
production by cultured porcine cerebral endothelial cells. Stroke, 1991. 22(3):
p. 378-83.
50.
Esmon, C.T., The roles of protein C and thrombomodulin in the regulation of
blood coagulation. J Biol Chem, 1989. 264(9): p. 4743-6.
51.
Conway, E.M., et al., An ultrastructural study of thrombomodulin endocytosis:
internalization occurs via clathrin-coated and non-coated pits. J Cell Physiol,
1992. 151(3): p. 604-12.
52.
Maruyama, I. and P.W. Majerus, The turnover of thrombin-thrombomodulin
complex in cultured human umbilical vein endothelial cells and A549 lung
cancer cells. Endocytosis and degradation of thrombin. J Biol Chem, 1 '85.
260(29): p. 15432-8.
53.
Tanaka, Y., et al., Heparan sulfate proteoglycan on leukemic cells is primarily
involved in integrin triggering and its mediated adhesion to endothelial cells. J
Exp Med, 1996. 184(5): p. 1987-97.
54.
Ihrcke, N.S. and J.L. Platt, Shedding of heparan sulfate proteoglycan by
stimulated endothelial cells: evidence for proteolysis of cell-surface molecules.
J Cell Physiol, 1996. 168(3): p. 625-37.
55.
Fukudome, K., et al., Activation mechanism of anticoagulant protein C in large
blood vessels involving the endothelial cell protein C receptor. J Exp Med,
1998. 187(7): p. 1029-35.
141
56.
Ye, X., et al., The endothelial cell protein C receptor (EPCR) functions as a
primary receptor for protein C activation on endothelial cells in arteries, veins,
and capillaries. Biochem Biophys Res Commun, 1999. 259(3): p. 671-7.
57.
Patrassi, G.M., et al., Venous thrombosis and tissue plasrminogen activator
release deficiency: a family study. Blood Coagul Fibrinolysis, 1991. 2(2): p.
231-5.
58.
Segel, G.B. and C.A. Francis, Anticoagulant proteins in childhood venous and
arterial thrombosis: a review. Blood Cells Mol Dis, 2000. 26(5): p. 540-60.
59.
Barnathan, E.S., et al., Tissue-type plasminogen activator binding to human
endothelial cells. Evidence for two distinct binding sites. J Biol Chem, 1988.
263(16): p. 7792-9.
60.
Hajjar, K.A. and N.M. Hamel, Identification and characterization of human
endothelial cell membrane binding sites for tissue plasminogen activator and
urokinase. J Biol Chem, 1990. 265(5): p. 2908-16.
61.
Hajjar, K.A., et al., Binding of tissue plasminogen activator to cultured human
endothelial cells. J Clin Invest, 1987. 80(6): p. 1712-9.
62.
Cesarman, G.M., C.A. Guevara, and K.A. Hajjar, An endothelial cell receptor
for plasminogen/tissue plasminogen activator (t-PA). II. Annexin II-mediated
enhancement of t-PA-dependent plasminogen activation. J Biol Chemn,1994.
269(33): p. 2 1 19 8 -2 0 3 .
63.
Hajjar, K.A., A.T. Jacovina, and J. Chacko, An endothelial cell receptor for
plasminogen/tissue plasminogen activator. I. Identity with annexin II. J Biol
Chem, 1994. 269(33): p. 21191-7.
64.
Carmeliet, P., et al., Physiological consequences of loss of plasminogen
activator gene function in mice. Nature, 1994. 368(6470): p. 419-24.
65.
Yamamoto, K. and D.J. Loskutoff, Fibrin deposition in tissues from endotoxintreated mice correlates with decreases in the expression of urokinase-type but
not tissue-type plasminogen activator. J Clin Invest, 1996.97(11): p. 2440-5 i.
142
66.
Barnathan, E.S., et al., Interaction of single-chain urokinase-type plasminogen
activator with human endothelial cells. J Biol Chem, 1990. 265(5): p. 2865-72.
67.
Higazi, A.A., et al., Single-chain urokinase-type plasminogen activator bound
to its receptor is relatively resistant to plasminogen activator inhibitor type 1.
Blood, 1996.87(9): p. 3545-9.
68.
Sadler, J.E., Biochemistry and genetics of von Willebrand factor. Annu Rev
Biochem, 1998. 67: p. 395-424.
69.
Lip, G.Y. and A. Blann, von Willebrand factor: a marker of endothelial
dysfunction in vascular disorders? Cardiovasc Res, 1997. 34(2): p. 255-65.
70.
Wahlberg, T.B., M. Blomback, and I. Overmark, Blood coagulation studies in
45 patients with ischemic cerebrovascular disease and 44 patients with venous
thromboembolic disease. Acta Med Scand, 1980. 207(5): p. 385-90.
71.
Dewey, C.F., et al., The dynamic response of vascular endothelial cells to fluid
shear stress. J Biomech Eng, 1981. 103(3): p. 177-85.
72.
Malek, A.M. and S. Izumo, Molecular aspects of signal transduction of shear
stress in the endothelial cell. J Hypertens, 1994. 12(9): p. 989-99.
73.
Kaiser, D., M.A. Freyberg, and P. Friedl, Lack of hemodynamic forces triggers
apoptosis in vascular endothelial cells. Biochem Biophys Res Commun, 1997.
231(3): p. 586-90.
74.
Fleming, I., J. Bauersachs, and R. Busse, Calcium-dependent and calciumindependent activation of the endothelial NO synthase. Journal of Vascular
Research, 1997.34(3): p. 165-74.
75.
Uematsu, M., et al., Regulation of endothelial cell nitric oxide synthase mRNA
expression by shear stress. Am J Physiol, 1995. 269(6 Pt 1): p. C1371-8.
76.
Ranjan, V., Z. Xiao, and S.L. Diamond, Constitutive NOS expression in
cultured endothelial cells is elevated by fluid shear stress. Am J Physiol, 1995.
269(2 Pt 2): p. H550-5.
143
77.
Okahara, K., B. Sun, and J. Kambayashi, Upregulation of prostacyclin
synthesis-related gene expression by shear stress in vascular endothelial cells.
Arterioscler Thromb Vasc Biol, 1998. 18(12): p. 1922-6.
78.
Topper, J.N., et al., Identification of vascular endothelial genes differentially
responsive to fluid mechanical stimuli: cyclooxygenase-2,
manganese
superoxide dismutase, and endothelial cell nitric oxide synthase are selectively
up-regulated by steady laminar shear stress. Proc Natl Acad Sci U S A, 1996.
93(19): p. 10417-22.
79.
Okahara, K., et al., Shear stress induces expression of CNP gene in human
endothelial cells. FEBS Lett, 1995. 373(2): p. 108-10.
80.
Chun, T.H., et al., Shear stress augments expression of C-type natriuretic
peptide and adrenomedullin. Hypertension, 1997. 29(6): p. 1296-302.
81.
Ohno, M., et al., Fluid shear stress induces endothelial transforming growth
factor beta- 1 transcription and production. Modulation by potassium channel
blockade. J Clin Invest, 1995. 95(3): p. 1363-9.
82.
Diamond, S.L., et al., Tissue plasminogen activator messenger RNA levels
increase in cultured human endothelial cells exposed to laminar shear stress. J
Cell Physiol, 1990. 143(2): p. 364-71.
83.
Diamond, S.L., S.G. Eskin, and L.V. Mclntire, Fluid flow stimulates tissue
plasminogen activator secretion by cultured human endothelial cells. Science,
1989.243(4897): p. 1483-5.
84.
Kawai, Y., et al., Hemodynamic forces modulate the effects of cytokines on
fibrinolytic activity of endothelial cells. Blood, 1996. 87(6): p. 2314-21.
85.
Inoue, N., et al., Shear stress modulates expression of Cu/Zn superoxide
dismutase in human aortic endothelial cells. Circ Res, 1996.79(1): p. 32-7.
86.
De Keulenaer, G.W., et al., Oscillatory and steady laminar shear stress
differentially affect human endothelial redox state: role of a superoxideproducing NADH oxidase. Circ Res, 1998.82(10): p. 1094-101.
144
87.
Sharefkin, J.B., et al., Fluid flow decreases preproendothelin
mRNA levels and
suppresses endothelin-l peptide release in cultured human endothelial cells. J
Vasc Surg, 1991. 14(1): p. 1-9.
88.
Masatsugu, K., et al., Physiologic shear stress
suppresses endothelin-
converting enzyme-I expression in vascular endothelial cells. J Cardiovasc
Pharmacol, 1998. 31(Suppl 1): p. S42-5.
89.
Resnick, N., et al., Platelet-derived growth factor B chain promoter contains a
cis-acting fluid shear-stress-responsive element. Proc Natl Acad Sci U S A,
1993. 90(16): p. 7908.
90.
Kosaki, K., et al., Fluid shear stress increases the production of granulocytemacrophage colony-stimulating
factor by endothelial
cells via mRNA
stabilization. Circ Res, 1998. 82(7): p. 794-802.
91.
Shyy, Y.J., et al., Fluid shear stress induces a biphasic response of human
monocyte chemotactic protein 1 gene expression in vascular endothelium.
Proc Natl Acad Sci U S A, 1994. 91(1 1): p. 4678-82.
92.
Ando, J., et al., Shear stress inhibits adhesion of cultured mouse endothelial
cells to lymphocytes by downregulating VCAM-1 expression. Am J Physiol,
1994. 267(3 Pt 1): p. C679-87.
93.
Korenaga, R., et al., Negative transcriptional regulation of the VCAM-1 gene
by fluid shear stress in murine endothelial cells. Am J Physiol, 1997. 273(5 Pt
1): p. C1506-15.
94.
Malek,
A. and S. Izumo, Physiological
fluid
shear stress causes
downregulation of endothelin-l mRNA in bovine aortic endothelium. Am J
Physiol, 1992. 263(2 Pt 1): p. C389-96.
95.
Rieder, MJ., et al., Suppression of angiotensin-converting enzyme expression
and activity by shear stress. Circ Res, 1997. 80(3): p. 312-9.
96.
Noris, M., et al., Nitric oxide synthesis by cultured endothelial cells is
modulated by flow conditions. Circ Res, 1995.76(4): p. 536-43.
145
97.
Malek, A.M., et al., Endothelial expression of thrombomodulin is reversibly
regulated by fluid shear stress. Circ Res, 1994. 74(5): p. 852-60.
98.
Iba, T. and B.E. Sumpio, Morphological response of human endothelial cells
subjected to cyclic strain in vitro. Microvutsc Res, 1991. 42(3): p. 245-54.
99.
Iba, T. and B.E. Sumpio, Tissue plasminogen activator expression in
endothelial cells exposed to cyclic strain in vitro. Cell Transplant (B02), 1992.
1(1): p. 43-50.
100.
Cheng, J.J., et al., Cyclic strain-induced plasminogen activator inhibitor-i
(PAI-i) release from endothelial cells involves reactive oxygen species.
Biochem Biophys Res Commun, 1996. 225(1): p. 100-5.
101.
Awolesi, M.A., W.C. Sessa, and B.E. Sumpio, Cyclic strain upregulates nitric
oxide synthase in cultured bovine aortic endothelial cells. J Clin Invest, 1995.
96(3): p. 1449-54.
102.
Cheng, JJ., et al., Cyclic strain enhances adhesion of monocytes to endothelial
cells by increasing intercellular adhesion molecule-i expression. Hypertension,
1996.28(3): p. 386-91.
103.
Sumpio, B.E., et al., Regulation of PDGF-B in endothelial cells exposed to
cyclic strain. Arterioscler Thromb Vasc Biol, 1998. 18(3): p. 349-55.
104.
Silverman, M.D., et al., Tissue factor expression is differentially modulated by
cyclic mechanical strain in various human endothelial cells. Blood Coagul
Fibrinolysis, 1996. 7(3): p. 281-8.
105.
Wung, B.S., et al., Cyclic strain-induced monocyte chemotactic protein-l gene
expression in endothelial cells involves reactive oxygen species activation of
activator protein 1. Circ Res, 1997. 81(1): p. 1-7.
106.
Yun, J.K., J.M. Anderson, and N.P. Ziats, Cyclic-strain-induced endothelial
cell expression of adhesion molecules and their roles in monocyte-endothelial
interaction. J Biomed Mater Res, 1999. 44(1): p. 87-97.
146
107.
Benbrahim, A., et al., Characteristics of vascular wall cells subjected to
dynamic cyclic strain and fluid shear conditions in vitro. J Surg Res, 1996.
65(2): p. 119-27.
108.
Benbrahim, A., et al., A compliant tubular device to study the influences of
wall strain and fluid shear stress on cells of the vascular wall. J Vasc Surg,
1994. 20(2): p. 84-94.
109.
Altman, P.L. and D.D. Katz, Respiration
and circulation.
Biological
handbooks. 1971, Bethesda, Md.,: Federation of American Societies for
Experimental Biology. xxv, 930.
110.
Milnor, W.R., Hemodynamics. 2nd ed. 1989, Baltimore: Williams & Wilkins.
xii, 419.
111.
Jaffe, E.A., et al., Culture of human endothelial cells derived from umbilical
veins. Identification by morphologic and immunologic criteria. J Clin Invest,
1973. 52(11): p. 2745-56.
112.
O'Brien, T.E., M. Woodford, and M.H. Irving, The effect of intermittent
compression of the calf on the fibrinolytic responses in the blood during a
surgical operation. Surg Gynecol Obstet, 1979. 149(3): p. 380-4.
113.
Grabowski, E.F., et al., Shear stress decreases endothelial cell tissue factor
activity by augmenting secretion of tissue factor pathway inhibitor.
Arterioscler Thromb Vasc Biol, 2001. 21(1): p. 157-62.
114.
Resnick, N., et al., Endothelial gene regulation by laminar shear stress. Adv
Exp Med Biol, 1997. 430: p. 155-64.
115.
Malek, A.M., et al., Fluid shear stress differentially modulates expression of
genes encoding basic fibroblast growth factor and platelet-derived growth
factor B chain in vascular endothelium. J Clin Invest, 1993. 92(4): p. 2013-21.
116.
Reidy, M.A. and D.E. Bowyer, Scanning electron microscopy of arteries. The
morphology of aortic endothelium in haemodynamically stressed areas
associated with branches Atherosclerosis, 1977. 26(2): p. 181-94.
147
117.
Levesque, M.J., et al., Correlation of endothelial cell shape and wall shear
stress in a stenosed dog aorta. Arteriosclerosis,
118.
1986. 6(2): p. 220-9.
Kooistra, T., et al., Regulation of endothelial cell t-PA synthesis and release.
Int J Hematol, 1994. 59(4): p. 233-55.
119.
Knight, M.T. and R. Dawson, Effect of intermittent compression of the arms
on deep venous thrombosis in the legs. Lancet, 1976. 2(7998): p. 1265-8.
120.
Bourey, R.E. and S.A. Santoro, Interactions of exercise, coagulation, platelets,
and fibrinolysis--a brief review. Med Sci Sports Exerc, 1988. 20(5): p. 439-46.
121.
Szymanski, L.M. and R.R. Pate, Fibrinolytic responses to moderate intensity
exercise. Comparison of physically active and inactive men. Arterioscler
Thromb, 1994. 14(11): p. 1746-50.
122.
Munkvad, S., Fibrinolysis in patients with acute ischaemic heart disease. With
particular reference to systemic effects of tissue-type plasminogen activator
treatment on fibrinolysis, coagulation and complement pathways. Dan Med
Bull, 1993. 40(4): p. 383-408.
123.
Shackford, S.R., et al., Venous thromboembolism in patients with major
trauma. Am J Surg, 1990. 159(4): p. 365-9.
124.
Lipshutz, RJ., et al., High density synthetic oligonucleotide arrays. Nat Genet,
1999.21(1 Suppl): p. 20-4.
125.
Lockhart, DJ., et al., Expression monitoring by hybridization to high-density
oligonucleotide arrays. Nat Biotechnol, 1996. 14(13): p. 1675-80.
126.
Wu, K.K., Endothelial
prostaglandin
and nitric oxide synthesis in
atherogenesis and thrombosis. J Formos Med Assoc, 1996. 95(9): p. 661-6.
127.
Gomazkov, O.A., Endothelin-converting
enzyme: its functional aspect.
Biochemistry (Mosc), 1998. 63(2): p. 125-32.
128.
Ware, J.A. and D.D. Heistad, Seminars in medicine of the Beth Israel Hospital,
Boston. Platelet- endothelium interactions. N Engl J Med, 1993. 328(9): p.
628-35.
148
129.
Stuehr, DJ., Mammalian nitric oxide synthases. Biochim Biophys Acta, 1999.
1411(2-3): p. 217-30.
130.
Griffith, O.W. and D.J. Stuehr, Nitric oxide synthases: properties and catalytic
mechanism. Annu Rev Physiol, 1995. 57: p. 707-36.
131.
Forstermann, U., et al., Nitric oxide synthase isozymes. Characterization,
purification, molecular cloning, and functions. Hypertension, 1994. 23(6 Pt 2):
p. 1121-31.
132.
Sessa, W.C., The nitric oxide synthase family of proteins. J Vasc Res, 1994.
31(3): p. 131-43.
133.
Michel, J.B., et al., Reciprocal regulation of endothelial nitric-oxide synthase
by Ca2+- calmodulin and caveolin. J Biol Chem, 1997.272(25): p. 15583-6.
134.
Dimmeler, S., et al., Activation of nitric oxide synthase in endothelial cells by
Akt- dependent phosphorylation. Nature, 1999. 399(6736): p. 601-5.
135.
Fulton, D., et al., Regulation of endothelium-derived nitric oxide production by
the protein kinase Akt. Nature, 1999. 399(6736): p. 597-601.
136.
Traub, 0. and B.C. Berk, Laminar shear stress: mechanisms by which
endothelial cells transduce
an atheroprotective force. Arteriosclerosis,
Thrombosis & Vascular Biology, 1998. 18(5): p. 677-85.
137.
Wilcox, J.N., et al., Expression of multiple isoforms of nitric oxide synthase in
normal and atherosclerotic vessels. Arterioscler Thromb Vasc Biol, 1997.
17(11): p. 2479-88.
138.
Schwarz, P.M., H. Kleinert, and U. Forstermann, Potential functional
significance of brain-type and muscle-type nitric oxide synthase I expressed in
adventitia and media of rat aorta. Arterioscler Thromb Vasc Biol, 1999. 19(11):
p. 2584-90.
139.
Umans, J.G. and R. Levi, Nitric oxide in the regulation of blood flow and
arterial pressure. Annu Rev Physiol, 1995. 57: p. 771-90.
140.
Sarkar, R., et al., Nitric oxide reversibly inhibits the migration of cultured
vascular smooth muscle cells. Circ Res, 1996. 78(2): p. 225-30.
149
141.
De Caterina, R., et al., Nitric oxide decreases cytokine-induced endothelial
activation. Nitric oxide selectively reduces endothelial expression of adhesion
molecules and proinflammatory cytokines. J Clin Invest, 1995. 96(1): p. 60-8.
142.
Tsao, P.S., et al., Nitric oxide regulates monocyte chemotactic protein-1.
Circulation, 1997. 96(3): p. 934-40.
143.
Hogg, N., et al., Inhibition of low-density lipoprotein oxidation by nitric oxide.
Potential role in atherogenesis. FEBS Lett, 1993. 334(2): p. 170-4.
144.
Ignarro, L.J., et al., Oxidation of nitric oxide in aqueous solution to nitrite but
not nitrate: comparison with enzymatically formed nitric oxide from Larginine. Proc Natl Acad Sci U S A, 1993. 90(17): p. 8103-7.
145.
Misko, T.P., et al., A fluorometric assay for the measurement of nitrite in
biological samples. Anal Biochem, 1993. 214(1): p. 11-6.
146.
Furfine, E.S., et al., Potent and selective inhibition of human nitric oxide
synthases. Selective inhibition of neuronal nitric oxide synthase by S-methylL- thiocitrulline and S-ethyl-L-thiocitrulline. J Biol Chem, 1994. 269(43): p.
26677-83.
147.
Kimura, A., et al., Dexamethasone on inducible nitric oxide synthase and
nitrite/nitrate production in myocardial infarction. Proc Soc Exp Biol Med,
1998. 219(2): p. 138-43.
148.
Kubes, P., M. Suzuki, and D.N. Granger, Nitric oxide: an endogenous
modulator of leukocyte adhesion. Proc Natl Acad Sci U S A, 1991. 88(11): p.
4651-5.
149.
Kuchan, M.J. and J.A. Frangos, Role of calcium and calmodulin in flowinduced nitric oxide production in endothelial cells. American Journal of
Physiology, 1994. 266(3 Pt 1): p. C628-36.
150.
Berk, B.C., et al., Protein kinases as mediators of fluid shear stress stimulated
signal transduction in endothelial cells: a hypothesis for calcium-dependent
and calcium-independent events activated by flow. Journal of Biomechanics,
1995. 28(12): p. 1439-50.
150
151.
Kanai, AJ., et al., Shear stress induces ATP-independent transient nitric oxide
release from vascular endothelial cells, measured directly with a porphyrinic
microsensor. Circ Res, 1995. 77(2): p. 284-93.
152.
Nollert, M.U., S.L. Diamond, and L.V. McIntire, Hydrodynamic shear stress
and mass transport modulation of endothelial cell metabolism. Biotech.
Bioeng., 1991.38: p. 588-602.
153.
Sessa, W.C., et al., Chronic exercise in dogs increases coronary vascular nitric
oxide production and endothelial cell nitric oxide synthase gene expression.
Circ Res, 1994. 74(2): p. 3'
154.
-53.
Gimbrone, M.A., et al., Endothelial dysfunction, hemodynamic forces, and
atherogenesis. Ann N YAcad Sci, 2000. 902: p. 230-9; discussion 239-40.
155.
Goligorsky, M.S., et al., A pivotal role of nitric oxide in endothelial cell
dysfunction. Acta Physiol Scand, 2000. 168(1): p. 33-40.
156.
Ziegler, T., et al., Influence of oscillatory and unidirectional flow environments
on the expression of endothelin and nitric oxide synthase in cultured
endothelial cells. Arterioscler Thromb Vasc Biol, 1998. 18(5): p. 686-92.
157.
Comerota, A.J., M.L. Katz, and J.V. White, Why does prophylaxis with
external pneumatic compression for deep vein thrombosis fail? Am J Surg,
1992. 164(3): p. 265-8.
158.
Liu, K., et al., Influences of inflation rate and duration on vasodilatory effect
by intermittent pneumatic compression in distant skeletal muscle. J Orthop
Res, 1999. 17(3): p. 415-20.
159.
Gardner, A.M.N. and R.H. Fox, The return of blood to the heart. 1993,
London: John Libbey & Co.
160.
Gallus, A., K. Raman, and T. Darby, Venous thrombosis after elective hip
replacement--the influence of preventive intermittent calf compression and of
surgical technique. Br J Surg, 1983. 70(1): p. 17-9.
161.
Rosenberg, R.D. and W.C. Aird, Vascular-bed--specific hemostasis and
hypercoagulable states. N Engl J Med, 1999. 340(20): p. 1555-64.
151
THESIS PROCESSING SLIP
FIXED FIELD:
ill.
name
-
index
O COPIES: (rchive
Lindgren
biblio
Aero
Dewey
Barker
Hum
Music
Rotch
Sciencee
Sche-Ploug
.
TITLE VARIES:
rL ·
NAME VARIES:
,[-
IMPRINT:
(COPYRIGHT)
P COLLATION:
I-
I ADD: DEGREE:
--
I ADD: DEGREE:
! DEPT.:
-
-
*, DEPT.:
SUPERVISORS:
-
NOTES:
cat'r:
13DPT:
"'
, YEAR-
-
date:
page:
_
5
oo 1
*NAME:
T)T.
--- ------
,DEGREE--- · ·
C(tc,
ql-) ,,
b
l
1
I
-