Regulation of the mTORC1 growth pathway by amino aci ds
by
MASSACHUSETTS INSTITUTE
OF rECHNOLOLGY
Zhi-Yang Tsun
B.S. Bioengineering, Molecular Biology
University of California, San Diego (2004)
MAY 2 7 2015
LIBRARIES
Submitted to the Department of Biology
in Partial Fulfillment of the Requirements for the Degree of
Doctor of Philosophy
at the
Massachusetts Institute of Technology
June 2015
@2015 Zhi-Yang Tsun. All rights reserved.
The author hereby grants to MIT permission to reproduce
and to distribute publicly paper and electronic
copies of this thesis document in whole or in part
in any medium now known or hereafter created.
Signature of Author.....................................
Signature redacted
Departmqntof Biology
Marob 14, 2015
C e rtifie d b y ................................................
Signature redacted
David M. Sabatini
Professor of Biology
JI]hesis Supervisor
A cce pted by ............................................
Signature redacted
Midhael T. Hemann
Professor of Biology
Chairman, Committee for Graduate Students
1
2
Regulation of the mTORC1 growth pathway by amino acids
by
Zhi-Yang Tsun
Submitted to the Department of Biology on May 22, 2015 in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy at the Massachusetts Institute of
Technology
Abstract:
The mTORC1 kinase is a master growth regulator that responds to numerous
environmental cues, including amino acids, to regulate many processes, such as protein,
lipid, and nucleotide synthesis, as well as autophagy. Given that mTORC1 regulates a
multitude of processes, it is not surprising that the pathway it anchors is deregulated in
various common diseases, including cancer.
The Rag GTPases interact with mTORC1 and signal amino acid sufficiency by
promoting the translocation of mTORC1 to the lysosomal surface, its site of activation.
The Rags are unusual GTPases in that they function as obligate heterodimers, which
consist of RagA or B bound to RagC or D. We show that RagC/D is a key regulator of
the interaction of mTORC1 with the Rag heterodimer and that, unexpectedly, RagC/D
must be GDP-bound for the interaction to occur. We identify FLCN and its binding
partners, FNIP1/2, as Rag-interacting proteins with GTPase activating activity for
RagC/D, but not RagA/B.
Given that many proteins known to signal amino acid sufficiency to mTORC1,
including the Rag GTPases, localize to the lysosome and that intralysosomal amino acid
accumulation is necessary for mTORC1 activation, we began our search for potential
direct amino acid sensors at the lysosomal membrane. We identify SLC38A9, an
uncharacterized protein with homology to amino acid transporters, as a lysosomal
transmembrane protein. SLC38A9 forms a supercomplex with Ragulator, the Rag
GTPases and the v-ATPase and is necessary for mTORC1 activation by amino acids,
particularly arginine. Overexpression of the full-length protein or just its Ragulatorbinding domain makes mTORC1 signaling insensitive to amino acid starvation but does
not affect its dependence on Rag activity. SLC38A9 reconstituted in proteoliposomes
transports arginine, an abundant amino acid in the lysosome and necessary for
mTORC1 pathway activity. These results place SLC38A9 between amino acids and the
Rag GTPases and are consistent with the notion that amino acids are sensed at the
lysosome. Thus, SLC38A9 is an excellent candidate for being an amino acid sensor
upstream of mTORC1.
Thesis supervisor: David M. Sabatini
Title: Member, Whitehead Institute; Professor of Biology, MIT
3
Acknowledgements:
Undertaking PhD training in David Sabatini's lab has been the most
transformative years of my life. What inspires me most about David is that he leads by
example. He engenders incredible work ethic in his trainees because he works harder
than anyone in the lab. David has a piercing clarity of thought that instantly scrutinizes
new data and develops consistent models, that is matched by his scientific rigor and
fearlessness. David pursues the highest caliber of quality not just in experiments but
also in data figures, writing, and in giving seminars. Attempting to emulate these
qualities has pushed me to grow in ways I never expected. Perhaps the most valuable
lesson that I've learned working with David is to pursue important problems, and thanks
to my time in his lab, I finally have the confidence to tackle important but difficult
problems.
I would like to thank the members of my thesis committee, Steve Bell, and Bob
Sauer, for the continued guidance and support throughout my journey. I am also grateful
to Brendan Manning and Hidde Ploegh who are also part of my thesis evaluation
committee.
It is rare to find a lab with such talented and motivated people and yet have an
environment that is equally exceptional in collegiality. Many thanks to Rich Possemato
who mentored me during my rotation with inexhaustible patience, and Kris Wood, Yoav
Shaul, Shomit Sengupta, Peggy Hsu, Doug Wheeler, Yasemin Sancak, Maki Saitoh for
making the transition from undergraduate to graduate lab such a welcoming one. I also
appreciate the incisive conversations with Tim Peterson, who started the work on BirtHogg-Dube syndrome, and whose DEPTOR paper helped convinced me to pursue my
rotation here.
Liron Bar-Peled and Lynne Chantranupong were wonderful bay-mates and
tolerated my relentless questions when I first joined the lab. Lynne-mama, as we
affectionately call her, has been an amazing bench-mate throughout my time here-so
thoughtful and showed me what 'being industrious' means. Although Rachel Wolfson
recently joined the bay, I have really appreciated her incisive feedback, vigorous
discussions, and unconditional eagerness to help. I am grateful to Shuyu Wang, with
whom I had the pleasure of sitting next to and work closely with, and who pushed me to
think deeper about science and life. And many thanks to Kuang Shen who has taught
me everything I know about experimental biochemistry. It has been a pleasure to work
with everyone who has spent time in our bay, Tony Kang, Naama Kanarek, Bobby
Saxton, and Jose Orozco. The way everyone so generously came to help during the two
instances when we had to race to submit our manuscripts is a testament to how the lab
really has become a family.
Many people in the lab have made this an inspiring and rigorous place to train:
Walter Chen for his constant encouragement and companionship as we joined the lab
together; Larry Schweitzer for incisive feedback and help with my NRSA fellowship
application; Carson Thoreen, Omer Yilmaz, Pekka Katajisto and Kris Wood for giving
inspiring advice; Roberto Zoncu, who taught me how to work with microscopes and
isolate lysosomes, and whose exemplar seminars have been inspirational; Mike Pacold,
who has been a wonderful source of necessary and unnecessary information, as well as
medical advice; Kivanc Birsoy, Bill Comb, and Do Kim for thoughtful discussions and
advice; Kathleen Ottina, who makes it so effortless to do our best science in lab, and for
sharing life advice; Amanda Hutchins, Sam Murphy, and Kevin Krupczak who ensure the
lab runs smoothly; Edie Valeri, who always brightens the day and has been so reliable
and responsive for everything non-science in the lab; Greg Wyant and Monther
Remaileh for a seamless transition as I wrapped up in lab. I have been most fortunate to
4
have the opportunity to work with very talented students, Choah Kim, Tony Jones,
Elizabeth Yuan, and Alice Chen, who have certainly taught me more than I could teach
them.
I especially want to thank Tim Wang who has become a dear friend and scientific
colleague. I am grateful that we went through scientific races together, and what can
only be described as a scientific coming-of-age, together. His intellectual and scientific
prowess inspires me and his incisive feedback pushes me to grow.
I would also like to thank Mounir Koussa, who has been my partner in crime as
we embarked on this science and life journey 3 years ago. His companionship has kept
me sane while also in many ways encouraged madness. He has been unnecessarily
generous with his time in reviewing all my practice talks, grant applications, and
manuscript drafts, and I am grateful for how he has shaped my personal and scientific
development.
I am very fortunate to have friends who have not only supported me but continue
to inspire me: Nikhil Bhatla, Allen Cheng, Sasha and Masha Rayshubskiy
Anna Chambers, Jason Yamada-Hanff, Pallav Kosuri, and Dr. Sheila Nutt.
I would like to thank my parents, Maung-win Maung and Sau-Man Yang, and
sister Zhi-Fang Tsun, who continue to support me unconditionally and made possible all
the opportunities I am fortunate to have. And Charlie and Veronica Plovanich who have
been my family here on the east coast.
And of course my wife, Molly Plovanich, who not only supports and inspires me
through every step of our journey, but also provided key scientific guidance during the
most critical time. She is my better half who grounds me in life.
5
Table of Contents
A b stra ct ....................................................................................................
A cknow ledgem ents .....................................................................................
. .3
4
Chapter 1: Introduction
I. Intro d u ctio n ..............................................................................................
. .8
II. T he m T O R P athw ay...................................................................................
8
A. Rapamycin: a discovery tool and therapeutic........................................ 8
B. mTORC1 and mTORC2.................................................................... 9
C. Amino acid signaling machinery....................................................... 11
D. Downstream effectors of mTORC1.....................................................12
Ill. mTOR signaling in cancer..........................................................................13
A . U pstream of m T O R C 1........................................................................13
B. Birt-Hogg-Dub6 Syndrome...................................................................15
C. Outputs of mTORC1 Altered in Cancer.............................................. 16
D. Rapalogues in cancer therapy...........................................................17
IV . A m ino acid transport............................................................................... 19
A. History: digestion, protein absorption, and AA uptake in tissues.........19
B. SLC38 AA transporter family.............................................................21
C. Arginine transport at the plasma and lysosomal membranes.................. 23
V. Preface for work presented in this thesis.......................................................25
Re fe re n ce s ...............................................................................................
. ..2 8
Chapter 2: The Folliculin tumor suppressor is a GAP for RagC/D GTPases that
signal amino acid levels to mTORC1
S u m m a ry ......................................................................................................
39
Introd u ction ...................................................................................................
40
R e sults .....................................................................
................
. . 41
The RagC Nucleotide State Determines mTORC1 Binding to the Rag
H e tero d im e r...................................................................................... . 4 1
FLCN Interacts with the Rags in an Amino Acid-Sensitive Fashion................43
FLCN is Necessary for mTORC1 Activation and Localization to the Lysosomal
M e m b ra ne s .......................................................
.
. ...................... . . 45
FLCN Co-Localizes with the Rag GTPases on the Lysosomal Surface in an
Amino Acid-Sensitive Fashion....................................................................46
FLCN-FNIP2 is a GAP for RagC and RagD............................................ 47
D is c u s sio n .....................................................................................................
50
F ig u re s .....................................................................................................
. . 52
F ig u re Leg e nd s ........................................................................................
. . 56
Experimental Procedures.............................................................................
60
R e fe re n ce s ...............................................................................................
. ..6 6
S up ple m e nta l Info ........................................................................................
. 72
6
Chapter 3: Lysosomal amino acid transporter SLC38A9 signals arginine
sufficiency to mTORC1
S u m m a ry ......................................................................................................
79
Intro d u ctio n ...............................................................................................
. 80
Re s u lts .....................................................................................................
. .81
SLC38A9 Interacts with Ragulator and the Rag GTPases......................... 81
SLC38A9, a Lysosomal Membrane Protein Required for mTORC1 Activation... 82
SLC38A9.1 Overexpression Makes mTORC1 Signaling Insensitive to Amino
Acids.....................
.................................
83
Modulation of the SLC38A9-Rag-Ragulator Interactions by Amino Acids..........84
SLC38A9.1 is an Amino Acid Transporter...................................................85
D isc u s s io n ...............................................................................................
. .. 8 6
F ig u re s .....................................................................................................
. . 88
F ig u re Le g e nd s ........................................................................................
. . 93
R e fe re n ce s ............ ...................................................................................
. . 96
Experimental Procedures.............................................................................
99
S u p p le m e nta l Info ..........................................................................................
10 7
Chapter 4: Future directions and discussions
I. T he R ag H ete ro d im e r..................................................................................119
11. Lysosomal amino acid concentrations in human cells........................................120
111. Nutrient sensing in the compartmentalized cell...............................................121
R e fe re n ce s ..................................................................................................
1 23
7
CHAPTER 1
I. INTRODUCTION
Cell growth, or the accumulation of mass, is a resource-intensive process. As such, cells
have evolved sophisticated systems to ensure that the rate of growth is controlled not
only by the availability of nutrients, but also by signaling pathways that report growth
factors and cellular stresses. One such system is the mechanistic target of rapamycin
complex 1 (mTORC1) pathway. mTORC1 integrates a diverse set of signals, such as
growth factors, nutrient and energy levels, to regulate many anabolic and catabolic
processes, including protein, lipid, and nucleotide synthesis, as well as autophagy.
Given that mTORC1 regulates a multitude of processes, it is not surprising that the
pathway it anchors is deregulated in various common diseases, including cancer,
diabetes, and aging. Therefore, understanding the molecular underpinnings of this
pathway will be essential for therapeutic intervention.
II. THE MTOR PATHWAY
A. Rapamycin: a discovery tool and therapeutic
In the 1970s, Rapamycin was isolated from Streptomyces hygroscopicus in a soil
sample from Easter Island, also called Rapa Nui. Identified from an antibiotic screen
performed in Ayerst Research Labs, rapamycin lacked antibacterial activity but had
potent growth-inhibitory effects on yeast, causing G1 arrest (Robert and Gregory, 1996).
These anti-proliferative effects also applied to human cancer cells, extending these
effects from yeast to human (Eng et al., 1984). Rapamycin was also shown to have
immunosuppressive effects in two mouse models of auto-immune disease. Once FDA
approved rapamycin for use as an immunosuppressant in kidney transplant patients,
several pharmaceutical companies developed derivatives, called rapalogues, with better
bioavailability (Robert and Gregory, 1996). Rapamycin and its chemical derivatives,
rapalogues, are also used as anti-restenosis agents in drug-eluting stents and in
chemotherapy for cancer. Rapamycin extends lifespan in every model organism tested,
and rapalogues are in pre-clinical trials for aging-related morbidities.
8
The Target Of Rapamycin:
As a small molecule, rapamycin has an unusual mechanism of action. It binds to a small
intracellular protein called FKBP12, and in the form of this complex, inhibits its target. To
identify the target of rapamycin, screens in yeast were performed to isolate mutants that
are resistant to its growth-inhibitory effects. Mutant alleles of three genes were
identified-recessive mutations in FKBP12, and dominant mutations in TOR1, and
TOR2 (Heitman et al., 1991; Koltin et al., 1991). The FKBP12 null cells did not
recapitulate the growth arrest, whereas the TOR1/TOR2 double mutants mimicked the
growth arrest imposed by rapamycin, suggesting that rapamycin inhibits the TOR
proteins (Helliwell et al., 1994). Direct evidence that rapamycin inhibited TOR came from
biochemical purification from mammalian sources. Sequence analysis of the proteins
revealed homology to the yeast TORs (Brown et al., 1994; Chen et al., 1994; Sabatini et
al., 1994; Sabers et al., 1995). We now refer to this protein as the mechanistic target of
rapamycin, or mTOR.
B. mTORC1 and mTORC2
We now know that mTOR is the catalytic kinase domain of two distinct complexes,
mTOR complex 1 (mTORC1), and mTOR complex 2 (mTORC2). In response to growth
factors and nutrients, mTORC1 regulates key cell growth processes, such as protein,
lipid, and nucleotide biosynthesis, and autophagy. Considered part of the P13K-Akt
pathway, mTORC2 is less well-understood but was found to be the elusive kinase for
one of the two phosphorylation sites for Akt activation in response to growth factor
signaling. Thus, as part of two distinct complexes, mTOR is both upstream and
downstream of itself.
mTORC2
Yeast TOR2, but not TOR1, had rapamycin-insensitive functions (Xiao-Feng et al.,
1995). This issue was clarified with the discovery of two distinct complexes containing
TOR2. TOR1 or TOR2 can associate with the rapamycin-sensitive TOR complex 1
(TORC1), which included KOG1 (homologous to human raptor) and LST8 (homologous
to human GbL/mLST8). On the other hand, only TOR2 was found in TOR complex 2
(TORC2), which comprised of AVO1 (homologous to human SIN1), AVO2, AVO3
(homologous to human rictor) (Loewith et al., 2002). In mammals, there is one mTOR
9
protein and it is found in both complexes. mTORC2 is defined by its rictor component
and also contains mLST8, SIN1 (Sarbassov et al., 2004). Deletion of TORC2
components in yeast and knockdown in mammalian cells showed actin cytoskeleton
defects (Jacinto et al., 2004).
Interest in the mTOR pathway escalated to a new high when mTORC2 was found to be
the elusive kinase for full Akt activation. The PI3K/PTEN/Akt pathway mediates insulin
signaling and is one of the most commonly mutated pathways in cancer. Full activation
of Akt requires phosphorylation at two sites. PDK1 executes the first round of
phosphorylation on T308, and mTORC2 phosphorylates S473 for full Akt activation
(Sarbassov et al., 2005b). In turn, Akt drives cell growth, cell cycle progression, glucose
metabolism, and survival by signaling to its targets TSC2, Cyclin1, GSK3, and BAD
(Greer and Brunet, 2005). How mTORC2 is activated by P13K is still poorly understood.
mTORC1
Concurrent with yeast studies, raptor was found to be a defining component of the
nutrient-responsive, rapamycin-sensitive, mammalian mTORC1 (Hara et al., 2002; Kim
et al., 2002). Raptor is not required for mTOR kinase activity in vitro, but is thought to
help in substrate recruitment (Sabatini, 2006). As described above, GbL/mLST8 is also a
component of mTORC1, but its function has been debated. PRAS40 is the final
component of mTORC1 and is an insulin-sensitive inhibitor of mTORC1 (Sancak et al.,
2007b).
The mechanisms through which mTORC1 senses and integrates stimuli are of great
interest. One key upstream factor is the Tuberous Sclerosis Complex, TSC1-TSC2
tumor suppressor, which suppresses mTORC1 activity in response to deprivation of
growth factor or energy (Brugarolas et al., 2004; Castro et al., 2003; Corradetti et al.,
2005; Garami et al., 2003; Inoki et al., 2003a; Inoki et al., 2003b; Ma et al., 2005; Reiling
and Hafen, 2004; Roux et al., 2004; Saucedo et al., 2003; Stocker et al., 2003; Tee et
al., 2003a; Tee et al., 2002; Tee et al., 2003b; Zhang et al., 2003). The TSC complex
does so by inhibiting Rheb, a GTP-binding protein that is an essential activator of the
mTORC1 kinase activity (Long et al., 2005; Sancak et al., 2007a).
10
C. Amino Acid Signaling Machinery
The TOR pathway has been associated with nutrient sensing ever since treatment with
rapamycin or TOR1/TOR2 deletion in yeast revealed a cellular response characteristic of
starvation (Barbet et al., 1996). Amino acid starvation is sufficient to cause rapid
dephosphorylation of both S6K and 4EBP1 in many cell types (Fox et al., 1998a; Fox et
al., 1998b; Hara et al., 1998; Kimball et al., 1998; Krause et al., 2002; Patti et al., 1998;
Wang et al., 1998; Xu et al., 1998). Leucine seems to contribute the most to the amino
acid-responsive effects, followed by arginine.
GATOR2 complex
(A) Low amino acid levels
(B) High amino add levels
Svc
Energy,
GATORI complex
Energy,
oxygenoxygen
lel
evels
acids
Ragulator complex
signaling
signaling
tyt
GAPPN
GEF
"04"t
.:GA
GAP
Folliculin complex
TSC complex
Figure 1: Lysosomal integration of nutrients and growth factor signals in the
mTORCI pathway, adapted from Bar-Peled et al., 2013
Amino acids do not appear to signal through the TSC complex (Nobukuni et al., 2005;
Roccio et al., 2006; Smith et al., 2005). Instead, emerging evidence indicates that
mTORC1 activation by amino acids requires a lysosome-associated machinery,
comprised of the vacuolar adenosine triphosphatase (v-ATPase), the Ragulator,
GATOR1, and the Rag GTPases (Figure 1) (Kim et al., 2008; Sancak et al., 2010;
Sancak et al., 2008; Zoncu et al., 2011). Like Rheb, the Rags are members of the Rasrelated GTP-binding superfamily of proteins, but they are unusual in that they function as
obligate heterodimers of RagA or B (A/B) with RagC or D (C/D). RagA and RagB are
highly homologous and redundant, as are RagC and RagD (Hirose et al., 1998; Sancak
et al., 2008; Schurmann et al., 1995; Sekiguchi et al., 2001). The Rag nucleotide state
11
determines mTORC1 binding and localization to the lysosome (Sancak et al., 2008;
Sancak et al., 2010).
We have proposed that amino acids signal from within the lysosomal lumen to
Ragulator, in a v-ATPase-dependent fashion. In turn, Ragulator activates RagA/B
through its activity as a guanine nucleotide exchange factor (GEF). When RagA/B is
loaded with GTP, the Rag heterodimer recruits mTORC1 to the lysosomal surface where
it binds Rheb and becomes activated (Bar-Peled et al., 2013; Bar-Peled et al., 2012;
Efeyan et al., 2012). To turn off amino acid signals, GATOR1 activates RagA/B GTPase
activity, resulting in loss of mTORC1 binding and the loss of mTORC1 lysosomal
localization.
Interestingly, the TSC complex shuttles on and off the lysosomal surface in response to
growth factors (Menon et al., 2014). P13K signaling activates Akt and in turn
phosphorylates the TSC complex, resulting in its dissociation from the lysosome.
Without the GAP activity of the TSC complex acting on Rheb, Rheb is activated to
stimulate mTORC1 kinase activity. Thus, the lysosome has emerged as a signal
integration hub for the mTORC1 pathway.
D. Downstream Effectors of mTORC1:
The mTORC1 pathway regulates cell growth by phosphorylating key regulators of
anabolic and catabolic processes, such as protein, lipid, and nucleotide biosynthesis,
and autophagy. Before the identification of mTOR, its key substrates 4E-BP1 and S6K1
were already known to be rapamycin-sensitive (Beretta et al., 1996; Chung et al., 1992;
Kuo et al., 1992; von Manteuffel et al., 1996). Shortly after its identification, mTOR was
shown to be kinase responsible for their phosphorylation (Brunn et al., 1997; Burnett et
al., 1998; Hara et al., 1997; Isotani et al., 1999). Both S6K1 and 4E-BP1 regulate the
formation of the translational pre-initiation complex (eIF4E, eIF4G, elF3) (Holz et al.,
2005). eIF4E binds the 7-methylguanosine mRNA 5' cap and unphosphorylated 4EBP1
prevents the eIF4E-mRNA complex from binding to eIF4G. mTORC1 activation
phosphorylates 4E-BP1 and diminishes its affinity for eIF4E, allowing translation to
proceed. Activated S6K1 phosphorylates S6, a subunit of 40S ribosome, which permits
its association with the pre-initiation complex and thus translation (Holz et al., 2005).
12
S6K1 also mediates other mTORC1-associated anabolic processes. mTORC1 regulates
lipid synthesis through SREBP1 and 2, transcription factors that govern expression of
genes involved in fatty acid and cholesterol synthesis, in a S6K1 and Lipin-1 dependent
fashion (Laplante and Sabatini, 2012; Peterson et al., 2011). S6K1 regulates nucleotide
biosynthesis by phosphorylating CAD, the enzyme responsible for catalyzing the first
three steps of pyrimidine synthesis (Ben-Sahra et al., 2013; Robitaille et al., 2013).
Importantly, S6K1 mediates a negative feedback loop that restricts growth factor
signaling. S6K1 phosphorylates insulin receptor substrates (IRS), preventing them from
activating the P13K lipid kinase. This negative feedback loop plays important roles in
insulin resistance, as S6K1 null mice were resistant to obesity and maintained high
insulin sensitivity (Um et al., 2004).
Ill. MTOR SIGNALING IN CANCER
A. Pathways altered in cancer upstream of mTORC1
RT K
Downstreanstrea
effector
Teffector
Cell growth
trien
Figure 2: Signaling cascade upstream of mTOR, adapted from Shaw and Cantley,
2006
Tumor suppressors associated with the mTORC1 pathway are mutated in both sporadic
cancers and familial tumor-prone syndromes. Growth factor receptor tyrosine kinases
13
(RTK) activate the Ras and P13K signal transduction pathways (Figure 2), both of which
are deregulated in cancer (Laplante and Sabatini, 2012). NF1 normally reverses the
effects of Ras as a GTPase activating protein (GAP). Germline mutations in NF1 cause
neurofibromatosis, a tumor-prone syndrome (Xu et al., 1990). Both Ras and RTKs
activate the catalytic subunit p11 Oa of the P13K lipid kinase, which often harbors
activating mutations or is amplified in cancer (Gupta et al., 2007). The most common
mechanism of activating this pathway, however, is loss of the PTEN lipid phosphatase
that reverses the action of P13K. PTEN is one of the most commonly mutated tumor
suppressors after p53 (Salmena et al., 2008). Mutations in PTEN also cause a familial
cancer syndrome called Cowden syndrome (Liaw et al., 1997).
The tuberous sclerosis complex (TSC) integrates growth factor signals and ATP levels to
regulate mTORC1 activation (Dibble and Manning, 2013). Growth factor signals are
conveyed by AKT, a major effector of P13K signaling, and ATP levels are reported by
AMP-activated protein kinase AMPK. To signal low ATP levels, AMPK needs to be
activated by LKB1 (Shaw et al., 2004; Woods et al., 2003), which is frequently mutated
in lung adenocarcinomas (Sanchez-Cespedes et al., 2002). Mutations in LKB1 and
TSC1/2 cause the Peutz-Jeghers and Tuberous Sclerosis Complex familial cancer
syndromes, respectively (Hemminki et al., 1998; Slegtenhorst, 1997).
Growth factor signaling and ATP levels regulate TSC1/2 GAP activity towards Rheb,
which in turn stimulates mTORC1 kinase activity at the lysosomal surface. Rheb
represents the first half of a lysosome-based coincidence detector comprised of
GTPases that controls activation of mTORC1. The other half, signals amino acid levels
via the Rag GTPases, which bind mTORC1 and promote its lysosomal localization.
Thus, the pathway ensures that appropriate growth conditions are met by independently
regulating mTORC1 lysosomal localization and kinase activation via the Rag and Rheb
GTPases (Bar-Peled and Sabatini, 2014).
Amino Acid Sensing by mTORC1
Although the tumor suppressors involved in growth factor signaling are well established,
emerging components of the amino acid signaling machinery are already implicated in
cancer. Furthermore, mTOR itself was also recently appreciated to be mutated in cancer
(Grabiner et al., 2014). The Rag GTPases are obligate heterodimers comprised of RagA
14
or RagB bound to RagC or RagD. GATOR1, the GAP for RagA/B, is mutated in
gliobastomas and ovarian cancers (Bar-Peled et al., 2013). Mutations in FLCN, the GAP
for RagC/D, cause the Birt-Hogg-Dube tumor syndrome (Tsun et al., 2013).
B. The Tumor-prone Birt-Hogg-Dube Syndrome
FLCN is conserved from yeast to human yet its molecular function remains unclear. Loss
of function mutations in FLCN cause an inherited cancer syndrome called Birt-HoggDube (BHD) characterized by benign skin tumors (fibrofolliculomas), bilateral, multifocal
renal neoplasms of different subtypes, and lung cysts (BIRT et al., 1977). BHD is
autosomal dominantly inherited and loss of heterozygosity observed in humans, mouse
and rat BHD models led to a proposed tumor suppressor function for FLCN (Hasumi et
al., 2009; Khoo et al., 2002; Okimoto et al., 2004). The most common germline mutation,
observed in over half of BHD patients, occurs in a tract of eight cytosines where either a
cytosine is inserted (1 733insC) or deleted (1 733delC), resulting in a truncated protein
(Toro et al., 2008). Missense germline mutations are rare, but a BHD canine model is
caused by a mutation in a highly conserved residue, corresponding to H255R in human
FLCN (Lingaas et al., 2003).
Because genes (tscl/2, pten, Lkbl) linked to other hamartoma syndromes are all
classical tumor suppressors that restrict mTORC1 activity (Inoki et al., 2002; Sarbassov
et al., 2005a; Shaw et al., 2004), it has been proposed that FLCN is a negative regulator
of mTORC1 activity. However, there have been conflicting reports, in mouse models of
BHD (Baba et al., 2008; Chen et al., 2008; Hartman et al., 2009; Hasumi et al., 2009;
Hudon et al., 2010) and cell-based studies (Baba et al., 2006; Cash et al., 2011;
Hartman et al., 2009; Takagi et al., 2008), on whether it acts as a negative or positive
regulator in the mTORC1 pathway. Therefore, although there is a clear connection for
FLCN to the mTORC1 pathway, how it regulates mTORC1 activity is unclear.
There is emerging evidence that FLCN has a role in nutrient sensing. The FLCN and
TSC1/2 yeast orthologs have opposing roles in amino acid homeostasis (van
Slegtenhorst et al., 2007). Furthermore, FNIP1 and 2, which are paralogs with 74%
sequence similarity, directly interact with AMP-activated protein kinase (AMPK), an
energy-sensing molecule that regulates mTORC1 activity through the action of TSC
15
complex (Baba et al., 2006; Hasumi et al., 2008; Takagi et al., 2008). However, the
mechanism through which FLCN regulates nutrient signaling in the mTORC1 pathway
has yet to be revealed.
C. Outputs of mTORC1 Altered in Cancer
Processes regulated by mTORC1 that affect amino acid pools, such as protein
translation and autophagy, have been implicated in cancer. S6 kinase 1 (S6K1) and
eIF4E-binding protein (4E-BP1) are well known mTORC1 substrates that regulate
protein translation. Phosphorylation of 4E-BP1 by mTORC1 relieves its inhibition of the
elF4E translation initiation factor, allowing translation to proceed (Sonenberg and
Hinnebusch, 2009). The 4E-BP1-eIF4E axis, not S6K1, is emerging as the major
downstream effector of mTORC1 in cancer (Hsieh et al., 2010). elF4E is amplified or
overexpressed in various sporadic cancers and increased 4E-BP1 phosphorylation
correlates with poor survival outcomes (Armengol et al., 2007; Bjornsti and Houghton,
2004). Expression of phosphorylation defective 4E-BP1 reduces tumor progression in
KRAS and P13K driven tumors, suggesting elF4E plays an important role in maintaining
cancer growth (Hsieh et al., 2010; She et al., 2010). Conversely, loss of 4E-BP1 and 4EBP2 increased tumorigenesis in p53 null mice (Petroulakis et al., 2009). How 4EBP1elF4E deregulation promotes oncogenesis is unclear but it is thought to increase
translation of pro-oncogensis proteins for cell survival (Hsieh et al., 2010; Wendel et al.,
2007) and cell-cycle progression (Dowling et al., 2010).
Autophagy, or 'self-eating', is a stress-induced survival mechanism that degrades and
recycles damaged or superfluous proteins and organelles in the lysosome. As amino
acid levels are also influenced by autophagy, especially during metabolic stress
(Noboru, 2007) the mTORCI pathway is a primary autophagy regulator, shutting the
process off during abundant nutrient and growth factor signaling (Kroemer et al., 2010).
Autophagy plays a dual role as an oncogenic and tumor suppressive process. On one
hand, autophagy is activated during early tumor formation before adequate blood supply
is established to buffer metabolic stress (Degenhardt et al., 2006), and contributes to
chemotherapy resistance (Amaravadi et al., 2007; Carew et al., 2007). However, despite
this pro-survival role, there is clear evidence that autophagy is tumor suppressive.
Monoallelic loss of beclinI, an essential autophagy component, is frequently observed in
16
human breast, ovarian, and prostate cancer, and is sufficient to cause spontaneous
tumor development in mice (Liang et al., 1999; Qu et al., 2003; Yue et al., 2003). Loss of
other autophagy genes such as UVRAG, Atg4C, and Bif-1 also increases susceptibility
to tumorigenesis (Liang et al., 2006; Marino et al., 2007; Takahashi et al., 2007). How
autophagy suppresses tumor formation is still under investigation, but as an important
contributor to cellular housekeeping, autophagy clears damaged proteins, damaged
mitochondria, and reactive oxygen species, which can promote oncogenesis (Mathew et
al., 2009). Furthermore, autophagy is thought to prevent necrotic death in apoptotic
deficient tumor cells, thereby limiting local inflammation, which can increase tumor
growth (Degenhardt et al., 2006). Finally, autophagy-deficient cells are prone to
chromosome instability and DNA damage (Mathew et al., 2007). Thus, targeting
autophagy in cancer will likely require context-specific and disease-stage specific
modulation.
D. Rapalogues in cancer therapy
For a pathway so critical to growth, and with so much promising pre-clinical data to
support anti-tumor effects, it is disappointing that rapamycin and its derivatives have
limited use in cancer therapy. Rapamycin-or its chemical derivatives, rapaloguesextend survival for cancer patients with renal cell carcinoma, and mantle cell lymphoma
(Wander et al., 2011). Probably the best indication for mTOR inhibition is blocking
angiomyolipoma growth in tuberous sclerosis patients, where hyperactive mTORC1
signaling is the root cause of the disease (Crino et al., 2006). Indeed, in a Phase Ill
clinical trial, treatment with rapalogue, everolimus, showed a 42% response rate of
reducing angiomyolipoma size (Bissler et al., 2013).
Why rapalogues haven't proved to be more effective has been widely debated.
Fundamentally, it seems that effectors downstream of mTORC1 control cell growth,
which is certainly a requisite for tumorigenesis, but inhibition of these processes is not
sufficient to kill a cancer cell. In other words, rapalogues seem to have more of a
cytostatic rather than a cytotoxic effect. For example, rapamycin treatment prevents
further growth of established tumors in a NF1 mouse model (Johannessen et al., 2008),
and the angiomyolipomas in patients with tuberous sclerosis continue to grow after
cessation of sirolimus treatment (Bissler et al., 2008). This is also true in PTEN driven
17
endometrial tumors, where regression is rarely observed but disease is stabilized by 2644% (Colombo et al., 2007; Slomovitz et al. 2008).
There is evidence that mTORC1 inhibition might, in some cases, even enable more
aggressive tumor cell growth. As described earlier, mTORC1 activity negatively
regulates Akt signaling, and rapalogue treatment has been shown to activate Akt in
colorectal carcinoma (O'Reilly et al., 2006). Loss of mTORC1 signaling may even cause
other proliferative pathways to compensate, such as MAPK upregulation seen in mouse
model of prostate cancer treated with rapalogues (Carracedo et al., 2008). This
compensation is not surprising given the incredible selective pressures that tumor cells
face.
Another issue that we now appreciate is that rapamycin inhibits mTORC2 in select cells
and is a partial inhibitor of mTORC1. Long-term treatment with rapamycin, as is the case
in chemotherapy, has been shown to disrupt mTORC2 assembly (Sarbassov et al.,
2006). Thus, the response of cancer cells to rapamycin may in fact be due to mTORC2
inhibition and loss of subsequent Akt activation. Disassembly of mTORC2 does not
correlate with efficacy of treatment, so it still unclear why this fraction of tumors are
responsive. The development of ATP-competitive inhibitors of mTOR has revealed that
rapamycin is not a complete inhibitor of mTOR (Thoreen et al., 2009). Rapamycin
inhibits S6K1 well but 4E-BP1 phosphorylation is rapamycin-resistant. Given the
emerging evidence that the 4E-BP1 - eIF4E axis is deregulated in cancer, the
incomplete inhibition of this axis by rapamycin may also contribute to its poor efficacy.
The contribution of these two possibilities will likely become more clear once there is
sufficient clinical data for the mTOR ATP-competitive inhibitors currently in trials,
although dosing will be limited by the narrow therapeutic window given the inhibition of
both mTORC1 and mTORC2 (Benjamin et al., 2011).
Perhaps it is not surprising that rapalogues have failed as a single agent therapy. After
decades of chemotherapy trials, there are rare examples for durable remission for single
agents against any target. It is increasingly clear that chemotherapy will need to involve
multiple agents that accommodate the stage of disease and anticipate the rewiring of
signaling pathways in response to therapy. Given the mTORC1's involvement in protein
translation, perhaps its inhibition will prevent cancer cells from rewiring its signaling
18
networks. It will be interesting to see how rapalogue combination therapy trials will turn
out (Wander et al., 2011).
IV. AMINO ACID TRANSPORT
A. History: digestion, protein absorption, and amino acid uptake in tissues
Digestion: a chemical process
Digestion was first demonstrated to be more than mechanical-a chemical processwhen Rene Reamur, in the 1750s, induced a bird to swallow an opened tube filled with
food and observed that the food was partially digested. 30 years later, Lazzaro
Spallanzani confirmed these results by feeding and forcing regurgitation of many
animals-himself included-with perforated spherules containing food. Furthermore, he
induced himself to vomit on an empty stomach and showed that digestion can take place
in gastric fluid outside of the body, confirming that it was indeed a chemical process. But
perhaps the most famous experiments came in the 1830s from William Beaumont, a
self-taught physician largely known as the father of gastric physiology. The opportunity
came when his patient suffered a shotgun wound that left a gastric fistula, allowing direct
access into his stomach. Beaumont confirmed that digestion was a chemical process,
both outside the body and in the stomach, and with the help of chemists, established
that hydrochloric acid was the main component of gastric juice (Complete Dictionary of
Scientific Biography, 2008).
Meanwhile, the proteinogenic amino acids were just being discovered, although it wasn't
appreciated yet that they were the building blocks of protein. First was Asparagine,
isolated from asparagus (Vauquelin, 1807), and soon leucine was discovered from
cheese in 1818 and arginine from lupin seedlings in 1886 (Plimmer, 1912). But it wasn't
until -1895 that Emil Fischer and Albrecht Kossel showed that amino acids were
hydrolysis products of protein. And together with Franz Hofmeister, Fischer
demonstrated that amino acids are linked by peptide bonds in proteins (Fischer, 1906).
19
Protein absorption: intact or as amino acids
As we learned that proteins were made of amino acids, another debate was being
settled-how are proteins absorbed into the body? There were two schools of thought.
Liebeg and Voit posited that proteins are absorbed directly, with no or little
decomposition, arguing that it would not make sense to waste energy to decompose
them only to reform them in tissues (Folin, 1905). On the other hand, Pflciger and
colleagues insisted that proteins were chemically changed for adequate absorption
(Slyke, 1917). This debate was settled when Otto Cohnheim isolated intestinal juices,
termed erepsin, and demonstrated that proteins added to erepsin are digested into
amino acids (Cohnheim, 1902). This work opened many lines of investigation, further
confirming that amino acids are the "protein currency of the body" (Matthews, 1978).
Emil Abderhalden fed dogs only amino acids and showed that they were able to
maintain a positive nitrogen balance, and even deliver pups. From these experiments,
he proposed that proteins are indeed rebuilt from absorbed amino acids (Wolf, 1996).
Certain amino acids were shown to be essential when Willcock and Hopkins fed mice
only plant protein; they died, but were rescued by tryptophan supplementation (Willcock
and Hopkins, 1906).
Uptake of amino acids into tissues
The field focused next on how amino acids were incorporated into tissues. In a seminal
study, Van Slyke and Meyer showed that amino acids are enriched, as much as ten fold,
in tissues compared to serum (Slyke and Meyer, 1913). Insights into how this large
gradient was achieved came when Halvor Christensen fed guinea pigs individual amino
acids and examined the relative distribution of glycine and glutamine in plasma versus
tissue (Christensen et al., 1948). They saw that a subset of fed amino acids reduced
glycine or glutamine enrichment in tissues, suggesting competitive inhibition of limited
transporters. Based on the subsets of amino acids that can affect the distribution ratios
of particular amino acids-interpreted as the substrate preferences of the different
transporters-distinct transport "systems" were defined, reviewed in (Brder, 2008). In
1957, before molecular characterization and any crystallographic insight, Peter Mitchell
proposed an alternating access mechanism for transporters, which has largely turned
out to be true (Mitchell, 1957).
20
Since the advent of expression cloning (Hediger et al., 1987), there has been an
explosion of gene identification responsible for many transport activities, including amino
acids. About 10% of the genome (-2,000 genes) is dedicated to transporting solutes
across membranes. Half are represented by solute carrier (SLC) transporters, -35% are
ion channels and the remaining 15% are ATPases, reviewed in (Hediger et al., 2013).
B. The SLC38 Amino Acid Transporter family
The SLC families are defined by sequence similarity of 20-25% (Hediger et al., 2004).
The SLC38 family is comprised of sodium-coupled amino acid transporters. SLC38A1-5
reside on the plasma membrane, but SLC38A7 localizes to the lysosome (Chapel et al.,
2013), while SLC38A8-11 have not been characterized. Interestingly, SLC38A9 has
diverged over evolution from all other SLC38 members (Figure 3) (Schi6th et al., 2013).
The SLC6, -7, and -36 families are the closest in sequence similarity to the SLC38
family.
SLC38A1-6
SLC38A11
a.k.a. PAT 1-4
SLC38A9
SLC38A7-8
vesicular GABA/ Gly
transporter
SLC38A10
Figure 3: SLC38A9 is phylogenetically separated from other SLC38 family
members, adapted from Schioth et al., 2013
21
Although the SLC families are segregated by sequence divergence, recent crystal
structures of several SLC families, namely SLC6 and SLC7, show remarkable structural
similarity, reviewed in (Forrest and Rudnick, 2009; Krishnamurthy et al., 2009; Perez and
Ziegler, 2013; Schweikhard and Ziegler, 2012). The leucine transporter LeuT was the
first to be crystallized among these and has laid the foundation for ion-coupled amino
acid/polyamine transport (Yamashita et al., 2005). The LeuT fold represents one of five
different structural architectures found in transporters (Schlessinger et al., 2010).
C
NSS (LeuT)
N
Repeat I
Repeat 2
C
NCS1 (Mhpl)
ApcT (AdI)
SSSP(SGLT)
BCCT (BetP)
Figure 4: Structurally conserved inverted repeat domain structure of LeuT across
many SLC transporter families, adapted from Khafizov et al., 2010
The LeuT fold, found in the AdiC, vSGLT, BetP, GadC, MHP1, ApcT, DAT, and CaiT
structures, comprises a ten transmembrane (TM) domain of inverted structural repeats,
each 5 TM segments, suggesting a structural mechanism of alternative access.
Remarkably, this structural fold is conserved despite substantial differences in
sequence, coupling mode, and nature of substrate (Figure 4) (Khafizov et al., 2010). TM
domains 1, 3, 6, and 8 are involved in substrate binding and TM1 and 6 have a break in
22
their alpha-helix structure to form a hinge that bends during transport. Although a crystal
structure of an SLC38 family member has yet to be solved, the Drosophila dopamine
transporter SLC6A3 (DAT) shows remarkable similarity to the related LeuT prokaryotic
structures (Penmatsa et al., 2013).
C. Arginine transport at the plasma and lysosomal membranes
Arginine is used in the synthesis of many biomolecules, including creatine, urea,
agmatine, nitric oxide and proteins. Arginine is considered a semi-essential amino acid
because it is required during development but adult tissues, particularly the kidney, can
synthesize it. However, during times of high demand, such as wound healing, sepsis,
and growth, endogenous arginine may be limiting (Closs et al., 2004).
Plasma membrane transporters that accept arginine as a substratel,2
Arginine transport
Gene
3
Transport
Na+ -
system
dependent
Na+
-
3
Apparent Km
dependent
y+LAT2 +
SLC7A6
4F2hc
b0. AT
rBAT
ATBO,I
SLC3A2
SLC7A9 4
SLC3A1
SLC6A14
No
No
No
No
-
-
0.10-0.16
3.40-3.90
0.25-0.70
0.20-0.50
-
-
-
-
Yes
No
Moderate
Moderate
12
12
12
13
y+L
No
0.346
Yes
0.02
Yes
14
y+L
No
0.12-0.147
Yes
0.20-0.30
Yes
15
0.08-0.20
0.10-0.15
No
Yes + Cl-
0.30
0.01
Yes
No
16, 17
18
+
CAT-4
y'
ND
y+
y+
Ref.
+
y+LAT1 +
4F2hc
SLC7A1
SLC7A2
SLC7A2
SLC7A3
SLC7A4
SLC7A7
SLC3A2
Transstimulation
mmol/L
mmoWlL
CAT-13,4
CAT-2A3
CAT-2B3,4
3
CAT-3 5
Apparent Km
-
Protein
Leucine transport
bO.0
B ,
No
Yes + Cl
1 Known carrier proteins for arginine are listed; only the most common name for each protein is given. Gene names are per HUGO. Apparent
extracellular Km values are for arginine and, where applicable, the neutral amino acid leucine (for comparison).
2 Abbreviations: AT, amino acid transporter; ND, not defined.
3 Values are for human CAT proteins. Note that experimental Km values vary considerably.
4 CAT-1 and CAT-2 may also mediate activities of systems b1 and b2 (23).
5 No transport activity has been detected.
6 Value for arginine is 93 ytmol/L in the absence of Na
7 Km is independent of Na+ concentration.
Table 1: Plasma membrane arginine transport, adapted from Closs et al., 2004
Arginine transport at the plasma membrane is largely mediated by the cationic transport
system y+ (y from lysine, first substrate described for this system, + for cationic),
comprised of cationic amino acid transporters CAT1-4, also known as SLC7A1-4 (Deves
and Boyd, 1998; Fotiadis et al., 2013; Verrey et al., 2004; White, 1985). Recent kinetic
experiments revealed other minor routes via other transport systems, summarized in
Table 1. Unlike most plasma membrane transporters, which have high affinities in the
50-300 pM, range, CAT2, expressed in the liver, is a low-affinity (-4mM), high-capacity
23
arginine transporter thought to be responsible for cationic amino acid uptake following a
meal (Closs et al., 1993).
Arginine transport at the lysosomal membrane is relatively poorly characterized and is
largely achieved through a distinct transport system, dubbed system c. This transports
cationic amino acids lysine, arginine, ornithine, histidine, and ornithine, and its activity is
ATP, pH gradient, and vATPase-dependent, but not Na-dependent (Pisoni et al., 1985;
Pisoni et al., 1987; Ramirez-Montealegre and Pearce, 2005). Unlike many plasma
membrane transport activities, no lysosomal transport has been reported to be Nadependent (Pisoni and Thoene, 1991). Interestingly, the Km of arginine uptake into
lysosomes in fibroblasts is 300 pM, approximately 8 fold higher than that observed in the
plasma membrane, indicating a much lower-affinity system at the lysosome.
The orphan transporter SLC7A14 was recently proposed to participate in system c
based on its lysosomal localization and substrate profile of a SLC7A2-SLC7A14
chimera (Jaenecke et al., 2012). However, more compelling evidence indicates that
PQLC2 is largely responsible for lysosomal arginine efflux. C. elegans mutants defective
in PQLC2 have excess arginine and lysine in their lysosomes, and transport studies of
heterologously-expressed PQLC2 in oocytes, representing lysosomal-export activity,
reveal a Km of -4 mM (Jezegou et al., 2012; Liu et al., 2012). Such a low-affinity
transport activity for PQLC2 is consistent with a role in arginine/lysine export from the
lysosome, when concentrations become high following autophagy or lysosomaldegradation of proteins. Because it was technically not possible to assay lysosomal
import activity of PQLC2, it is unclear if PQLC2 is also responsible for the lysosomal
import activity of arginine (Km 300 pM). It is likely that SLC7A14 and/or other transporters
may be involved.
24
V. PREFACE FOR WORK PRESENTED IN THIS THESIS:
How the mTORC1 pathway senses the multitude of inputs to stimulate growth only in the
appropriate context has been of great interest. We now know that these signals are
integrated at the lysosome by a coincidence detector comprised of the Rag and Rheb
GTPases (Figure 5). Growth factors, energy levels and stresses regulate the activity of
Rheb, which stimulates mTORC1 kinase activity. Amino acids, on the other hand, signal
through the Rags, which regulate mTORC1 localization to the lysosome. Thus, by
independently controlling the kinase activity and subcellular localization of mTORC1,
these regulators ensure that mTORC1 is only active in appropriate growth conditions.
Inputs:
growth factors
energy levels
Input.
amino
stress
acids
Function:
Function:
stimulates mTORC1
kinase activity
recruits mTORC1
to
lysosome
p
Ls
om
Figure 5: The Rag and Rheb GTPases are key regulators of mTORC1
Whereas the upstream regulators of Rheb are relatively well characterized, the
mechanisms of amino acid signaling are only beginning to emerge. The Rag GTPases
interact with mTORC1 and signal amino acid sufficiency by promoting the translocation
of mTORC1 to the lysosomal surface, the site of its activation. The Rags are unusual
GTPases in that they function as obligate heterodimers, which consist of RagA or B
(A/B) bound to RagC or D (C/D). We have proposed that amino acids signal from within
the lysosomal lumen to Ragulator, the lysosomal scaffold for the Rags, in a v-ATPasedependent fashion. In turn, Ragulator activates RagA/B through its guanine nucleotide
exchange factor (GEF) activity. When RagA/B is loaded with GTP, the Rag heterodimer
recruits mTORC1 to the lysosomal surface where it can bind Rheb and becomes
activated.
25
What is the role of RagC/D in the Rag heterodimer?
Although the loading of RagA/B with GTP initiates amino acid signaling to mTORC1, the
role of RagC/D was unknown. We discovered that RagC/D is a key regulator of the
interaction of mTORC1 with the Rag heterodimer and that, unexpectedly, RagC/D must
be GDP-bound for the interaction to occur. We identified Folliculin (FLCN) and its
binding partners, FNIP1 and 2, as Rag interacting proteins. Mutations in FLCN cause the
tumor-prone Birt-Hogg-Dube syndrome, yet the molecular function of FLCN had been
elusive. We found that FLCN is necessary for mTORC1 activation by amino acids and
that the FLCN-FNIP complex has GTPase activating protein (GAP) activity for RagC/D,
but not RagA/B. Thus, we revealed a role for RagC/D in mTORC1 activation and a
molecular function for FLCN (Figure 6).
IP
(inactive)
FLCN-FNIP GAP activity
towards RagCID
+Amino
acids
Figure 6: FLCN-FNIP is a GAP for RagC/D
What is the amino acid sensor(s)?
Although there are many components being discovered in this amino acid signaling
machinery, the actual amino acid sensor(s) has been elusive. Recent work
demonstrated that amino acids signal from within the lysosomal lumen, through an
unknown mechanism, to the Rags and Ragulator complexes, which reside on cytosolic
side of the lysosomal membrane. We reasoned that candidate sensor(s) would be
transmembrane protein(s) and interact with Rag and Ragulator, key components of the
amino acid signal transduction machinery.
26
We identified SLC38A9, an uncharacterized protein with sequence similarity to amino
acid transporters, as a lysosomal transmembrane protein that interacts with the Rag
GTPases and Ragulator in an amino acid-sensitive fashion. The cytosolic facing, Nterminal region of 119 residues in SLC38A9 is sufficient for Rag/Ragulator interaction,
which we call the Ragulator-binding domain, but the amino acid-regulated interaction
requires the 11 transmembrane domains, where amino acid substrates are predicted to
bind. In vitro liposome reconstituted SLC38A9 transports arginine with a high Km
(-40mM) and seems to have a broad substrate profile. Loss of SLC38A9 represses
mTORC1 activation by amino acids, particularly arginine. Overexpression of SLC38A9
or just its Ragulator-binding domain makes mTORC1 signaling insensitive to amino acid
starvation but not to Rag activity. Thus, SLC38A9 functions upstream of the Rag
GTPases and is an excellent candidate for being an arginine sensor for the mTORC1
pathway (Figure 7).
amino
v-ATPase
11
acids
cytosol
SLC38A9
lysosomal
membrane
lysosomal
lumen
amino
acids
Figure 7: SLC3BA9 Is a candidate amino acid sensor. Model
for distinct amino acids Inputs In the mTORCi pathway
27
References:
Amaravadi, R.K., Yu, D., Lum, J.J., Bui, T., Christophorou, M.A., Evan, G.I., ThomasTikhonenko, A., and Thompson, C.B. (2007). Autophagy inhibition enhances therapyinduced apoptosis in a Myc-induced model of lymphoma. The Journal of clinical
investigation 117, 326-336.
Baba, M., Furihata, M., Hong, S.-B., Tessarollo, L., Haines, D.C., Southon, E., Patel, V.,
Igarashi, P., Alvord, W.G., Leighty, R., et al. (2008). Kidney-targeted Birt-Hogg-Dube
gene inactivation in a mouse model: Erkl/2 and Akt-mTOR activation, cell
hyperproliferation, and polycystic kidneys. J Natl Cancer 1100, 140-154.
Baba, M., Hong, S.-B., Sharma, N., Warren, M.B., Nickerson, M.L., Iwamatsu, A.,
Esposito, D., Gillette, W.K., Hopkins, R.F., Hartley, J.L., et al. (2006). Folliculin encoded
by the BHD gene interacts with a binding protein, FNIP1, and AMPK, and is involved in
AMPK and mTOR signaling. P Natl Acad Sci Usa 103,15552-15557.
Bar-Peled, L., Chantranupong, L., Cherniack, A.D., Chen, W.W., Ottina, K.A., Grabiner,
B.C., Spear, E.D., Carter, S.L., Meyerson, M., and Sabatini, D.M. (2013). A Tumor
suppressor complex with GAP activity for the Rag GTPases that signal amino acid
sufficiency to mTORC1. Science 340,1100-1106.
Bar-Peled, L., Schweitzer, L.D., Zoncu, R., and Sabatini, D.M. (2012). Ragulator is a
GEF for the rag GTPases that signal amino acid levels to mTORC1. Cell 150, 11961208.
Barbet, N.C., Schneider, U., Helliwell, S.B., Stansfield, I., Tuite, M.F., and Hall, M.N.
(1996). TOR controls translation initiation and early G1 progression in yeast. Molecular
Biology of the Cell.
Ben-Sahra, I., Howell, J.J., Asara, J.M., and Manning, B.D. (2013). Stimulation of de
novo pyrimidine synthesis by growth signaling through mTOR and S6K1. Science 339,
1323-1328.
Beretta, L., Gingras, A.C., Svitkin, Y.V., Hall, M.N., and Sonenberg, N. (1996).
Rapamycin blocks the phosphorylation of 4E-BP1 and inhibits cap-dependent initiation
of translation. EMBO J 15, 658-664.
BIRT, A., HOGG, G., and DUBE, W. (1977). HEREDITARY MULTIPLE
FIBROFOLLICULOMAS WITH TRICHODISCOMAS AND ACROCHORDONS. Arch
Dermatol 113, 1674-1677.
Brown, E.J., Albers, M.W., Shin, T.B., Ichikawa, K., Keith, C.T., Lane, W.S., and
Schreiber, S.L. (1994). A mammalian protein targeted by G1-arresting rapamycinreceptor complex. Nature 369, 756-758.
Brugarolas, J., Lei, K., Hurley, R.L., Manning, B.D., Reiling, J.H., Hafen, E., Witters, L.A.,
Ellisen, L.W., and Kaelin, W.G. (2004). Regulation of mTOR function in response to
hypoxia by REDD1 and the TSC1/TSC2 tumor suppressor complex. Gene Dev 18,
2893-2904.
28
Brunn, G.J., Hudson, C.C., Sekulic, A., Williams, J.M., Hosoi, H., Houghton, P.J.,
Lawrence, J.C., Jr., and Abraham, R.T. (1997). Phosphorylation of the translational
repressor PHAS-1 by the mammalian target of rapamycin. Science 277, 99-101.
Burnett, P.E., Barrow, R.K., Cohen, N.A., Snyder, S.H., and Sabatini, D.M. (1998).
RAFT1 phosphorylation of the translational regulators p70 S6 kinase and 4E-BP1.
Proceedings of the National Academy of Sciences of the United States of America 95,
1432-1437.
Carew, J.S., Nawrocki, S.T., Kahue, C.N., Zhang, H., Yang, C., Chung, L., Houghton,
J.A., Huang, P., Giles, F.J., and Cleveland, J.L. (2007). Targeting autophagy augments
the anticancer activity of the histone deacetylase inhibitor SAHA to overcome Bcr-Ablmediated drug resistance. Blood 110, 313-322.
Cash, T.P., Gruber, J.J., Hartman, T.R., Henske, E.P., and Simon, M.C. (2011). Loss of
the Birt-Hogg-Dube tumor suppressor results in apoptotic resistance due to aberrant
TGF beta-mediated transcription. Oncogene 30, 2534-2546.
Castro, A.F., Rebhun, J.F., Clark, G.J., and Quilliam, L.A. (2003). Rheb binds tuberous
sclerosis complex 2 (TSC2) and promotes S6 kinase activation in a rapamycin- and
farnesylation-dependent manner. The Journal of biological chemistry 278, 32493-32496.
Chen, J., Futami, K., Petillo, D., Peng, J., Wang, P., Knol, J., Li, Y., Khoo, S.-K., Huang,
D., Qian, C.-N., et al. (2008). Deficiency of FLCN in Mouse Kidney Led to Development
of Polycystic Kidneys and Renal Neoplasia. Plos One 3, e3581.
Chen, Y., Chen, H., Rhoad, A.E., Warner, L., Caggiano, T.J., Failli, A., Zhang, H., Hsiao,
C.L., Nakanishi, K., and Molnar-Kimber, K.L. (1994). A putative sirolimus (rapamycin)
effector protein. Biochem Biophys Res Commun 203, 1-7.
Chung, J., Kuo, C.J., Crabtree, G.R., and Blenis, J. (1992). Rapamycin-FKBP
specifically blocks growth-dependent activation of and signaling by the 70 kd S6 protein
kinases. Cell 69, 1227-1236.
Closs, E.I., Albritton, L.M., Kim, J.W., and Cunningham, J.M. (1993). Identification of a
low affinity, high capacity transporter of cationic amino acids in mouse liver. The Journal
of biological chemistry 268, 7538-7544.
Closs, E.I., Simon, A., Vekony, N., and Rotmann, A. (2004). Plasma membrane
transporters for arginine. J Nutr 134, 2752S-2759S; discussion 2765S-2767S.
Corradetti, M.N., Inoki, K., and Guan, K.-L. (2005). The stress-inducted proteins RTP801
and RTP801 L are negative regulators of the mammalian target of rapamycin pathway.
The Journal of biological chemistry 280, 9769-9772.
Degenhardt, K., Mathew, R., Beaudoin, B., Bray, K., Anderson, D., Chen, G., Mukherjee,
C., Shi, Y., Gelinas, C., Fan, Y., et al. (2006). Autophagy promotes tumor cell survival
and restricts necrosis, inflammation, and tumorigenesis. Cancer cell 10, 51-64.
29
Deves, R., and Boyd, C.A.R. (1998). Transporters for Cationic Amino Acids in Animal
Cells: Discovery, Structure, and Function. Transporters for Cationic Amino Acids in
Animal Cells: Discovery, Structure, and Function 78, 487-545.
Dowling, R.J.O., Topisirovic, I., Alain, T., and Bidinosti, M. (2010). mTORC1-mediated
cell proliferation, but not cell growth, controlled by the 4E-BPs. Science.
Efeyan, A., Zoncu, R., and Sabatini, D.M. (2012). Amino acids and mTORC1: from
lysosomes to disease. Trends in molecular medicine.
Eng, C.P., Sehgal, S.N., and Vezina, C. (1984). Activity of rapamycin (AY-22,989)
against transplanted tumors. The Journal of antibiotics 37, 1231-1237.
Fotiadis, D., Kanai, Y., and Palacin, M. (2013). The SLC3 and SLC7 families of amino
acid transporters. Molecular aspects of medicine 34, 139-158.
Fox, H.L., Kimball, S.R., Jefferson, L.S., and Lynch, C.J. (1998a). Amino acids stimulate
phosphorylation of p70S6k and organization of rat adipocytes into multicellular clusters.
Am J Physiol 274, C206-213.
Fox, H.L., Pham, P.T., Kimball, S.R., Jefferson, L.S., and Lynch, C.J. (1998b). Amino
acid effects on translational repressor 4E-BP1 are mediated primarily by L-leucine in
isolated adipocytes. Am J Physiol 275, C1232-1238.
Garami, A., Zwartkruis, F.J.T., Nobukuni, T., Joaquin, M., Roccio, M., Stocker, H.,
Kozma, S.C., Hafen, E., Bos, J.L., and Thomas, G. (2003). Insulin activation of Rheb, a
mediator of mTOR/S6K/4E-BP signaling, is inhibited by TSC1 and 2. Mol Cell 11, 14571466.
Greer, E.L., and Brunet, A. (2005). FOXO transcription factors at the interface between
longevity and tumor suppression. Oncogene 24, 7410-7425.
Hara, K., Maruki, Y., Long, X., Yoshino, K., Oshiro, N., Hidayat, S., Tokunaga, C.,
Avruch, J., and Yonezawa, K. (2002). Raptor, a binding partner of target of rapamycin
(TOR), mediates TOR action. Cell 110, 177-189.
Hara, K., Yonezawa, K., Kozlowski, M.T., Sugimoto, T., Andrabi, K., Weng, Q.P.,
Kasuga, M., Nishimoto, I., and Avruch, J. (1997). Regulation of elF-4E BP1
phosphorylation by mTOR. J Biol Chem 272, 26457-26463.
Hara, K., Yonezawa, K., Weng, Q.P., Kozlowski, M.T., Belham, C., and Avruch, J.
(1998). Amino acid sufficiency and mTOR regulate p70 S6 kinase and elF-4E BP1
through a common effector mechanism. The Journal of biological chemistry 273, 1448414494.
Hartman, T.R., Nicolas, E., Klein-Szanto, A., AI-Saleem, T., Cash, T.P., Simon, M.C.,
and Henske, E.P. (2009). The role of the Birt-Hogg-Dube protein in mTOR activation and
renal tumorigenesis. Oncogene 28, 1594-1604.
30
Hasumi, H., Baba, M., Hong, S.-B., Hasumi, Y., Huang, Y., Yao, M., Valera, V.A.,
Linehan, W.M., and Schmidt, L.S. (2008). Identification and characterization of a novel
folliculin-interacting protein FNIP2. Gene 415, 60-67.
Hasumi, Y., Baba, M., Ajima, R., Hasumi, H., Valera, V.A., Klein, M.E., Haines, D.C.,
Merino, M.J., Hong, S.-B., Yamaguchi, T.P., et al. (2009). Homozygous loss of BHD
causes early embryonic lethality and kidney tumor development with activation of
mTORC1 and mTORC2. P Natl Acad Sci Usa 106,18722-18727.
Heitman, J., Movva, N.R., and Hall, M.N. (1991). Targets for cell cycle arrest by the
immunosuppressant rapamycin in yeast. Science 253, 905-909.
Helliwell, S.B., Wagner, P., Kunz, J., Deuter-Reinhard, M., Henriquez, R., and Hall, M.N.
(1994). TOR1 and TOR2 are structurally and functionally similar but not identical
phosphatidylinositol kinase homologues in yeast. Mol Biol Cell 5, 105-118.
Hirose, E., Nakashima, N., Sekiguchi, T., and Nishimoto, T. (1998). RagA is a functional
homologue of S. cerevisiae Gtrlp involved in the Ran/Gspl-GTPase pathway. J Cell Sci
111 (Pt 1), 11-21.
Holz, M.K., Ballif, B.A., Gygi, S.P., and Blenis, J. (2005). mTOR and S6K1 mediate
assembly of the translation preinitiation complex through dynamic protein interchange
and ordered phosphorylation events. Cell 123, 569-580.
Hsieh, A.C., Costa, M., Zollo, 0., Davis, C., Feldman, M.E., Testa, J.R., Meyuhas, 0.,
Shokat, K.M., and Ruggero, D. (2010). Genetic dissection of the oncogenic mTOR
pathway reveals druggable addiction to translational control via 4EBP-eIF4E. Cancer
Cell 17, 249-261.
Hudon, V., Sabourin, S., Dydensborg, A.B., Kottis, V., Ghazi, A., Paquet, M., Crosby, K.,
Pomerleau, V., Uetani, N., and Pause, A. (2010). Renal tumour suppressor function of
the Birt-Hogg-Dube syndrome gene product folliculin. J Med Genet 47, 182-189.
Inoki, K., Li, Y., Xu, T., and Guan, K. (2003a). Rheb GTPase is a direct target of TSC2
GAP activity and regulates mTOR signaling. Gene Dev 17, 1829-1834.
Inoki, K., Li, Y., Zhu, T., Wu, J., and Guan, K. (2002). TSC2 is phosphorylated and
inhibited by Akt and suppresses mTOR signalling. Nat Cell Biol 4, 648-657.
Inoki, K., Zhu, T., and Guan, K. (2003b). TSC2 mediates cellular energy response to
control cell growth and survival. Cell 115, 577-590.
Isotani, S., Hara, K., Tokunaga, C., Inoue, H., Avruch, J., and Yonezawa, K. (1999).
Immunopurified mammalian target of rapamycin phosphorylates and activates p70 S6
kinase alpha in vitro. J Biol Chem 274, 34493-34498.
Jacinto, E., Loewith, R., Schmidt, A., Lin, S., Ruegg, M.A., Hall, A., and Hall, M.N.
(2004). Mammalian TOR complex 2 controls the actin cytoskeleton and is rapamycin
insensitive. Nat Cell Biol 6, 1122-1128.
31
Jaenecke, I., Boissel, J.-P.P., Lemke, M., Rupp, J., Gasnier, B., and Closs, E.I. (2012). A
chimera carrying the functional domain of the orphan protein SLC7A14 in the backbone
of SLC7A2 mediates trans-stimulated arginine transport. The Journal of biological
chemistry 287, 30853-30860.
Jezegou, A., Llinares, E., Anne, C., Kieffer-Jaquinod, S., O'Regan, S., Aupetit, J., Chabli,
A., Sagne, C., Debacker, C., Chadefaux-Vekemans, B., et al. (2012). Heptahelical
protein PQLC2 is a lysosomal cationic amino acid exporter underlying the action of
cysteamine in cystinosis therapy. Proceedings of the National Academy of Sciences of
the United States of America 109, 43.
Khoo, S., Giraud, S., Kahnoski, K., Chen, J., Motorna, 0., Nickolov, R., Binet, 0.,
Lambert, D., Friedel, J., Levy, R., et al. (2002). Clinical and genetic studies of Birt-HoggDube syndrome. J Med Genet 39, 906-912.
Kim, D.-H.H., Sarbassov, D.D., Ali, S.M., King, J.E., Latek, R.R., Erdjument-Bromage,
H., Tempst, P., and Sabatini, D.M. (2002). mTOR interacts with raptor to form a nutrientsensitive complex that signals to the cell growth machinery. Cell 110, 163-175.
Kim, E., Goraksha-Hicks, P., Li, L., Neufeld, T.P., and Guan, K.-L. (2008). Regulation of
TORC1 by Rag GTPases in nutrient response. Nat Cell Biol 10, 935-945.
Kimball, S.R., Horetsky, R.L., and Jefferson, L.S. (1998). Implication of eIF2B rather
than eIF4E in the regulation of global protein synthesis by amino acids in L6 myoblasts.
J Biol Chem 273, 30945-30953.
Koltin, Y., Faucette, L., Bergsma, D.J., Levy, M.A., Cafferkey, R., Koser, P.L., Johnson,
R.K., and Livi, G.P. (1991). Rapamycin sensitivity in Saccharomyces cerevisiae is
mediated by a peptidyl-prolyl cis-trans isomerase related to human FK506-binding
protein. Mol Cell Biol 11, 1718-1723.
Krause, U., Bertrand, L., Maisin, L., Rosa, M., and Hue, L. (2002). Signalling pathways
and combinatory effects of insulin and amino acids in isolated rat hepatocytes. European
journal of biochemistry / FEBS 269, 3742-3750.
Kroemer, G., Marino, G., and Levine, B. (2010). Autophagy and the integrated stress
response. Mol Cell 40, 280-293.
Kuo, C.J., Chung, J., Fiorentino, D.F., Flanagan, W.M., Blenis, J., and Crabtree, G.R.
(1992). Rapamycin selectively inhibits interleukin-2 activation of p70 S6 kinase. Nature
358, 70-73.
Laplante, M., and Sabatini, D.M. (2012). mTOR signaling in growth control and disease.
Cell 149, 274-293.
Liang, C., Feng, P., Ku, B., Dotan, I., Canaani, D., Oh, B.H., and Jung, J.U. (2006).
Autophagic and tumour suppressor activity of a novel Beclin1-binding protein UVRAG.
Nat Cell Biol 8, 688-699.
32
Liang, X.H., Jackson, S., Seaman, M., Brown, K., Kempkes, B., Hibshoosh, H., and
Levine, B. (1999). Induction of autophagy and inhibition of tumorigenesis by beclin 1.
Nature 402, 672-676.
Lingaas, F., Comstock, K.E., Kirkness, E.F., Sorensen, A., Aarskaug, T., Hitte, C.,
Nickerson, M.L., Moe, L., Schmidt, L.S., Thomas, R., et al. (2003). A mutation in the
canine BHD gene is associated with hereditary multifocal renal cystadenocarcinoma and
nodular dermatofibrosis in the German Shepherd dog. Hum Mol Genet 12, 3043-3053.
Liu, B., Du, H., Rutkowski, R., Gartner, A., and Wang, X. (2012). LAAT-1 is the
lysosomal lysine/arginine transporter that maintains amino acid homeostasis. Science
(New York, NY) 337, 351-354.
Loewith, R., Jacinto, E., Wullschleger, S., Lorberg, A., Crespo, J.L., Bonenfant, D.,
Oppliger, W., Jenoe, P., and Hall, M.N. (2002). Two TOR complexes, only one of which
is rapamycin sensitive, have distinct roles in cell growth control. Molecular cell 10, 457468.
Long, X., Lin, Y., Ortiz-Vega, S., Yonezawa, K., and Avruch, J. (2005). Rheb binds and
regulates the mTOR kinase. Curr Biol 15, 702-713.
Ma, L., Chen, Z., Erdjument-Bromage, H., Tempst, P., and Pandolfi, P.P. (2005).
Phosphorylation and functional inactivation of TSC2 by Erk implications for tuberous
sclerosis and cancer pathogenesis. Cell 121, 179-193.
Marino, G., Salvador-Montoliu, N., Fueyo, A., Knecht, E., Mizushima, N., and L6pezOtin, C. (2007). Tissue-specific autophagy alterations and increased tumorigenesis in
mice deficient in Atg4C/autophagin-3. The Journal of biological chemistry 282, 1857318583.
Mathew, R., Karp, C.M., Beaudoin, B., Vuong, N., Chen, G., Chen, H.-Y.Y., Bray, K.,
Reddy, A., Bhanot, G., Gelinas, C., et al. (2009). Autophagy suppresses tumorigenesis
through elimination of p62. Cell 137, 1062-1075.
Mathew, R., Kongara, S., Beaudoin, B., Karp, C.M., Bray, K., Degenhardt, K., Chen, G.,
Jin, S., and White, E. (2007). Autophagy suppresses tumor progression by limiting
chromosomal instability. Genes & development 21, 1367-1381.
Menon, S., Dibble, C.C., Talbott, G., Hoxhaj, G., Valvezan, A.J., Takahashi, H., Cantley,
L.C., and Manning, B.D. (2014). Spatial control of the TSC complex integrates insulin
and nutrient regulation of mTORC1 at the lysosome. Cell 156, 771-785.
Noboru, M. (2007). Autophagy: process and function. Genes & Development.
Nobukuni, T., Joaquin, M., Roccio, M., Dann, S.G., Kim, S.Y., Gulati, P., Byfield, M.P.,
Backer, J.M., Natt, F., Bos, J.L., et al. (2005). Amino acids mediate mTOR/raptor
signaling through activation of class 3 phosphatidylinositol 30H-kinase. P Natl Acad Sci
Usa 102, 14238-14243.
Okimoto, K., Sakurai, J., Kobayashi, T., Mitani, H., Hirayama, Y., Nickerson, M., Warren,
M., Zbar, B., Schmidt, L., and Hino, 0. (2004). A germ-line insertion in the Birt-Hogg-
33
Dube (BHD) gene gives rise to the Nihon rat model of inherited renal cancer. P NatI
Acad Sci Usa 101, 2023-2027.
Patti, M.E., Brambilla, E., Luzi, L., Landaker, E.J., and Kahn, C.R. (1998). Bidirectional
modulation of insulin action by amino acids. J Clin Invest 101, 1519-1529.
Peterson, T.R., Sengupta, S.S., Harris, T.E., Carmack, A.E., Kang, S.A., Balderas, E.,
Guertin, D.A., Madden, K.L., Carpenter, A.E., Finck, B.N., et al. (2011). mTOR complex
1 regulates lipin 1 localization to control the SREBP pathway. Cell 146, 408-420.
Petroulakis, E., Parsyan, A., Dowling, R.J., LeBacquer, 0., Martineau, Y., Bidinosti, M.,
Larsson, 0., Alain, T., Rong, L., Mamane, Y., et al. (2009). p53-dependent translational
control of senescence and transformation via 4E-BPs. Cancer cell 16, 439-446.
Pisoni, R.L., and Thoene, J.G. (1991). The transport systems of mammalian lysosomes.
Biochimica et biophysica acta 1071, 351-373.
Pisoni, R.L., Thoene, J.G., and Christensen, H.N. (1985). Detection and characterization
of carrier-mediated cationic amino acid transport in lysosomes of normal and cystinotic
human fibroblasts. Role in therapeutic cystine removal? The Journal of biological
chemistry 260, 4791-4798.
Pisoni, R.L., Thoene, J.G., and Lemons, R.M. (1987). Important differences in cationic
amino acid transport by lysosomal system c and system y+ of the human fibroblast.
Journal of Biological ....
Qu, X., Yu, J., Bhagat, G., Furuya, N., Hibshoosh, H., Troxel, A., Rosen, J., Eskelinen,
E.-L.L., Mizushima, N., Ohsumi, Y., et al. (2003). Promotion of tumorigenesis by
heterozygous disruption of the beclin 1 autophagy gene. The Journal of clinical
investigation 112, 1809-1820.
Ramirez-Montealegre, D., and Pearce, D.A. (2005). Defective lysosomal arginine
transport in juvenile Batten disease. Hum Mol Genet 14, 3759-3773.
Reiling, J.H., and Hafen, E. (2004). The hypoxia-induced paralogs Scylla and Charybdis
inhibit growth by down-regulating S6K activity upstream of TSC in Drosophila. Gene Dev
18, 2879-2892.
Robert, T.A., and Gregory, J.W. (1996). IMMUNOPHARMACOLOGY OF RAPAMYCIN1.
Immunology.
Robitaille, A.M., Christen, S., Shimobayashi, M., Cornu, M., Fava, L.L., Moes, S.,
Prescianotto-Baschong, C., Sauer, U., Jenoe, P., and Hall, M.N. (2013). Quantitative
Phosphoproteomics Reveal mTORC1 Activates de Novo Pyrimidine Synthesis. Science
339,1320-1323.
Roccio, M., Bos, J.L., and Zwartkruis, F.J.T. (2006). Regulation of the small GTPase
Rheb by amino acids. Oncogene 25, 657-664.
34
Roux, P.P., Ballif, B.A., Anjum, R., Gygi, S.P., and Blenis, J. (2004). Tumor-promoting
phorbol esters and activated Ras inactivate the tuberous sclerosis tumor suppressor
complex via p90 ribosomal S6 kinase. P Natl Acad Sci Usa 101, 13489-13494.
Sabatini, D.M. (2006). mTOR and cancer: insights into a complex relationship. Nature
reviews Cancer 6, 729-734.
Sabatini, D.M., Erdjument-Bromage, H., Lui, M., Tempst, P., and Snyder, S.H. (1994).
RAFT1: a mammalian protein that binds to FKBP1 2 in a rapamycin-dependent fashion
and is homologous to yeast TORs. Cell 78, 35-43.
Sabers, C.J., Martin, M.M., Brunn, G.J., Williams, J.M., Dumont, F.J., Wiederrecht, G.,
and Abraham, R.T. (1995). Isolation of a protein target of the FKBP1 2-rapamycin
complex in mammalian cells. J Biol Chem 270, 815-822.
Sancak, Y., Bar-Peled, L., Zoncu, R., Markhard, A.L., Nada, S., and Sabatini, D.M.
(2010). Ragulator-Rag Complex Targets mTORC1 to the Lysosomal Surface and Is
Necessary for Its Activation by Amino Acids. Cell 141, 290-303.
Sancak, Y., Peterson, T.R., Shaul, Y.D., Lindquist, R.A., Thoreen, C.C., Bar-Peled, L.,
and Sabatini, D.M. (2008). The Rag GTPases bind raptor and mediate amino acid
signaling to mTORC1. Science 320,1496-1501.
Sancak, Y., Thoreen, C.C., Peterson, T.R., Lindquist, R.A., Kang, S.A., Spooner, E.,
Carr, S.A., and Sabatini, D.M. (2007a). PRAS40 is an insulin-regulated inhibitor of the
mTORC1 protein kinase. Mol Cell 25, 903-915.
Sancak, Y., Thoreen, C.C., Peterson, T.R., Lindquist, R.A., Kang, S.A., Spooner, E.,
Carr, S.A., and Sabatini, D.M. (2007b). PRAS40 is an insulin-regulated inhibitor of the
mTORC1 protein kinase. Molecular cell 25, 903-915.
Sarbassov, D., Guertin, D., Ali, S., and Sabatini, D. (2005a). Phosphorylation and
regulation of Akt/PKB by the rictor-mTOR complex. In Science, pp. 1098-1101.
Sarbassov, D.D., Ali, S.M., Kim, D.-H.H., Guertin, D.A., Latek, R.R., ErdjumentBromage, H., Tempst, P., and Sabatini, D.M. (2004). Rictor, a novel binding partner of
mTOR, defines a rapamycin-insensitive and raptor-independent pathway that regulates
the cytoskeleton. Current biology : CB 14, 1296-1302.
Sarbassov, D.D., Guertin, D.A., Ali, S.M., and Sabatini, D.M. (2005b). Phosphorylation
and regulation of Akt/PKB by the rictor-mTOR complex. Science (New York, NY) 307,
1098-1101.
Saucedo, L., Gao, X., Chiarelli, D., Li, L., Pan, D., and Edgar, B. (2003). Rheb promotes
cell growth as a component of the insulin/TOR signalling network. Nat Cell Biol 5, 566571.
Schurmann, A., Brauers, A., Massmann, S., Becker, W., and Joost, H.G. (1995). Cloning
of a novel family of mammalian GTP-binding proteins (RagA, RagBs, RagB1) with
remote similarity to the Ras-related GTPases. The Journal of biological chemistry 270,
28982-28988.
35
Sekiguchi, T., Hirose, E., Nakashima, N., Ii, M., and Nishimoto, T. (2001). Novel G
proteins, Rag C and Rag D, interact with GTP-binding proteins, Rag A and Rag B. J Biol
Chem 276, 7246-7257.
Shaw, R., Bardeesy, N., Manning, B., Lopez, L., Kasmatka, M., DePinho, R., and
Cantley, L. (2004). The LKB1 tumor suppressor negatively regulates mTOR signaling.
Cancer Cell 6, 91-99.
Shaw, R.J., and Cantley, L.C. (2006). Ras, PI(3)K and mTOR signalling controls tumour
cell growth. Nature 441, 424-430.
She, Q.B., Halilovic, E., Ye, Q., Zhen, W., Shirasawa, S., Sasazuki, T., Solit, D.B., and
Rosen, N. (2010). 4E-BP1 is a key effector of the oncogenic activation of the AKT and
ERK signaling pathways that integrates their function in tumors. Cancer Cell 18, 39-51.
Smith, E.M., Finn, S.G., Tee, A.R., Browne, G.J., and Proud, C.G. (2005). The tuberous
sclerosis protein TSC2 is not required for the regulation of the mammalian target of
rapamycin by amino acids and certain cellular stresses. The Journal of biological
chemistry 280, 18717-18727.
Stocker, H., Radimerski, T., Schindelholz, B., Wittwer, F., Belawat, P., Daram, P.,
Breuer, S., Thomas, G., and Hafen, E. (2003). Rheb is an essential regulator of S6K in
controlling cell growth in Drosophila. Nat Cell Biol 5, 559-565.
Takagi, Y., Kobayashi, T., Shiono, M., Wang, L., Piao, X., Sun, G., Zhang, D., Abe, M.,
Hagiwara, Y., Takahashi, K., et al. (2008). Interaction of folliculin (Birt-Hogg-Dube gene
product) with a novel Fnipl-like (FnipL/Fnip2) protein. Oncogene 27, 5339-5347.
Takahashi, Y., Coppola, D., Matsushita, N., Cualing, H.D., Sun, M., Sato, Y., Liang, C.,
Jung, J.U., Cheng, J.Q., Mule, J.J., et al. (2007). Bif-1 interacts with Beclin 1 through
UVRAG and regulates autophagy and tumorigenesis. Nat Cell Biol 9, 1142-1151.
Tee, A.R., Anjum, R., and Blenis, J. (2003a). Inactivation of the tuberous sclerosis
complex-1 and -2 gene products occurs by phosphoinositide 3-kinase/Akt-dependent
and -independent phosphorylation of tuberin. The Journal of biological chemistry 278,
37288-37296.
Tee, A.R., Fingar, D.C., Manning, B.D., Kwiatkowski, D.J., Cantley, L.C., and Blenis, J.
(2002). Tuberous sclerosis complex-1 and -2 gene products function together to inhibit
mammalian target of rapamycin (mTOR)-mediated downstream signaling. P Natl Acad
Sci Usa 99, 13571-13576.
Tee, A.R., Manning, B.D., Roux, P.P., Cantley, L.C., and Blenis, J. (2003b). Tuberous
sclerosis complex gene products, Tuberin and Hamartin, control mTOR signaling by
acting as a GTPase-activating protein complex toward Rheb. Curr Biol 13, 1259-1268.
Toro, J.R., Wei, M.-H., Glenn, G.M., Weinreich, M., Toure, 0., Vocke, C., Turner, M.,
Choyke, P., Merino, M.J., Pinto, P.A., et al. (2008). BHD mutations, clinical and
molecular genetic investigations of Birt-Hogg-Dube syndrome: a new series of 50
families and a review of published reports. J Med Genet 45, 321-331.
36
Um, S.H., Frigerio, F., Watanabe, M., Picard, F., Joaquin, M., Sticker, M., Fumagalli, S.,
Allegrini, P.R., Kozma, S.C., Auwerx, J., et al. (2004). Absence of S6K1 protects against
age- and diet-induced obesity while enhancing insulin sensitivity. Nature 431, 200-205.
van Slegtenhorst, M., Khabibullin, D., Hartman, T.R., Nicolas, E., Kruger, W.D., and
Henske, E.P. (2007). The Birt-Hogg-Dube and tuberous sclerosis complex homologs
have opposing roles in amino acid homeostasis in Schizosaccharomyces pombe. J Biol
Chem 282, 24583-24590.
Verrey, F., Closs, E.I., Wagner, C.A., Palacin, M., Endou, H., and Kanai, Y. (2004).
CATs and HATs: the SLC7 family of amino acid transporters. Pflugers Arch 447, 532542.
von Manteuffel, S.R., Gingras, A.C., Ming, X.F., Sonenberg, N., and Thomas, G. (1996).
4E-BP1 phosphorylation is mediated by the FRAP-p70s6k pathway and is independent
of mitogen-activated protein kinase. Proc Natl Acad Sci U S A 93, 4076-4080.
Wang, X., Campbell, L.E., Miller, C.M., and Proud, C.G. (1998). Amino acid availability
regulates p70 S6 kinase and multiple translation factors. Biochem J 334 ( Pt 1), 261-267.
Wendel, H.-G.G., Silva, R.L., Malina, A., Mills, J.R., Zhu, H., Ueda, T., WatanabeFukunaga, R., Fukunaga, R., Teruya-Feldstein, J., Pelletier, J., et al. (2007). Dissecting
eIF4E action in tumorigenesis. Genes & development 21, 3232-3237.
White, M.F. (1985). The transport of cationic amino acids across the plasma membrane
of mammalian cells. Biochimica et Biophysica Acta (BBA) - Reviews on Biomembranes
822, 355374.
Xiao-Feng, Z., David, F., Jie, C., Gerald, R.C., and Stuart, L.S. (1995). TOR kinase
domains are required for two distinct functions, only one of which is inhibited by
rapamycin. Cell.
Xu, G., Kwon, G., Marshall, C.A., Lin, T.A., Lawrence, J.C., Jr., and McDaniel, M.L.
(1998). Branched-chain amino acids are essential in the regulation of PHAS-1 and p70
S6 kinase by pancreatic beta-cells. A possible role in protein translation and mitogenic
signaling. J Biol Chem 273, 28178-28184.
Yue, Z., Jin, S., Yang, C., Levine, A.J., and Heintz, N. (2003). Beclin 1, an autophagy
gene essential for early embryonic development, is a haploinsufficient tumor suppressor.
Proceedings of the National Academy of Sciences of the United States of America 100,
15077-15082.
Zhang, Y., Gao, X., Saucedo, L.J., Ru, B., Edgar, B.A., and Pan, D. (2003). Rheb is a
direct target of the tuberous sclerosis tumour suppressor proteins. Nat Cell Biol 5, 578581.
Zoncu, R., Bar-Peled, L., Efeyan, A., Wang, S., Sancak, Y., and Sabatini, D.M. (2011).
mTORC1 Senses Lysosomal Amino Acids Through an Inside-Out Mechanism That
Requires the Vacuolar*H+-ATPase. Science 334, 678-683.
37
CHAPTER 2
Reprinted from Cell Press:
The Folliculin tumor suppressor is a GAP for RagC/D GTPases that signal amino
acid levels to mTORC1
,
Zhi-Yang Tsun, 2 , Liron Bar-Peled1 2', Lynne Chantranupong 1 ,2 , Roberto Zoncu, 2
2 3
Tim Wang1,2 , Choah Kim 1 ,2, Eric Spooner', and David M. Sabatini1, ,
1Whitehead
Institute for Biomedical Research and Massachusetts Institute of
Technology, Department of Biology, Nine Cambridge Center, Cambridge, MA 02142,
2Koch
USA
Institute for Integrative Cancer Research, 77 Massachusetts Avenue, Cambridge,
MA 02139, USA
3 Howard
Hughes Medical Institute, Department of Biology, Massachusetts Institute of
Technology, Cambridge, MA 02139, USA
*
These authors contributed equally to this work
Correspondence should be addressed to D.M.S.
Tel: 617-258-6407; Fax: 617-452-3566; Email: sabatiniawi.mit.edu
Experiments
Experiments
Experiments
Experiments
Experiments
in
in
in
in
in
Figures 1, S1 were performed by LBP.
Figures 2D were performed by LC.
Figure 2C were performed by ZYT under guidance of TW.
Figures 3A, 3B, S2 were performed by ZYT under guidance of RZ.
Figures 2A, 2B, 2E, 2F, 3C, 3D, 4, S3 were performed by ZYT.
38
SUMMARY
The mTORC1 kinase is a master growth regulator that senses numerous environmental
cues, including amino acids. The Rag GTPases interact with mTORC1 and signal amino
acid sufficiency by promoting the translocation of mTORC1 to the lysosomal surface, its
site of activation. The Rags are unusual GTPases in that they function as obligate
heterodimers, which consist of RagA or B bound to RagC or D. While the loading of
RagA/B with GTP initiates amino acid signaling to mTORC1, the role of RagC/D is
unknown. Here, we show that RagC/D is a key regulator of the interaction of mTORC1
with the Rag heterodimer and that, unexpectedly, RagC/D must be GDP-bound for the
interaction to occur. We identify FLCN and its binding partners, FNIP1/2, as Raginteracting proteins with GAP activity for RagC/D, but not RagA/B. Thus, we reveal a role
for RagC/D in mTORC1 activation and a molecular function for the FLCN tumor
suppressor.
PU.LCN-FNIP
+Amino
acids
m TORCI
FLCN-FNIP GAP activity
towards RagC1D
HIGHLIGHTS
-RagC/D nucleotide state is a key determinant of mTORC1 binding to the Rag GTPases
-FLCN-FNIP complex interacts with the Rag GTPases in an amino-acid sensitive fashion
-FLCN is necessary for mTORC1 activation by amino acids
-FLCN-FNIP complex is a GTPase activating protein (GAP) for RagC/D
39
INTRODUCTION
The mechanistic target of rapamycin complex 1 (mTORC1) protein kinase is a
master regulator of growth. It senses a diverse set of signals, such as growth factors,
nutrient and energy levels, to regulate many anabolic and catabolic processes, including
protein, lipid, and nucleotide synthesis, as well as autophagy. Given that mTORC1
regulates a multitude of processes, it is not surprising that the pathway it anchors is
deregulated in various common diseases, including cancer (reviewed in Howell et al.,
2013; Kim et al., 2013; Yuan et al., 2013; Zoncu et al., 2011b).
The mechanisms through which mTORC1 senses and integrates stimuli have
-
been of great interest over the last few years. One key upstream factor is the TSC1
TSC2 tumor suppressor, which suppresses mTORC1 in response to growth factor or
energy deprivation (Brugarolas et al., 2004; Castro et al., 2003; Corradetti et al., 2005;
Garami et al., 2003; Inoki et al., 2003a; Inoki et al., 2003b; Ma et al., 2005; Reiling and
Hafen, 2004; Roux et al., 2004; Saucedo et al., 2003; Stocker et al., 2003; Tee et al.,
2003a; Tee et al., 2002; Tee et al., 2003b; Zhang et al., 2003). TSC1-TSC2 does so by
inhibiting Rheb, a GTP-binding protein that is an essential activator of the mTORC1
kinase activity (Long et al., 2005; Sancak et al., 2007).
mTORC1 is also acutely sensitive to drops in amino acid levels, but these
nutrients do not appear to signal through TSC1-TSC2 (Nobukuni et al., 2005; Roccio et
al., 2006; Smith et al., 2005). Instead, emerging evidence indicates that mTORC1
activation by amino acids requires a lysosome-associated machinery, comprised of the
vacuolar adenosine triphosphatase (v-ATPase), the Ragulator, and the Rag GTPases
(Kim et al., 2008; Sancak et al., 2010; Sancak et al., 2008; Zoncu et al., 2011 a). Like
Rheb, the Rags are members of the Ras-related GTP-binding superfamily of proteins,
but they are unusual in that they function as obligate heterodimers of RagA or B (A/B)
40
with RagC or D (C/D). RagA and RagB are highly homologous and redundant, as are
RagC and RagD (Hirose et al., 1998; Sancak et al., 2008; Schurmann et al., 1995;
Sekiguchi et al., 2001). We have proposed that amino acids signal from within the
lysosomal lumen to Ragulator, in a v-ATPase-dependent fashion. In turn, Ragulator
activates RagA/B through its guanine nucleotide exchange factor (GEF) activity. When
RagA/B is loaded with GTP, the Rag heterodimer recruits mTORC1 to the lysosomal
surface where it binds Rheb and becomes activated (Bar-Peled et al., 2013; Bar-Peled
et al., 2012; Efeyan et al., 2012).
Whereas much attention has focused on RagA/B, the role of RagC/D in
mTORC1 signaling has remained a mystery. Here, we make the surprising finding that
GDP-loading of RagC is necessary for the binding of mTORC1 to the Rag heterodimer,
and that the nucleotide state of RagC affects the activation of mTORC1 in response to
amino acids. Moreover, we identified the FLCN-FNIP complex as a potent GTPase
activating protein (GAP) for RagC/D that interacts with the Rag heterodimer in an amino
acid-sensitive fashion and localizes to the lysosomal surface upon amino acid starvation.
Thus, we provide a molecular function for FLCN, mutations in which cause the BirtHogg-Dub6 hereditary cancer syndrome, and reveal a role for RagC/D in amino acid
signaling to mTORC1.
RESULTS
The RagC Nucleotide State Determines mTORCI Binding to the Rag Heterodimer
The binding of mTORC1 to the heterodimeric Rag GTPases in the presence of
amino acids is a key event in the activation of mTORC1. Using two classes of Rag
nucleotide binding mutants, we and others have shown that the interaction between the
Rags and mTORC1 depends on the nucleotide configuration of the Rag heterodimer
41
(Gong et al., 2011; Sancak et al., 2008). The first class of mutations (RagBQ 9 9 Land
RagCQ12 0L) is analogous to the oncogenic H-RasQ'1L mutant (Frech et al., 1994; Krengel
et al., 1990) that abolishes GTPase activity and maintains RagB or RagC loaded with
GTP (Bar-Peled et al., 2012; Sancak et al., 2008). Mutations of the second class
(RagAT 2 1N, RagBT 54 N, and RagCS 7 5 N) disrupt the coordination of the magnesium co-factor
(Feig, 1999; Feig and Cooper, 1988; John et al., 1993), resulting in mutants with much
lower affinity for all nucleotides but with likely preferential binding of GDP over GTP
within cells (Bar-Peled et al., 2012; Sancak et al., 2008).
To test the contribution of each Rag to the binding of mTORC1, we expressed
combinations of Rag nucleotide mutants in human embryonic kidney (HEK)-293T cells.
99
Consistent with previous reports (Gong et al., 2011; Sancak et al., 2008), RagBQ L_
CS 7 5 N co-immunoprecipitated the largest amount of endogenous mTORC1 (Figure IA).
From these data, as well as the observation that RagAT 2 1N- or RagBT 5 4 N-containing
heterodimers do not co-immunoprecipitate mTORC1, it has been supposed that RagA/B
nucleotide state is the major determinant for mTORC1 binding (Gong et al., 2011;
Sancak et al., 2008). To re-examine which Rag heterodimer is responsible for mTORC1
binding, we immunoprecipitated single Rag nucleotide mutants paired with wild-type
partners. Surprisingly, RagB-CS 7 5 N, but not RagBQ 9 9 L-C, was sufficient to recover large
amounts of mTORC1 similar to that of RagBQ 99 LCS 7 5 N, suggesting that the RagC
nucleotide state determines mTORC1 binding (Figure 1A).
Because the behavior of these mutants may not reflect that of nucleotide-loaded,
wild-type Rags, we developed an in vitro assay in which we load purified Rag
heterodimers with specified nucleotides and monitor their ability to bind to raptor, the
Rag-binding subunit of mTORC1. Unexpectedly, wild-type Rags loaded with GDP bound
more raptor than Rags loaded with GTP (Figure 1 B), suggesting that the GDP-bound
state of one or both Rags promotes raptor binding. To determine which Rag in the
42
heterodimer is responsible for this effect, we employed another class of Rag nucleotide
mutants that has base specificity for xanthine rather than guanine nucleotides (BarPeled et al., 2012; Hoffenberg et al., 1995; Schmidt et al., 1996). We term these RagBX
and RagCX (RagBD1
63
N,
RagCD1 81N), as they bind less than 2% of the amount of guanine
nucleotides bound by their wild-type counterparts (Bar-Peled et al., 2012). Consistent
with the results obtained in cells, the RagC nucleotide state determined raptor binding,
as only GDP-loaded RagBx-C could bind raptor (Figure 1 C). Importantly, RagB-CX
loaded with XDP also recovered raptor, suggesting that the state induced by the
nucleotide diphosphate loading of RagC promotes raptor binding (Figure 1 D). Thus,
unlike most GTPases, which activate their effectors in the GTP-bound state, it is the
GDP-bound state of RagC that promotes raptor binding to the Rag heterodimer.
Given that the nucleotide state of RagC is important for mTORC1 binding, we
reasoned that expression of RagC nucleotide mutants might alter the sensitivity of the
mTORC1 pathway to amino acid levels. Indeed, expression of RagCS 7 5 Nrendered
mTORC1 activity resistant to amino acid starvation, as judged by phosphorylation of S6
kinase (S6K1), a canonical mTORC1 substrate (Figure 1E). Conversely, the GTP-bound
mutant RagCQ 2 0L blunted mTORC1 activity, even in the presence of amino acids. Thus,
RagC plays a pivotal role in mediating the binding of mTORC1 to the Rag heterodimer
and manipulating the nucleotide state of RagC affects mTORC1 pathway activity.
FLCN Interacts with the Rag GTPases in an Amino Acid-Sensitive Fashion
Because RagC is critical for mTORC1 activation, we sought to identify regulators
of its nucleotide state. We employed proteomic approaches that have successfully
identified other mTORC1 pathway components (see Experimental Procedures). Mass
spectrometric analysis of anti-FLAG immunoprecipitates prepared from HEK-293T cells
stably expressing FLAG-tagged RagA, -B, -C, or -D, but not control proteins,
43
consistently identified peptides derived from Folliculin (FLCN) and its interacting
partners, FNIP1 and FNIP2.
FLCN is evolutionarily conserved, yet its molecular function remains unknown
(Schmidt, 2012; van Slegtenhorst et al., 2007). Loss-of-function mutations in FLCN
cause a familial cancer syndrome called Birt-Hogg-Dube (BHD), characterized by
hamartomatous tumors of the hair follicle (fibrofolliculomas), kidney, and lung (BIRT et
al., 1977; Nickerson et al., 2002). Given that TSC1/2, PTEN, and LKB1-genes linked to
other hamartoma syndromes-are bona fide tumor suppressors that impinge on the
mTORC1 pathway, FLCN is likely a regulator of the pathway (Baba et al., 2006; Guertin
and Sabatini, 2007). In addition, there is emerging evidence that FLCN plays a role in
mTORC1 nutrient sensing, potentially implicating the involvement of the Rags. For
example, deletions of the fission yeast orthologs of FLCN and TSC1/2 have opposite
effects on the expression of amino acid metabolism genes (van Slegtenhorst et al.,
2007). Furthermore, a chemical genomic screen revealed that the deletion mutants for
the budding yeast orthologs of FLCN (LST7) and the Rags (GTR1, GTR2) exhibited
similar growth sensitivities to various environmental and chemical insults (Figure S1)
(Hillenmeyer et al., 2008). FLCN forms a complex with either FNIP1 or FNIP2, paralogs
with 74% sequence similarity (Baba et al., 2006; Hasumi et al., 2008; Takagi et al.,
2008). The FNIPs directly interact with AMP-activated protein kinase (AMPK), an
energy-sensor that monitors the AMP/ATP ratio. Given these results, the possibility that
the FLCN-FNIP complex interacts with the Rags was of great interest.
To begin to verify our mass spectrometric identification of FLCN and FNIPs as
Rag-interacting proteins, we expressed them alone or in combination in HEK-293T cells.
Endogenous RagA and RagC co-immunoprecipitated with FLCN when it was coexpressed with FNIP2, but not with metap2, or when FLCN or FNIP2 were expressed
44
alone (Figure 2A). This suggests that a FLCN-FNIP2 complex is required for either
FLCN or FNIP2 to interact with the Rags.
The Rags, Ragulator, and v-ATPase, established components of the mTORC1
nutrient-sensing machinery, all engage in nutrient-responsive interactions with each
other (Bar-Peled et al., 2012; Efeyan et al., 2013; Zoncu et al., 2011 a). Like that of
Ragulator and the v-ATPase, the interaction between endogenous FLCN and the Rag
heterodimer, isolated through stably expressed RagB, strengthened upon amino acid
starvation (Figure 2B).
FLCN is Necessary for mTORC1 Activation and Localization to the Lysosomal
Membranes
Studies investigating the role of FLCN in the mTORC1 pathway in mammalian
systems have yielded equivocal results. While in most cell-based systems acute loss of
FLCN inhibits mTORC1 activation (Bastola et al., 2013; Hartman et al., 2009; Hudon et
al., 2010; Takagi et al., 2008; van Slegtenhorst et al., 2007), deletion of FLCN in tissues
in vivo, causes mTORC1 hyperactivation (Baba et al., 2008; Baba et al., 2012; Chen et
al., 2008; Hasumi et al., 2009) (see Discussion for more details). In the cell-based
assays we have used to study other mTORC1 components, we find that FLCN is indeed
necessary for mTORC1 activation by amino acids. In HEK-293T cells, short-hairpin
RNAs (shRNAs) targeting FLCN suppressed mTORC1 activation by amino acids, as
read out by the phosphorylation of S6K1 (Figure 2C). This phenotype was recapitulated
in Drosophila S2 cells treated with double stranded RNAs (dsRNAs) targeting the
ortholog of FLCN, indicating that the function of FLCN is conserved (Figure 2D).
Collectively, these results show that FLCN interacts with the Rag GTPases in a nutrientsensitive manner and is necessary for mTORC1 activation by amino acids.
45
A key event in the activation of mTORC1 by amino acids is its recruitment to the
lysosomal surface by the Rag GTPases (Sancak et al., 2010). In HEK-293T cells
expressing shRNAs targeting FLCN, mTOR failed to localize to LAMP2-positive
lysosomes in response to amino acid stimulation (Figure 2E). Unlike Ragulator, the
lysosomal scaffold for the Rags, FLCN was not required for Rag subcellular localization
(Figure 2F). Thus, although the Rags localize appropriately to the lysosomal membranes
in FLCN knockdown cells, mTORC1 is unable to be recruited there. These results are
consistent with FLCN being required for mTORC1 activation by amino acids (Figure 2C).
FLCN Co-Localizes with the Rag GTPases on the Lysosomal Surface in an Amino
Acid-Sensitive Fashion
Given that FLCN and FNIPs are enriched in membranes (Takagi et al., 2008)
and that FLCN interacts with the Rag GTPases, we tested the possibility that FLCN itself
may localize to the lysosomal surface. Indeed, in HEK-293T cells co-expressing HAFNIP2, GFP-tagged FLCN co-localized with RFP-tagged LAMP1, a lysosomal marker
(Figure 3A), and this association persisted over time as lysosomes trafficked within the
cell (Figure 3B). Consistent with previous reports (Takagi et al., 2008), FLCN-GFP was
found diffusely throughout the cell when FNIP2 was not co-expressed (Figure S2),
suggesting that FNIP2 is required for the lysosomal localization of FLCN.
Despite detecting amino acid-sensitive interactions between the Rags and FLCN
in co-immunoprecipitation experiments, initial tests using transiently co-expressed FLCN
and FNIP2 did not reveal appreciable nutrient-responsive changes in their localization.
We reasoned that overexpression might overwhelm endogenous regulatory
mechanisms; therefore, we sought to probe the localization of endogenous FLCN using
an anti-FLCN antibody. Although knockdown of FLCN expression did not diminish the
immunofluorescence signal of most anti-FLCN antibodies we tested, we did identify one
46
antibody that showed both specific (lysosomal) and non-specific (nuclear) signals
(Figure 3C). Using this antibody we found that, in HEK-293T cells, endogenous FLCN
was enriched at the lysosomal surface during amino acid starvation and dispersed upon
amino acid stimulation (Figure 3C). Furthermore, in HEK-293T cells treated with Torin1,
an ATP-competitive inhibitor of mTOR (Thoreen et al., 2009), FLCN still dispersed from
the lysosome upon amino acid stimulation (Figure 3D). Thus, FLCN localizes to the
lysosomal surface during amino acid starvation, but leaves this site upon amino acid
stimulation in an mTORC1 activity-independent manner. This regulated localization of
FLCN to the lysosomes is consistent with the increased binding of FLCN to the Rags
under amino acid starvation conditions (Figure 2B).
FLCN-FNIP2 is a GAP for RagC and RagD
Regulators of GTP-binding proteins commonly associate with either the GTP- or
GDP-bound form of their cognate GTPases (Takai et al., 2001). To investigate the
molecular function of the FLCN-FNIP complex, we asked if it exhibits any preferential
binding to the Rag GTPase mutants. Different combinations of Rag mutants were coexpressed with FNIPs in HEK-293T cells. Interestingly, Rag heterodimers containing low
affinity nucleotide mutants behaved in opposite ways; large amounts of endogenous
FLCN co-purified with the RagBT5 4 N-C heterodimer, whereas little FLCN was recovered
with RagB-CS 7 5 N (Figure 4A). In contrast, RagB-CS 7 5Nwas able to interact with mTORC1
and Ragulator, as detected through their raptor and p18 subunits, respectively.
These binding properties are consistent with several possible functions for the
FLCN-FNIP complex. The robust binding to RagBT 54 Nsuggests that the FLCN-FNIP
complex might be a guanine nucleotide exchange factor (GEF) or GDP dissociation
inhibitor (GDI) for RagB (Bos et al., 2007; DerMardirossian and Bokoch, 2005).
Intriguingly, a recent report of the crystal structure of the FLCN C-terminal domain
47
revealed that despite having almost no sequence similarity, it shares structural similarity
with the DENN domain, which has GEF activity towards the Rab GTPases (Nookala et
al., 2012). Alternatively, although not mutually exclusively, the inability of FLCN to
interact with RagCS 75 Nindicates that the FLCN-FNIP complex prefers binding to RagC in
its GTP-bound state, a property shared by many GTPase activating proteins (GAPs)
(Bos et al., 2007; Takai et al., 2001).
Because the Rags function as obligate heterodimers, it was necessary to monitor
the nucleotide state of one Rag at a time. To accomplish this, we assembled Rag
heterodimers composed of a wild-type Rag with its appropriate RagX partner. Thus,
loading with radiolabeled guanine and unlabeled xanthine nucleotides allowed us to
selectively monitor the nucleotide state of the wild-type Rag, as previously described
(Bar-Peled et al., 2012). Purified FLCN-FNIP complex did not stimulate or inhibit the
dissociation of GDP from RagB or RagC when coupled with either a RagX or wild-type
partner (Figures S3A-S3C). These results suggest that FLCN-FNIP does not have GEF
or GDI activities towards the Rags. Instead, the strong binding to RagBT 5 4 Nmight
indicate that RagB serves as a docking site for FLCN-FNIP on the Rag heterodimer. As
RagB is GDP-bound during amino acid starvation, this behavior would be consistent with
both the increased binding to the Rag heterodimer and lysosomal localization of FLCN
under this condition (Figures 2B and 3C).
We pursued the possibility that the FLCN-FNIP complex may be a GAP for
RagC/D. To assay GTPase activating activity towards one Rag at a time, we prepared
Rag heterodimers with a wild-type Rag partnered with a doubly mutated Rag that binds
xanthine nucleotides but lacks GTPase activity, termed RagBQ 9 9 L-X and RagCQ12
0LX.
expected, purified GATOR1, a GAP for RagA/B (Bar-Peled et al., 2013), strongly
stimulated the GTPase activity of RagB, but not RagC or RagD (Figures 4B-4D).
Conversely, purified FLCN-FNIP2 potently stimulated GTP hydrolysis by RagC and
48
As
RagD, but not RagA, RagB, or Rap2A (a control GTPase), in a time- and dosedependent manner (Figures 4B-4E, 4G, S3D). Similar degrees of GAP activity were
observed toward RagC when RagBx was loaded with either XTP or XDP, suggesting
that the GAP activity towards RagC/D is not dependent on the nucleotide state of
RagA/B (Figure 4F). The FLCN-FNIP1 complex was overall less active than FLCNFNIP2 and appears to prefer RagD instead of RagC (Figures 4B and 4C).
The observed GTP hydrolysis was not due to contaminating phosphatases
because addition of purified FLCN-FNIP2 to free GTP showed minimal hydrolysis
(Figure S3E). Furthermore, an FLCN-FNIP2 complex with FLCN lacking its N-terminal
region (Nookala et al., 2012), but that still interacts with the Rags, did not exhibit GAP
activity, suggesting that this region is required for the GAP activity (Figure 4F). In
contrast to a recent report that proposed that the leucyl-tRNA synthetase (LRS) acts as
a GAP for RagD (Han et al., 2012), purified LRS did not increase basal GTPase activity
of any of the Rags in any condition tested (Figures 4B-D). Lastly, purified FLCN or
FNIP2 alone did not have GAP activity for the Rags, suggesting that an intact complex is
required (Figure 4F).
As RagC-GDP is required for mTORC1 binding to the Rag heterodimer (Figure
1), we asked if FLCN-FNIP2 GAP activity was sufficient to promote binding of mTORC1
to the Rags in vitro. Indeed, addition of FLCN-FNIP2, but not a control protein, caused
RagBX-C loaded with GTP to bind raptor (Figure 4H). Together, these results indicate
that FLCN-FNIP2 acts as a positive component of the mTORC1 pathway by promoting
the binding of mTORC1 to the Rag heterodimer via its GAP activity for RagC and RagD.
49
DISCUSSION
A growing body of evidence indicates that the Rags and Rheb are key
components of a coincidence detector mechanism that ensures mTORC1 is active only
in the appropriate growth conditions (reviewed in Dibble and Manning, 2013; Efeyan et
al., 2012; Kim et al., 2013; Yuan et al., 2013). Through a Rag-mediated pathway, amino
acids recruit mTORC1 to the lysosomal surface, where it can encounter Rheb. If growth
factors and energy levels are sufficient, Rheb then binds to and activates the kinase
activity of mTORC1. Our new findings support the idea that the Ragulator-Rag complex
is a nutrient-regulated docking site for mTORC1 on lysosomes, in which the nucleotide
state of RagC, and likely RagD, is the key determinant of mTORC1 binding.
Our work raises a number of intriguing questions. First, given the importance of
RagC in the binding of the Rag heterodimer to mTORC1, what is the role of RagA/B? It
is clear that RagA/B plays a dominant role in mTORC1 activation as expression of a
RagA/B mutant that is bound constitutively to GTP makes the mTORC1 pathway
completely insensitive to amino acid starvation (Efeyan et al., 2013; Kim et al., 2008;
Sancak et al., 2008). A likely possibility is that RagA/B controls a process that has not
been recognized but is critical for mTORC1 signaling. For example, RagA/B may
regulate the subcellular localization of the heterodimer, thereby controlling its access to
mTORC1. While the Rag proteins appear to be constitutively localized to the lysosomal
surface, there may be a pool of Rag heterodimers that cycle on and off lysosomes upon
amino acid stimulation, enabling them to find and retrieve mTORC1 from its nonlysosomal location in amino acid-starved cells. This cycling could be controlled by the
RagA/B nucleotide state, which would be consistent with the observation that the loading
of RagA/B with GDP greatly strengthens the binding of the Rag heterodimer to
Ragulator, its lysosomal scaffold (Bar-Peled et al., 2012).
50
Such a model could also help address a second conundrum. As mTORC1 and
the Rags reside on the lysosomal surface in the presence of amino acids, why is FLCN
found diffusely in the cytoplasm under this same condition? A possibility consistent with
the above model is that FLCN activates RagC/D in Rag heterodimers that have come off
the lysosomes upon amino acid stimulation and are on route to recruiting mTORC1.
Alternatively, in amino acid starved cells FLCN might be poised at the lysosomal surface
to activate RagC/D upon the restoration of amino acid levels, but such a scenario would
require a mechanism to regulate the FLCN-FNIP GAP activity.
A third question is why FLCN is a tumor suppressor and yet in most studies in
cultured cells and whole organisms, including ours, it scores as a positive component of
the TORC1 pathway (Baba et al., 2006; Bastola et al., 2013; Hartman et al., 2009;
Hudon et al., 2010; Liu et al., 2013; Takagi et al., 2008; van Slegtenhorst et al., 2007). It
is possible that in response to the suppression of mTORC1 signaling caused by FLCN
loss, cells overdrive other pathways that more than compensate for mTORC1 inhibition.
Indeed, in FLCN-null kidney tumors and cysts, as well as embryonic stem cells, the RasMAPK, Akt, and mTORC1 pathways all appear hyperactive (Baba et al., 2008; Cash et
al., 2011; Chen et al., 2008; Hasumi et al., 2009), although this could reflect the
proliferative state of the cells. Furthermore, in FLCN-null tumors there must be a
mechanism to reactivate mTORC1, suggesting that there may be proteins that can
compensate for FLCN loss. Candidates for such a role include C9orf72 and SMCR8,
which have very little sequence homology with FLCN, but like it, are predicted to have
DENN-like domains (Levine et al., 2013; Zhang et al., 2012). Lastly, it is likely that future
studies will reveal that the FLCN-FNIP complex funnels so far unidentified regulatory
signals to the Rag pathway so as to modulate amino acid sensing by mTORC1.
51
FIGURE 1: The RagC Nucleotide State Determines mTORC1 Binding to the Rag
Heterodimer and Regulates Amino Acid Sensing by mTORC1
Input
FLAG-raptor:
RagC 01 20L: GTP hydrolysis mutant RagC S75N: low affinity for all nucleotides
RagB 099L: GTP hydrolysis mutant RagB T54N: low affinity for all nucleotides
transfected HA-ST-RagC:
FLAG-RagB:
cDNAs:
FLAG-Rap2A:
-
W00120L
-
WT
T54N
+-
-
mTOR
S75N WT
099L T54N
WT S75N 0120L
WT
099L WT
pull-down:
+
5
HA-GST-RagB + HA-RagC:
NA-GST-Rap2A:
in vitro
binding
+
-
+
+
+
GST
+
bad fo
l
1Ctd
FLAG-raptOr
assay
-----
+
+
5%
C
Rag Nucleotide Mutants
+
A
HA-GST-RagBx
AW
HA-RagC
HA-GST-RW2A
raptor
HA-GST-RagC
HA-GST-Rap2A
raptor
HA-RagB
+
HA-RagB:
HA-GST-Rap2A:
+
+
GTP
+
-
amino acida:
FLAG-raptor
in vitro
binding
I: -T389-S6K1
HA-GsT-RagC
FLAG
NA-GsT-Rap2A
lysate
FLAG-SOKI
assay
HA-GST-RagC
HA-GsT-RagB
HA-RagB
52
+
R&g8
FLAG-S6K1
RagB
+
+
RagB
RagC RagCal"a RagC01?
+ "-+
GST
+
GTP XDP XTP
&
GOP
_k
-
--
+
+ +
+
+
transfected
cDNAs:
-
FLAG-raptor:
HA-GsT-RagC
E
+
-+GDP
HA-GST-RagC
lysate
pull-down: GST
+
FLAG-raptOr 4
mTOR
5%
Input
+
-
in vitro
binding
assay
FLAG-Rap2A
B
pull-down:
+
+
FLAG-raptOr:
HA-GST-RagCx+ HA-RagB:
HA-GsT-Rap2A:
+
5%
Input
FLAG-RagB
-
IP:
FLAG
FIGURE 2: FLCN-FNIP2 is a Rag-interacting Complex and is Necessary for
mTORC1 Activation by Amino Acids
A
B
C ORMA: GFP FLCN1
transfectedt&*dl
cDNA:
M.sRA
cells expressing* LG
L* Ra
s
amino acids:
-
WWI"
F
-
LN1FC_
+
-+
FC
R-gC
1p:
FLAG
- +
"
RaAFLCN
IP:
amino ackis:
(9T3ag-4sK1
F!!1
+
F
FaaFMiLCA
NAagO
FLA-feta
Ake
RegANMA*
lysale
RsA111
FLCN 1006*
R-gCO M"
HA-FNIP2 -_j
FLAG-MNP2 -yat
pi
-g
1"s
_tm
FA2,g
FLA-tsp
FLAG-ROPM4A
E
ShGPP
antibody:
mTOR
--
LAMP2
dw6
F
*hFLCN-2
mTOR
LAMP2
EL
antibody:
ahGFP
LAMP2
ShFLCN_2
LAMP2
flmTORar
LAMP2
-A.&. for
0nin
.yu
T90d6
aL
for
LAMP2
&AL for
TOR
LAMP2
53
-Wmi
LAMP2
"."aC
FIGURE 3: FLCN Localizes to the Lysosomal Surface in an Amino Acid-Sensitive
Fashion
A
C
B
shGFP
antibody:
-a.a. for
50min
-a.a. for
50min
+a.a. for
10min
D
DMSO
antibody:
*hFLCN_2
I
I
.CN
LAMP2
merge
FLCN
LAMP2
merge
Torin1
FL
FLCN
-a.a. for
50min
I
LAMP2
merge
-a.a. for
FLCN
50min
LAMP2
+a.a. for
merge
10min
54
FIGURE 4: FLCN-FNIP is a GTPase-Activating Protein Complex for RagC and
RagD
C
RagBsO"-RagD
A
HA-FNIP1+ HA-FNIP2 8
B
Rag8"-B-RagC
Condition: buffer
LAS
FLCN
GATORI FNIP2
FLCN
Condition: buffer
FNIPI
LRS
FLCN
GATORI FFIP2
FLCN
FNIP1
-
transfected NA-GST-RagC: - WT W7 WT I -,
RAG-RagS: - W. -IL 1, WT WI
cDNAs:
FLA-Rbp2A: +
FLCN
raptor
a
GDP
GDP
GTP
GTP
0
PIS
FLAG-RagS
%GDP:
50,24
13,23
5.,
17
000,0
%GDP:
201.S9
D
'LAG-fp2A
reptor 400s
am
a M M4
Condition: buffer
1
52
3
FNIP2
FLCN
FNi1
Rap2A
Condition: buffer
FLCN
FNIP2
FLCN
FMP1
GOP
FLAo-RagB
087,*1
164,3
%GDP:
154,27
30 min
3.0%
84.5%
843%
5.6%
5,7%
3.8%
90
G
Nueleotldes
Loaded
GTP, XDP
GTP. XDP
GTP, XTP
GT, XDP
GTP, XDP
GTP. XDP
-
0
-0'C..fafl
H
-tCF
5
in vitro
binchng
assay
dao
030
20
20,07
36,06
FLAG-rapto: T
s'o
E
24,0
HA-as-Rap2A:
FLAG-raptor W
6A-csT-RagD'
HA-RagC
HA-oST-Rap2AO
0
5
6
4
3
1
2
Molar Ptmio (Protein : RegEa'RagC)
55
7
'+
A4sT-wtagB' + HA-RagC:
+
40,00
30 rain
RagB--R8gC
Condition
Buffer only
FLCN-FNIP2
FLCN-FNIP2
FLCN alone
FNIP2 alone
FLC~aN-trmn)-FNIP2
13,02
9
GTP
-
%GDP:
FLAGO-fp2A
9,
9TP 9
C
F
GATOR
FLCN
9
GOP
HA-GST-RagC
lysato
LRS
36,0
21,01
E
RagB-Ragca'4-x
FLCN
6,14
30 min
30 nIn
+
FLAG
#
IIA.OST.RagC
yPs
M
0
4
-1,1
FIGURE LEGENDS
Figure 1. The RagC Nucleotide State Determines mTORCI Binding to the Rag Heterodimer
and Regulates Amino Acid Sensing by mTORC1
(A) Rag heterodimers containing RagCS75N co-immunoprecipitate the largest amount of
endogenous mTORC1. Anti-FLAG immunoprecipitates were prepared from HEK-293T cells
expressing the indicated cDNAs. Cell lysates and immunoprecipitates were analyzed by
immunoblotting for the indicated proteins.
(B) Raptor preferentially binds a GDP-loaded Rag heterodimer. In vitro binding assay in which
recombinant HA-GST-tagged-RagB-RagC or -Rap2A were loaded with the indicated nucleotide
and incubated with purified FLAG-tagged raptor protein. HA-GST precipitates were analyzed by
immunoblotting for indicated proteins. Irrelevant lanes were removed and indicated by a dashed
line.
(C) Raptor only binds to the RagBX-C heterodimer when RagC is GDP-loaded. In vitro binding
assay in which recombinant HA-GST-tagged-RagBX-RagC or -Rap2A were loaded with the
indicated nucleotide and incubated with purified FLAG-tagged raptor protein and analyzed as in
(B).
(D) Raptor only binds to the RagB-CX heterodimer when RagCX is XDP-loaded. In vitro binding
assay in which recombinant HA-GST-tagged-RagB-RagCx or -Rap2A were loaded with the
indicated nucleotide and incubated with purified FLAG-tagged raptor protein and analyzed as in
(B).
(E) Expression of RagC S75N or RagCQ10IL renders the mTORC1 pathway insensitive to amino acid
levels. HEK-293T cells expresssing the indicated cDNAs were analyzed as in (A). Irrelevant lanes
were removed and indicated by a dashed line.
Figure 2. FLCN-FNIP2 is a Rag-Interacting Complex and is Necessary for mTORCI
Activation by Amino Acids
56
(A) Recombinant epitope-tagged FLCN-FNIP2 co-immunoprecipitates endogenous RagA and
RagC. Anti-FLAG immunoprecipitates were prepared from HEK-293T cells expressing the
indicated cDNAs in expression vectors and analyzed along with cell lysates by immunoblotting for
indicated proteins. Irrelevant lanes were removed and indicated by a dashed line.
(B) Amino acid starvation increases the amount of endogenous FLCN that co-immunoprecipitates
with recombinant RagB. HEK-293T cells stably expressing FLAG-RagB were starved for amino
acids for 50 min, or starved and stimulated with amino acids for 10 min. Anti-FLAG
immunoprecipitates were analyzed as in (A).
(C) FLCN is necessary for the activation of the mTORC1 pathway by amino acids. HEK-293T
cells expressing a control shRNA or two distinct shRNAs targeting FLCN were starved for amino
acids for 50 min, or starved and stimulated with amino acids for 10 min. Levels of indicated
proteins and phosphorylation states were analyzed by immunobloting of cell lysates.
(D) FLCN function is conserved in Drosophila cells. Drosophila S2 cells were transfected with a
control dsRNA, or dsRNAs targeting dRagB, or dFLCN, starved of amino acids for 90 min, or
starved and re-stimulated with amino acids for 30 min and analyzed as in (C).
(E) Knockdown of FLCN prevents amino acid-induced translocation of mTOR to lysosomes.
HEK-293T cells expressing the indicated shRNAs were starved or starved and re-stimulated with
amino acids for the specified times before co-immunostaining for mTOR (red) and LAMP2
(green).
(F) FLCN is not required for the lysosomal localization of RagC. HEK-293T cells expressing the
indicated shRNAs were treated and processed as described in (E).
In all images, insets show selected fields that were magnified two times and their overlays. Scale
bars represent 10 pm.
See also Figure S1.
Figure 3. FLCN Localizes to the Lysosomal Surface in an Amino Acid-Sensitive Fashion
57
(A) FLCN localizes to the lysosomal surface. Spinning disk confocal image of a HEK-293T cell
co-expressing FLCN-GFP, HA-FNIP2, and mRFP-LAMP1 (pseudo-colored red and green in
merge, respectively).
(B) FLCN associates with lysosomes as they traffic within cells. Time-lapse of FLCN- and
LAMP1-positive lysosomes from the boxed region in (A) magnified by 2.5 times. Time intervals
are in seconds.
(C) FLCN localizes to the lysosomal surface upon amino acid starvation. HEK-293T cells
expressing the indicated shRNAs were starved or starved and re-stimulated with amino acids for
the specified times before co-immunostaining for FLCN (red) and LAMP2 (green).
(D) Amino acid-sensitive localization of FLCN is independent of mTORC1 activity. HEK-293T
cells treated with DMSO or Torin1 (250 nM) were starved or starved and re-stimulated with amino
acids for the specified times before co-immunostaining for FLCN (red) and LAMP2 (green). In (C)
and (D), insets show selected fields that were magnified two times and their overlays. All scale
bars represent 10 pm.
See also Figure S2.
Figure 4. FLCN-FNIP is a GTPase-Activating Protein Complex for RagC and RagD
(A) Rag heterodimers containing RagB T54N, but not RagCS75N, co-immunoprecipitate endogenous
FLCN. Anti-FLAG immunoprecipitates were prepared from HEK-293T cells transfected with
indicated cDNAs in expression vectors. Cell lysates and immunoprecipitates were analyzed by
immunoblotting of indicated proteins.
(B) FLCN-FNIP stimulates GTP hydrolysis by RagC. 5 pmol of RagB Q 99L-X-RagC was loaded with
[a- P]GTP and incubated with indicated proteins (20 pmol). GTP hydrolysis was determined by
thin-layer chromatography (see Experimental Procedures). Each value represents the mean
SD
(n=3).
(C) FLCN-FNIP stimulates GTP hydrolysis by RagD. GAP assay was performed with RagB Q9L-X_
RagD as described in (B).
58
(D) GATOR1, but not FLCN-FNIP1/2, stimulates GTP hydrolysis by RagB. GAP assay was
performed with RagB-RagCQ
-
as described in (B).
(E) FLCN-FNIP does not stimulate GTP hydrolysis by Rap2A. GAP assay was performed with the
Rap2A control GTPase as described in (B).
(F) Nucleotide state of RagB does not affect FLCN-FNIP2 GAP activity towards RagC, FLCNFNIP2 complex is required for GAP activity, and N-terminal region of FLCN is required for GAP
activity. GAP assays were performed as described in (B) with 10 min incubations of indicated
proteins. Values represent an average from at least 2 experiments.
(G) FLCN-FNIP2 stimulates GTP hydrolysis by RagC in a dose-dependent manner. GAP assay
was performed as described in (B) with indicated molar ratios of FLCN-FNIP2 or control metap2
to RagBx-RagC.
(H) In vitro, the FLCN-FNIP2 GAP activity is sufficient to cause raptor to bind to the Rags. In vitro
binding assay in which recombinant HA-GST-tagged-RagBX-RagC or -Rap2A were loaded with
the indicated nucleotide and incubated with purified FLAG-tagged raptor along with FLCN-FNIP2
or metap2 control protein. HA-GST precipitates were analyzed by immunoblotting for indicated
proteins.
See also Figure S3.
59
EXPERIMENTAL PROCEDURES
Cell Lysis and Immunoprecipitation
HEK-293T cells were rinsed once with ice-cold PBS and lysed with Triton lysis
buffer (1% Triton X-100, 10 mM P-glycerol phosphate, 10 mM pyrophosphate, 40 mM
Hepes pH 7.4, 2.5 mM MgCl 2 and 1 tablet of EDTA-free protease inhibitor (per 25 ml)).
When amino acid-sensitive interactions were interrogated, cells were lysed in CHAPS
lysis buffer (0.3% CHAPS, 10 mM P-glycerol phosphate, 10 mM pyrophosphate, 40 mM
Hepes pH 7.4, 2.5 mM MgCl 2 and 1 tablet of EDTA-free protease inhibitor (per 25 ml)).
The soluble fractions of cell lysates were isolated by centrifugation at 13,000 rpm in a
refrigerated microcentrifuge for 10 minutes. For anti-FLAG-immunoprecipitations, the
FLAG-M2 affinity gel was washed with lysis buffer 3 times and 50 [d of a 50% slurry of
the affinity gel was then added to cleared cell lysates and incubated with rotation for 3
hours at 4 0C. The beads were washed 3 times with lysis buffer containing 150 mM NaCl.
Immunoprecipitated proteins were denatured by the addition of 50 d of sample buffer
and boiling for 5 minutes as described (Kim et al., 2002), resolved by 8%-16% SDSPAGE, and analyzed by immunoblotting.
For co-transfection experiments, 2,000,000 HEK-293T cells were plated in 10 cm
culture dishes. Twenty-four hours later, cells were transfected using XtremeGene 9
transection reagent with the pRK5-based cDNA expression plasmids indicated in the
Figures in the following amounts: 100 ng HA-RagB; 100 ng HA- or HA-GST-RagC; 300
ng HA-GST-RagBQ 99 Lor 300 ng HA-GST-RagBT 5 4 N; 300 ng HA-GST-RagCS 7 5 Nor 300 ng
HA-GST-RagCQ12
0L;
100 ng FLAG-Rap2A; 300 ng of FLAG-metap2, 300 ng of FLAG-
FLCN, 300 ng of HA- or FLAG-FNIP2, and 5 ng Flag-S6K. The total amount of plasmid
60
DNA in each transfection was normalized to 2 pg with empty pRK5. Thirty-six hours after
transfection, cells were lysed as described above.
Amino acid Starvation of Cells
HEK-293T cells in culture dishes or coated glass cover slips were rinsed with and
incubated in amino acid-free RPMI for 50 minutes and stimulated with amino acids for
10-15 minutes. After stimulation, the final concentration of amino acids in the media was
the same as in RPMI. A 1OX amino acid mixture used to stimulate cells, which was
prepared from individual powders of amino acids. When Torin1 was used, cells were
incubated with 250 nM of Torin1 or DMSO during the 50 minute starvation period and
the 10 minute stimulation period.
RNAi in Mammalian Cells
Lentiviral shRNAs targeting FLCN and non-targeting controls (Sancak et al.,
2008) were obtained from the TRC. The TRC number for each shRNA is as follows:
Human FLCN shRNA_1: TRCN0000237882
Human FLCN shRNA_2: TRCN0000237885
shRNA-encoding plasmids were co-transfected with the Delta VPR envelope and
CMV VSV-G packaging plasmids into actively growing HEK-293T cells using
XtremeGene 9 transfection reagent as previously described (Sarbassov et al., 2005).
Virus-containing supernatants were collected 48 hours after transfection and passed
through a 0.45 um filter to eliminate cells. Target cells were infected in the presence of 8
pg/ml polybrene. 24 hours later, cells were selected with puromycin and analyzed on the
3 rd
day after selection.
Immunofluorescence Assays
61
Immunofluorescence assays were performed as described in (Sancak et al.,
2010). Briefly, 400,000 of the indicated HEK-293T cells were seeded on fibronectincoated glass coverslips in 6-well tissue culture plates. Twenty-four hours later, the slides
were starved or stimulated with amino acids as described above and fixed for 15 min
with 4% paraformaldehyde in PBS at room temperature. The slides were rinsed twice
with PBS and cells were permeabilized with 0.05% Triton X-100 in PBS for 5 min. After
rinsing twice with PBS, the slides were incubated with primary antibody in 5% normal
donkey serum for 1 hr at room temperature, rinsed four times with PBS, and incubated
with secondary antibodies produced in donkey (diluted 1:400 in 5% normal donkey
serum) for 40 min at room temperature and washed four times with PBS. Slides were
mounted on glass coverslips using Vectashield containing DAPI (Vector Laboratories)
and imaged on a spinning disk confocal system (Perkin Elmer).
Live Cell Imaging
300,000 HEK-293T cells were seeded on fibronectin-coated glass bottom 35 mm
dishes (MatTek Corp.). The next day, cells were co-transfected using XtremeGene 9
with the following plasmids: 90 ng FLCN-GFP (Clontech), 10 ng HA-FNIP2, 100 ng
mRFP-LAMP1, 300 ng empty pRK5. The following day, cells were imaged on a spinning
disk confocal microscope (Andor Technology) with a 488-nm and a 568-nm laser
through a 60x objective.
Purification of Recombinant Proteins for GAP and In Vitro Binding Assays
To produce protein complexes used for GAP assays, 4,000,000 HEK-293T cells
were plated in 15 cm culture dishes. Forty-eight hours later, cells were transfected with
the following combination of constructs (all cDNAs were expressed from the pRK5
expression plasmid). For RagB-RagCQ120L-X: 16 pg HA-RagB and 8 pg Flag-RagCQ120L-
62
D181N;
for RagBQ 99L-X-RagC: 8 pg FLAG-RagBQ 9 9 L-D1 6 3 Nand 16 pg HA-RagC; for RagBQ 9 9 L-
X-RagD: 8 pg FLAG-RagBQ 99L-D
63
N and 16 pg HA-RagD; for RagBX-RagC: 8 pg FLAG-
RagBD1 6 3 N and 16 pg HA-RagC. For Rags used in in-vitro binding: 8 pg HA-GSTRagBD1 6 3 N and 16 pg HA-RagC; 8 pg HA-GST-RagCD1 8 1N and 16 pg HA-RagB; 8 pg HAGST-RagC and 16 pg HA-RagB; GATOR1: 4 pg FLAG-DEPDC5 and 8 pg myc-NPRL2
and 8 pg myc-NPRL3 (Bar-Peled et al., 2013); FLCN-FNIP1: 8 pg FLAG-FNIP1 and 16
pg HA-FLCN; FLCN-FNIP2: 8 pg FLAG-FNIP2 and 16 pg HA-FLCN; FLCN(AN-term)FNIP2: 8 pg FLAG-FNIP2 and 16 pg HA-FLCN(AN-term) (Nookala et al., 2012). For
FLCN-FNIP purifications, it is crucial to immunoprecipitate through the FNIP component
to obtain stoichiometric complexes with high activities. For individual proteins: 10 pg
Flag- or HA-GST-Rap2A, 15 pg of FLAG-Leucyl tRNA synthetase (LRS), or 10 pg FlagMetap2, 16 pg FLAG-FLCN, 16 pg FLAG-FNIP2.
Thirty-six hours post transfection cell lysates were prepared as described above,
with the exception that for all FLCN or FNIP containing purifications, EDTA-free protease
inhibitor tablet was added to prevent degradation and for all GATOR purifications cells
were lysed in 0.3% CHAPS buffer without MgC 2 . 200 pl of a 50% slurry of FLAG-M2
affinity gel or immobilized glutathione beads were added to lysates from cells expressing
FLAG-tagged proteins or HA-GST tagged proteins, respectively. Recombinant proteins
were immunoprecipitated for 3 hours at 4*C. Each sample was washed once with Triton
lysis buffer, followed by 3 washes with Triton lysis buffer supplemented with 500 mM
NaCl and finally, 4 washes with the CHAPS buffer. FLCN-FNIP complexes were rotated
at 40C in the last Triton salt wash for 30 minutes for a cleaner purification. FLAG-tagged
proteins were eluted from the FLAG-M2 affinity gel with a competing FLAG peptide for 1
hour as described above. All proteins were stored in CHAPS buffer supplemented with
10% glycerol, snap frozen with liquid nitrogen and stored at -80*C.
63
To remove the FLAG peptide, proteins were subsequently purified on a HiLoad
16/60 Superdex 200 FPLC column (GE) pre-equilibrated with CHAPS buffer
supplemented with 150 mM salt. For FLCN-FNIP purifications, 4 protease inhibitor
tablets were supplemented per 400mL of CHAPS buffer. The peak corresponding to the
desired complex was concentrated in 10,000 MW CO columns (Amicon), snap frozen in
CHAPS buffer supplemented with 10% glycerol and stored at -800 C. All proteins were
verified by Coomasie staining on a 4-16% gel.
Rag GTP Hydrolysis Assays
GAP assays were performed essentially as described in (Bar-Peled et al., 2013).
In brief, the indicated GTPases were bound at 40C to FLAG-M2 affinity gel. The resin
was then washed to remove unbound protein, and the GTPases were loaded with XDP
(or XTP where indicated) and [a- 3 2 P]GTP at room temperature followed by an incubation
with MgC 2 to stabilize the nucleotide. The GTPases were subsequently washed to
remove unbound nucleotide and eluted from the affinity gel with competing FLAG
peptide. Protein concentrations were determined prior to use.
For the TLC-based GTP hydrolysis assay, 5 pmoles of the indicated Rag
heterodimer or Rap2a loaded with xanthine nucleotides and [a- 32 P]GTP were added to
20 pmoles of purified LRS, GATOR1, or FLCN-FNIP in 45 pl of GTPase wash buffer.
The reaction was incubated at 250C for the indicated times and eluted samples were
spotted on PEI Cellulose plates and developed for 2.5 hours in 0.5 M KH 2PO 4 pH 3.4.
Plates were exposed to film and spot densities were quantified with ImageJ.
ACKNOWLEDGEMENTS
We thank Shuyu Wang, Larry Schweitzer, Mounir Koussa, Molly Plovanich, and
Rich Possemato for critical review of the manuscript and all members of the Sabatini Lab
64
for helpful suggestions. This work was supported by grants from NIH (CA103866 and
A147389) and Department of Defense (W81XWH-07-0448) to D.M.S., fellowship support
from the NCI (F30CA180754) to Z.T., David H. Koch Graduate Fellowship Fund to L.B.P., National Science Foundation to L.C. and T.W., Jane Coffin Childs Memorial Fund for
Medical Research to R.Z., and support from Howard Hughes Medical Institute (HHMI) to
C.K. D.M.S. is an investigator of the HHMI.
65
REFERENCES
Baba, M., Furihata, M., Hong, S.-B., Tessarollo, L., Haines, D.C., Southon, E., Patel, V.,
Igarashi, P., Alvord, W.G., Leighty, R., et a/. (2008). Kidney-targeted Birt-Hogg-Dube
gene inactivation in a mouse model: Erkl/2 and Akt-mTOR activation, cell
hyperproliferation, and polycystic kidneys. J Natl Cancer 1 100, 140-154.
Baba, M., Hong, S.-B., Sharma, N., Warren, M.B., Nickerson, M.L., lwamatsu, A.,
Esposito, D., Gillette, W.K., Hopkins, R.F., Hartley, J.L., et al. (2006). Folliculin encoded
by the BHD gene interacts with a binding protein, FNIP1, and AMPK, and is involved in
AMPK and mTOR signaling. P Natl Acad Sci Usa 103,15552-15557.
Baba, M., Keller, J.R., Sun, H.-W., Resch, W., Kuchen, S., Suh, H.C., Hasumi, H.,
Hasumi, Y., Kieffer-Kwon, K.-R., Gonzalez, C.G., et al. (2012). The Folliculin-FNIP1
pathway deleted in human Birt-Hogg-Dube syndrome is required for mouse B cell
development. Blood.
Bar-Peled, L., Chantranupong, L., Cherniack, A.D., Chen, W.W., Ottina, K.A., Grabiner,
B.C., Spear, E.D., Carter, S.L., Meyerson, M., and Sabatini, D.M. (2013). A Tumor
suppressor complex with GAP activity for the Rag GTPases that signal amino acid
sufficiency to mTORC1. Science 340,1100-1106.
Bar-Peled, L., Schweitzer, L.D., Zoncu, R., and Sabatini, D.M. (2012). Ragulator is a
GEF for the rag GTPases that signal amino acid levels to mTORC1. Cell 150, 11961208.
Bastola, P., Stratton, Y., Kellner, E., Mikhaylova, 0., Yi, Y., Sartor, M.A., Medvedovic,
M., Biesiada, J., Meller, J., and Czyzyk-Krzeska, M.F. (2013). Folliculin Contributes to
VHL Tumor Suppressing Activity in Renal Cancer through Regulation of Autophagy.
PLoS ONE 8, e70030.
Birt, A., Hogg, G., and Dube, W. (1977). Hereditary Multiple Fibrofolliculomas with
Trichodiscomas and Acrochordons. Arch Dermatol 113, 1674-1677.
Bos, J.L., Rehmann, H., and Wittinghofer, A. (2007). GEFs and GAPs: Critical elements
in the control of small G proteins. Cell 129, 865-877.
Brugarolas, J., Lei, K., Hurley, R.L., Manning, B.D., Reiling, J.H., Hafen, E., Witters, L.A.,
Ellisen, L.W., and Kaelin, W.G. (2004). Regulation of mTOR function in response to
hypoxia by REDD1 and the TSC1/TSC2 tumor suppressor complex. Gene Dev 18,
2893-2904.
Cash, T.P., Gruber, J.J., Hartman, T.R., Henske, E.P., and Simon, M.C. (2011). Loss of
the Birt-Hogg-Dube tumor suppressor results in apoptotic resistance due to aberrant
TGF beta-mediated transcription. Oncogene 30, 2534-2546.
Castro, A.F., Rebhun, J.F., Clark, G.J., and Quilliam, L.A. (2003). Rheb binds tuberous
sclerosis complex 2 (TSC2) and promotes S6 kinase activation in a rapamycin- and
farnesylation-dependent manner. The Journal of biological chemistry 278, 32493-32496.
66
Chen, J., Futami, K., Petillo, D., Peng, J., Wang, P., Knol, J., Li, Y., Khoo, S.-K., Huang,
D., Qian, C.-N., et al. (2008). Deficiency of FLCN in Mouse Kidney Led to Development
of Polycystic Kidneys and Renal Neoplasia. Plos One 3, e3581.
Corradetti, M.N., Inoki, K., and Guan, K.-L. (2005). The stress-inducted proteins RTP801
and RTP801 L are negative regulators of the mammalian target of rapamycin pathway.
The Journal of biological chemistry 280, 9769-9772.
DerMardirossian, C., and Bokoch, G. (2005). GDIs: central regulatory molecules in Rho
GTPase activation. Trends Cell Biol 15, 356-363.
Dibble, C.C., and Manning, B.D. (2013). Signal integration by mTORC1 coordinates
nutrient input with biosynthetic output. Nat Cell Biol 15, 555-564.
Efeyan, A., Zoncu, R., Chang, S., Gumper, I., Snitkin, H., Wolfson, R.L., Kirak, 0.,
Sabatini, D.D., and Sabatini, D.M. (2013). Regulation of mTORC1 by the Rag GTPases
is necessary for neonatal autophagy and survival. Nature 493, 679-683.
Efeyan, A., Zoncu, R., and Sabatini, D.M. (2012). Amino acids and mTORC1: from
lysosomes to disease. Trends in molecular medicine.
Feig, L.A. (1999). Tools of the trade: use of dominant-inhibitory mutants of Ras-family
GTPases. Nat Cell Biol 1, E25-27.
Feig, L.A., and Cooper, G.M. (1988). Inhibition of NIH 3T3 cell proliferation by a mutant
ras protein with preferential affinity for GDP. Mol Cell Biol 8, 3235-3243.
Frech, M., Darden, T.A., Pedersen, L.G., Foley, C.K., Charifson, P.S., Anderson, M.W.,
and Wittinghofer, A. (1994). Role of glutamine-61 in the hydrolysis of GTP by p21 H-ras:
an experimental and theoretical study. Biochemistry 33, 3237-3244.
Garami, A., Zwartkruis, F.J.T., Nobukuni, T., Joaquin, M., Roccio, M., Stocker, H.,
Kozma, S.C., Hafen, E., Bos, J.L., and Thomas, G. (2003). Insulin activation of Rheb, a
mediator of mTOR/S6K/4E-BP signaling, is inhibited by TSC1 and 2. Mol Cell 11, 14571466.
Gong, R., Li, L., Liu, Y., Wang, P., Yang, H., Wang, L., Cheng, J., Guan, K.-L., and Xu,
Y. (2011). Crystal structure of the Gtrl p-Gtr2p complex reveals new insights into the
amino acid-induced TORC1 activation. Gene Dev 25, 1668-1673.
Guertin, D.A., and Sabatini, D.M. (2007). Defining the role of mTOR in cancer. Cancer
Cell 12, 9-22.
Han, J.M., Jeong, S.J., Park, M.C., Kim, G., Kwon, N.H., Kim, H.K., Ha, S.H., Ryu, S.H.,
and Kim, S. (2012). Leucyl-tRNA synthetase is an intracellular leucine sensor for the
mTORC1-signaling pathway. Cell 149, 410-424.
Hartman, T.R., Nicolas, E., Klein-Szanto, A., AI-Saleem, T., Cash, T.P., Simon, M.C.,
and Henske, E.P. (2009). The role of the Birt-Hogg-Dube protein in mTOR activation and
renal tumorigenesis. Oncogene 28, 1594-1604.
67
Hasumi, H., Baba, M., Hong, S.-B., Hasumi, Y., Huang, Y., Yao, M., Valera, V.A.,
Linehan, W.M., and Schmidt, L.S. (2008). Identification and characterization of a novel
folliculin-interacting protein FNIP2. Gene 415, 60-67.
Hasumi, Y., Baba, M., Ajima, R., Hasumi, H., Valera, V.A., Klein, M.E., Haines, D.C.,
Merino, M.J., Hong, S.-B., Yamaguchi, T.P., et al. (2009). Homozygous loss of BHD
causes early embryonic lethality and kidney tumor development with activation of
mTORC1 and mTORC2. P Natl Acad Sci Usa 106,18722-18727.
Hillenmeyer, M.E., Fung, E., Wildenhain, J., Pierce, S.E., Hoon, S., Lee, W., Proctor, M.,
St Onge, R.P., Tyers, M., Koller, D., et al. (2008). The chemical genomic portrait of
yeast: Uncovering a phenotype for all genes. Science 320, 362-365.
Hirose, E., Nakashima, N., Sekiguchi, T., and Nishimoto, T. (1998). RagA is a functional
homologue of S. cerevisiae Gtrl p involved in the Ran/Gspl -GTPase pathway. J Cell Sci
111 (Pt 1), 11-21.
Hoffenberg, S., Nikolova, L., Pan, J.Y., Daniel, D.S., Wessling-Resnick, M., Knoll, B.J.,
and Dickey, B.F. (1995). Functional and structural interactions of the Rab5 D136N
mutant with xanthine nucleotides. Biochem Bioph Res Co 215, 241-249.
Howell, J.J., Ricoult, S.J.H., Ben-Sahra, I., and Manning, B.D. (2013). A growing role for
mTOR in promoting anabolic metabolism. Biochem Soc T 41, 906-912.
Hudon, V., Sabourin, S., Dydensborg, A.B., Kottis, V., Ghazi, A., Paquet, M., Crosby, K.,
Pomerleau, V., Uetani, N., and Pause, A. (2010). Renal tumour suppressor function of
the Birt-Hogg-Dube syndrome gene product folliculin. J Med Genet 47, 182-189.
Inoki, K., Li, Y., Xu, T., and Guan, K. (2003a). Rheb GTPase is a direct target of TSC2
GAP activity and regulates mTOR signaling. Gene Dev 17, 1829-1834.
Inoki, K., Zhu, T., and Guan, K. (2003b). TSC2 mediates cellular energy response to
control cell growth and survival. Cell 115, 577-590.
John, J., Rensland, H., Schlichting, I., Vetter, I., Borasio, G.D., Goody, R.S., and
Wittinghofer, A. (1993). Kinetic and structural analysis of the Mg(2+)-binding site of the
guanine nucleotide-binding protein p21 H-ras. J Biol Chem 268, 923-929.
Kim, D., Sarbassov, D., Ali, S., King, J., Latek, R., Erdjument-Bromage, H., TEMPST, P.,
and Sabatini, D. (2002). MTOR interacts with Raptor to form a nutrient-sensitive complex
that signals to the cell growth machinery. Cell 110, 163-175.
Kim, E., Goraksha-Hicks, P., Li, L., Neufeld, T.P., and Guan, K.-L. (2008). Regulation of
TORC1 by Rag GTPases in nutrient response. Nat Cell Biol 10, 935-945.
Kim, S.G., Buel, G.R., and Blenis, J. (2013). Nutrient regulation of the mTOR complex 1
signaling pathway. Mol Cells 35, 463-473.
Krengel, U., Schlichting, I., Scherer, A., Schumann, R., Frech, M., John, J., Kabsch, W.,
Pai, E.F., and Wittinghofer, A. (1990). Three-dimensional structures of H-ras p21
68
mutants: molecular basis for their inability to function as signal switch molecules. Cell 62,
539-548.
Levine, T.P., Daniels, R.D., Gatta, A.T., Wong, L.H., and Hayes, M.J. (2013). The
product of C9orf72, a gene strongly implicated in neurodegeneration, is structurally
related to DENN Rab-GEFs. Bioinformatics.
Liu, W., Chen, Z., Ma, Y., Wu, X., Jin, Y., and Hou, S. (2013). Genetic Characterization
of the Drosophila Birt-Hogg-Dube Syndrome Gene. PLoS ONE 8, e65869.
Long, X., Lin, Y., Ortiz-Vega, S., Yonezawa, K., and Avruch, J. (2005). Rheb binds and
regulates the mTOR kinase. Curr Biol 15, 702-713.
Ma, L., Chen, Z., Erdjument-Bromage, H., Tempst, P., and Pandolfi, P.P. (2005).
Phosphorylation and functional inactivation of TSC2 by Erk implications for tuberous
sclerosis and cancer pathogenesis. Cell 121, 179-193.
Nickerson, M., Warren, M., Toro, J., Matrosova, V., Glenn, G., Turner, M., Duray, P.,
Merino, M., Choyke, P., Pavlovich, C., et al. (2002). Mutations in a novel gene lead to
kidney tumors, lung wall defects, and benign tumors of the hair follicle in patients with
the Birt-Hogg-Dube syndrome. Cancer Cell 2, 157-164.
Nobukuni, T., Joaquin, M., Roccio, M., Dann, S.G., Kim, S.Y., Gulati, P., Byfield, M.P.,
Backer, J.M., Natt, F., Bos, J.L., et al. (2005). Amino acids mediate mTOR/raptor
signaling through activation of class 3 phosphatidylinositol 30H-kinase. P Natl Acad Sci
Usa 102, 14238-14243.
Nookala, R.K., Langemeyer, L., Pacitto, A., Ochoa-Montaho, B., Donaldson, J.C.,
Blaszczyk, B.K., Chirgadze, D.Y., Barr, F.A., Bazan, J.F., and Blundell, T.L. (2012).
Crystal structure of folliculin reveals a hidDENN function in genetically inherited renal
cancer. Open Biol 2, 120071.
Reiling, J.H., and Hafen, E. (2004). The hypoxia-induced paralogs Scylla and Charybdis
inhibit growth by down-regulating S6K activity upstream of TSC in Drosophila. Gene Dev
18, 2879-2892.
Roccio, M., Bos, J.L., and Zwartkruis, F.J.T. (2006). Regulation of the small GTPase
Rheb by amino acids. Oncogene 25, 657-664.
Roux, P.P., Ballif, B.A., Anjum, R., Gygi, S.P., and Blenis, J. (2004). Tumor-promoting
phorbol esters and activated Ras inactivate the tuberous sclerosis tumor suppressor
complex via p90 ribosomal S6 kinase. P Natl Acad Sci Usa 101, 13489-13494.
Sancak, Y., Bar-Peled, L., Zoncu, R., Markhard, A.L., Nada, S., and Sabatini, D.M.
(2010). Ragulator-Rag Complex Targets mTORC1 to the Lysosomal Surface and Is
Necessary for Its Activation by Amino Acids. Cell 141, 290-303.
Sancak, Y., Peterson, T.R., Shaul, Y.D., Lindquist, R.A., Thoreen, C.C., Bar-Peled, L.,
and Sabatini, D.M. (2008). The Rag GTPases bind raptor and mediate amino acid
signaling to mTORC1. Science 320,1496-1501.
69
Sancak, Y., Thoreen, C.C., Peterson, T.R., Lindquist, R.A., Kang, S.A., Spooner, E.,
Carr, S.A., and Sabatini, D.M. (2007). PRAS40 is an insulin-regulated inhibitor of the
mTORC1 protein kinase. Mol Cell 25, 903-915.
Sarbassov, D., Guertin, D., Ali, S., and Sabatini, D. (2005). Phosphorylation and
regulation of Akt/PKB by the rictor-mTOR complex. Science 307, 1098-1101.
Saucedo, L., Gao, X., Chiarelli, D., Li, L., Pan, D., and Edgar, B. (2003). Rheb promotes
cell growth as a component of the insulin/TOR signalling network. Nat Cell Biol 5, 566571.
Schmidt, G., Lenzen, C., Simon, I., Deuter, R., Cool, R.H., Goody, R.S., and
Wittinghofer, A. (1996). Biochemical and biological consequences of changing the
specificity of p21 ras from guanosine to xanthosine nucleotides. Oncogene 12, 87-96.
Schmidt, L.S. (2012). Birt-Hogg-Dube syndrome: from gene discovery to molecularly
targeted therapies. Fam Cancer.
Schormann, A., Brauers, A., Massmann, S., Becker, W., and Joost, H.G. (1995). Cloning
of a novel family of mammalian GTP-binding proteins (RagA, RagBs, RagB1) with
remote similarity to the Ras-related GTPases. The Journal of biological chemistry 270,
28982-28988.
Sekiguchi, T., Hirose, E., Nakashima, N., Ii, M., and Nishimoto, T. (2001). Novel G
proteins, Rag C and Rag D, interact with GTP-binding proteins, Rag A and Rag B. J Biol
Chem 276, 7246-7257.
Smith, E.M., Finn, S.G., Tee, A.R., Browne, G.J., and Proud, C.G. (2005). The tuberous
sclerosis protein TSC2 is not required for the regulation of the mammalian target of
rapamycin by amino acids and certain cellular stresses. The Journal of biological
chemistry 280, 18717-18727.
Stocker, H., Radimerski, T., Schindelholz, B., Wittwer, F., Belawat, P., Daram, P.,
Breuer, S., Thomas, G., and Hafen, E. (2003). Rheb is an essential regulator of S6K in
controlling cell growth in Drosophila. Nat Cell Biol 5, 559-565.
Takagi, Y., Kobayashi, T., Shiono, M., Wang, L., Piao, X., Sun, G., Zhang, D., Abe, M.,
Hagiwara, Y., Takahashi, K., et al. (2008). Interaction of folliculin (Birt-Hogg-Dube gene
product) with a novel Fnipl-like (FnipL/Fnip2) protein. Oncogene 27, 5339-5347.
Takai, Y., Sasaki, T., and Matozaki, T. (2001). Small GTP-binding proteins. Physiol Rev
81, 153-208.
Tee, A.R., Anjum, R., and Blenis, J. (2003a). Inactivation of the tuberous sclerosis
complex-1 and -2 gene products occurs by phosphoinositide 3-kinase/Akt-dependent
and -independent phosphorylation of tuberin. The Journal of biological chemistry 278,
37288-37296.
Tee, A.R., Fingar, D.C., Manning, B.D., Kwiatkowski, D.J., Cantley, L.C., and Blenis, J.
(2002). Tuberous sclerosis complex-1 and -2 gene products function together to inhibit
70
mammalian target of rapamycin (mTOR)-mediated downstream signaling. P Natl Acad
Sci Usa 99, 13571-13576.
Tee, A.R., Manning, B.D., Roux, P.P., Cantley, L.C., and Blenis, J. (2003b). Tuberous
sclerosis complex gene products, Tuberin and Hamartin, control mTOR signaling by
acting as a GTPase-activating protein complex toward Rheb. Curr Biol 13, 1259-1268.
Thoreen, C.C., Kang, S.A., Chang, J.W., Liu, Q., Zhang, J., Gao, Y., Reichling, L.J., Sim,
T., Sabatini, D.M., and Gray, N.S. (2009). An ATP-competitive mammalian target of
rapamycin inhibitor reveals rapamycin-resistant functions of mTORC1. The Journal of
biological chemistry 284, 8023-8032.
van Slegtenhorst, M., Khabibullin, D., Hartman, T.R., Nicolas, E., Kruger, W.D., and
Henske, E.P. (2007). The Birt-Hogg-Dube and tuberous sclerosis complex homologs
have opposing roles in amino acid homeostasis in Schizosaccharomyces pombe. J Biol
Chem 282, 24583-24590.
Yuan, H.-X., Xiong, Y., and Guan, K.-L. (2013). Nutrient sensing, metabolism, and cell
growth control. Mol Cell 49, 379-387.
Zhang, D., lyer, L.M., He, F., and Aravind, L. (2012). Discovery of Novel DENN Proteins:
Implications for the Evolution of Eukaryotic Intracellular Membrane Structures and
Human Disease. Front Genet 3, 283.
Zhang, Y., Gao, X., Saucedo, L.J., Ru, B., Edgar, B.A., and Pan, D. (2003). Rheb is a
direct target of the tuberous sclerosis tumour suppressor proteins. Nat Cell Biol 5, 578581.
Zoncu, R., Bar-Peled, L., Efeyan, A., Wang, S., Sancak, Y., and Sabatini, D.M. (2011a).
mTORC1 Senses Lysosomal Amino Acids Through an Inside-Out Mechanism That
Requires the Vacuolar H+-ATPase. Science 334, 678-683.
Zoncu, R., Efeyan, A., and Sabatini, D.M. (2011b). mTOR: from growth signal integration
to cancer, diabetes and ageing. Nat Rev Mol Cell Bio 12, 21-35.
71
Supplemental Info
A
Homozygous co-ftness Interactions
Top 10 InleracMora wtth GTRI by homozgous co-senilvIty:
Qoq ry
Ti
at
rrewo"
1
.78085
.74338
TRI
_____
Enriched O Wrma .r kerucare
_
___
TRI
.71567
*
.54758
A3379
A203
1
TR1
* aulaphay (2e-03)
Funcoon:
SNone
______
________.3833
.37561
9_
_QM
_
Wo lasma membane transoort
Component
1036
* vacuolar membrane (4e-041
# vacuolar membrane (sensu Funal)
* vatoe M6-031
Figure S1, related to Figure 2. Yeast orthologs of FLCN and Rag GTPases have
similar growth sensitivities
(A) Top 10 interactors with GTR1 (Yeast RagA/B ortholog) include GTR2 (Yeast RagC/D
ortholog) and LST7 (Yeast FLCN ortholog) in terms of growth sensitivities to various
environmental and chemical insults. Output from querying "GTR1" at:
http://chemogenomics.stanford.edu/supplements/cofitness/index.html
(Hillenmeyer et al., 2008)
72
A
Figure S2, related to Figure 3. FLCN requires FNIP2 to localize to the lysosomal
surface
(A) Spinning disk confocal image of a HEK-293T cell co-expressing FLCN-GFP and
mRFP-LAMP1 (pseudo-colored red and green in merge, respectively).
A
B
RagB-RagCx
C
RagBx-R8gC
0
7
RagB-RagC
-_
V0
7L
W
0.
metap2
a- Ragulator
FL N-FNIP2
7
00
0
2iX
21
2672
0
D
10
4
8
12
i
0m
Time (min)
Time (mn)
RagBx-RagC
E
0
12
4
8
12
Time (min)
free GTP
8
aw metap2
-
Condition:
FLCN-FNIP2
buffer
FLCN
FNIP2
2
0
GDP
10
20
Time (min)
30
GTP
% GDP:
0.5
30 min
Figure S3, related to Figure 4. FLCN-FNIP2 does not have GEF activity towards the
Rag GTPases, FLCN-FNIP2 stimulates RagC GTPase activity in a time-dependent
73
manner, and purified FLCN-FNIP2 does not contain significant contaminating
phosphatases
(A) FLCN-FNIP2 does not stimulate GDP dissociation from RagB. Dissociation assay in
which RagB-RagCx was loaded with [ 3H]GDP, and incubated with FLCN-FNIP2,
Ragulator positive control, or metap2 control protein. Dissociation was monitored by a
filter-binding assay. Each value represents the average of a replicate.
(B) FLCN-FNIP2 does not stimulate GDP dissociation from RagC. Dissociation assay
with RagBX-RagC was performed as described in (A).
(C) FLCN-FNIP2 does not stimulate GDP dissociation from wild-type RagB-RagC.
Dissociation assay with RagB-RagC was performed as described in (A).
(D) FLCN-FNIP2 stimulates GTP hydrolysis by RagC in a time-dependent manner. 5
pmol of RagBX-RagC was loaded with [a- 32P]GTP and incubated with indicated proteins
(20 pmol) for indicated times. GTP hydrolysis was determined by thin-layer
chromatography. Each value represents the average of two experiments.
(E) Purified FLCN-FNIP2 does not contain significant amounts of contaminating
phosphatases. The purified FLCN-FNIP2 used in Figure 4 was incubated with free [a32 P]GTP.
This amount of hydrolysis is representative of separate FLCN-FNIP2
purifications. Value represents the quantification in the incubation shown.
Supplemental Experimental Procedures
Materials
Reagents were obtained from the following sources: HRP-labeled anti-mouse
and anti-rabbit secondary antibodies and LAMP2 antibody from Santa Cruz
Biotechnology; antibodies to phospho-T389 S6K1, S6K1, phospho-S473-Akt, Akt,
phospho-T398 dS6K, RagA, RagC, p18, mTOR, FLCN, and the FLAG epitope from Cell
74
Signaling Technology; antibodies to the HA epitope from Bethyl laboratories; antibodies
to raptor from Millipore. RPMI, FLAG M2 affinity gel, ATP, GDP, and amino acids were
from Sigma Aldrich; DMEM from SAFC Biosciences; XtremeGene9 and Complete
Protease Cocktail from Roche; Alexa 488 and 568-conjugated secondary antibodies,
Schneider's media, Express Five-SFM, and Inactivated Fetal Calf Serum (IFS) from
Invitrogen; amino acid-free RPMI, and amino acid-free Schneider's media from US
Biological; Cellulose PEI TLC plates from Sorbent Technologies; [a- 32P]GTP from Perkin
Elmer; GTP, XTP and XDP from Jena Biosciences; nitrocellulose membrane filters from
Advantec; DSP and Glutathione beads from Pierce. Torin1 from Dr. Nathanael Gray
(DFCI). The dS6K antibody was a generous gift from Mary Stewart (North Dakota State
University).
Identification of FLCN, FNIP1, and FNIP2 as Rag-interacting proteins
HEK-293T cells stably expressing FLAG-tagged metap2, RagA, RagB, RagC or
RagD were subjected to FLAG-immunoprecipitation as described above. Proteins were
eluted with the FLAG peptide (sequence DYKDDDDK) from the FLAG-M2 affinity gel,
resolved on 4-12% NuPage gels (Invitrogen), and stained with simply blue stain
(Invitrogen). Each gel lane was sliced into 10-12 pieces and the proteins in each gel
slice digested overnight with trypsin. The resulting digests were analyzed by mass
spectrometry as described (Sancak et al., 2008). Peptides corresponding to FLCN and
FNIP1 and FNIP2 were detected in the FLAG-RagA, -B, -C, and -D immunoprecipitates,
while no such peptides were detected in negative control immunoprecipitates of FLAGmetap2.
75
RNAi in Drosophila S2 cells
dsRNAs against Drosophila FLCN were designed as described in (Sancak et al.,
2008). Primer sequences used to amplify DNA templates for dsRNA synthesis for
dFLCN including underlined 5' and 3' T7 promoter sequences, are as follows:
dFLCN (CG8616)
Forward primer CG8616_1F:
GAATTAATACGACTCACTATAGGGAGA AGAATAACAATGCGATCTACAGCAG
Reverse primer CG8616_1R:
GAATTAATACGACTCACTATAGGGAGA GAAGGTGTGACTCAGGATGTGA
Forward primer CG8616_2F:
GAATTAATACGACTCACTATAGGGAGA GTACAAAATCATATCCGTGTCCAAT
Reverse primer CG8616_2R:
GAATTAATACGACTCACTATAGGGAGA GAAGGTGTGTGCTCCAGTAGTTAAT
dsRNAs targeting GFP and dRagB (Sancak et al., 2008) were used as negative
and positive controls, respectively. On day one, 4,000,000 S2 cells were plated in 6-cm
culture dishes in 4 ml of Express Five SFM media. Cells were transfected with 1 pg of
dsRNA per million cells using XtremeGene9. Two days later, a second round of dsRNA
transfection was performed. On day four, cells were transferred to a fibronectin coated 6cm culture dish. On day five, cells were rinsed once with amino acid-free Schneider's
medium, and starved for amino acids by replacing the media with amino acid-free
Schneider's medium for 1.5 hours. To stimulate with amino acids, the amino acid-free
medium was replaced with complete Schneider's medium for 30 minutes. Cells were
then washed with ice cold PBS, lysed in Triton lysis buffer, and subjected to
immunoblotting for phospho-T398 dS6K and total dS6K.
76
In Vitro Binding Assays
For the binding reactions, 20 pl of a 50% slurry containing immobilized HA-GSTtagged proteins were incubated in binding buffer (0.3% CHAPS, 2.5 mM MgC 2, 40 mM
HEPES [pH 7.4], 2 mM DTT, and 1 mg/ml BSA) with 2 pg of FLAG-raptor, FLAGmetap2, or FLAG-FNIP2-HA-FLCN in a total volume of 50 pl for 1 hr and 30 min at 40C.
Where indicated, Rags were loaded with the indicated nucleotides as previously
described (Bar-Peled et al., 2012). To terminate binding assays, samples were washed
twice times with 1 mL of ice-cold binding buffer supplemented with 150 mM NaCl
followed by the addition of 50 pl of sample buffer.
Nucleotide Exchange Assays
GEF assays were performed as described in (Bar-Peled et al., 2012). Briefly, the
indicated purified Rag GTPases were loaded with XTPyS and [ 3 H]GTP at room
temperature followed by an incubation with MgCl 2 to stabilize the nucleotide. To initiate
GEF assay, purified FLCN-FNIP2, Ragulator, or metap2 proteins were added to Rags
along with GTPyS. Samples were taken every 2 minutes and spotted on nitrocellulose
filters, which were washed. Filter-associated radioactivity was measured using a TriCarb
scintillation counter (PerkinElmer).
Supplemental References
Bar-Peled, L., Schweitzer, L.D., Zoncu, R., and Sabatini, D.M. (2012). Ragulator is a
GEF for the rag GTPases that signal amino acid levels to mTORC1. Cell 150, 11961208.
Hillenmeyer, M.E., Fung, E., Wildenhain, J., Pierce, S.E., Hoon, S., Lee, W., Proctor, M.,
St Onge, R.P., Tyers, M., Koller, D., et al. (2008). The chemical genomic portrait of
yeast: Uncovering a phenotype for all genes. Science 320, 362-365.
Sancak, Y., Peterson, T.R., Shaul, Y.D., Lindquist, R.A., Thoreen, C.C., Bar-Peled, L.,
and Sabatini, D.M. (2008). The Rag GTPases bind raptor and mediate amino acid
signaling to mTORC1. Science 320,1496-1501.
77
CHAPTER 3
Reprinted from Science Magazine:
Lysosomal amino acid transporter SLC38A9 signals arginine sufficiency to
mTORC1
Shuyu Wang ,2,3,4,*, Zhi-Yang Tsun 1,2,3,4,*, Rachel Wolfson 1,2,3,4, Kuang Shen 1,2,3,4, Gregory A.
1234
2,3,4
12,34
Wyant1 ,Molly
E. Plovanich , Elizabeth D. Yuan', Tony D. Jones,'
, Lynne
Chantranupong12, 4, William Comb 1,2,3,4, Tim Wang 1,2,3,4, Liron Bar-Peled1,2,3,4 t, Roberto
Zoncu1 2,3,4:, Christoph Straub , Choah Kim 1,2,3,4, Jiwon Park 1,2,3,4, Bernardo L. Sabatini , and
David M. Sabatini',2,3,4
Whitehead Institute for Biomedical Research and Massachusetts Institute of Technology,
Department of Biology, 9 Cambridge Center, Cambridge, MA 02142, USA
Howard Hughes Medical Institute, Department of Biology, Massachusetts Institute of
I
fTechnology,
Cambridge, MA 02139, USA
Koch Institute for Integrative Cancer Research, 77 Massachusetts Avenue, Cambridge, MA 02139,
USA
4Broad Institute of Harvard and Massachusetts Institute of Technology, 7 Cambridge Center,
Cambridge MA 02142, USA
Department of Neurobiology, Howard Hughes Medical Institute, Harvard Medical School, 220
Longwood Avenue, Boston, MA 02115, USA
6
Harvard Medical School, 260 Longwood Avenue, Boston, MA 02115, USA
*These authors contributed equally to this work
tPresent address: Department of Chemical Physiology, The Scripps Research Institute, La Jolla,
CA 92037, USA
tPresent address: Department of Molecular and Cell Biology, University of California Berkeley,
Berkeley, CA 94720, USA
Correspondence should be addressed to D.M.S.
Tel: 617-258-6407; Fax: 617-452-3566; Email: sabatinicwi.mit.edu
Experiments in Figure 1A were performed by LBP.
Experiments in Figure 1B were performed by SW.
Experiments in Figure IC were performed by ZYT.
Experiments in Figures 1D were performed by SW using reagents generated by ZYT.
Experiments in Figures 1E, 1F were performed by RW.
Experiments in Figure 2A were performed by ZYT.
Experiments in Figures 2B were performed by LC and TW.
Experiments in Figures 3A-B, 3D-3F were performed by SW using reagents generated by
ZYT.
Experiments in Figure 3C were performed by SW using reagents generated by RW.
Experiments in Figures 4A, 4C were performed by SW.
Experiments in Figures 4B were performed by ZYT.
Experiments in Figures 5A, 5C, 5D were performed by ZYT.
Experiments in Figures 5B were performed by ZYT under guidance of KS.
Experiments in Figures 5E, 5F were performed by GAW.
Experiments in Figures S1A, S3A S3B, S6A-D, S6F-G were performed by ZYT.
Experiments in Figure S4A, S4B, S4D, S4E, S5 were performed by SW.
Experiments in Figures S2, S4C were performed by SW using reagents generated by ZYT.
Experiments in Figure S3C were performed by KS. Experiments in Figure S3D were
performed by WC. Experiments in Figure S6E were performed by CS.
Experiments in Figure S61 were performed by ZYT and EDY under guidance of MEP.
78
SUMMARY:
The mTOR complex 1 (mTORC1) protein kinase is a master growth regulator
that responds to multiple environmental cues. Amino acids stimulate, in a Rag-,
Ragulator-, and v-ATPase-dependent fashion, the translocation of mTORC1 to the
lysosomal surface, where it interacts with its activator Rheb. Here, we identify SLC38A9,
an uncharacterized protein with sequence similarity to amino acid transporters, as a
lysosomal transmembrane protein that interacts with the Rag GTPases and Ragulator in
an amino acid-sensitive fashion. SLC38A9 transports arginine with a high Km and loss of
SLC38A9 represses mTORC1 activation by amino acids, particularly arginine.
Overexpression of SLC38A9 or just its Ragulator-binding domain makes mTORC1
signaling insensitive to amino acid starvation but not to Rag activity. Thus, SLC38A9
functions upstream of the Rag GTPases and is an excellent candidate for being an
arginine sensor for the mTORC1 pathway.
amino
acids
cytosol
SLC38A9
lysosomal
membrane
I
lysosomal
lumen
arginine
79
INTRODUCTION:
The mechanistic target of rapamycin complex 1 (mTORC1) protein kinase is a
central controller of growth that responds to the nutritional status of the organism and is
deregulated in several diseases, including cancer (1-3). Upon activation, mTORC1
promotes anabolic processes, including protein and lipid synthesis, and inhibits catabolic
ones, such as autophagy (4). Environmental cues such as nutrients and growth factors
regulate mTORC1, but how it senses and integrates these diverse inputs is unclear.
The Rag and Rheb GTPases have essential but distinct roles in mTORC1
pathway activation, with the Rags controlling the subcellular localization of mTORC1 and
Rheb stimulating its kinase activity (5). Nutrients, particularly amino acids, activate the
Rag GTPases, which then recruit mTORC1 to the lysosomal surface where they are
concentrated (6, 7). Rheb also localizes to the lysosomal surface (6, 8-10) and, upon
growth factor withdrawal, the tuberous sclerosis complex (TSC) tumor suppressor
translocates there and inhibits mTORC1 by promoting GTP hydrolysis by Rheb (10).
Thus, the Rag and Rheb inputs converge at the lysosome, forming two halves of a
coincidence detector that ensures that mTORC1 activation occurs only when both are
active.
There are four Rag GTPases in mammals and they form stable, obligate
heterodimers consisting of RagA or RagB with RagC or RagD. RagA and RagB are
highly similar and functionally redundant, as are RagC and RagD (1, 6). The function of
each Rag within the heterodimer is poorly understood and their regulation is likely
complex as many distinct factors play important roles. A lysosome-associated molecular
machine containing the multi-subunit Ragulator and vacuolar ATPase (v-ATPase)
complexes regulates the Rag GTPases and is necessary for mTORC1 activation by
amino acids (11). Ragulator anchors the Rag GTPases to the lysosome and also has
nucleotide exchange activity for RagA/B (12, 13), but the molecular function of the vATPase in the pathway is unknown. Two GTPase activating protein (GAP) complexes,
which are both tumor suppressors, promote GTP hydrolysis by the Rag GTPases, with
GATOR1 acting on RagA/B (14) and Folliculin-FNIP2 on RagC/D (15). Lastly, a distinct
complex called GATOR2 negatively regulates GATOR1 through an unknown
80
mechanism (14). Despite the identification of many proteins involved in signaling amino
acid sufficiency to mTORC1, the actual amino acid sensors remain unknown.
RESULTS:
SLC38A9 Interacts with Ragulator and the Rag GTPases
We have proposed that amino acid sensing initiates at the lysosome and requires
the presence of amino acids in the lysosomal lumen (11). Thus, we sought to identify, as
candidate sensors, proteins that interact with known components of the pathway and
also have transmembrane domains. Mass spectrometric analyses of non-heated
immunoprecipitates of several Ragulator components and, to a lesser extent, RagB,
revealed the presence of isoform 1 of SLC38A9 (SLC38A9.1), a previously unstudied
protein with sequence similarity to the SLC38 class of sodium-coupled amino acid
transporters (16) (Fig. 1A). SLC38A9.1 is predicted to have eleven transmembrane
domains, a cytosolic N-terminal region of 119 amino acids, and three N-linked
glycosylation sites in the luminal loop between transmembrane domains 3 and 4 (Fig. 1B
and fig. S1, A and B). When stably expressed in human embryonic kidney (HEK)-293T
cells, SLC38A9.1 migrated on SDS-PAGE as a smear that collapsed to near its
predicted molecular weight of 63.8 kDa after treatment with Peptide-N-Glycosidase F
(PNGase F) (Fig. 1C). Isoforms 2 (SLC38A9.2) and 4 (SLC38A9.4) lack the first 63 or
124 amino acids of SLC38A9.1, respectively (Fig. 1B).
As expected from the mass spectrometry results, immunoprecipitates of stably
expressed FLAG-tagged SLC38A9.1, but not of three other lysosomal membrane
proteins -LAMP1 (17), SLC36A1 (18), and SLC38A7 (19) - contained Ragulator (as
detected by its p14 and p18 components), RagA, and RagC (Fig. 1D and fig. S2A).
Indicative of the strength of the Ragulator-SLC38A9.1 interaction, the amounts of
endogenous Ragulator that coimmunoprecipitated with SLC38A9.1 were similar to those
associated with the RagB-RagC heterodimer (Fig. 1 D). In contrast, SLC38A9.2,
SLC38A9.4 or a mutant of SLC38A9.1 lacking its first 110 amino acids (SLC38A9.1
Al 10) did not associate with Ragulator (fig. S2, B and C). The N-terminal region of
SLC38A9.1 is sufficient for it to interact with Ragulator-Rag because on its own the first
119 amino acids of SLC38A9.1 coimmunoprecipitated similar amounts of Ragulator and
Rag GTPases as did the full-length protein (Fig. 1 D and fig. S2C). Using alanine
81
scanning mutagenesis of residues in the N-terminal region conserved to the SLC38A9.1
homolog in C. elegans (F13H10.3), we identified 168, Y71, L74, P85, and P90 as
required for the Ragulator-SLC38A9.1 interaction (Fig. 1E).
The v-ATPase and its activity are necessary for amino acid sensing by the
mTORC1 pathway and, like SLC38A9.1, it coimmunoprecipitated with stably expressed
FLAG-tagged Ragulator (11, 20, 21). Indicating the existence of a supercomplex, stably
expressed SLC38A9.1, but not LAMP1, associated with endogenous components of the
v-ATPase in addition to Ragulator and the Rag GTPases (Fig. 1 F). Although SLC38A9.2
does not interact with Ragulator, it did co-immunoprecipitate the v-ATPase, albeit at
lesser amounts than SLC38A9.1 (Fig. 1F). This suggests that the interaction between
SLC38A9.1 and the v-ATPase is not mediated through Ragulator but directly or indirectly
through the region of SLC38A9.1 that contains its transmembrane domains. Concordant
with this interpretation, the N-terminal domain of SLC38A9.1, which interacts strongly
with Ragulator, did not coimmunoprecipitate the v-ATPase (Fig. 1 F).
SLC38A9 is a Lysosomal Membrane Protein Required for mTORC1 Activation
Well-characterized members of the SLC38 family of amino acid transporters
(SLC38A1-5) localize to the plasma membrane (22) but at least one member, SLC38A7,
is a lysosomal membrane protein (19). This is also the case for SLC38A9.1, SLC38A9.2,
and SLC38A9.4 as in HEK-293T cells all three isoforms co-localized with LAMP2, an
established lysosomal membrane protein (Fig. 2A and fig. S3, A and B). Amino acids did
not affect the lysosomal localization of SLC38A9.1 (Fig. 2A). As would be expected if
SLC38A9.1 binds to Ragulator at the lysosome, a Ragulator mutant that does not
localize to the lysosomal surface because its p18 component lacks lipidation sites (23)
did not interact with SLC38A9.1 (fig. S3C).
ShRNA- or siRNA-mediated depletion of SLC38A9 in HEK-293T cells
suppressed activation of mTORC1 by amino acids, as detected by the phosphorylation
of its established substrate ribosomal protein S6 Kinase 1 (S6K1) (Fig. 2B and fig. S3D).
Thus, like the five known subunits of Ragulator (12, 13), SLC38A9.1 is a positive
component of the mTORC1 pathway. We conclude that SLC38A9.1 is a lysosomal
membrane protein that interacts with Ragulator and the Rag GTPases through its Nterminal 119 amino acids ('Ragulator-binding domain') and is required for mTORC1
activation.
82
SLC38A9.1 Overexpression Makes mTORC1 Signaling Insensitive to Amino Acids
Given the similarity of SLC38A9.1 to amino acid transporters, we reasoned that it
might act in conveying amino acid sufficiency to Ragulator and the Rag GTPases. In
accord with this expectation, stable or transient overexpression in HEK-293T cells of
SLC38A9.1, but not of several control proteins, rendered mTORC1 signaling resistant to
total amino acid starvation or to just that of leucine or arginine, two amino acids that
regulate mTORC1 activity in many cell types (24-26) (Fig. 3A and fig. S4A).
Overexpression of SLC38A9.1 did not affect the regulation of mTORC1 by growth factor
signaling (fig. S4, D and E). Commensurate with its effects on mTORC1, SLC38A9.1
overexpression suppressed the induction of autophagy caused by amino acid starvation
(fig. S4C), a phenotype shared with activated alleles of RagA and RagB (6, 7, 28).
Overexpression of variants of SLC38A9 that do not interact with Ragulator and the Rag
GTPases, including SLC38A9.2, SLC38A9.4, and the SLC38A9.1 Al10 and SLC38A9.1
168A mutants, failed to maintain mTORC1 signaling after amino acid withdrawal (Fig. 3,
B and C, and fig. S4A). Thus, even in cells deprived of amino acids, some of the
overexpressed SLC38A9.1 protein appears to be in an active conformation that confers
amino acid insensitivity on mTORC1 signaling in a manner dependent on its capacity to
bind Ragulator and Rags. SLC38A9.1 overexpression also activated mTORC1 in the
absence of amino acids in HEK-293E, HeLa, and LN229 cells, as well as in mouse
embryonic fibroblasts (MEFs), with the degree of activation proportionate to the amount
of SLC38A9.1 expressed (fig. S4B). Interestingly, overexpression of just the Ragulatorbinding domain of SLC38A9.1 mimicked the effects of the full-length protein on
mTORC1 signaling (Fig. 3D), indicating that it can adopt an active state when separated
from the transmembrane portion of SLC38A9.1.
The gain of function phenotype caused by SLC38A9.1 overexpression offered an
opportunity to test its relation to the Rag GTPases, mTORC1, and the v-ATPase. The
Rag GTPases and mTORC1 both clearly function downstream of SLC38A9.1 as
2
or treatment
expression of the dominant negative Rag heterodimer (RagBT 54 N-RagCQ OL)
with the mTOR inhibitor Torinl (29) completely inhibited mTORC1 activity, irrespective
of whether SLC38A9.1 was overexpressed or not (Fig. 3, E and F). In contrast, the vATPase has a more complex relationship with SLC38A9.1. Its inhibition with
concanamycin A eliminated mTORC1 signaling in the control cells but only partially
83
blocked it in cells overexpressing SLC38A9.1 (Fig. 3F). These results suggest a model
in which SLC38A9.1 and the v-ATPase represent parallel pathways that converge upon
the Ragulator-Rag GTPase complex.
Modulation of the SLC38A9-Rag-Ragulator Interactions by Amino Acids
Amino acids modulate the interactions between many of the established
components of the amino acid sensing pathway, so we tested if this was also the case
for the SLC38A9.1-Ragulator-Rag complex. Indeed, amino acid starvation strengthened
the interaction between stably expressed or endogenous Ragulator and endogenous
SLC38A9 (Fig. 4A, fig. S5) and between stably expressed SLC38A9.1 and endogenous
Ragulator and Rags (Fig. 4B). We obtained similar results when cells were deprived of
and stimulated with just leucine or arginine (Fig. 4A). Curiously, although the N-terminal
domain of SLC38A9.1 readily bound Ragulator, the interaction was insensitive to amino
acids (Fig. 4B), suggesting that the transmembrane region is required to confer amino
acid responsiveness.
As amino acid starvation alters the nucleotide state of the Rag GTPases (6, 7),
we tested whether SLC38A9 interacted differentially with mutants of the Rags that lock
their nucleotide state. Heterodimers of epitope-tagged RagB-RagC containing RagBT 54 N
which mimics the GDP-bound state (6, 7), were associated with more endogenous
SLC38A9 than heterodimers containing wild-type RagB (Fig. 4C). In contrast,
heterodimers containing RagBQ 99L, which lacks GTPase activity and so is bound to GTP
(6, 7, 15), interacted very weakly with SLC38A9 (Fig. 4C). Thus, like Ragulator,
SLC38A9 interacts best with Rag heterodimers in which RagA/B is GDP-loaded, which
is consistent with SLC38A9 binding to Ragulator and with Ragulator being a GEF for
RagA/B. These results suggest that amino acid modulation of the interaction of
SLC38A9.1 with Rag-Ragulator largely reflects amino acid-induced changes in the
nucleotide state of the Rag GTPases. Because the RagB mutations had greater effects
on the interaction of the Rag GTPases with SLC38A9 than with Ragulator (in Figure 4C
compare the SLC38A9 blots with those for p14 and p18), it is very likely that the Rag
heterodimers make Ragulator-independent contacts with SLC38A9 that affect the
stability of Rag-SLC38A9 interaction.
84
SLC38A9.1 is an Amino Acid Transporter
We failed to detect SLC38A9.1 -mediated amino acid transport or amino acidinduced sodium currents in live cells in which SLC38A9.1 was so highly overexpressed
that some reached the plasma membrane (fig. S6, A-E). Because these experiments
were confounded by the presence of endogenous transporters or relied on indirect
measurements of transport, respectively, we reconstituted SLC38A9.1 into liposomes to
directly assay the transport of radiolabelled amino acids. Affinity-purified SLC38A9.1
inserted unidirectionally into liposomes so that its N-terminus faced outward in an
orientation analogous to that of the native protein in lysosomes (fig. S6, F-H). We could
not use radiolabelled L-leucine in transport assays because it bound non-specifically to
liposomes so we focused on the transport of L-arginine, which had low background
binding (fig. S61). The SLC38A9.1-containing proteoliposomes exhibited time-dependent
uptake of radiolabelled arginine while those containing LAMP1 interacted with similar
amounts of arginine as liposomes (Fig. 5A, fig. S61). Steady-state kinetic experiments
revealed that SLC38A9.1 has a Michaelis constant (Km) of -39 mM and a catalytic rate
constant (kcat) of -1.8 min- (Fig. 5B), indicating that SLC38A9.1 is a low-affinity amino
acid transporter. SLC38A9.1 can also efflux arginine from the proteoliposomes (Fig. 5C),
but its orientation in liposomes makes it impossible to obtain accurate Km and kcat
measurements for this activity. It is likely that by having to assay the transporter in the
'backwards' direction we are underestimating its affinity for amino acids during their
export from lysosomes.
To assess the substrate specificity of SLC38A9.1, we performed competition
experiments using unlabeled amino acids (Fig. 5D). The positively charged amino acids
histidine and lysine competed radiolabelled arginine transport to similar degrees as
arginine, while leucine had a modest effect and glycine was the least effective
competitor. Thus, it appears that SLC38A9.1 has a relatively non-specific substrate
profile with a preference for polar amino acids.
Given the preference of SLC38A9.1 for the transport of arginine and that arginine
is highly concentrated in rat liver lysosomes (30) and yeast vacuoles (31), we asked
whether SLC38A9.1 may have an important role in transmitting arginine levels to
mTORC1. Towards this end we examined how mTORC1 signaling responded to a range
of arginine or leucine concentrations in HEK-293T cells in which we knocked out
SLC38A9 using CRISPR-Cas9 genome editing (Fig. 5E). Interestingly, activation of
mTORC1 by arginine was strongly repressed at all arginine concentrations while the
85
response to leucine was only blunted so that high leucine concentrations activated
mTORC1 equally well in null and control cells (Fig. 5F).
DISCUSSION:
Several properties of SLC38A9.1 are consistent with it functioning as an amino
acid sensor for the mTORC1 pathway. Purified SLC38A9.1 transports and therefore
directly interacts with amino acids. Overexpression of SLC38A9.1 or just its Ragulatorbinding domain activates mTORC1 signaling even in the absence of amino acids. The
activation of mTORC1 by amino acids, particularly arginine, is defective in cells lacking
SLC38A9. Given these results and that arginine is highly enriched in lysosomes from at
least one mammalian tissue (30), we suggest that SLC38A9.1 is a strong candidate for
being a lysosome-based arginine sensor for the mTORC1 pathway. To substantiate this
possibility it will be necessary to determine the actual concentrations of arginine and
other amino acids in the lysosomal lumen and cytosol and compare them to the affinity
of SLC38A9.1 for amino acids. If high arginine levels are a general feature of
mammalian lysosomes it could explain why SLC38A9.1 appears to have a relatively
broad amino acid specificity; perhaps no other amino acid besides arginine is in the
lysosomal lumen at levels that approach its Km.
The notion that proteins with sequence similarity to transporters function as both
transporters and receptors (transceptors) is not unprecedented (32, 33). The
transmembrane region of SLC38A9.1 might undergo a conformational change upon
amino acid binding that is then transmitted to Ragulator through its N-terminal domain.
What this domain does is unknown but it could regulate Ragulator nucleotide exchange
activity or access to the Rag GTPases by other components of the pathway. To support
a role as a sensor, it will be necessary to show that amino acid binding regulates the
biochemical function of SLC38A9.1.
Even if SLC38A9.1 is an amino acid sensor, additional sensors, even for
arginine, are almost certain to exist as we already know that amino acid-sensitive events
exist upstream of Folliculin (15, 34) and GATOR1 (35), which, like Ragulator, also
regulate the Rag GTPases. An attractive model is that distinct amino acid inputs to
mTORC1 converge at the level of the Rag GTPases with some initiating at the lysosome
through proteins like SLC38A9.1 and others from cytosolic sensors that remain to be
86
defined (Fig. 5G). Indeed, such a model would explain why the loss of SLC38A9.1
specifically affects arginine sensing but its overexpression makes mTORC1 signaling
resistant to arginine or leucine starvation: hyperactivation of the Rag GTPases through
the deregulation of a single upstream regulator is likely sufficient to overcome the lack of
other positive inputs. A similar situation may occur upon loss of GATOR1, which, like
SLC38A9.1 overexpression, causes mTORC1 signaling to be resistant to total amino
acid starvation (14).
Modulators of mTORC1 have clinical utility in disease states associated with or
caused by mTORC1 deregulation. The allosteric mTOR inhibitor rapamycin is used in
cancer treatment (36) and transplantation medicine (37). However, to date, there have
been few reports on small molecules that activate mTORC1 by engaging known
components of the pathway. The identification of SLC38A9.1-a protein that is a positive
regulator of the mTORC1 pathway and has an amino acid binding site-provides an
opportunity to develop small molecule agonists of mTORC1 signaling. Such molecules
should promote mTORC1-mediated protein synthesis and could have utility in
combatting muscle atrophy secondary to disuse or injury. Lastly, there is reason to
believe that a selective mTORC1 pathway inhibitor may have better clinical benefits than
rapamycin, which in long-term use inhibits both mTORC1 and mTORC2 (38).
SLC38A9.1 may be an appropriate target to achieve this.
87
FIGURE 1: Interaction of SLC38A9.1 with Ragulator and the Rag GTPases
B
C
Metap2
RagB
Ragulator:
0
2
p18
3
7
9
5
p14
c7orf59
HBX1P
S,
SLC38A9.4
100 kDa
SLC3SA9.1 A110
70 kDa
$C38A9.
N-tfm 119
50 kDa
D
F
E
Transfecd
'
cNAs:
C.lls ... rssvl
FLAG-SLC38A9.1
PNGase F:
SLC38A92
#
protein
a5i SLC38A9.1
-
SLC38A9.1
peptlde
-
IPed
-
A
Y
m r T
UUUU.
38aASNMPa3*.?LTPADAL
*EjD-PGELTM
s gsALt
IA9
y1#AW
9N1a
PS
Cels expreask:
1
PIS
franseced
cDNAs:
RagC
pie
RagA
P1
13
A
-Vlm
4
IP
FLAG
v-ATPas*
.
p14
R&O
RagC
FLAo-LAMP1
lp:
PLAo-SLC38A9. 1
'P
RagA
FLAG
FLAG
NuAn etMp2
FLA-LAMPi
*1
FLAO-RagE
PLAG-SLC38AS.1
Ao- SLC38A9.2
F AMPI
SLC3A9.1
FLAO-SLC3SA9.1
1_1190
p18
~
F.Aa-p14
ag
p14
i4ARaC
RagA
m
_
Cell
M
Cel
tysate
lysals
FLAo-LAMP;
nua-SLC3S.A9.1
ruoa4n@tp2
FLA-RagE
nAo-SLC38A9.1
1-119
88
F"Ap16
FIGURE 2: Localization of SLC38A9.1 to the lysosomal membrane in an amino
acid-independent fashion and requirement of SLC38A9 for mTORCI pathway
activation by amino acids
A
FLAG-SLC38A9.1
LAMP2
FLAG-
SLC38A9.1
-a.a. for
50
for
LAMP2
Merge
B
C
shRNA:
amino acids: '
®-T389-S6K1
+'
4
S6K1 .0,0
-
O
'"-+'
0
00
SLC38A9
-a.a. forFLAG50 mfo
SLC38A9.1
dj!*'ytd
raptor
SLAMP2
+a.a. for
10 min
Merge
89
**
#04
4*
FIGURE 3: Stable overexpression of full-length SLC38A9.1 or its N-terminal
Ragulator-binding domain makes the mTORC1 pathway insensitive to amino acid
deprivation
A
B
Ces expressing:
ssing:
amino aci :
Be ucine:
acids:
-amino
4
-T389-36K1
-
ar inine:
-
+
-
+
-
+
Cells expre
6S6K1
c-T3a9 S6K1
S61 a
Ra-SLC3WA.1As
FLAG-SLC39AS.2
ULKI
1MO
W
6
0 db*
.
4
.- S65-4E-BP1
04
WOW0
M44
-
*0
4*
C
V
Cels expressing:
amino acids:
4E-BP1
+
+
-
-+
+
®-S757-ULKI
T389-SK1
FLAO-SLC38A9.1
FLAG-LAMP1
FLAG-SLC3BA9.1
FLAOmetap2
D
E
FLA.56K1 & KATranstected
Cells expressing:
+
RaagC*'
++
-
arginine:
R[
MW i"s
'0
®-T389-6K1
+
FLAG
FLAOSLC38A9.1
CeN
lysate
1-119
Conc-nycin A
DMSO
treatment
Torini
-
+
-
+
-
+
-
+
-
+
-
+
Cells expressing:
amino acids:
S6K1
mA-SEC30A9.1
FLAG-metap2
F
amino acids
1T38946K1
-T389-S6K1
40 f 40
96K1
FLAO-SLC38A9.1
FLA-metap2
90
4A-mtap2
t.RagcolL
-
+
'-
+
-
-
+
+o
RagBt1
+
amino acids:
+
SLC36A9.1
Metp2
Rag3"B
cDNAs:
40 som40' s aft
FIGURE 4: Modulation of the interaction between SLC38A9 and Ragulator and the
Rag GTPases by amino acids
FLAG-
FLAG-pIS
FLAG-p14
-
-
C
agC u.
Roo YS
+
leucine:
argirnine:
+
+
amino acids:
metp2
+
SLC38A9
Translected
cDNAs:
FLAG
lysae
[
ue p14 ~
Rag nucleobd binding mutanits
AseYoknwy wam nuesohes]
GTP hVdycyesmWnwi
OTP hey**pi emfwt
FLA.mtap2:
-
A-GAT-RagB:
-
SL
FLAPI
+-
FLAO-1R0gC:
-
-
-
-
-
-
WT WI WT S7QOIOL5n*O1O
L
wT lim oauL wT wI owt iset
3A9
SLC36A9
FLA-p1i
(samea
f
FLAa-p14
Fp.
FLAG
B
Cells expressing:
amino acids:
/
xYe~e~
/~P/~
FuoAretp2 ams
FLAG-RagC
RagC
mA-a-RagO
RagA
SLC38A9
d"4V"~
PLAaSLC38A9.1
PLAG-SLC3BA9.2
raptor
ek
Ceil
FLAo-metap2
FLAGSLC3&A9.4
p14 WON
Fuw-mWt2
1-119
FLAo-RagC
m-AST-RagSB
p14
RegA
Cell
lysate
4
a
p14
p14
L
raptor
p18
p1S
IP:
FLAG
-
A
Cells expressing:
RagC
Rua-SLC3SA9.1
FLAo-SLC3SA9.2
FLAa-fWtap2
FLAG-SLC36A9.4
ruLo-SLC3SA9.1
1-119
91
"W Oft
w
A
-p.-.
FIGURE 5: SLC38A9.1 is a low affinity amino acid transporter and is necessary for
mTORC1 pathway activation by arginine
B
4- R-(05uM)
+IR'+20 mM R
0
-
e 8~
20
R*+50 mM R
1100- *
SLC38A9.1 proteoliposomes
10-
fi
R'+10O0mM R
R+400 mMR
&
A,
'a e. 6-
10-Km
~50
= 39 mM
-
14-
liposormes onl~y
2-
0
Time(min)
20
0
60
40
20
Skcat
0.
C
40
Time (min)
300
200
100
0
60
1 .8
E
C4
0SLC38A9
-E
a 0
raptor g
4
S.
FHEK-293T clone:
sgAAVS1_
0
%leucino
in RPMI:
1
3
-w
®-T389-S6K1
10
100 0
im t
1
3
1
3
10 30 100
in RPMI
S6K1
G
so
S
®-T389-S6K1
,
w90
cytosol
R
40 0 0
HEK-293T clone:
% aglne 0
in RPMI:
1
®-T389-S6K1
gAAVS12
3
10 30 100 0
amino
acids
membrane
amino
acids
92
sgSLC38A9-1
1
3
10 30 100
&gSLC38A9-2
1 3 10 30 100
s 4 6V
W6K1 4% a 0 00,
SLC38A9
ru
&gAAVS1 1
1 3 10 30 100 0
0
,i 00 *4 "-- 06 10 0 1 l ,04
v-ATPase
tysosomai
lumen
M
0
SKI S
I*
*gSLC38A9_2
0
10 30 100
%arglnkn
in RPMI
G
®
k-T389-S6K1
o
-
sgAAVS1_1
0
HEK-293T clone:
3 10 30 100
1
a ft so a
HEK-293T clone:
H KQ E M F L I A P
Competitor amino acid
sgSLC3BA9 I
30
S6K1 A
%leucdne
R
20
4110
.
100 15;0 200
Time
000
(min)
500
400
[Arg] (mM)
D
0
min-
40 46
li 00 d 4k6
Figure Legends
Figure 1. Interaction of SLC38A9.1 with Ragulator and the Rag GTPases. (A) The
spectral counts of SLC38A9-derived peptides detected by mass spectrometry in
immunoprecipitates prepared from HEK-293T cells stably expressing the indicated
FLAG-tagged proteins. (B) Schematic depicting SLC38A9 isoforms and truncation
mutants. Transmembrane domains predicted by the TMHMM (transmembrane hidden
Markov model) algorithm (http://www.cbs.dtu.dk/services/TMHMM) are shown as blue
boxes. (C) Effects of PNGase F treatment of SLC38A9.1 on its electrophoretic migration.
(D) Interaction of full-length SLC38A9.1 or its N-terminal domain with endogenous
Ragulator (p18 and p14) and RagA and RagC GTPases. HEK-293T cells were
transfected with the indicated cDNAs in expression vectors and lysates were prepared
and subjected to FLAG immunoprecipitation followed by immunoblotting for the indicated
proteins. (E) Identification of key residues in the N-terminal domain of SLC38A9.1
required for it to interact with Ragulator and the Rag GTPases. Experiment was
performed as in (D) using indicated SLC38A9.1 mutants. (F) Interaction of SLC38A9.1
with v-ATPase components VOd1 and V1 B2. HEK-293T cells stably expressing the
indicated FLAG-tagged proteins were lysed and processed as in (D).
Figure 2. Localization of SLC38A9.1 to the lysosomal membrane in an amino acidindependent fashion and requirement of SLC38A9 for mTORC1 pathway activation by
amino acids. (A) SLC38A9.1 localization in cells deprived of or replete with amino acids.
HEK-293T cells stably expressing FLAG-SLC38A9.1 were starved and stimulated with
amino acids for the indicated times. Cells were processed and immunostained for
LAMP2 and FLAG-SLC38A9.1. (B) Requirement of SLC38A9 for the activation of the
mTORC1 pathway by amino acids. HEK-293T cells expressing indicated short hairpin
RNAs (shRNAs) were deprived of amino acids for 50 min or deprived of and then restimulated with amino acids for 10 min. Cell lysates were analyzed for the levels of
indicated proteins and the S6K1 phosphorylation state.
Figure 3. Stable overexpression of full-length SLC38A9.1 or its N-terminal Ragulatorbinding domain makes the mTORC1 pathway insensitive to amino acid deprivation. (A)
Stable overexpression of FLAG-SLC38A9.1 largely restores mTORC1 signaling during
total amino acid starvation and completely restores it upon deprivation of leucine or
arginine. HEK-293T cells transduced with lentiviruses encoding the specified proteins
93
were deprived for 50 min of all amino acids, leucine, or arginine and, where indicated,
re-stimulated for 10 min with the missing amino acid(s). Cell lysates were analyzed for
the levels of the specified proteins and the phosphorylation states of S6K1, ULKI, and
4E-BP1. (B and C) Overexpression of neither SLC38A9.2 nor a point mutant of
SLC38A9.1 that fails to bind Ragulator rescues mTORC1 signaling during amino acid
starvation. Experiment was performed as in (A) except that cells were stably expressing
SLC38A9.2 (B) or SLC38A9.1 168A (C). (D) Stable overexpression of the Ragulatorbinding domain of SLC38A9.1 largely restores mTORC1 signaling during total amino
acid starvation and completely rescues it upon deprivation of leucine or arginine.
Experiment was performed as in (A) except cells were stably expressing FLAGSLC38A9.1 1-119. (E) The ability of SLC38A9.1 overexpression to rescue mTORC1
signaling during amino acid starvation is eliminated by co-expression of RagBT 5 4 N_
RagCQ 2OL, a Rag heterodimer locked in the nucleotide configuration associated with
amino acid deprivation. Effects of expressing the indicated proteins on mTORC1
signaling were monitored by the phosphorylation state of co-expressed FLAG-S6K1. (F)
Effects of concanamycin A and Torin1 on mTORC1 signaling in cells stably expressing
SLC38A9.1. HEK-293T cells stably expressing the indicated FLAG-tagged proteins were
treated with the DMSO vehicle or the specified small molecule inhibitor during the 50 min
starvation for and, where indicated, the 10 min stimulation with amino acids.
Figure 4. Modulation of the interaction between SLC38A9 and Ragulator and the Rag
GTPases by amino acids. (A) Effects of amino acids on interaction between the
Ragulator complex and endogenous SLC38A9. HEK-293T cells stably expressing the
indicated FLAG-tagged Ragulator components were deprived of total amino acids,
leucine, or arginine for 1 hour and, where indicated, re-stimulated with amino acids,
leucine, or arginine for 15 min. After lysis, samples were subject to FLAG
immunoprecipitation and immunoblotting for the indicated proteins. Quantification of
SLC38A9 levels in the stimulated state relative to starved state, p14 IP: 0.75 (+AA), 0.79
(+L), 0.74 (+R); p18 IP: 0.56 (+AA), 0.57 (+L), 0.49 (+R). (B) Effects of amino acids on
the interaction between full-length or truncated SLC38A9.1 and endogenous Ragulator
and the Rag GTPases. Experiment was performed as in (A) except that cells stably
expressed the indicated SLC38A9 isoforms or its N-terminal domain (SLC38A9.1 1-119).
Quantification of indicated protein levels in the stimulated state relative to starved state,
SLC38A9.1 IP: 0.43 (p18), 0.51 (p14), 0.61 (RagC), 0.58 (RagA); SLC38A9.1 1-119 IP:
94
0.99 (p18), 1.05 (p14), 1.04 (RagC), 1.09 (RagA). (C) Effects of the RagBT 5 4N mutation
on association with endogenous SLC38A9. HEK-293T cells were transfected with the
indicated cDNAs in expression vectors and lysates were prepared and subjected to
FLAG immunoprecipitation followed by immunoblotting for the indicated proteins. Two
different antibodies were used to detect endogenous SLC38A9.
Figure 5. SLC38A9.1 is a low affinity amino acid transporter and is necessary for
mTORC1 pathway activation by arginine. (A) Time-dependent uptake of [ 3 H]arginine at
0.5 pM by proteoliposomes containing 22.4 pmol of SLC38A9.1. To recapitulate the pH
gradient across the lysosomal membrane, the lumen of the proteoliposomes is buffered
at pH 5.0, while the external buffer is pH 7.4. (B) Steady-state kinetic analysis of
SLC38A9.1 uptake activity reveals a Michaelis constant (Kn) of -39mM and catalytic
rate constant (kcat) of -1.8min-1. (Left) Time course of [3H]arginine (R*) uptake, given
fixed [ 3H]arginine (0.5 pM) and increasing concentrations of unlabeled arginine. (Right)
Velocity, calculated from left panel, as a function of total arginine concentration. Data
were fitted to the Michaelis-Menton equation. Experiment was repeated over 4 times
with similar results and a representative one is shown. (C) Time-dependent efflux of
SLC38A9.1 proteoliposomes following 1.5 hr loading with 0.5 pM [ 3 H]arginine. (D)
Competition of 0.5 pM [ 3H]arginine transport by SLC38A9.1 using 100 mM of indicated
unlabeled amino acids. In A-D, error bars represent standard deviation derived from at
least 3 measurements. (E) HEK-293T cells null for SLC38A9 were generated using
CRISPR-Cas9 genome editing using two different guide sequences and isolated by
single cell cloning. The AAVS1 locus was targeted as a negative control. (F) Impairment
of arginine-induced activation of the mTORC1 pathway in SLC38A9-null HEK-293T
cells. Cells were starved of the indicated amino acid for 50 minutes and stimulated for 10
minutes using the indicated amino acid concentrations. The leucine and arginine
concentrations in RPMI are, respectively, 381 pM and 1.14 mM. (G) Model for distinct
amino acid inputs to the Rag GTPases in signaling amino acid sufficiency to mTORC1.
95
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
J. L. Jewell, R. C. Russell, K. L. Guan, Amino acid signalling upstream of mTOR.
Nature reviews. Molecular cell biology 14, 133 (Mar, 2013).
J. J. Howell, B. D. Manning, mTOR couples cellular nutrient sensing to
organismal metabolic homeostasis. Trends in endocrinology and metabolism:
TEM 22, 94 (Mar, 2011).
R. Zoncu, A. Efeyan, D. M. Sabatini, mTOR: from growth signal integration to
cancer, diabetes and ageing. Nature reviews. Molecular cell biology 12, 21 (Jan,
2011).
S. Sengupta, T. R. Peterson, D. M. Sabatini, Regulation of the mTOR complex 1
pathway by nutrients, growth factors, and stress. Molecular cell 40, 310 (Oct 22,
2010).
M. Laplante, D. M. Sabatini, mTOR signaling in growth control and disease. Cell
149, 274 (Apr 13, 2012).
Y. Sancak et al., The Rag GTPases bind raptor and mediate amino acid
signaling to mTORC1. Science 320,1496 (Jun 13, 2008).
E. Kim, P. Goraksha-Hicks, L. Li, T. P. Neufeld, K. L. Guan, Regulation of
TORCI by Rag GTPases in nutrient response. Nature cell biology 10, 935 (Aug,
2008).
K. Saito, Y. Araki, K. Kontani, H. Nishina, T. Katada, Novel role of the small
GTPase Rheb: its implication in endocytic pathway independent of the activation
of mammalian target of rapamycin. Journal of biochemistry 137, 423 (Mar, 2005).
C. Buerger, B. DeVries, V. Stambolic, Localization of Rheb to the
endomembrane is critical for its signaling function. Biochemical and biophysical
research communications 344, 869 (Jun 9, 2006).
S. Menon et al., Spatial control of the TSC complex integrates insulin and
nutrient regulation of mTORC1 at the lysosome. Cell 156, 771 (Feb 13, 2014).
R. Zoncu et al., mTORC1 senses lysosomal amino acids through an inside-out
mechanism that requires the vacuolar H(+)-ATPase. Science 334, 678 (Nov 4,
2011).
L. Bar-Peled, L. D. Schweitzer, R. Zoncu, D. M. Sabatini, Ragulator is a GEF for
the rag GTPases that signal amino acid levels to mTORC1. Cell 150, 1196 (Sep
14, 2012).
Y. Sancak et al., Ragulator-Rag complex targets mTORC1 to the lysosomal
surface and is necessary for its activation by amino acids. Cell 141, 290 (Apr 16,
2010).
L. Bar-Peled et al., A Tumor suppressor complex with GAP activity for the Rag
GTPases that signal amino acid sufficiency to mTORC1. Science 340, 1100
(May 31, 2013).
Z. Y. Tsun et al., The folliculin tumor suppressor is a GAP for the RagC/D
GTPases that signal amino acid levels to mTORC1. Molecular cell 52, 495 (Nov
21, 2013).
B. E. Sundberg et al., The evolutionary history and tissue mapping of amino acid
transporters belonging to solute carrier families SLC32, SLC36, and SLC38.
Journal of molecular neuroscience : MN 35, 179 (Jun, 2008).
S. R. Carlsson, J. Roth, F. Piller, M. Fukuda, Isolation and characterization of
human lysosomal membrane glycoproteins, h-lamp-1 and h-lamp-2. Major
sialoglycoproteins carrying polylactosaminoglycan. The Journal of biological
chemistry 263, 18911 (Dec 15, 1988).
96
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
C. Sagne et al., Identification and characterization of a lysosomal transporter for
small neutral amino acids. Proceedings of the National Academy of Sciences of
the United States of America 98, 7206 (Jun 19, 2001).
A. Chapel et al., An extended proteome map of the lysosomal membrane reveals
novel potential transporters. Molecular & cellular proteomics : MCP 12, 1572
(Jun, 2013).
M. Li et al., Suppression of lysosome function induces autophagy via a feedback
down-regulation of MTOR complex 1 (MTORC1) activity. The Journal of
biological chemistry 288, 35769 (Dec 13, 2013).
Y. Xu et al., Epidermal growth factor-induced vacuolar (H+)-atpase assembly: a
role in signaling via mTORC1 activation. The Journal of biological chemistry 287,
26409 (Jul 27, 2012).
B. Mackenzie, J. D. Erickson, Sodium-coupled neutral amino acid (System N/A)
transporters of the SLC38 gene family. Pflugers Archiv: European journal of
physiology 447, 784 (Feb, 2004).
S. Nada et al., The novel lipid raft adaptor p18 controls endosome dynamics by
anchoring the MEK-ERK pathway to late endosomes. The EMBO journal 28, 477
(Mar 4, 2009).
H. Ban et al., Arginine and Leucine regulate p70 S6 kinase and 4E-BP1 in
intestinal epithelial cells. Internationaljournal of molecular medicine 13, 537 (Apr,
2004).
K. Hara et al., Amino acid sufficiency and mTOR regulate p70 S6 kinase and elF4E BP1 through a common effector mechanism. The Journal of biological
chemistry 273, 14484 (Jun 5, 1998).
K. Yao et al., Dietary arginine supplementation increases mTOR signaling activity
in skeletal muscle of neonatal pigs. The Journal of nutrition 138, 867 (May,
2008).
A. Efeyan, R. Zoncu, D. M. Sabatini, Amino acids and mTORC1: from lysosomes
to disease. Trends in molecular medicine 18, 524 (Sep, 2012).
A. Efeyan et al., Regulation of mTORC1 by the Rag GTPases is necessary for
neonatal autophagy and survival. Nature 493, 679 (Jan 31, 2013).
C. C. Thoreen et al., An ATP-competitive mammalian target of rapamycin
inhibitor reveals rapamycin-resistant functions of mTORC1. The Journal of
biological chemistry 284, 8023 (Mar 20, 2009).
E. Harms, N. Gochman, J. A. Schneider, Lysosomal pool of free-amino acids.
Biochemical and biophysical research communications 99, 830 (Apr 15, 1981).
K. Kitamoto, K. Yoshizawa, Y. Ohsumi, Y. Anraku, Dynamic aspects of vacuolar
and cytosolic amino acid pools of Saccharomyces cerevisiae. Journal of
bacteriology 170, 2683 (Jun, 1988).
1. Holsbeeks, 0. Lagatie, A. Van Nuland, S. Van de Velde, J. M. Thevelein, The
eukaryotic plasma membrane as a nutrient-sensing device. Trends in
biochemical sciences 29, 556 (Oct, 2004).
R. Hyde, E. L. Cwiklinski, K. MacAulay, P. M. Taylor, H. S. Hundal, Distinct
sensor pathways in the hierarchical control of SNAT2, a putative amino acid
transceptor, by amino acid availability. The Journal of biological chemistry 282,
19788 (Jul 6, 2007).
C. S. Petit, A. Roczniak-Ferguson, S. M. Ferguson, Recruitment of folliculin to
lysosomes supports the amino acid-dependent activation of Rag GTPases. The
Journal of cell biology 202, 1107 (Sep 30, 2013).
97
35.
36.
37.
38.
L. Chantranupong et al., The Sestrins Interact with GATOR2 to Negatively
Regulate the Amino-Acid-Sensing Pathway Upstream of mTORC1. Cell reports,
(Sep 24, 2014).
D. Benjamin, M. Colombi, C. Moroni, M. N. Hall, Rapamycin passes the torch: a
new generation of mTOR inhibitors. Nature reviews. Drug discovery 10, 868
(Nov, 2011).
B. D. Kahan, J. S. Camardo, Rapamycin: clinical results and future opportunities.
Transplantation 72, 1181 (Oct 15, 2001).
D. W. Lamming, L. Ye, D. M. Sabatini, J. A. Baur, Rapalogs and mTOR inhibitors
as anti-aging therapeutics. The Journal of clinical investigation 123, 980 (Mar 1,
2013).
Acknowledgements
We thank all members of the Sabatini Lab for helpful insights, E. Spooner for the mass
spectrometric analyses, and G. Superti-Furga and M. Rebsamen for suggesting the use
of the Sigma antibody to detect SLC38A9. This work was supported by grants from the
NIH (R01 CA103866 and A147389) and Department of Defense (W81XWH-07-0448) to
D.M.S., and fellowship support from the NIH to Z.T. (F30 CA1 80754), to S.W. (T32
GM007753 and F31 AG044064), to L.C. (F31 CA180271), and to R.W. (T32
GM007753); an NDSEG Fellowship to G.A.W.; an NSF Graduate Research Fellowship
to T.W.; an American Cancer Society - Ellison Foundation Postdoctoral Fellowship to
W.C. (PF-13-356-01-TBE); a German Academic Exchange Service/DAAD Fellowship to
C.S., and support from the Howard Hughes Medical Institute to T.D.J., C.K. and J.P.
D.M.S. and B.L.S. are investigators of the Howard Hughes Medical Institute.
98
EXPERIMENTAL PROCEDURES
Materials
Reagents were obtained from the following sources: HRP-labeled anti-mouse,
anti-rabbit, and anti-goat secondary antibodies and the antibody to LAMP2 from Santa
Cruz Biotechnology; antibodies to phospho-T389 S6K1, S6K1, phospho-ULK1, ULK1,
phospho-S65 4E-BP1, 4E-BP1, RagA, RagC, p14 (LAMTOR2), p18 (LAMTOR1),
mTOR, and the FLAG epitope (rabbit antibody) from Cell Signaling Technology; the
antibody to the HA epitope from Bethyl laboratories; the antibody to ATP6V1 B2 from
Abcam; RPM I, FLAG M2 affinity gel, FLAG-M2 (mouse) and ATP6V0d1 antibodies, and
amino acids from Sigma Aldrich; the PNGase F from NEB; Xtremegene 9 and Complete
Protease Cocktail from Roche; AlexaFluor-labeled donkey anti-rabbit, anti-mouse, and
anti-rat secondary antibodies from Invitrogen and Inactivated Fetal Calf Serum (IFS)
from Invitrogen; amino acid-free RPMI and Leucine or Arginine-free RPMI from US
Biological; siRNAs targeting indicated genes and siRNA transfection reagent from
Dharmacon; Concanamycin A from A.G. Scientific; Torin1 from Nathanael Gray (DFCI);
[ 14C]-labeled
amino acids and Opti-Fluor scintillation fluid from PerkinElmer; [ 3H]-labeled
amino acids from American Radiolabeled Chemicals; Egg phosphatidylcholine
(840051C) from Avanti lipids; Bio-beads SM-2 from Bio-Rad; and PD-1 0 columns from
GE Healthcare Life Sciences. The antibody to SLC38A9 from Sigma (HPA043785) was
used to recognize the deglycosylated protein (according to NEB instructions except
without the boiling step) in cell lysates and immunopurifications. A distinct antibody to
SLC38A9.1 was generated in collaboration with Cell Signaling Technology and was
used to detect the glycosylated protein in Ragulator immunopurifications but is not
sensitive enough to detect it in cell lysates.
Cell lines and tissue culture
HEK-293T cells were cultured in DMEM supplemented with 10% inactivated fetal
bovine serum, penicillin (100 IU/mL), and streptomycin (100 pg/mL) and maintained at
370C and 5% CO2. In HEK-293E, but not HEK-293T, cells the mTORC1 pathway is
strongly regulated by serum and insulin (1).
Mass spectrometric analyses
Immunoprecipitates from 30 million HEK-293T cells stably expressing FLAGmetap2, FLAG-p18, FLAG-p14, FLAG-HBXIP, FLAG-c7orf59, and FLAG-RagB were
prepared as described below. Proteins were eluted with the FLAG peptide (sequence
99
DYKDDDDK) from the anti-FLAG affinity beads, resolved on 4-12% NuPage gels
(Invitrogen), and stained with SimplyBlue SafeStain (Invitrogen). Each gel lane was
sliced into 10-12 pieces and the proteins in each gel slice digested overnight with
trypsin. The resulting digests were analyzed by mass spectrometry as described (2).
Amino acid or individual amino acid starvation and stimulation of cells
Almost confluent cell cultures in 10 cm plates were rinsed twice with amino acidfree RPMI, incubated in amino acid-free RPMI for 50 min, and stimulated for 10 min with
a water-solubilized amino acid mixture added directly to the amino acid-free RPMI. For
leucine or arginine starvation, cells in culture were rinsed with and incubated in leucineor arginine-free RPMI for 50 min, and stimulated for 10 min with leucine or arginine
added directly to the starvation media. After stimulation, the final concentration of amino
acids in the media was the same as in RPMI. Cells were processed for biochemical or
immunofluorescence assays as described below. The 1OX amino acid mixture and the
300X individual stocks were prepared from individual amino acid powders. When
Concanamycin A (ConA) or Torin1 was used, cells were incubated in 5 pM
Concanamycin or 250 nM Torin1 during the 50 min amino acid starvation and 10 min
amino acid stimulation periods.
Cell lysis and immunoprecipitations
HEK-293T cells stably expressing FLAG-tagged proteins were rinsed once with
ice-cold PBS and lysed in ice-cold lysis buffer (40 mM HEPES pH 7.4, 1% Triton X-100,
10 mM P-glycerol phosphate, 10 mM pyrophosphate, 2.5 mM MgC1 2 and 1 tablet of
EDTA-free protease inhibitor (Roche) per 25 ml buffer). The soluble fractions from cell
lysates were isolated by centrifugation at 13,000 rpm for 10 min in a microcentrifuge. For
immunoprecipitates 30 uL of a 50% slurry of anti-FLAG affinity gel (Sigma) were added
to each lysate and incubated with rotation for 2-3 hr at 40C. Immunoprecipitates were
washed three times with lysis buffer containing 500 mM NaCl. Immunoprecipitated
proteins were denatured by the addition of 50 uL of sample buffer and incubation at RT
for 30 min. It is critical that the samples containing SLC38A9 are neither boiled nor
frozen prior to resolution by SDS-PAGE and analysis by immunoblotting. A similar
protocol was employed when preparing samples for mass spectrometry.
cDNA manipulations and mutagenesis
100
The cDNAs for all human SLC38A9 isoforms, both native and codon-optimized,
were gene-synthesized by GenScript. The cDNAs were amplified by PCR and the
products were subcloned into Sal I and Not I sites of HA-pRK5 and FLAG-pRK5. The
cDNAs were mutagenized using the QuikChange 11 kit (Agilent) with oligonucleotides
obtained from Integrated DNA Technologies. All constructs were verified by DNA
sequencing.
FLAG-tagged SLC38A9 isoforms and SLC38A9 N-terminal 1-119 were amplified
by PCR and cloned into the Sal I and EcoR I sites of pLJM60 or into the Pac I and EcoR
I sites of pMXs. After sequence verification, these plasmids were used, as described
below, in cDNA transfections or to produce lentiviruses needed to generate cell lines
stably expressing the proteins.
cDNA transfection-based experiments
For cotransfection-based experiments to test protein-protein interactions, 2
million HEK-293T cells were plated in 10 cm culture dishes. 24 hours later, cells were
transfected with the pRK5-based cDNA expression plasmids indicated in the figures in
the following amounts: 500 ng FLAG-metap2; 50 ng FLAG-LAMP1; 100 ng FLAG-RagB
and 100 ng HA-RagC; 300 ng FLAG-SLC38A9.1; 600 ng FLAG-SLC38A9.1 A110; 200
ng FLAG-SLC38A9.4; 400 ng FLAG-N-terminal 119 fragment of SLC38A9. 1; 200 ng
FLAG-RagC; 200 ng FLAG-RagC S75N; 200 ng FLAG-RagC Q120L; 400 ng HAGSTRagB; 400 ng HAGST-RagB T54N; 400 ng HAGST-RagB Q99L. Transfection mixes
were taken up to a total of 5 pg of DNA using empty pRK5.
For co-transfection experiments to test mTORC1 activity, 1 million HEK-293T
cells were plated in 10 cm culture dishes. 24 hours later, cells were transfected with the
pRK5-based cDNA expression plasmids indicated in the figures in the following
amounts: 500 ng HA-metap2; 50 ng HA-LAMP1; 200 ng HA-SLC38A9.1; 500 ng HASLC38A9.1 A110; 200 ng HA-SLC38A9.4; 100 ng HA-RagB T54N and 100 ng HA-RagC
Q1 20L; 2 ng FLAG-S6K1. 72 hours post-transfection, cells were washed once prior to
50-min incubation with amino acid-free RPMI. Cells were stimulated with vehicle or
amino acids (to a final concentration equivalent to RPMI) prior to harvest.
Lentivirus production and lentiviral transduction
Lentiviruses were produced by co-transfection of the pLJM1/pLJM60 lentiviral
transfer vector with the VSV-G envelope and CMV AVPR packaging plasmids into viral
101
HEK-293T cells using the XTremeGene 9 transfection reagent (Roche). For infection of
HeLa cells, LN229 cells, and MEFs, retroviruses were produced by co-transfection of the
pMXs retroviral transfer vector with the VSV-G envelope and Gag/Pol packaging
plasmids into viral HEK-293T cells. The media was changed 24 hours post-transfection
to DME supplemented with 30% IFS. The virus-containing supernatants were collected
48 hours after transfection and passed through a 0.45 pm filter to eliminate cells. Target
cells in 6-well tissue culture plates were infected in media containing 8 pg/mL polybrene
and spin infections were performed by centrifugation at 2,200 rpm for 1 hour. 24 hours
after infection, the virus was removed and the cells selected with the appropriate
antibiotic.
Mammalian RNAi
Lentiviruses encoding shRNAs were prepared and transduced into HEK-293T
cells as described above. The sequences of control shRNAs and those targeting human
SLC38A9, which were obtained from The RNAi Consortium 3 (TRC3), are the following
(5' to 3'):
SLC38A9 #1: GCCTTGACAACAGTTCTATAT (TRCN0000151238)
SLC38A9 #2: CCTCTACTGTTTGGGACAGTA (TRCN00001 56474)
GFP: TGCCCGACAACCACTACCTGA (TRCN0000072186)
For siRNA-based experiments, 200,000 HEK-293T cells were plated in a 6-well
plate. 24 hours later, cells were transfected using Dharmafect 1 (Dharmacon) with 250
nM of a pool of siRNAs (Dharmacon) targeting SLC38A9 or a non-targeting pool. 48
hours post-transfection, cells were transfected again but this time with double the
amount of siRNAs. 24 hours following the second transfection, cells were rinsed with icecold PBS, lysed, and subjected to immunoblotting as described above. The following
siRNAs were used:
Non-targeting: ON-TARGETplus Non-targeting Pool (D-001810-10-05)
SLC38A9: SMARTpool: ON-TARGETplus SLC38A9 (L-007337-02-0005)
Immunofluorescence assays
HEK-293T cells were plated on fibronectin-coated glass coverslips in 6-well
tissue culture dishes, at 300,000 cells/well. 12-16 hours later, the slides were rinsed with
PBS once and fixed and permeabilized in one step with ice-cold 100% methanol (for
102
SLC38A9 detection) at -20'C for 15 min. After rinsing twice with PBS, the slides were
incubated with primary antibody (FLAG CST 1:300, LAMP2 1:400) in 5% normal donkey
serum for 1 hr at room temperature, rinsed four times with PBS, incubated with
secondary antibodies produced in donkey (diluted 1:400 in 5% normal donkey serum) for
45 min at room temperature in the dark, and washed four times with PBS. Slides were
mounted on glass coverslips using Vectashield with DAPI (Vector Laboratories) and
imaged on a spinning disk confocal system (Perkin Elmer).
Whole-cell amino acid transport assay
HEK-293T cells (150,000/well) were plated onto fibronectin-coated 12-well
dishes and transfected 12 hours later with the pRK5-based cDNA expression plasmids
indicated in the figures in the following amounts using XtremeGene9: 400 ng LAMP1FLAG, 400 ng FLAG-SLC38A9.1, 400 ng SLC38A2-FLAG, 150 ng PQLC2-FLAG, and
50 ng GFP. Transfection mixes were taken up to a total of 2 pg of DNA using empty
pRK5. Cells were assayed 48 hours later by washing twice in transport buffer (140 mM
NaCl, 5 mM KCI, 2 mM MgCI2, 2 mM CaCl 2, 30 mM Tris-HCI, pH 7.4, 5 mM glucose),
incubating in transport buffer for 5 min. at 370C before replacing the buffer with fresh
buffer supplemented with amino acids (unlabeled and 0.1 pCi of [ 14C]leucine at a total
concentration of 380 pM, or unlabeled and 0.1pCi of [ 14C]amino acid mix at total
concentrations found in RPMI, or unlabeled and 0.2 pCi of [ 14C]arginine at a total
concentration of 3 mM) at the indicated pH (pH 5 buffered by MES, pH 8 buffered by
Tris) for 10 minutes at 370C. After uptake, cells were washed twice in ice-cold transport
buffer and harvested in 0.5 mL of 1% SDS for scintillation counting. Protocol and amino
acid concentrations used were informed by previous whole-cell assays to detect
transport by SLC38A2 and PQLC2 (3, 4).
Electrophysiology
Whole-cell recordings were made from GFP-positive HEK-293T cells, prepared
as described above, 48 to 72 hrs post transfection. Patch pipettes (open-tip resistance 34 Mf) were filled with a solution containing (in mM) K-gluconate 153, MgC 2 2, CaC 2 1,
EGTA 11, HEPES 10, pH 7.25 adjusted with KOH, and tip resistance was left
uncompensated. Cells were continuously superfused (- 2 ml/min) with extracellular
solution containing (in mM) NaCl 150, KCI 3, CaCl 2 2, MgC 2 1, Glucose 5, HEPES 10,
pH adjusted to 7.4 with NaOH. Once whole-cell configuration was established, a
103
homemade perfusion system consisting of several adjacent glass tubes (ID 252 pm) was
used to locally perfuse extracellular solution pH 5.5 and to apply amino acids (in mM)
leucine 1.6, arginine 2.4, glutamine 4. Membrane currents were amplified and low-pass
filtered at 3 kHz using a Multiclamp 700B amplifier (Molecular Devices), digitized at 10
kHz and acquired using National Instruments acquisition boards and a custom version of
ScanImage written in MATLAB (Mathworks) (5). Data were analyzed offline using Igor
Pro (Wavemetrics), and amino acid-induced currents were quantified as difference in the
average membrane currents for the 5 s-windows right before and during application.
Proteoliposome Reconstitution
HEK-293T cells stably expressing FLAG-SLC38A9.1 were harvested as
described above for immunoprecipitations, except cells were lysed in 40 mM HEPES pH
7.4, 0.5% Triton X-100, 1 mM DTT, and protease inhibitors. Following a 3 hr
immunoprecipitation, FLAG-affinity beads were washed twice for 5 min each in lysis
buffer supplemented with 500 mM NaCl. Beads were equilibrated with inside buffer (20
mM MES pH 5, 90 mM KCI 10 mM NaCI) supplemented with 10% glycerol by washing
them 5 times. FLAG-affinity purified SLC38A9.1 protein was eluted in glycerolsupplemented inside buffer containing 1 mg/mL FLAG peptide by rotation for 30 min.
Protein was concentrated using Amicon centrifuge filters to about 1 mg/mL and snapfrozen in liquid nitrogen and stored at -80'C.
Chloroform-dissolved phosphatidycholine (PC, 50 mg) was evaporated using dry
nitrogen to yield a lipid film in a round bottom flask and desiccated overnight under
vacuum. Lipids were hydrated in inside buffer at 50 mg/mL with light sonication in a
water bath (Branson M2800H) and split into 100 pL aliquots in eppendorf tubes.
Aliquoted lipids were clarified using water bath sonication and recombined and extruded
through a 100 nm membrane with 15 passes (Avanti 61000). Reconstitution reaction (15
pg FLAG-SLC38A9.1 protein, 7.5 mg Triton X-100, 10 mg extruded PC, 1 mM DTT in
inside buffer up to 700 pL) was initiated by rotating at 40C for 30 min. Glycerolsupplemented inside buffer was used in lieu of SLC38A9.1 protein in liposome only
controls. Bio-beads (200 mg/reaction) were prepared by washing 1 time in methanol, 5
times in water and 2 times in inside buffer. Reconstitution reaction was applied to Biobeads for 1 hr, transferred to fresh Bio-beads overnight, and transferred again to fresh
Bio-beads for 1 hr. Protocol was adapted from a recently reconstituted lysosomal
104
transporter and a recent review (6, 7).
Floatation assay
A three-step sucrose gradient was generated by first adding 3.8 mL of the middle
buffer (35% glycerol in inside buffer) to the ultracentrifuge tube, then applying 1 mL of
the bottom buffer (50% glycerol in inside buffer) with 100 pL of SLC38A9.1
proteoliposomes (or protein only) using a 2 mL pipette to the bottom of the tube, and
finally layering 1.2 mL of the top buffer (0% glycerol, inside buffer) on top. For assays
containing urea, the proteoliposomes were rotated in bottom buffer containing 6 M urea
for 30 min. at 40C before generating the sucrose gradient with above buffers
supplemented with 6 M urea. Gradients were topped with 2 mL paraffin oil and loaded
into a SW32.1 rotor and centrifuged at 32,000 g for 24 hours. Fractions (500 pL,
excluding the oil) were collected from the top and 20 pL of each subjected to anti-FLAG
western analysis. Protocol was adapted from Wuu et al. (8).
Trypsin protection assay
Trypsin (1 pL of 0.05%, Invitrogen) was added to SLC38A9.1 proteoliposomes
(15 pL) and incubated at 370C for 30 min. As indicated, 1% Triton X-100 was added and
rotated for 30 min. at 40C before addition of trypsin. Reactions were subjected to antiFLAG western analysis. Protocol was inspired by Brown and Goldstein (9).
In vitro amino acid transport assay
All buffers were chilled and assays performed in a 40C cold room. For time
course experiments, SLC38A9.1 proteoliposomes or liposome controls were applied to
PD10 columns equilibrated with outside buffer (20 mM Tris pH 7.4, 100 mM NaCl) and
eluted according to manufacturer's instructions. Amino acid uptake was initiated by the
addition of 0.5 pM [ 3H]arginine and incubated in a 300C water bath. Time points were
collected by taking a fraction of the assay reaction and applying it to PD10 columns preequilibrated with outside buffer. Columns were eluted in fractions or a single elution of
1.75 mL and added to 5 mL of scintillation fluid. Protein used in uptake assays was
estimated by assuming 100% incorporation efficiency during reconstitution. To obtain
accurate measures of amino acid concentrations, equal volumes of outside buffer was
added to scintillation fluid in the standards.
105
For competition experiments with unlabeled amino acids, high concentrations of
amino acids were required due to the high Km (-39mM) of SLC38A9.1 import activity.
SLC38A9.1 proteoliposomes or liposome controls were centrifuged at 100,000 g for 30
min. in a TLA-1 00.3 rotor and resuspended in a smaller volume of outside buffer such
that they could be added to a larger volume of 100 mM unlabeled amino acid (final
concentration) supplemented with outside buffer components. We had to resort to this
procedure due to the solubility limit of leucine at -130 mM. At such high concentrations,
it is important to adjust all amino acid solutions to pH 7.4. Assays were initiated by
addition of 0.5 pM [ 3 H]arginine to the amino acid buffer solution followed by the addition
of SLC38A9.1 proteoliposomes or liposome controls. For steady-state kinetics
experiments, time points were collected as described above and to assess substrate
specificity, competition experiments were collected at 75 min.
For efflux experiments, SLC38A9.1 proteoliposomes or liposome controls were
loaded with [ 3H]arginine as described above for an import assay for 1.5 hrs. To remove
external amino acids, the reactions were applied to PD10 columns pre-equilibrated with
outside buffer, and time points were collected as described above. Scintillation counts
from liposome controls were subtracted from that of SLC38A9.1 proteoliposomes.
Generation of knockout clones using CRISPR/Cas9
The CRISPR guide sequences designed to the N-terminus (1-119 a.a.) of
SLC38A9 or the AAVS1 locus using http://crispr.mit.edu were cloned into pX459 (10).
AAVS1: GGGGCCACTAGGGACAGGAT
SLC38A9_1: GGCTCAAACTGGATATTCATAGG
SLC38A9_2: GGAGCTGGAACTACATGGTCTGG
HEK-293T cells (750,000/well) were plated into 6 well dishes and transfected 16
hours later with 1 pg of pX459 expressing above guides using XtremeGene9. Cells were
trypsinized 48 hours later, 2 mg/mL puromycin was applied for 72 hours, and allowed to
recover for a few days. When cells were approaching confluency, they were single-cell
sorted into 96-well dishes containing 30% serum and conditioned media. Clones were
expanded and evaluated for knockout status by western analysis for SLC38A9. These
clones were evaluated for amino acid response as described above.
106
SUPPLEMENTAL INFO
Figure S1: Membrane topology of SLC38A9.1.
A
TMHMM output for human SLC38A9.1
1.2
0.
0.6
CL 0.4
0.2
residue number: o
100
200
transmembrane
300
inside
--
P
I
v
A
)
B
Scytosol
I
Iv
Iy
0ue
Av
107
vma
500
400
--
outside
Figure S2: Ragulator and the Rag GTPases do not interact with all lysosomal amino
acid transporter-like proteins.
P~f%
A
N B
B
C
0
Transfected
cDNAs:
RgC
0
Transiected
cDNAs
~
p18
R4q
RagA
RagA
4
p18
p14
IP:
FLAG
p1S
'P
FLAG
IP:
p14
ReAC
nuo-LAMP1
FPLASLC38A9.1
LA.SLC38A9.1 Alt0
Fu4oeWa2
FAOCSLC8A9.4
.A.LAMP1
LAG-SLCS8A9.1
FLAG
FR0-SLC38A9.2
FnA-LAMPI
FPAa-SLCMA9.1
nAomltap2
R9gC
RagC
A
Cell
lysate
n.o-SLC36A1
RagA
FLo-SLC38A7
FLAGLAMP1
PLA-SLC38A9.1
A110
FLA-SLC38A8.I
p18
*
RagC
CoN
lysate
FLA-SLC38A.4
P14
PL&G-SLCUA1.1
ROgA
p18
Col
LAGLAMPI
nAo-SLC38A9.1
~
FtA-SLC38A9.2
p14
lysate
FLAG-LAMPI
Un-Ametap2
-
F.A-SLC38A9.1
FiA-SLC38A7
FLAo-SLC36AI
4
108
FLAG-
SLC38A9.2
FLAG-p14 + HA-HBXIP+
hA-MPI + -c7orf59
Transfected
cDNAs:
"Isa
IA.p1s
HA-SLC3SA9.1
LAMP2
uA-SLC38A9.4
H
--
HA-SLC38A9.1
merge
B
PLAo-p14
IP:
FLAG-
FLAG
"A-HBXIP
SLC38A9.4
"A-Plie"
HA-plO
LAMP2
HA-MPl
mu-c7orf59
merge
mSLC38A9.1
D
siRNA:
amino acids:
NA-SLC38A9.4
-+
cell
-+
FLA*-p14
lysale
(-T389-6K1
mA-HBXIP
SOKI
HA-plaA
SLC38A9
sA.MP1
.
109
-4
A-c7orf59
+
+
C
+
A
+
Figure S3: Localization of SLC38A9 isoforms 2 and 4 and signaling effects of siRNAmediated SLC38A9 knockdown.
Figure S4: (A) Transient overexpression of SLC38A9.1, but not truncation mutants
lacking the N-terminal Ragulator-binding domain, makes the mTORC1 pathway
insensitive to amino acid starvation.
r
ODN":
LM'SLC8".
,"'."p2
COS expr.ssing:
arginine starvation time (h):
-
chloroquine:
%
TransIected
C
nAG.SOK1 &liA.
+
- +
-
+
-+
- +
#
eS
Onmin, ack:
FLAG
-+
++
+-
-
-
16K1
96KI
LC3
BI
A4.LAMP1
pG2
isA-SLC28A9.1
Ap2
PLASLC3SA1.1
A110
A-81CIIIIIA9A
MA-SLC31IA9.1
B
p5 -/-
2MT
Ceexpssing
amino
rua~netmp2
.
.
HeLa
MEFs
:.
adds:
Cellsexpressing
r=
-+
+
-+
,p
-ax
-
#AM.
.
CON
lyeate
®-T238-6K1
arninomed'
-BT311-4611
PLAG-SLC38AS
pu.-SLCM8A9Wll
amino acia: =+r="+""i
-+
SGK1 jV
®T355-46K1[
S6KI
FLA".LC3BAO
PLua-Rap2A
FLA&-Rap2
FLAG-RWp2
i 00M1,
oil
insulin:
®-T9-SSKI
HEK-293T cells
expressfg:
VLf!!-
ap2
treatment: Dtno ua2M
=-+
amino scids: -
HEK-293E Cellis
expressing:
-
+
-
+"
D2T32 6K1
K
FLA-SLC26A9.1
suLa~ap2
-T306AkM
AkM
L~mABtAII
110
PLAG.sLC3aA.1
DB
-+
MM"
'-
+
-- MM
D
P"=d
llll
-
+
A
Figure SS: Endogenous immunoprecipitation of Rag and Ragulator components
recovers SLC38A9 in an amino acid-sensitive fashion.
p18
+
RagC
RagA
- +'-
-
IP antibody: control
amino acids: -+
SLC38A9
(cn-r
IP
RagA
Y
SLC38A9
RagC
RagA
cell
lysate
L
RpgA
111
Figure S6: SLC38A9.1 is a low-affinity amino acid transporter.
D
C
B
A
4000$2000,
1000.
'10
/OPqt?~/
Transfectod
J~~~%~.
pH
PH5
H
F
0001
60-0
tin-
40-
SLC36A9
LAMPISLC3&A. I
FLA4-SLM3AS
.
,0
pH 5
pH
-
.
s
20so-
SLOWV
0-20
Transfected
cDNA:
empty
vector
SLC38A9.1 SLC38A2
1s-
G
fraction from top of sucrose gradient:
1
2
3
4
5
6
7
8
9
10 11 12
FLAG-SLC38A9.1
proteollposomes
FLAG-sLC38A9.1 protein only
FLAG-SLC36A9.1 +
I
FLAG-LAMP1
lposomes
proteolIposomS
liposomes
* WM Urea
3W0-
E
82000F
1000-
.
FLAG-sLC38A9.1 +
0.5
1.0
1.5
2.0
Elution volume (mL)
- Buffer only
I+ Uposomes only
3
[ HJArg +
+ SLC38A9.1 proteoliposomes
+0LAMP1 proteoliposomes
112
Figure S1: Membrane topology of SLC38A9.1. (A) Representation of the TMHMM
topology prediction for SLC38A9.1. (B) Visualization of SLC38A9.1 topology as
generated by Protter.
Figure S2: Ragulator and the Rag GTPases do not interact with all lysosomal amino
acid transporter-like proteins. (A) SLC38A9.1, but not SLC38A7 or SLC36A1, interacts
with the Ragulator complex and the Rag GTPases. HEK-293T cells were transfected
with the indicated cDNAs in expression vectors and lysates were prepared and
subjected to FLAG immunoprecipitation followed by immunoblotting for the indicated
proteins. (B and C) The interaction with Ragulator requires the presence of the intact Nterminal domain of SLC38A9.1, which is lacking in SLC38A9.2 (B), SLC38A9.1 A110
(C), and SLC38A9.4 (C). HEK-293T cells were transfected with the indicated cDNAs in
expression vectors and processed as in (A).
Figure S3: Localization of SLC38A9 isoforms 2 and 4 and signaling effects of siRNAmediated SLC38A9 knockdown. SLC38A9 isoforms lacking part (A) or all (B) of the Nterminal region of SLC38A9.1 still localize to the lysosomal membrane. HEK-293T cells
stably expressing the indicated FLAG-tagged SLC38A9 isoforms were immunostained
for FLAG and LAMP2. (C) The interaction between SLC38A9.1 and Ragulator occurs
only when Ragulator is anchored at the lysosomal membrane through lipidation of the Nterminus of p18. Ragulator containing the lipidation-deficient p 1 8 G2A mutant fails to
interact with SLC38A9.1. HEK-293T cells were transfected with the indicated cDNAs in
expression vectors and lysates prepared and subjected to FLAG immunoprecipitation
followed by immunoblotting for the indicated proteins. (D) Knockdown of SLC38A9 in
HEK293T cells with a pool of short interfering RNAs suppresses the phosphorylation of
S6K1.
Figure S4: (A) Transient overexpression of SLC38A9.1, but not truncation mutants
lacking the N-terminal Ragulator-binding domain, makes the mTORCI pathway
insensitive to amino acid starvation. Cell lysates were prepared from HEK-293T cells
deprived for 50 min for amino acids and, then, where indicated, stimulated with amino
acids for 10 min. Cell lysates and FLAG immunoprecipitates were analyzed for the levels
of the specified proteins and for the phosphorylation state of S6K1. (B) Stable
overexpression of SLC38A9.1 in HeLa cells, LN229 cells, and MEFs makes the
113
mTORC1 pathway partially resistant to amino acid deprivation. Cells transduced with
retroviruses encoding the specified proteins were deprived for 50 min of all amino acids
and, where indicated, stimulated for 10 min with amino acids. Cell lysates were analyzed
for the levels of the specified proteins and the phosphorylation state of S6K1. (C) Stable
overexpression of SLC38A9.1 suppresses autophagy induction upon arginine starvation
as indicated by detected by p62 accumulation and suppressed LC3 degradation. HEK293T cells stably overexpressing FLAG-SLC38A9.1 were simultaneously deprived of
arginine and, where indicated, treated with 30 uM chloroquine for the indicated time. Cell
lysates were analyzed for the levels of the specified proteins and the phosphorylation
state of S6K1. (D) Stable overexpression of SLC38A9.1 in HEK-293E cells does not
perturb the response of mTORC1 signaling to serum starvation and insulin stimulation.
(E) Stable overexpression of SLC38A9.1 does not protect mTORCI signaling from the
inhibitory effects of MK2206, which blocks growth factor signaling by allosterically
inhibiting Akt.
Figure S5: Endogenous immunoprecipitation of Rag and Ragulator components
recovers SLC38A9 in an amino acid-sensitive fashion. Cell lysates were prepared from
HEK-293T cells deprived for 50 min for amino acids and, then, where indicated,
stimulated with amino acids for 10 min. Cell lysates as well as control, p18, RagA, and
RagC immunoprecipitates were analyzed for the levels of the indicated endogenous
proteins.
Figure S6: SLC38A9.1 is a low-affinity amino acid transporter. (A) Immunostaining of
HEK-293T cells transiently overexpressing SLC38A9.1 at levels that cause spillover to
the plasma membrane. These cells were used for whole-cell amino acid transport
assays and amino acid-induced current recordings. HEK-293T cells transiently
expressing indicated cDNAs were incubated with [1 4C]arginine (B), [1 4C]amino acid mix
(C), or [ 1 4C]leucine (D) containing buffer at the indicated pH and washed before
harvested for scintillation counting. (E) (Left) Whole-cell recordings from HEK-293T cells
expressing indicated cDNAs at -80 mV. Quantified is the change in steady-state current
following local application of 2.4 mM arginine, 1.6 mM leucine, and 4 mM glutamine (4x
DMEM concentrations). All recordings were performed at pH 5.5. Statistical comparison
was performed by Kruskall-Wallis test, followed by Dunn's test. (Right) Representative
examples of individual recordings. Grey bars indicate application of amino acids. (F)
114
Coomassie stain of FLAG-affinity purified LAMP1 or SLC38A9.1 from HEK-293T cells
stably expressing respective protein. (G) Floatation assay shows successful insertion of
SLC38A9.1 into proteoliposomes. Where indicated, 6 M urea was added following the
reconstitution reaction. (H) SLC38A9.1 is unidirectionally inserted into proteoliposomes,
with the N-terminus facing the outside of liposomes. Proteoliposomes containing Nterminally FLAG-tagged SLC38A9.1 were exposed to trypsin and immunoblotted for
FLAG. The addition of 1% Triton X-100 did not reveal any protected FLAG-tagged
fragments. (1) SLC38A9.1 proteoliposomes uptake [ 3H]arginine. 0.5 pM [ 3H]arginine was
incubated with the indicated components for 60 min. and the reaction was applied to a
column that traps free amino acids. Proteoliposomes pass through the column and
fractions were subjected to scintillation counting and FLAG immunoblotting. To
recapitulate the pH gradient across the lysosomal membrane, the lumen of the
proteoliposomes is buffered at pH 5.0, while the external buffer is pH 7.4.
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
Y. Sancak et al., PRAS40 is an insulin-regulated inhibitor of the mTORC1 protein
kinase. Molecular cell 25, 903 (Mar 23, 2007).
Y. Sancak et al., The Rag GTPases bind raptor and mediate amino acid signaling to
mTORC1. Science 320, 1496 (Jun 13, 2008).
Z. Zhang, A. Gameiro, C. Grewer, Highly conserved asparagine 82 controls the
interaction of Na+ with the sodium-coupled neutral amino acid transporter SNAT2.
The Journal of biological chemistry 283, 12284 (May 2, 2008).
B. Liu, H. Du, R. Rutkowski, A. Gartner, X. Wang, LAAT-1 is the lysosomal
lysine/arginine transporter that maintains amino acid homeostasis. Science 337, 351
(Jul 20, 2012).
T. A. Pologruto, B. L. Sabatini, K. Svoboda, Scanimage: flexible software for operating
laser scanning microscopes. Biomedical engineering online 2, 13 (May 17, 2003).
C. Zhao, W. Haase, R. Tampe, R. Abele, Peptide specificity and lipid activation of the
lysosomal transport complex ABCB9 (TAPL). The Journal of biological chemistry 283,
17083 (Jun 20, 2008).
J. L. Rigaud, D. Levy, Reconstitution of membrane proteins into liposomes. Methods in
enzymology 372, 65 (2003).
J. J. Wuu, J. R. Swartz, High yield cell-free production of integral membrane proteins
without refolding or detergents. Biochimica et biophysica acta 1778, 1237 (May,
2008).
A. Nohturfft, M. S. Brown, J. L. Goldstein, Topology of SREBP cleavage-activating
protein, a polytopic membrane protein with a sterol-sensing domain. The Journal of
biological chemistry 273, 17243 (Jul 3, 1998).
F. A. Ran et al., Genome engineering using the CRISPR-Cas9 system. Nature protocols
8, 2281 (Nov, 2013).
115
Figure S1: Membrane topology of SLC38A9.1. (A) Representation of the TMHMM
topology prediction for SLC38A9.1. (B) Visualization of SLC38A9.1 topology as
generated by Protter.
Figure S2: Ragulator and the Rag GTPases do not interact with all lysosomal amino
acid transporter-like proteins. (A) SLC38A9.1, but not SLC38A7 or SLC36A1, interacts
with the Ragulator complex and the Rag GTPases. HEK-293T cells were transfected
with the indicated cDNAs in expression vectors and lysates were prepared and
subjected to FLAG immunoprecipitation followed by immunoblotting for the indicated
proteins. (B and C) The interaction with Ragulator requires the presence of the intact Nterminal domain of SLC38A9.1, which is lacking in SLC38A9.2 (B), SLC38A9.1 A110
(C), and SLC38A9.4 (C). HEK-293T cells were transfected with the indicated cDNAs in
expression vectors and processed as in (A).
Figure S3: Localization of SLC38A9 isoforms 2 and 4 and signaling effects of siRNAmediated SLC38A9 knockdown. SLC38A9 isoforms lacking part (A) or all (B) of the Nterminal region of SLC38A9.1 still localize to the lysosomal membrane. HEK-293T cells
stably expressing the indicated FLAG-tagged SLC38A9 isoforms were immunostained
for FLAG and LAMP2. (C) The interaction between SLC38A9.1 and Ragulator occurs
only when Ragulator is anchored at the lysosomal membrane through lipidation of the Nterminus of p18. Ragulator containing the lipidation-deficient p 1 8 G2A mutant fails to
interact with SLC38A9.1. HEK-293T cells were transfected with the indicated cDNAs in
expression vectors and lysates prepared and subjected to FLAG immunoprecipitation
followed by immunoblotting for the indicated proteins. (D) Knockdown of SLC38A9 in
HEK293T cells with a pool of short interfering RNAs suppresses the phosphorylation of
S6K1.
Figure S4: (A) Transient overexpression of SLC38A9.1, but not truncation mutants
lacking the N-terminal Ragulator-binding domain, makes the mTORCI pathway
insensitive to amino acid starvation. Cell lysates were prepared from HEK-293T cells
deprived for 50 min for amino acids and, then, where indicated, stimulated with amino
acids for 10 min. Cell lysates and FLAG immunoprecipitates were analyzed for the levels
of the specified proteins and for the phosphorylation state of S6K1. (B) Stable
116
overexpression of SLC38A9.1 in HeLa cells, LN229 cells, and MEFs makes the
mTORC1 pathway partially resistant to amino acid deprivation. Cells transduced with
retroviruses encoding the specified proteins were deprived for 50 min of all amino acids
and, where indicated, stimulated for 10 min with amino acids. Cell lysates were analyzed
for the levels of the specified proteins and the phosphorylation state of S6K1. (C) Stable
overexpression of SLC38A9.1 suppresses autophagy induction upon arginine starvation
as indicated by detected by p62 accumulation and suppressed LC3 degradation. HEK293T cells stably overexpressing FLAG-SLC38A9.1 were simultaneously deprived of
arginine and, where indicated, treated with 30 uM chloroquine for the indicated time. Cell
lysates were analyzed for the levels of the specified proteins and the phosphorylation
state of S6K1. (D) Stable overexpression of SLC38A9.1 in HEK-293E cells does not
perturb the response of mTORC1 signaling to serum starvation and insulin stimulation.
(E) Stable overexpression of SLC38A9.1 does not protect mTORC1 signaling from the
inhibitory effects of MK2206, which blocks growth factor signaling by allosterically
inhibiting Akt.
Figure S5: Endogenous immunoprecipitation of Rag and Ragulator components
recovers SLC38A9 in an amino acid-sensitive fashion. Cell lysates were prepared from
HEK-293T cells deprived for 50 min for amino acids and, then, where indicated,
stimulated with amino acids for 10 min. Cell lysates as well as control, p18, RagA, and
RagC immunoprecipitates were analyzed for the levels of the indicated endogenous
proteins.
Figure S6: SLC38A9.1 is a low-affinity amino acid transporter. (A) Immunostaining of
HEK-293T cells transiently overexpressing SLC38A9.1 at levels that cause spillover to
the plasma membrane. These cells were used for whole-cell amino acid transport
assays and amino acid-induced current recordings. HEK-293T cells transiently
expressing indicated cDNAs were incubated with [1 4C]arginine (B), [14 C]amino acid mix
(C), or [ 14C]leucine (D) containing buffer at the indicated pH and washed before
harvested for scintillation counting. (E) (Left) Whole-cell recordings from HEK-293T cells
expressing indicated cDNAs at -80 mV. Quantified is the change in steady-state current
following local application of 2.4 mM arginine, 1.6 mM leucine, and 4 mM glutamine (4x
DMEM concentrations). All recordings were performed at pH 5.5. Statistical comparison
was performed by Kruskall-Wallis test, followed by Dunn's test. (Right) Representative
117
examples of individual recordings. Grey bars indicate application of amino acids. (F)
Coomassie stain of FLAG-affinity purified LAMP1 or SLC38A9.1 from HEK-293T cells
stably expressing respective protein. (G) Floatation assay shows successful insertion of
SLC38A9.1 into proteoliposomes. Where indicated, 6 M urea was added following the
reconstitution reaction. (H) SLC38A9.1 is unidirectionally inserted into proteoliposomes,
with the N-terminus facing the outside of liposomes. Proteoliposomes containing Nterminally FLAG-tagged SLC38A9.1 were exposed to trypsin and immunoblotted for
FLAG. The addition of 1% Triton X-100 did not reveal any protected FLAG-tagged
fragments. (1) SLC38A9.1 proteoliposomes uptake [ 3H]arginine. 0.5 pM [ 3H]arginine was
incubated with the indicated components for 60 min. and the reaction was applied to a
column that traps free amino acids. Proteoliposomes pass through the column and
fractions were subjected to scintillation counting and FLAG immunoblotting. To
recapitulate the pH gradient across the lysosomal membrane, the lumen of the
proteoliposomes is buffered at pH 5.0, while the external buffer is pH 7.4.
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
Y. Sancak et al., PRAS40 is an insulin-regulated inhibitor of the mTORC1
protein kinase. Molecular cell 25, 903 (Mar 23, 2007).
Y. Sancak et aL., The Rag GTPases bind raptor and mediate amino acid
signaling to mTORC1. Science 320, 1496 (Jun 13, 2008).
Z. Zhang, A. Gameiro, C. Grewer, Highly conserved asparagine 82 controls
the interaction of Na+ with the sodium-coupled neutral amino acid
transporter SNAT2. The Journal of biological chemistry 283, 12284 (May 2,
2008).
B. Liu, H. Du, R. Rutkowski, A. Gartner, X. Wang, LAAT-1 is the lysosomal
lysine/arginine transporter that maintains amino acid homeostasis. Science
337, 351 (Jul 20, 2012).
T. A. Pologruto, B. L. Sabatini, K. Svoboda, Scanimage: flexible software
for operating laser scanning microscopes. Biomedical engineering online
2,13 (May 17, 2003).
C. Zhao, W. Haase, R. Tampe, R. Abele, Peptide specificity and lipid
activation of the lysosomal transport complex ABCB9 (TAPL). The Journal
of biological chemistry 283, 17083 (Jun 20, 2008).
J. L. Rigaud, D. Levy, Reconstitution of membrane proteins into liposomes.
Methods in enzymology 372, 65 (2003).
J. J. Wuu, J. R. Swartz, High yield cell-free production of integral membrane
proteins without refolding or detergents. Biochimica et biophysica acta
1778, 1237 (May, 2008).
A. Nohturfft, M. S. Brown, J. L. Goldstein, Topology of SREBP cleavageactivating protein, a polytopic membrane protein with a sterol-sensing
domain. The Journal of biological chemistry 273, 17243 (Jul 3,1998).
F. A. Ran et al., Genome engineering using the CRISPR-Cas9 system.
Nature protocols 8, 2281 (Nov, 2013).
118
CHAPTER 4: Future Directions and Discussions
1. The Rag Heterodimer
The Rag GTPases are unusual in that they function as obligate heterodimers whereas
most Ras-like GTPases are typically monomeric. This heterodimeric state is conserved
from yeast to human. Why do the Rag GTPases function as heterodimers? Monomeric
GTPases have two states-either GTP or GDP loaded. Therefore, a heterodimeric
configuration affords four states. In cells, RagA/B must be bound by GTP for the Rag
heterodimer to bind mTORC1, but the RagA/B-(GTP) - RagC/D-(GDP) heterodimer
exhibits greatest mTORC1 binding (Sancak et al., 2008). In contrast, in vitro, RagC/D
loaded with GDP is sufficient for the Rag heterodimer to bind mTORC1, suggesting that
RagC/D is the primary determinant of mTORC1 binding (Tsun 2013). The fact that
RagA/B-(GDP) - RagC/D-(GDP) does not bind mTORC1 in cells suggests that there
must be other factors in cells that are not accounted for in vitro or that RagA/B-(GDP) is
dominant over RagC/D nucleotide state.
For example, in cells the Rags must both bind mTORC1 and localize to the lysosome.
Interestingly RagA/B-(GDP), or amino acid starvation, shows weaker Rag interactions
with Ragulator, its lysosomal scaffold, suggesting that the Rag heterodimers may
dynamically localize to the lysosome. Although by immunofluorescence the Rags appear
lysosomal, this static image does not provide information about the level of Rag
turnover. Comparison of fluorescence recovery after photobleaching (FRAP) of
photobleached lysosomes in cells expressing fluorescently tagged Rags, under amino
acid starved versus stimulated state, will test this possibility. It would be ideal to use
endogenously tagged Rags to avoid overexpression artifacts, especially because careful
measurements of turnover will likely be required. If true, it could mean that RagA/B
nucleotide state regulates lysosomal docking, whereas RagC/D regulates mTORC1
binding. If RagA/B is in the GDP state, it can never leave the lysosome and thus cannot
bind mTORC1 in cells, regardless of RagC/D nucleotide state. Another possibility is that
each Rag within the heterodimer can affect the nucleotide state of the other, as seen in
the heterodimeric GTPases, signal recognition particle (SRP) and its receptor (SR)
(Saraogi et al., 2011).
119
1I. Lysosomal amino acid concentrations in human cells
The broad substrate profile and high Km (-40mM) of SLC38A9 raises several important
questions. Given that intracellular concentrations of arginine are -100uM, how is
SLC38A9 relevant for sensing arginine? We know that leucine and arginine are
important for mTORC1 activity, yet loss of SLC38A9 seems to specifically affect
mTORC1 activation by arginine. Given that a growth pathway should monitor the total
cellular nutrient content, our current model proposes that the Rag GTPases integrate
multiple amino acid inputs from both the lysosomal and cytosolic compartments (Fig. 1).
SLC38A9 may be responsible for reporting lysosomal amino acid content, where
arginine, more than any other amino acid, has been reported to be highly enriched
(Harms et al., 1981). Thus, despite the broad substrate profile of SLC38A9, perhaps
concentrations of no other lysosomal amino acid besides arginine reach its Km.
v-ATPase
amino
AClds
cytosol
SLC38A9
lysosomal
membrane
lysosomal
lumen
amino
acids
Figure 1: SLC38A9 is a candidate amino acid sensor. Model
for distinct amino acids inputs in the mTORC1 pathway
To test this model, it will be necessary to measure lysosomal amino acid concentrations
in human cells, which will require quantifying lysosomal amino acids as well as obtaining
the lysosomal volume. Using the immunopurification method developed in the lab,
capturing lysosomes using an epitope-tagged lysosomal transmembrane protein (Zoncu
et al., 2011), it should be feasible to isolate lysosomes quickly for metabolite profiling. To
measure lysosomal volume, a quick estimate would be to quantify the volume occupied
by lysosomal membrane stain in confocal images, but of course this will be diffraction
limited. Because lysosomes range from 0.1 - 1.2 um in diameter, super-resolution
imaging of a lysosomal dye such as Lysotracker will obtain a more accurate
120
measurement. Given the lysosomal localization of many mTORC1 pathway components,
this method will be instrumental in understanding how this pathway is regulated by
amino acids and how lysosomal contents change in normal physiology and disease.
Ill. Nutrient sensing in the compartmentalized cell
The emerging picture is that the lysosome is a signal integration hub for the mTORC1
growth pathway. How did the mTORC1 pathway end up anchoring at the lysosome?
What is the significance of the lysosomal surface? Fundamentally, we think the TOR
pathway had to solve the problem of nutrient sensing in a compartmentalized cell, in
which membrane bound compartments are used for storage.
In prokaryotes, there is a single cytoplasmic compartment and no organelles for storage.
If extracellular nutrients became limiting, the cell had to either stopped growing or
perform the biosynthetic reactions to make the things it needs. Prokaryotes don't have a
TOR pathway (van Dam et al., 2011).
With the exception of malaria and microsporidium, both parasites, the TOR pathway can
be found in all eukaryotes, which rely on membrane compartmentalization (van Dam et
al., 2011). The lysosome or vacuole in yeast and plants are the major storage site for
amino acids (Klionsky et al., 1990). The localization of TOR to this compartment is
conserved from yeast to human (Dubouloz et al., 2005; Sancak et al., 2010). Now, when
extracellular amino acids become limiting, growth doesn't need to stop if the cell has
large amino acid stores. To make that decision, the cell requires a system like the TOR
pathway that could regulate growth based on the availability of amino acids in both
compartments: the lysosome and cytoplasm. And the lysosomal surface is an ideal place
for this because it's at the interface between these two compartments (Fig. 2).
There is increasing evidence that both cytosolic and lysosomal events are amino acid
regulated. Zoncu et al, showed that amino acids have to be concentrated within isolated
lysosome in order for mTORC1 to localize to the lysosomal surface, indicating that there
is inside-out signaling of amino acids (Zoncu et al., 2011). On the cytoplasmic side, the
FLCN-FNIP complex lysosomal localization is amino acid responsive and so is the
sestrin-GATOR2 interaction (Lynne et al., 2014; Tsun et al., 2013).
121
Growth factors
Figure 2: Integration of cytosolic and lysosomal amino acid
inputs, as well as growth factor signaling, at the lysosomeal
surface.
With emergence of multicellular life, there was a need for growth factor based regulation.
Nutrient sensing is the more ancestral branch and it has remained here from yeast to
human so growth factor signaling likely represented another input that need to be
integrated at the lysosome.
122
References
Dubouloz, F., Deloche, 0., Wanke, V., Cameroni, E., and De Virgilio, C. (2005). The
TOR and EGO protein complexes orchestrate microautophagy in yeast. Molecular cell
19, 15-26.
Harms, E., Gochman, N., and Schneider, J.A. (1981). Lysosomal pool of free-amino
acids. Biochemical and biophysical research communications 99, 830-836.
Klionsky, D.J., Herman, P.K., and Emr, S.D. (1990). The fungal vacuole: composition,
function, and biogenesis. Microbiological reviews 54, 266-292.
Lynne, C., Rachel, L.W., Jose, M.O., Robert, A.S., Sonia, M.S., Liron, B.-P., Eric, S.,
Marta, I., Steven, P.G., and David, M.S. (2014). The Sestrins Interact with GATOR2 to
Negatively Regulate the Amino-Acid-Sensing Pathway Upstream of mTORC1. Cell
Reports.
Sancak, Y., Bar-Peled, L., Zoncu, R., Markhard, A.L., Nada, S., and Sabatini, D.M.
(2010). Ragulator-Rag complex targets mTORC1 to the lysosomal surface and is
necessary for its activation by amino acids. Cell 141, 290-303.
Sancak, Y., Peterson, T.R., Shaul, Y.D., Lindquist, R.A., Thoreen, C.C., Bar-Peled, L.,
and Sabatini, D.M. (2008). The Rag GTPases bind raptor and mediate amino acid
signaling to mTORC1. Science (New York, NY) 320,1496-1501.
Saraogi, I., Akopian, D., and Shan, S.O. (2011). A tale of two GTPases in cotranslational
protein targeting. Protein Science.
Tsun, Z.-Y.Y., Bar-Peled, L., Chantranupong, L., Zoncu, R., Wang, T., Kim, C., Spooner,
E., and Sabatini, D.M. (2013). The folliculin tumor suppressor is a GAP for the RagC/D
GTPases that signal amino acid levels to mTORC1. Molecular cell 52, 495-505.
van Dam, T.J., Zwartkruis, F.J., Bos, J.L., and Snel, B. (2011). Evolution of the TOR
pathway. Journal of molecular evolution 73, 209-220.
Zoncu, R., Bar-Peled, L., Efeyan, A., Wang, S., Sancak, Y., and Sabatini, D.M. (2011).
mTORC1 senses lysosomal amino acids through an inside-out mechanism that requires
the vacuolar H(+)-ATPase. Science (New York, NY) 334, 678-683.
123