Characterization of the two major merlin isoforms and
AfcHIVES
merlin regulation of YAP
MASSACHUSETTS INSTITUTE
OF rECHNOLOLGY
by
MAY 2 82015
Jeffrey W. Schindler
LIBRARIES
B.Sc., Life Sciences
Hebrew University, Jerusalem, Israel, 2002
SUBMITTED TO THE DEPARTMENT OF BIOLOGY IN PARTIAL
FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY IN BIOLOGY
AT THE
MASSACHUSETTS INSTITUTE OF TECHNOLOGY
JUNE 2015
Massachusetts Institute of Technology. All rights reserved.
Signature of Author
_Signature red acted___
/.'
Certified By:
//
Department of Biology
May 22, 2015
Signature red acted
_
_
_
Richard 0. Hynes
Professor of Biology
Thesis supervisor
Accepted By:
Signature red acted
Michael Hemann
Associate Professor of Biology
Chairman, Committee for Graduate Studies
1
2
Characterization of the two major merlin isoforms and merlin
regulation of YAP
by
Jeffrey W. Schindler
Submitted to the Department of Biology on May 2 2 nd 2015, in Partial Fulfillment
of the Requirements for the Degree of Doctor of Philosophy in Biology
ABSTRACT
Merlin is the protein encoded by the tumor suppressor gene NF2. Deletion or loss-offunction of NF2 leads to neurofibromatosis type 2, a disease characterized by the
formation of multiple benign tumors of the nervous system. In addition to the genetic
disorder, loss of merlin expression has been found in sporadically occurring
schwannomas and meningiomas, as well as in mesothelioma. Merlin has two major
isoforms that differ in only one exon at the C-terminal. Previous work hypothesized that
isoform 11 is unable to suppress growth. In this thesis, I show that both of the major
merlin isoforms are able to suppress growth in multiple cell lines, including
mesothelioma. Merlin has been shown to suppress growth through multiple
mechanisms, including upstream regulation of the oncogene YAP through stabilization of
the Hippo-pathway kinase Lats, allowing Lats to phosphorylate and inhibit YAP. In this
thesis I identify an additional mechanism for merlin regulation of YAP, which occurs
independently of the Hippo-pathway-based regulation. I show that mesothelioma cells
expressing merlin have lower YAP-driven transcriptional activity and that expression of
merlin leads to cytoplasmic localization of YAP. Furthermore, I show that this regulation
of YAP is not dependent on the major Lats phosphorylation sites, but does require the
YAP WW domains. This thesis provides additional insight into how merlin controls cell
growth, and into YAP regulation by merlin.
Thesis supervisor:
Richard 0. Hynes
Professor of Biology
3
Acknowledgments
I would like to thank my advisor, Richard Hynes, for his constant support,
encouragement and guidance. I could not have chosen a better lab in which to do this
work and my experience has been invaluable. I thank my thesis committee members,
Frank Gertler and Mike Hemann, for their time and advice throughout the many years of
my graduate work. I would also like to thank Andrea McClatchey, whose work I've
admired, for serving on my thesis defense committee.
I have enjoyed working in the Hynes lab for the past seven years, and would particularly
like to acknowledge Jane Trevithick, the former lab manager, who aside from keeping
the lab running smoothly would bake custom birthday cakes and Christmas cookies
yearly. All the Hynes lab members have been helpful, friendly, and supportive, serving
as a second family to me during my time in the lab. In particular I'd like to thank
Alexandra Naba for her extremely helpful advice and criticism over the years, especially
for our conversations about FERM domain proteins.
I am grateful to John Lamar, who has been a steadfast friend and mentor, constantly
providing guidance, stimulating conversation and valuable suggestions.
I would like to thank my dear friends Sara Fleming and Carmelle Amar, and my sister
Chevi Schindler, for their interest and feedback, offering insight and perspective when
needed. My father, Daniel Schindler, stimulated my interest in science and taught me
how to run a gel. Thank you Abba, that came in handy.
I would like to acknowledge to Koch Institute facilities that made these experiments
possible, and the scientists who provided reagents I used in this work- Ian Farrance,
Jonathan Fletcher, Kun-Liang Guan, Fred Miller, and Bob Weinberg.
Finally, I would like to thank my wife, Caryn-Amy Rose, who has supported this
endeavor with commitment, patience and love.
4
Table of Contents
Title page..........................................................................................................................1
Abstract............................................................................................................................3
Acknowledgem ents....................................................................................................
4
Table of contents......................................................................................................
5
List of figures...................................................................................................................8
Chapter 1: Introduction................................................................................................
9
1. 4.1 protein superfam ily .............................................................................
10
2. ERM proteins: Characterization and regulation .....................................
11
3. 4.1 fam ily proteins in cancer and m etastasis ..........................................
12
4. Merlin: A well characterized tum or suppressor .....................................
15
5. Merlin regulation through phosphorylation ............................................
16
6. Multiple mechanisms for merlin-derived suppression of growth..........19
7. The Hippo pathway in flies and m am m als ..............................................
21
Regulation of the Hippo pathway in Drosophila.............................21
Regulation of the Hippo pathway in mammals ...............................
8. Merlin regulation of YAP ..........................................................................
22
24
Merlin regulation of YAP in flies....................................................... 24
Merlin regulation of YAP in m am m als ..............................................
25
Merlin can stabilize Lats.....................................................................
26
9. Sum m ary ....................................................................................................
27
References .....................................................................................................
28
Chapter 2: FERM domain proteins in tumorigenesis and metastasis...................40
Introduction....................................................................................................
40
Results................................................................................................................40
5
1. 4.1 family expression in murine mammary carcinoma cells ............. 40
2. Barcode-containing knockdown of ERM proteins ............................
44
3. Orthotopic and tail vein assays following ERM knockdown............. 47
4. Migration and invasion in vitro following ERM knockdown .............. 49
5. Compensation and redundancy of ERM proteins ............................
51
6. Analysis of metastasis suppressor 4.1 B knockdown ........................
53
Discussion .....................................................................................................
56
References .....................................................................................................
59
Chapter 3: Both major merlin isoforms regulate cell growth................................ 62
Introduction....................................................................................................
62
Results................................................................................................................63
1. Expression of two merlin isoforms in multiple cell lines ................... 63
2. Both major merlin isoforms can suppress cell growth ..................... 65
3. Growth suppression requires contact inhibition and is regulated by
phosphorylation ...................................................................................
67
4. Isoform I and 11 are differentially regulated and differ in stability in
cu ltu re ...............................................................................................
. . 69
Discussion .....................................................................................................
73
References .....................................................................................................
76
Chapter 4: Merlin regulation of YAP.........................................................................79
Introduction....................................................................................................
79
Results................................................................................................................81
1. Merlin expression decreases nuclear localization of YAP ................ 81
2. Merlin expression decreases TEAD reporter activity....................... 83
3. Merlin can regulate a LATS-insensitive YAP mutant .......................
85
4. Hippo-pathway-independent regulation of YAP by merlin requires the
WW domains of YAP ...............................................................................
86
5. Merlin binding of YAP requires the WW domains of YAP.........92
Discussion .....................................................................................................
94
References .....................................................................................................
96
Chapter 5: Discussion ................................................................................................
100
6
1. The role of FERM domain proteins in tumorigenesis and metastasis ........... 100
2. Suppression of cell growth by both m ajor m erlin isoform s ............................
101
3. Hippo-pathway-independent regulation of YAP by m erlin .............................
103
References .......................................................................................................
109
M aterials and M ethods................................................................................................114
Chapter 2...........................................................................................................114
C h a p te r 3 ...........................................................................................................
1 19
Chapter 4...........................................................................................................122
References .......................................................................................................
124
7
List of Figures
Chapter 1
Figure 1: The ERM protein structure and activation ..................................................................
10
Figure 2: Multiple mechanisms for merlin regulation of growth................................................
19
Figure 3: The Hippo pathway in Drosophila and mammals .......................................................
23
Chapter 2
Figure 1: FERM domain family protein expression in the 4T1 panels of cell lines..................... 43
Figure 2: Knockdown of FERM domain-containing proteins in the 4T1 cell line....................... 46
Figure 3: Metastasis assays for 4T1 cells................................................................................
48
Figure 4: In vitro assays for 4T1 cells ......................................................................................
50
Figure 5: Knockdown of ERM proteins simultaneously and sequentially................................... 52
Figure 6: Tail vein and orthotopic metastasis assays for 4.1 B knockdown.............................. 54
Chapter 3
Figure 1: Merlin isoform I and I expression using an MSCV-based retroviral vector............... 64
Figure 2: Both major merlin isoforms suppress growth in multiple cell lines............................ 66
Figure 3: Both merlin isoforms regulate growth through a contact-dependent mechanism.......... 68
Figure 4: Isoform I and 11 of merlin differ in stability in culture...................................................
71
Chapter 4
Figure 1: The canonical Hippo pathway....................................................................................
80
Figure 2: Merlin expression decreases nuclear localization of YAP .........................................
82
Figure 3: Merlin expression decreases TEAD reporter activity................................................
84
Figure 4: Merlin expression decreases TEAD reporter activity and YAP nuclear localization in
presence of LATS-insensitive YAP ...........................................................................................
86
Figure 5: The YAP WW domains are required for merlin regulation of YAP...............
88
Figure 6: The YAP WW domains are required for YAP cytoplasmic relocation by merlin ......
90
Figure 7: Merlin expression decreases proliferation in presence of YAP but not YAP WW domain
m u ta n ts .........................................................................................................................................
91
Figure 8: Merlin binds YAP and requires YAP WW domains........................................................
93
8
Chapter 1: Introduction
The metastatic process consists of the successful completion of a number of steps,
termed also the metastatic cascade. Initially, cells need to detach from the primary tumor
and enter the blood stream in a process called intravasation. Once in the blood stream,
the tumor cells need to survive, arrest, and extravasate from the blood vessel into a new
location, where they must initiate and then maintain growth (1).
Since invasive behavior is required for metastasis, proteins which control cell polarity,
adhesion, and cytoskeletal rearrangements, are an obvious target to examine when
searching for proteins that determine the metastatic potential of a tumor.
The proteins of the 4.1 superfamily of proteins, which share a common domain termed
the FERM domain, have been shown to be involved in these processes, and my
research initially focused on developing a method to screen this family of proteins for
enhancers and suppressors of metastasis. While studying the 4.1 family of proteins, I
became interested in a well-characterized member of the family, merlin, a tumor
suppressor.
Merlin was identified as the protein product of the Nf2 tumor suppressor gene that is lost
in the familial neurofibromatosis type II (NF2) syndrome. In NF2, multiple tumors arise in
the central nervous system (2). Mutations or biallelic inactivation of merlin has also been
shown in other tumor types (3). Mice that are heterozygous for NF2 are prone to a wide
variety of tumors and the tumors that arise exhibit a high rate of metastasis (4). Like
other FERM domain family members, merlin can be found in a number of spliced
isoforms, and although merlin has been studied extensively, the functions of the various
isoforms was not clear. I decided to investigate whether a commonly found isoform,
isoform II, is able to function in growth suppression and whether there is differential
9
regulation between the major isoform, isoform I, and this splice variant. Finally, merlin
has been shown to suppress growth through multiple mechanisms, one being regulation
of the Hippo tumor suppressor pathway and its target, the oncogene YAP. Our lab is
interested in the mechanisms by which YAP enhances tumorigenesis and metastasis
(Lamar, Schindler et al. 2012), and the ways in which it can be regulated. In this context,
my study of merlin as a FERM domain protein turned towards the mechanism by which
merlin regulates YAP, and whether merlin can regulate YAP in a Hippo-pathwayindependent manner. This thesis will expand on these three points: (i) the role of FERMdomain proteins in metastasis, (ii) the growth suppressive capabilities of the two major
merlin isoforms, and (iii) how merlin regulates the YAP.
1. The 4.1 Protein superfamily
The initial family member to be described, 4.1 R (6) was originally identified as a critical
component of erthrocytes, localizing in the submembranous cytoskeleton and stabilizing
the red blood cell's unique shape. Since 4.1R was identified, the family has grown into
more than 50 proteins and is generally classified into five groups through sequence
analysis (7), (i) the band 4.1 group; (ii) the ERM family; (iii) talin-related; (iv) the PTPH
(protein tyrosine phosphatase) family; and (v) the NBL4 family. The 4.1 superfamily
members are characterized by a common conserved N-terminal domain known as the
FERM domain (Four-point-one, Ezrin, Radixin, Moesin), which is not only highly
conserved among all mammalian species, but is also conserved among eukaryotes, with
the fly FERM domain protein ortholog, coracle, containing 65% homology to the human
4.1 R (8). The FERM domain has been shown to bind a wide variety of molecules,
including phosphoinositols (9), the hyaluronate receptor CD44 (10, 11), ICAM (12), and
glycophorins (13) as well as the C-terminal domain of the FERM-domain proteins (14).
This variety of binding partners allows the FERM-domain family of proteins to act in
10
multiple roles that are necessary to the function and maintenance of a multi-cellular
organism, explaining their diversity across metazoans. FERM-domain family proteins
have been implicated in providing a cytoskeleton-membrane scaffold necessary for
assembling multi-protein complexes required for cell signaling, cell junction
maintenance, and establishing cell membrane compartments.
2. ERM Proteins: Characterization and regulation
Among the different subgroups of the 4.1 protein superfamily, the ERM group, consisting
of ezrin, radixin and moesin has been studied extensively. This subgroup is
characterized by a C-terminal actin-binding site in addition to the N-terminal FERM
domain, and the protein activity is regulated through intermolecular associations
between the N-terminal FERM domain and the C-terminal tail (15). Historically, ERM
proteins were described as inactive when found in the "closed" formation, with the Cterminal tail masking other protein-binding regions in the FERM-domain head (16).
Following phosphorylation of a C-terminal threonine, the interaction between the head
and the tail is weakened enough to allow the FERM-domain head to bind phospholipids
(5, 17) and the now "open" conformation allows multiple protein interactions to occur (1820). The crystal structure of moesin strengthened this model, as it showed a FERMdomain head/tail interaction that could be weakened due to phosphorylation, and that
the head/tail interaction masked actin-binding sites on the tail (21). Merlin is closely
related to the ERM subfamily, although it has some differences; most importantly, the
merlin C-terminal lacks the actin-binding site found in the other family members, ezrin,
radixin and moesin, and sequence conservation in the tail is low, the fact that the FERMdomain/tail interface residues are conserved hints that merlin is also regulated in a
similar manner through intermolecular interactions between the head and tail and is
11
110
M
f
FIgure 1: The ERM proteins, structure and activation
a. A schematic showing the homology between ERM proteins and merlin.
ERM members have a C-terrminal actin binding site, whereas merdin does
not. Ezrln and radixin share a prolne rich region which moeuin and merlin
do not. The major reuaoypopoyain(threonine for ERM, swdne for
merln) Is indicated. C-ERMAD, carboxy-ERM
amino-ERM association domain.
ERMAD.
domain; N-
b. A model of ERM activation. ERM proteins can form IntermTOlecular
asscitinsbetWeen the heed and tall. Association With PIP 2can recu
ERMs to the membrane, where they can be phosphorylated and persist In
an *open" form for additional protein-protein Interactions. (From Bretacher,
2002)
12
dependent on phosphorylation of a serine in the C-terminal tail, and indeed, that this
structure is possibly a model for all 4.1 superfamily proteins (15) (Figure 1, from (22)).
3. 4.1 family proteins in cancer and metastasis
4.1 family proteins have been implicated in functions such as cell-cell adhesion, cell
signaling, and cell migration that, when altered, can mediate the progression of tumor
formation and metastasis (23). Following are a number of examples of 4.1 family
proteins which have been shown to play roles in various cancer development (24).
Ezrin: Ezrin expression was shown to be elevated in osteosarcomas (25, 26) and
prostate cancer (27), as well as being a prognostic marker of metastasis in multiple
cancers (28), including osteosarcoma (26) and pancreatic cancer (29). Mutation of the
Src-phosphorylation target Y145, a tyrosine residue not conserved in ezrin's close family
members radixin and moesin, reduced cell migration (30). Mutation of an additional Srcphosphorylation target on ezrin, Y477, reduced in vivo invasion in mice (31). Ezrin
expression was also increased in highly metastatic lung cancer cell lines when
compared with poorly metastatic lung adenocarcinoma cell lines and knockdown of ezrin
in these highly metastatic lines led to a decrease in proliferation, migration and invasion
(32). Furthermore, abnormal ezrin localization from apical regions to the cytoplasm in
breast cancer patient samples correlated with poor patient prognosis (33).
Radixin: Knockdown of radixin in PANC1 human pancreatic carcinoma cells showed a
decrease in proliferation, adhesion and invasiveness in vitro as well as a decrease in
tumor growth in PANC1 tumor cells implanted in nude mice (34). In addition to role
radixin plays in pancreatic cancer, radixin has also been shown to enhance migration of
PC3 prostate cancer cells (35).
Moesin: Moesin expression has been linked to an increase in tumor size and
invasiveness in squamous cell carcinoma (36) as well as to survival of melanoma cells in
13
a tail-vein assay (37). In addition, moesin has been described as a marker of epithelialto-mesenchymal transition in pancreatic cancer (38) and breast cancer (39), and moesin
was required for actin remodeling in a mouse mammary epithelial cell model of TGFbeta induced EMT (40).
In addition to the roles these 4.1 family members play as enhancers of tumorigenesis
and metastasis, two 4.1 family members have been implicated as tumor suppressors.
These include merlin, which is the protein product of the NF2 tumor suppressor gene
and will be described more extensively below, and 4.1B/DAL, which was identified as a
novel gene whose expression was decreased in non-small cell lung carcinoma
compared to normal lung tissue (41). Furthermore, 4.1B was downregulated in breast
cancer (42) and in metastatic prostate cancer cell lines and shown to be a suppressor of
metastasis (43).
Objectives: Considering the roles that these proteins play in tumor formation and
metastasis, we wanted to see whether other members of the 4.1 superfamily of proteins
could also have roles in cancer and metastasis. The dual goal of this research would be
to develop a multiplex in-vivo tumorigenesis and metastasis screen, allowing
investigation of the involvement of multiple proteins simultaneously through the use of
barcoded knockdowns in the context of tumor formation and metastasis, while also
discovering previously unidentified 4.1 family members which might also play a role in
tumor development.
14
4. Merlin: A well-characterized tumor suppressor
As we began to investigate the role of FERM-domain proteins in tumorigenesis and
metastasis it became clear that there were still questions surrounding the function of
merlin in tumor suppression. Merlin had already been studied extensively due to its
involvement in human disease, yet questions remained regarding its regulation and its
potential role in tumor suppression through the Hippo pathway.
Merlin is an outlier in the ERM subgroup of the 4.1 superfamily of proteins. Although it
contains extensive sequence homology to ezrin, radixin and moesin in the FERM
domain N-terminal of the protein, it lacks the actin-binding domain that characterizes the
ERM protein C-terminal.
Merlin was initially discovered through its role in human disease; genetic mapping of
tumors from neurofibromatosis type 2 (NF2) patients revealed a deletion on
chromosome 22 (2, 44), which was mapped to the NF2 gene, also called merlin, due to
its similarity to the ERM family of proteins (moesin-radixin-ezrin-like-protein).
Neurofibromatosis type 2 is characterized by the development of schwannomas,
meningiomas and ependymomas, but merlin loss has also been identified in additional
tumor types, including mesothelioma, melanoma, and thyroid cancer (3). NF2 is one of
the most frequently mutated tumor suppressors in malignant mesothelioma, and is lost in
multiple mesothelioma-derived cell lines (45).
In addition to the benign tumors found in human neurofibromatosis type 2, heterozygous
merlin knock out in mice leads to highly metastatic disease (4), including
osteosarcomas, fibrosarcomas and hepatocellular carcinomas, suggesting that merlin
plays a role in metastasis, and furthermore, that merlin serves as a tumor suppressor in
a larger number of cell types.
15
The 4.1 family is extensively alternatively spliced, and merlin is not different in this
regard (46, 47). The NF2 gene contains 17 exons, and the two major splice isoforms
differ by inclusion or deletion of exon 16. While exon 16 is lacking in isoform I, it is
included in isoform II, which leads to a frameshift involving an early stop codon. This
creates an alternative C-terminal (3). Merlin isoform I contains 595 amino acids whereas
isoform I contains 590 amino acids. Both share a molecular weight of about 70kDa.
Initially, isoform II was described as an inactive form of merlin, due to limited ability of
the C-terminal to bind the N-terminal and thus form the "closed" isoform, which appeared
to be necessary for merlin activity (48-50). In addition, profiling the changes in splicing
following epithelial-to-mesenchymal transition (EMT) showed a change in expression of
merlin isoforms (Shapiro, personal communication). In these experiments, the splicing
profile of HMLE cells was compared before and after induction of EMT through Twist
expression with isoform I of merlin being present prior to EMT in epithelial cells and a
switch to isoform 11 occurring in the mesenchymal cells following Twist expression and
EMT (51). This could indicate that the switch to isoform 11 coincided with an inactivation
of merlin during EMT. However, newer data (52) showed that merlin activity was not
determined by a simple conformational switch, and furthermore, that the "open" form of
merlin (in which there is no intermolecular interaction between the head and tail) was
able to suppress growth, thus indicating that the isoform 11 might be active in
suppression of growth as well.
5. Merlin regulation through phosphorvlation
Like its close family members, the ERM proteins, merlin can be regulated through
phosphorylation at the C-terminal of the protein. This phosphorylation varies in response
to growth conditions, with increased confluency, serum starvation, or loss of cell-cell
contacts leading to a decrease in the phosphorylated form of merlin (53). Ser518 is
16
phosphorylated by p21-activated-kinase (PAK1/2)(54, 55), and by cAMP-dependent
protein kinase A (PKA) (56). Following phosphorylation on Ser518, merlin can be
phosphorylated on multiple other serine and threonines (57, 58). Relying on a similarity
to other ERM proteins, and pull-down experiments showing that the unphosphorylated
tail of merlin was able to bind the FERM-domain head (50), a canonical model was
adopted where phosphorylated merlin was described as being in the "open" form, and
unphosphorylated merlin was described as the "closed" form (5). Investigation of merlin's
function determined that phosphorylated merlin was unable to suppress growth, and that
mutating the predominant phosphorylation target Ser518 lead to constitutively active
merlin (59). However, this model indicated that the "closed" form of merlin was the active
state, which seemed paradoxical since the closed form would have less exposed sites
available for binding mediators of merlin function. Further study showed that indeed the
conformation of merlin was more fluid, and not altogether "open" or "closed". In this
model, the conformationally "open" state of merlin was the growth suppressive state, and
phosphorylation tipped the protein into adopting a more closed (but not entirely) closed
state (52). In addition, FRET studies show that Merlin's N-terminal FERM-domain head
and C-terminal tail are constitutively found in close proximity and only undergo subtle
changes following phosphorylation (60).
Objectives: Recent research determining that a "closed" conformation isn't necessary
for merlin activity indicates that previous assumptions regarding the inability of isoform 11
to inhibit growth were mistaken. We decided to compare the function of the two major
merlin isoforms, in order to determine whether both of the major merlin isoforms were
able to regulate growth, and further, in what context does this happen. The role of
isoform I in growth regulation during contact inhibition has been described, but the role
of isoform II in growth inhibition remains unclear. In addition, the regulation of isoform I
17
through phosphorylation has been investigated, but it is unknown whether regulation of
isoform II occurs in a manner similar to isoform 1.
6. Multiple mechanisms for merlin-derived suppression of growth
Merlin is able to suppress cell growth through many different mechanisms (Figure 2),
due to the ability of merlin to bind numerous transmembrane and intercellular proteins
(reviewed by (61)). In some cases, contradictory evidence raises questions about the
context and relevance of these different mechanisms to various biological models. For
example, merlin has been implicated in suppressing proliferation through contact
inhibition via control of actin organization. Although merlin lacks the C-terminal actinbinding domain found in the ERM proteins, it contains an actin-binding site in the Nterminal (62). Schwannoma cells lacking merlin have been shown to have disorganized
stress fibers, altered cell spreading, and increased membrane ruffling, all related to
abnormal actin organization (63), which can be reversed by the expression of merlin
(64). In addition, expression of merlin in mesothelioma cells lacking endogenous merlin
leads to decrease of phospho-FAK (65). This decrease in FAK phosphorylation leads to
a downstream decrease in Src activation, either directly, since merlin has been shown to
form a complex with FAK (66), or indirectly, through inhibition of Rac/PAK signaling (67).
Furthermore, merlin is able to block recruitment of Rac to the membrane and loss of
merlin can lead to increased Rac activity, lamellipodia formation, and increased cell
motility (68).
The mechanism behind merlin's ability to regulate Rac can be explained by Merlin's
interaction with angiomotin. Angiomotin, a scaffolding protein that localizes to tight
junctions, was shown to bind merlin. This interaction is competitive with angiomotin
binding Rich, which is then able to inactivate Rac (69). However, both unphosphorylated
merlin (S518A) and a phosphomimetic form of merlin (S518D) were shown to bind
18
a
I V
1
12
catenin J
4
mM
6
5
3
DC AF
NUCLEUS
Figure 2: Multiple mechanisms for merlin regulation of growth
1. Negatively regulates CD44 (Bai et aL. 2007).
2. Regulates the distribution, aggregation and availability of receptor
tyrosine kinases (McClatchey et al. 2009).
3. Translocates to the nucleus and inhibits the ubiquitin ligase
CRL4DCAF(Li et aL 2012).
4. Stabilizes adherens junctions through an interaction with a-catenin
(Gladden et aL. 2010).
5. Interacts with angiomotin to suppress Rac activity (Yi et a/. 2011).
6. Recruits the Lats kinases to the plasma membrane and
coordinates their activation by Mstl, driving phosphorylation and
inhibition of YAP/TAZ (Yin et al. 2013).
19
angiomotin, which raises the question of how merlin regulation through phosphorylation
can be explained in this context, and in what contexts does this mechanism for Rac
regulation through angiomotin confer biological relevance.
Merlin has also been shown to stabilize adherens junctions in mouse embryonic
fibroblasts and keratinocytes (70), through an interaction with a-catenin (71).
Aside from mediating contact inhibition through stabilization of adherens junctions,
merlin has also been shown to mediate contact inhibition through an interaction with
CD44, the hyaluronan receptor. CD44 is upregulated in several cancers, and is an
indicator of poor prognosis (reviewed by (72)). Using a rat schwannoma cell line,
Morrison et al. found that at high cell densities, when contact inhibition was required, a
hypophosphorylated form of merlin bound CD44, and that treatment with hyaluronic acid
or with anti-CD44 antibody led to a merlin-dependent decrease in cell proliferation (10).
In addition to its role in mediating contact inhibition, presumably through adherens
junction and CD44 interactions, merlin can also regulate cell growth through control of
the distribution, aggregation and availability of receptor tyrosine kinases (RTKs) in the
plasma membrane. This function of merlin as a regulator of cell growth has been shown
both in mammals (73, 74) and in Drosophila (75).
Finally, merlin has also been suggested to localize to the nucleus and inhibit cell growth
through an inhibitory interaction with the E3 ubiquitin ligase CRL 4 DCAF1 (7 6 ).
CRL4 ligases have been implicated in histone remodeling and can mediate a generally
cell-proliferative gene expression pattern, as well as directly ubiquitinating and inhibiting
a major component of the canonical Hippo pathway, LATS1/2 (77), providing an
additional, nuclear and transcriptionally-mediated role for merlin-dependent growth
suppression. However, since the merlin FERM-domain alone is able to suppress growth
in this manner, and the literature supports a role for C-terminal domain being required to
suppress growth as well (Lallemand et al. 2009), it is clear that merlin does not sustain
20
its major effects through nuclear localization and activity alone, and that the biological
context and other participants in the system described must be carefully considered.
7. The Hippo pathway in flies and mammals
Regulation of the Hippo pathway in Drosophila
Although multiple mechanisms and functions have been proposed for merlin as an
explanation for its role as a tumor suppressor, there remains one pathway, the Hippo
pathway in which merlin has been described as a member, and yet a mechanism for
merlin's participation in this pathway remain unclear; this will be one topic of interest in
this thesis. The Hippo pathway has recently been described as an important tumor
suppressor pathway in both flies and mammals, with mammalian orthologs for the
canonical components of the Drosophila pathway. In Drosophila the Hippo pathway
serves to control organ size through regulation of proliferation, cell growth and apoptosis
(78, 79), by limiting imaginal disc size. The core components of the pathway include the
serine/threonine kinases Warts (mammalian LATS1/2) and Hippo (mammalian MST1/2),
and two adaptor proteins, Salvador (Sav), a scaffolding protein that interacts with Hippo,
and Mats, which binds Warts. When the kinase cascade is activated, Hippo, in a
complex with Sav, phosphorylates and activates Warts, bound to its co-factor Mats.
Activated Warts phosphorylates the transcriptional co-activator Yorkie (mammalian
YAP/TAZ) at multiple sites, inhibiting its function (80). This inhibition occurs through
cytoplasmic sequestration of Yorkie, as the phosphorylation on Serl68 (Ser127 in the
mammalian ortholog YAP) acts as a recognition site for 14-3-3 binding, which retains Yki
in the cytoplasm and prevents its activity as a transcriptional co-activator. In the nucleus,
Yki promotes a transcriptional profile that is growth-permissive and anti-apoptotic
through interaction with the TEAD/TEF family transcription factor Scalloped (81, 82). In
21
flies, Hippo-independent regulation of Yki can occur through the FERM-domain protein
Expanded, which can suppress Yki activity directly through binding and cytoplasmic
retention (83-85) (Figure 3).
Mammalian regulation of the Hippo pathway
In mammals, multiple upstream regulators have been identified that can control the
Hippo pathway or alternatively YAP activity directly, independently of the Hippo pathway.
A major component of YAP regulation involves mechanical stress (86), with the
extracellular matrix regulating YAP/TAZ activity as a function of varying stiffness.
Dupont et al. found that on stiff ECM YAP localized to the nucleus regulated through
Rho and actin cytoskeleton activity, whereas on a soft matrix YAP localized to the
cytoplasm. Furthermore, knockdown of LATS was unable to rescue cells plated on a soft
matrix, suggesting that the stiffness-mediated regulation is independent of the Hippo
pathway. However, contradictory evidence showed that LATS was activated by cell
detachment and that LATS knockdown can prevent mechanical-stress-induced YAP
phosphorylation (87, 88).
In addition to YAP regulation through matrix stiffness, G-protein receptors have also
been identified as regulators of the Hippo pathway (89) through LATS inhibition by
G12/13 or Gq/1 1-coupled receptors, which leads to YAP activation, or LATS activation
through Gs-coupled receptors which leads to an inhibition of YAP.
The mammalian orthologs of Yki, YAP and TAZ, were discovered to be Yes-associated
proteins, and were the first WW-domain containing proteins to be identified (90). YAP
contains one or two WW domains, depending on the splice isoform involved, and TAZ
contains one WW domain. These domains contain two conserved tryptophans (WW),
and bind proline-rich motifs. In addition to the WW domains, YAP and TAZ also contain
a coiled-coil domain and a PDZ-binding motif, which regulate YAP localization and
function (91). There are five HXRXXS LATS target sequences in YAP/TAZ (92), with two
22
DROSOPHILA
I
I
I
M AMM ALS
I
I
I
**
I
'4
I
a
I
I
L4
I
I
M$T:
<1
I
Anti-apoptosis, pro-proliferation
I
Anti-apoptosis, pro-proliferation
Figure 3: The Hippo pathway In Drosophila and mammals
The corresponding proteins are indicated by matching colors. Direct biochemical
interactions are shown with a solid line, genetic Interactions are shown with a
dashed line. An hypothesized interaction is Indicated with a grey line.
23
of these sites appearing most important for regulation (80). Phosphorylation at Ser127
in YAP (Ser89 in TAZ) creates the 14-3-3 binding site which mediates YAP cytoplasmic
sequestration, and phosphorylation at Ser381 mediates YAP ubiquitination and
degradation (93).
YAP is implicated in human disease as an oncogene amplified in multiple tumor types
(94), and YAP expression and nuclear localization correlate with poor patient outcome in
several cancers (80, 95-98). Furthermore, YAP overexpression in multiple cell lines, as
well as transgenic activation in mice, has been shown to promote tumor growth (99,
100). Our lab has demonstrated an important role for YAP activity in metastasis (101).
8. Merlin regulation of YAP
Merlin regulation of the Hippo pathway in flies
Merlin has been implicated as an upstream regulator of the Hippo pathway in
Drosophila. Mutations in merlin and another FERM-domain family protein, expanded,
lead to overgrowth in multiple adult tissues in Drosophila, phenocopying mutations of
Hippo pathway components. In addition, mer;ex double mutants had higher levels of the
Yki target gene diapi, an anti-apoptotic gene. Interestingly, Hpo mutants could reverse
the reduced-eye-size phenotype caused by loss of Expanded, placing Expanded
upstream of Hippo (102), which is in contrast to later findings that Expanded is able to
regulate Yki directly without relying on the kinase cascade for phosphorylation and
regulation of Yki (83). However, the epistasis experiments could not rule out an
additional model of regulation in which the Hippo pathway is bypassed altogether, and
the experiments in Drosophila that illustrate how loss of merlin leads to EGFR trafficking
defects (75) demonstrate that merlin may play multiple roles through various
mechanisms depending on the cellular context and the developmental stage.
24
Since merlin and expanded appeared to synergize (103) and were assumed to be
redundant to each other in Drosophila, these genetic experiments which placed
expanded upstream of the Hippo pathway were considered to place merlin upstream of
the Hippo pathway as well. Due to the presence of a highly conserved Hippo kinase
cascade in mammals, and the relevance of the pathway to human disease, there has
been a focus on identifying the role of merlin in regulation of YAP, the Yki homolog,
primarily as an upstream regulator of the Hippo pathway.
Merlin regulation of YAP in mammals
In mammalian cells, merlin has been shown to regulate the expression and localization
of YAP in meningioma cells (104) and mesothelioma cells (105), although neither of
these studies convincingly implicated the Hippo pathway in this regulation of YAP.
In the search for a tractable mammalian model, that could be compared to the fly model
of the Hippo pathway regulating organ size, the liver was selected as an appropriate
example, since mammalian liver can undergo dramatic changes in organ size. When
YAP was inducibly overexpressed in the adult liver this led to an increase in liver size,
which was reversed when YAP overexpression was removed (99) Similar overgrowth
phenotypes were observed when the mammalian Hippo orthologs MST1 and MST2
were depleted in embryonic livers using a Cre-albumin promoter, which acts on
embryonic liver progenitors (106). These results show that YAP, as regulated by the
Hippo pathway, appears to be an important player in liver regeneration. However,
attempts to determine whether merlin plays a role in this regulation led to contradictory
results. Work by Zhang et al. showed that elimination of NF2 using an albumin-cre
model led to expanded liver progenitor growth, which could be suppressed by
heterozygous deletion of YAP, linking YAP regulation to merlin tumor-suppressor activity
(107). But research by Benhamouche et al. contradicted this experiment. When merlin
was knocked out using the same model of embryonic liver conditional knockout with
25
albumin-cre, there was an enlargment of the liver. However, there was no evidence of
Hippo pathway activity or YAP activation in the in these experiments, and the phenotype
observed following loss of merlin was explained through EGFR pathway regulation and
could be suppressed by treatment with erlotinib, an EGFR inhibitor (108). Considering
that there is crosstalk between YAP and downstream components of the EGFR signaling
pathway, where Raf can prevent MST2 interaction with Latsl (reviewed by (109)), and
on the other hand, the EGFR ligand amphiregulin is upregulated through YAP-mediated
transcription (100), the intertwined nature of EGFR activity and YAP activity can further
complicate the picture when trying to tease out regulatory mechanisms.
Merlin can stabilize Lats
One possible role for merlin in regulation of the Hippo pathway is through direct
stablization of Lats. Merlin has been shown to bind Lats through the FERM-domain,
recruiting Lats to the membrane, which allows it to be phosphorylated by MST1/2,
activating it and allowing it to phosphorylate and inhibit YAP (110). Although this is a
mechanism that allows regulation of YAP through attenuation of the Hippo pathway, it
does not rule out other mechanisms for merlin regulation of YAP. The question remains
whether, in addition to the role of merlin in LATS stablilization, merlin is able to regulate
YAP independently of the Hippo pathway.
Objective: examining Hippo pathway independent regulation of YAP by merlin
An example of Hippo pathway-independent regulation by merlin occurs in Drosophila. In
flies, expanded can regulate Yki without Yki phosphorylation by the Hippo kinase
cascade, through binding of the PPxY motifs of expanded to the WW domains of Yki
(83). Could a similar mode of regulation be available in mammals? Mammalian
expanded is shortened and lacks the PPxY motif found in Drosophila, however one
Hippo pathway-independent regulatory function involves the scaffolding protein
angiomotin binding YAP through a WW domain/PPxY motif interaction (111, 112) and
26
sequestering it in the cytoplasm without prior phosphorylation of YAP by the Hippo
kinase cascade. Since merlin has been shown to bind angiomotin through its role in Rac
inhibition (69), could it play an additional function in YAP inhibition as well? And what are
the cellular contexts that mediate merlin suppression of growth through the multiple
avenues that appear to be available for this suppression? In order to attempt to address
these questions we decided to investigate the ability of merlin to regulate YAP in a
mesothelioma model, and determine whether the ability of merlin to regulate YAP was
dependent upon the Hippo pathway.
9. Summary
This thesis aims to investigate multiple aspects of the FERM domain family of proteins.
The subsequent chapters will describe the following:
In Chapter 2 I attempt to establish an in vivo screen to determine whether members of
the FERM domain family are enhancers or suppressors of metastasis. In order to do this
we chose ezrin, a known enhancer of metastasis, as well as close family members
radixin and moesin, and 4.1 B, a known metastasis suppressor, as preliminary targets for
screening.
In Chapter 3 1 describe the FERM domain family member merlin's two major splice
isoforms, isoform I and isoform II, and establish that both of the isoforms are able to
suppress growth in multiple cell lines. I further show that similarly to the well
characterized isoform I, isoform II also suppresses cell growth in a contact inhibitiondependent manner, and is regulated by phosphorylation. However, there appears to be
differential regulation of the two isoforms, and isoform 11 not only is able to suppress
growth, despite being described previously as an inactive form of merlin, but is also
more stable when expressed in culture.
27
In Chapter 4 I investigate the mechanism by which merlin regulates the Hippo pathway
target YAP. I show that in addition to regulation through the Hippo pathway, which has
been described previously, merlin is able to regulate YAP in a Hippo-pathwayindependent manner, which requires the WW domains of YAP.
In Chapter 5 I summarize the work described in this thesis, the unanswered questions
that arose from this study, and possible avenues for future research into these
questions.
References
1.
Chambers AF, Groom AC, MacDonald IC. Dissemination and growth of cancer
cells in metastatic sites. Nat Rev Cancer 2002;2:563-72.
2.
Trofatter JA, MacCollin MM, Rutter JL, et al. A novel moesin-, ezrin-, radixin-like
gene is a candidate for the neurofibromatosis 2 tumor suppressor. Cell 1993;75:826.
3.
Bianchi AB, Hara T, Ramesh V, et al. Mutations in transcript isoforms of the
neurofibromatosis 2 gene in multiple human tumour types. Nat Genet 1994;6:185-92.
4.
McClatchey Al, Saotome I, Mercer K, et al. Mice heterozygous for a mutation at
the Nf2 tumor suppressor locus develop a range of highly metastatic tumors. Genes Dev
1998;12:1121-33.
5.
Bretscher A, Edwards K, Fehon RG. ERM proteins and merlin: integrators at the
cell cortex. Nat Rev Mol Cell Biol 2002;3:586-99.
6.
Holzwarth G, Yu J, Steck TL. Heterogeneity in the conformation of different
protein fractions from the human erythrocyte membrane. J Supramol Struct 1976;4:1618.
7.
Louvet-Vallee S. ERM proteins: from cellular architecture to cell signaling. Biol
Cell 2000;92:305-16.
28
8.
Baines AJ, Lu HC, Bennett PM. The Protein 4.1 family: hub proteins in animals
for organizing membrane proteins. Biochim Biophys Acta 2014;1838:605-19.
9.
Anderson RA, Marchesi VT. Regulation of the association of membrane skeletal
protein 4.1 with glycophorin by a polyphosphoinositide. Nature 1985;318:295-8.
10.
Morrison H, Sherman LS, Legg J, et al. The NF2 tumor suppressor gene product,
merlin, mediates contact inhibition of growth through interactions with CD44. Genes Dev
2001;15:968-80.
11.
Tsukita S, Yonemura S. ERM (ezrin/radixin/moesin) family: from cytoskeleton to
signal transduction. Curr Opin Cell Biol 1997;9:70-5.
12.
Ramesh V. Merlin and the ERM proteins in Schwann cells, neurons and growth
cones. Nat Rev Neurosci 2004;5:462-70.
13.
Kusunoki H, Kohno T. Solution structure and glycophorin C binding studies of the
protein 4.1R FERM alpha-lobe domain. Proteins 2009;76:255-60.
14.
Gary R, Bretscher A. Ezrin self-association involves binding of an N-terminal
domain to a normally masked C-terminal domain that includes the F-actin binding site.
Mol Biol Cell 1995;6:1061-75.
15.
McClatchey Al, Fehon RG. Merlin and the ERM proteins--regulators of receptor
distribution and signaling at the cell cortex. Trends Cell Biol 2009;19:198-206.
16.
Bretscher A, Gary R, Berryman M. Soluble ezrin purified from placenta exists as
stable monomers and elongated dimers with masked C-terminal ezrin-radixin-moesin
association domains. Biochemistry 1995;34:16830-7.
17.
Fievet BT, Gautreau A, Roy C, et al. Phosphoinositide binding and
phosphorylation act sequentially in the activation mechanism of ezrin. J Cell Biol
2004;164:653-9.
29
18.
Crepaldi T, Gautreau A, Comoglio PM, Louvard D, Arpin M. Ezrin is an effector of
hepatocyte growth factor-mediated migration and morphogenesis in epithelial cells. J
Cell Biol 1997;138:423-34.
19.
Matsui T, Maeda M, Doi Y, et al. Rho-kinase phosphorylates COOH-terminal
threonines of ezrin/radixin/moesin (ERM) proteins and regulates their head-to-tail
association. J Cell Biol 1998;140:647-57.
20.
Naba A, Reverdy C, Louvard D, Arpin M. Spatial recruitment and activation of the
Fes kinase by ezrin promotes HGF-induced cell scattering. EMBO J 2008;27:38-50.
21.
Pearson MA, Reczek D, Bretscher A, Karplus PA. Structure of the ERM protein
moesin reveals the FERM domain fold masked by an extended actin binding tail domain.
Cell 2000;101:259-70.
22.
Bretscher A, Chambers D, Nguyen R, Reczek D. ERM-Merlin and EBP50 protein
families in plasma membrane organization and function. Annu Rev Cell Dev Biol
2000;16:113-43.
23.
McClatchey Al. Merlin and ERM proteins: unappreciated roles in cancer
development? Nat Rev Cancer 2003;3:877-83.
24.
Clucas J, Valderrama F. ERM proteins in cancer progression. J Cell Sci
2014;127:267-75.
25.
Curto M, McClatchey Al. Ezrin... a metastatic detERMinant? Cancer Cell
2004;5:113-4.
26.
Khanna C, Wan X, Bose S, et al. The membrane-cytoskeleton linker ezrin is
necessary for osteosarcoma metastasis. Nat Med 2004;10:182-6.
27.
Bruce B, Khanna G, Ren L, et al. Expression of the cytoskeleton linker protein
ezrin in human cancers. Clin Exp Metastasis 2007;24:69-78.
28.
Hunter KW. Ezrin, a key component in tumor metastasis. Trends Mol Med
2004;10:201-4.
30
29.
Akisawa N, Nishimori 1, Iwamura T, Onishi S, Hollingsworth MA. High levels of
ezrin expressed by human pancreatic adenocarcinoma cell lines with high metastatic
potential. Biochem Biophys Res Commun 1999;258:395-400.
30.
Srivastava J, Elliott BE, Louvard D, Arpin M. Src-dependent ezrin
phosphorylation in adhesion-mediated signaling. Mol Biol Cell 2005;16:1481-90.
31.
Mak H, Naba A, Varma S, et al. Ezrin phosphorylation on tyrosine 477 regulates
invasion and metastasis of breast cancer cells. BMC Cancer 2012;12:82.
32.
Li Q, Gao H, Xu H, et al. Expression of ezrin correlates with malignant phenotype
of lung cancer, and in vitro knockdown of ezrin reverses the aggressive biological
behavior of lung cancer cells. Tumour Biol 2012;33:1493-504.
33.
Sarrio D, Rodriguez-Pinilla SM, Dotor A, Calero F, Hardisson D, Palacios J.
Abnormal ezrin localization is associated with clinicopathological features in invasive
breast carcinomas. Breast Cancer Res Treat 2006;98:71-9.
34.
Chen SD, Song MM, Zhong ZQ, et al. Knockdown of radixin by RNA interference
suppresses the growth of human pancreatic cancer cells in vitro and in vivo. Asian Pac J
Cancer Prev 2012;13:753-9.
35.
Valderrama F, Thevapala S, Ridley AJ. Radixin regulates cell migration and cell-
cell adhesion through Rac1. J Cell Sci 2012;125:3310-9.
36.
Kobayashi H, Sagara J, Kurita H, et al. Clinical significance of cellular distribution
of moesin in patients with oral squamous cell carcinoma. Clin Cancer Res 2004;10:57280.
37.
Estecha A, Sanchez-Martin L, Puig-Kroger A, et al. Moesin orchestrates cortical
polarity of melanoma tumour cells to initiate 3D invasion. J Cell Sci 2009;122:3492-501.
38.
Abiatari 1, Esposito I, Oliveira TD, et al. Moesin-dependent cytoskeleton
remodelling is associated with an anaplastic phenotype of pancreatic cancer. J Cell Mol
Med 2010;14:1166-79.
31
39.
Wang CC, Liau JY, Lu YS, Chen JW, Yao YT, Lien HC. Differential expression of
moesin in breast cancers and its implication in epithelial-mesenchymal transition.
Histopathology 2012;61:78-87.
40.
Haynes J, Srivastava J, Madson N, Wittmann T, Barber DL. Dynamic actin
remodeling during epithelial-mesenchymal transition depends on increased moesin
expression. Mol Biol Cell 2011;22:4750-64.
41.
Tran YK, Bogler 0, Gorse KM, Wieland I, Green MR, Newsham IF. A novel
member of the NF2/ERM/4.1 superfamily with growth suppressing properties in lung
cancer. Cancer Res 1999;59:35-43.
42.
Heller G, Geradts J, Ziegler B, et al. Downregulation of TSLC1 and DAL-1
expression occurs frequently in breast cancer. Breast Cancer Res Treat 2007;103:28391.
43.
Wong SY, Haack H, Kissil JL, et al. Protein 4.1B suppresses prostate cancer
progression and metastasis. Proc Natl Acad Sci U S A 2007;104:12784-9.
44.
Rouleau GA, Merel P, Lutchman M, et al. Alteration in a new gene encoding a
putative membrane-organizing protein causes neuro-fibromatosis type 2. Nature
1993;363:515-21.
45.
Sekido Y. Inactivation of Merlin in malignant mesothelioma cells and the Hippo
signaling cascade dysregulation. Pathol Int 2011;61:331-44.
46.
Arakawa H, Hayashi N, Nagase H, Ogawa M, Nakamura Y. Alternative splicing
of the NF2 gene and its mutation analysis of breast and colorectal cancers. Hum Mol
Genet 1994;3:565-8.
47.
Pykett MJ, Murphy M, Harnish PR, George DL. The neurofibromatosis 2 (NF2)
tumor suppressor gene encodes multiple alternatively spliced transcripts. Hum Mol
Genet 1994;3:559-64.
32
48.
Gonzalez-Agosti C, Wiederhold T, Herndon ME, Gusella J, Ramesh V.
Interdomain interaction of merlin isoforms and its influence on intermolecular binding to
NHE-RF. J Biol Chem 1999;274:34438-42.
49.
Gutmann DH, Haipek CA, Hoang Lu K. Neurofibromatosis 2 tumor suppressor
protein, merlin, forms two functionally important intramolecular associations. J Neurosci
Res 1999;58:706-16.
50.
Sherman L, Xu HM, Geist RT, et al. Interdomain binding mediates tumor growth
suppression by the NF2 gene product. Oncogene 1997;15:2505-9.
51.
Shapiro IM, Cheng AW, Flytzanis NC, et al. An EMT-driven alternative splicing
program occurs in human breast cancer and modulates cellular phenotype. PLoS Genet
201 1;7:e1002218.
52.
Sher I, Hanemann CO, Karplus PA, Bretscher A. The tumor suppressor merlin
controls growth in its open state, and phosphorylation converts it to a less-active moreclosed state. Dev Cell 2012;22:703-5.
53.
Shaw RJ, McClatchey Al, Jacks T. Regulation of the neurofibromatosis type 2
tumor suppressor protein, merlin, by adhesion and growth arrest stimuli. J Biol Chem
1998;273:7757-64.
54.
Kissil JL, Johnson KC, Eckman MS, Jacks T. Merlin phosphorylation by p21-
activated kinase 2 and effects of phosphorylation on merlin localization. J Biol Chem
2002;277:10394-9.
55.
Xiao GH, Beeser A, Chernoff J, Testa JR. p21-activated kinase links Rac/Cdc42
signaling to merlin. J Biol Chem 2002;277:883-6.
56.
Alfthan K, Heiska L, Gronholm M, Renkema GH, Carpen 0. Cyclic AMP-
dependent protein kinase phosphorylates merlin at serine 518 independently of p21activated kinase and promotes merlin-ezrin heterodimerization. J Biol Chem
2004;279:18559-66.
33
57.
Laulajainen M, Muranen T, Nyman TA, Carpen 0, Gronholm M. Multistep
phosphorylation by oncogenic kinases enhances the degradation of the NF2 tumor
suppressor merlin. Neoplasia 2011; 13:643-52.
58.
Tang X, Jang SW, Wang X, et al. Akt phosphorylation regulates the tumour-
suppressor merlin through ubiquitination and degradation. Nat Cell Biol 2007;9:1199207.
59.
Surace El, Haipek CA, Gutmann DH. Effect of merlin phosphorylation on
neurofibromatosis 2 (NF2) gene function. Oncogene 2004;23:580-7.
60.
Hennigan RF, Foster LA, Chaiken MF, et al. Fluorescence resonance energy
transfer analysis of merlin conformational changes. Mol Cell Biol 2010;30:54-67.
61.
Scoles DR. The merlin interacting proteins reveal multiple targets for NF2
therapy. Biochim Biophys Acta 2008;1785:32-54.
62.
Xu HM, Gutmann DH. Merlin differentially associates with the microtubule and
actin cytoskeleton. J Neurosci Res 1998;51:403-15.
63.
Pelton PD, Sherman LS, Rizvi TA, et al. Ruffling membrane, stress fiber, cell
spreading and proliferation abnormalities in human Schwannoma cells. Oncogene
1998;17:2195-209.
64.
Bashour AM, Meng JJ, Ip W, MacCollin M, Ratner N. The neurofibromatosis type
2 gene product, merlin, reverses the F-actin cytoskeletal defects in primary human
Schwannoma cells. Mol Cell Biol 2002;22:1150-7.
65.
Poulikakos P1, Xiao GH, Gallagher R, Jablonski S, Jhanwar SC, Testa JR. Re-
expression of the tumor suppressor NF2/merlin inhibits invasiveness in mesothelioma
cells and negatively regulates FAK. Oncogene 2006;25:5960-8.
66.
James MF, Beauchamp RL, Manchanda N, Kazlauskas A, Ramesh V. A NHERF
binding site links the betaPDGFR to the cytoskeleton and regulates cell spreading and
migration. J Cell Sci 2004;117:2951-61.
34
67.
Kissil JL, Wilker EW, Johnson KC, Eckman MS, Yaffe MB, Jacks T. Merlin, the
product of the Nf2 tumor suppressor gene, is an inhibitor of the p21-activated kinase,
Paki. Mol Cell 2003;12:841-9.
68.
Shaw RJ, Paez JG, Curto M, et al. The Nf2 tumor suppressor, merlin, functions
in Rac-dependent signaling. Dev Cell 2001;1:63-72.
69.
Yi C, Troutman S, Fera D, et al. A tight junction-associated Merlin-angiomotin
complex mediates Merlin's regulation of mitogenic signaling and tumor suppressive
functions. Cancer Cell 2011; 19:527-40.
70.
Lallemand D, Curto M, Saotome 1, Giovannini M, McClatchey Al. NF2 deficiency
promotes tumorigenesis and metastasis by destabilizing adherens junctions. Genes Dev
2003;17:1090-100.
71.
Gladden AB, Hebert AM, Schneeberger EE, McClatchey Al. The NF2 tumor
suppressor, Merlin, regulates epidermal development through the establishment of a
junctional polarity complex. Dev Cell 2010;19:727-39.
72.
Toole BP. Hyaluronan-CD44 Interactions in Cancer: Paradoxes and Possibilities.
Clin Cancer Res 2009;15:7462-8.
73.
Curto M, Cole BK, Lallemand D, Liu CH, McClatchey Al. Contact-dependent
inhibition of EGFR signaling by Nf2/Merlin. J Cell Biol 2007;177:893-903.
74.
Lallemand D, Manent J, Couvelard A, et al. Merlin regulates transmembrane
receptor accumulation and signaling at the plasma membrane in primary mouse
Schwann cells and in human schwannomas. Oncogene 2009;28:854-65.
75.
Maitra S, Kulikauskas RM, Gavilan H, Fehon RG. The tumor suppressors Merlin
and Expanded function cooperatively to modulate receptor endocytosis and signaling.
Curr Biol 2006;16:702-9.
76.
Li W, You L, Cooper J, et al. Merlin/NF2 suppresses tumorigenesis by inhibiting
the E3 ubiquitin ligase CRL4(DCAF1) in the nucleus. Cell 2010;140:477-90.
35
77.
Li W, Cooper J, Zhou L, et al. Merlin/NF2 loss-driven tumorigenesis linked to
CRL4(DCAF1)-mediated inhibition of the hippo pathway kinases Latsl and 2 in the
nucleus. Cancer Cell 2014;26:48-60.
78.
Halder G, Johnson RL. Hippo signaling: growth control and beyond.
Development 2011;138:9-22.
79.
Harvey K, Tapon N. The Salvador-Warts-Hippo pathway - an emerging tumour-
suppressor network. Nat Rev Cancer 2007;7:182-91.
80.
Zhao B, Wei X, Li W, et al. Inactivation of YAP oncoprotein by the Hippo pathway
is involved in cell contact inhibition and tissue growth control. Genes Dev 2007;21:274761.
81.
Harvey KF, Pfleger CM, Hariharan IK. The Drosophila Mst ortholog, hippo,
restricts growth and cell proliferation and promotes apoptosis. Cell 2003;114:457-67.
82.
Zhang L, Ren F, Zhang Q, Chen Y, Wang B, Jiang J. The TEAD/TEF family of
transcription factor Scalloped mediates Hippo signaling in organ size control. Dev Cell
2008; 14:377-87.
83.
Badouel C, Gardano L, Amin N, et al. The FERM-domain protein Expanded
regulates Hippo pathway activity via direct interactions with the transcriptional activator
Yorkie. Dev Cell 2009;16:411-20.
84.
Oh H, Reddy BV, Irvine KD. Phosphorylation-independent repression of Yorkie in
Fat-Hippo signaling. Dev Biol 2009;335:188-97.
85.
Ren F, Zhang L, Jiang J. Hippo signaling regulates Yorkie nuclear localization
and activity through 14-3-3 dependent and independent mechanisms. Dev Biol
2009;337:303-12.
86.
Dupont S, Morsut L, Aragona M, et al. Role of YAP/TAZ in mechanotransduction.
Nature 2011;474:179-83.
36
87.
Wada K, Itoga K, Okano T, Yonemura S, Sasaki H. Hippo pathway regulation by
cell morphology and stress fibers. Development 2011;138:3907-14.
88.
Zhao B, Li L, Wang L, Wang CY, Yu J, Guan KL. Cell detachment activates the
Hippo pathway via cytoskeleton reorganization to induce anoikis. Genes Dev
2012;26:54-68.
89.
Yu FX, Zhao B, Panupinthu N, et al. Regulation of the Hippo-YAP pathway by G-
protein-coupled receptor signaling. Cell 2012; 150:780-91.
90.
Sudol M, Bork P, Einbond A, et al. Characterization of the mammalian YAP (Yes-
associated protein) gene and its role in defining a novel protein module, the WW
domain. J Biol Chem 1995;270:14733-41.
91.
Oka T, Sudol M. Nuclear localization and pro-apoptotic signaling of YAP2 require
intact PDZ-binding motif. Genes Cells 2009;14:607-15.
92.
Hao Y, Chun A, Cheung K, Rashidi B, Yang X. Tumor suppressor LATS1 is a
negative regulator of oncogene YAP. J Biol Chem 2008;283:5496-509.
93.
Zhao B, Li L, Lei Q, Guan KL. The Hippo-YAP pathway in organ size control and
tumorigenesis: an updated version. Genes Dev 2010;24:862-74.
94.
Overholtzer M, Zhang J, Smolen GA, et al. Transforming properties of YAP, a
candidate oncogene on the chromosome 11q22 amplicon. Proc Natl Acad Sci U S A
2006;103:12405-10.
95.
Dong J, Feldmann G, Huang J, et al. Elucidation of a universal size-control
mechanism in Drosophila and mammals. Cell 2007;130:1120-33.
96.
Steinhardt AA, Gayyed MF, Klein AP, et al. Expression of Yes-associated protein
in common solid tumors. Hum Pathol 2008;39:1582-9.
97.
Wang Y, Dong Q, Zhang Q, Li Z, Wang E, Qiu X. Overexpression of yes-
associated protein contributes to progression and poor prognosis of non-small-cell lung
cancer. Cancer Sci 2010;101:1279-85.
37
98.
Xu MZ, Yao TJ, Lee NP, et al. Yes-associated protein is an independent
prognostic marker in hepatocellular carcinoma. Cancer 2009;115:4576-85.
99.
Camargo FD, Gokhale S, Johnnidis JB, et al. YAP1 increases organ size and
expands undifferentiated progenitor cells. Curr Biol 2007;17:2054-60.
100.
Zhang J, Ji JY, Yu M, et al. YAP-dependent induction of amphiregulin identifies a
non-cell-autonomous component of the Hippo pathway. Nat Cell Biol 2009;1 1:1444-50.
101.
Lamar JM, Stern P, Liu H, Schindler JW, Jiang ZG, Hynes RO. The Hippo
pathway target, YAP, promotes metastasis through its TEAD-interaction domain. Proc
Nati Acad Sci U S A 2012;109:E2441-50.
102.
Hamaratoglu F, Willecke M, Kango-Singh M, et al. The tumour-suppressor genes
NF2/Merlin and Expanded act through Hippo signalling to regulate cell proliferation and
apoptosis. Nat Cell Biol 2006;8:27-36.
103.
Yu J, Zheng Y, Dong J, Klusza S, Deng WM, Pan D. Kibra functions as a tumor
suppressor protein that regulates Hippo signaling in conjunction with Merlin and
Expanded. Dev Cell 2010; 18:288-99.
104.
Striedinger K, VandenBerg SR, Baia GS, McDermott MW, Gutmann DH, Lal A.
The neurofibromatosis 2 tumor suppressor gene product, merlin, regulates human
meningioma cell growth by signaling through YAP. Neoplasia 2008;10:1204-12.
105.
Yokoyama T, Osada H, Murakami H, et al. YAP1 is involved in mesothelioma
development and negatively regulated by Merlin through phosphorylation.
Carcinogenesis 2008;29:2139-46.
106.
Lu L, Li Y, Kim SM, et al. Hippo signaling is a potent in vivo growth and tumor
suppressor pathway in the mammalian liver. Proc Natl Acad Sci U S A 2010;107:143742.
38
107.
Zhang N, Bai H, David KK, et al. The Merlin/NF2 tumor suppressor functions
through the YAP oncoprotein to regulate tissue homeostasis in mammals. Dev Cell
2010; 19:27-38.
108.
Benhamouche S, Curto M, Saotome 1, et al. Nf2/Merlin controls progenitor
homeostasis and tumorigenesis in the liver. Genes Dev 2010;24:1718-30.
109.
Yi C, Kissil JL. Merlin in organ size control and tumorigenesis: Hippo versus
EGFR? Genes Dev 2010;24:1673-9.
110.
Yin F, Yu J, Zheng Y, Chen Q, Zhang N, Pan D. Spatial organization of Hippo
signaling at the plasma membrane mediated by the tumor suppressor Merlin/NF2. Cell
2013; 154:1342-55.
111.
Wang W, Huang J, Chen J. Angiomotin-like proteins associate with and
negatively regulate YAP1. J Biol Chem 2011;286:4364-70.
112.
Zhao B, Li L, Lu Q, et al. Angiomotin is a novel Hippo pathway component that
inhibits YAP oncoprotein. Genes Dev 2011;25:51-63.
39
Chapter 2. FERM-domain proteins in tumorigenesis and metastasis
Introduction
FERM-domain proteins have been implicated in various cancers (1), both as tumor
suppressors (2, 3) and as promoters of metastasis (4, 5). This is not surprising, since
FERM-domain proteins have been shown to play roles in cell polarization, cell-cell and
cell-ECM contact, and participate in cell signaling (6-10), all factors which play a role in a
tumor's ability to metastasize.
In order to further determine the role these proteins may play in metastasis, I developed
a screen wherein FERM-domain proteins can be knocked down or overexpressed in a
murine mammary carcinoma metastasis model and the resulting metastases examined
for enrichment or depletion of FERM-domain proteins.
Results
1. 4.1 family expression in murine mammary carcinoma cells
In order to examine the effects of FERM-domain proteins on metastasis I used a panel
of murine mammary carcinoma cell lines, which have varying metastatic potential
(11)(Table 1). 4T1 is described as the most aggressive, showing metastasis to the lungs
when injected into the tail vein or into the mammary fat pad. The 67NR and 168FARN
cell lines were described to have low to no metastatic potential when used in this
manner. Therefore, 67NR and 168FARN cells could be used to identify proteins which
when knocked down that increase metastatic potential, whereas 4T1 cells could be used
to assay for a decrease in metastatic potential.
40
67NR
I6SFARN
4T07
66c14
4T1
yes
yes
yes
yes
yeS
In bloodstream
no
no
very few
very few
yes
In lymphatics
no
yes
yes
yes
yes
Extravasation
(Cells found In lung.)
no
no
yes
yes
yes
Lungs
no
no
no
yes
yes
LIver
no
no
no
no
yes
Bone
no
no
no
no
yes
Thmorlgenic
Intravasation:
Metastatic tumors:
Table 1: The 4T1 panel of cell lines as described by Asklason and Miler ranked in order of
metastatic potential. The columns marked in red denote the cell lines I chose to use for the
screen, the poorly metastatic cell ine 67NR and the highly metastatic ce line 4T1.
41
Of the FERM-domain family proteins, we initially chose to investigate the ERM proteins
(ezrin, radixin and moesin) and a number of the 4.1 family proteins; 4.1B, 4.1G, 4.1N
and 4.1 R, and examined their expression in these cell lines. Ezrin, a FERM-domain
protein which acts as a membrane-cytoskeletal linker and has previously been shown to
be highly expressed in multiple types of invasive human cancers (12-14) had increased
expression levels in the highly metastatic 4T1 cell line compared to the poorly metastatic
67NR cell line, although there was no significant difference in expression of ezrin
between the highly metastatic 4T1 cell line and the 168FARN cell line, which has been
described as having a low metastatic potential. Radixin and moesin, two closely related
proteins, did not show much change in expression in the various cell lines (Figure 1a).
4.1 B, another FERM-domain family protein and a member of the 4.1 subgroup, has been
described as a suppressor of prostate-cancer metastasis (3) and was not expressed in
4T1, 66C4 or 4T07, the cell lines with the higher metastatic potential, but was expressed
in the poorly metastatic cell lines 168FARN and 67NR (Figure 1b).
Using qPCR to determine the transcript levels of 4.1G (Figure 1c), 4.1N (Figure 1d),
4.1R isoform I (Figure 1e) and 4.1R isoforms 11/111 (Figure 1f), we did not detect any
significant trend of expression changes that correlated with the metastatic potential of
the cell lines.
42
a.
;
Ezrin
b.
w
-
Radixin
___
Moesin
4.1B
GAPDH
GA PDH
d.
4.1G expression In 4Ti cell lines
C.
4.1N
expression in 4T1 cell lines
312
02.6
Joe
i.e
10.4
0.2
0.6
0
0
4T1
e
4.R
66c14
4T07
16FARN
67NR
isoform I expresslon in 4T1 cel lima
4TI
2.5
10
66c14
4T07
168FARN
67NR
4.1R Isoforms 111111 expression In 4T1 col lines
2
U1.5
4
1
ffcI4
4Th?
1OPARN
GNR
4TI
66c4
4707
168
RN
67MR
FERM domain family protein expression in the 4T1 panel of mouse mammary
carcinoma cell lines
a. Ezrin expression: Western blot showing levels of ezrin expression in the 4T1 panel of cell
lines. The cell lines are in order of metastatic potential from left to right.
b. 4.1 B expression:
Western blot showing levels of 4.1 B expression in the 4T1 panel of cell lines. n=2
c. 4.1G expression:
qPCR showing normalized expression levels of 4.1 G in the 4T1 panel of cell lines. n=2
d. 4.1N expression:
qPCR showing normalized expression levels of 4.1 N in the 4T1 panel of cell lines. n=2
e. 4.1 R expression:
qPCR showing normalized expression levels of 4.1 R isoform I in the 4T1 panel of cell lines. n=2
f. 4.1 R isoform Il/ll expression:
qPCR showing normalized expression levels of 4.1 R isoform 11/111 in the 4T1 panel of cell lines.
n=2
43
2. Barcode-containing knock down of ERM proteins for Luminex-based assays
Following verification of expression of the ERM proteins and 4.1B in the 4T1 and 67NR
cell lines, and a correlation of expression levels of ezrin and 4.1 B with metastatic
potential in accordance with their description in the literature as a metastasis enhancer
and suppressor respectively, we then established in vivo models of metastasis and
tumorigenesis that would enable us to screen multiple FERM-domain proteins
simultaneously for a role in metastasis or tumorigenesis.
In this system, MSCV-retroviral vectors including both a mir30-based shRNA targeting
the gene of interest and an oligonucleotide barcode unique to each hairpin were used to
knock down the genes of interest while labeling the cells with a barcode unique to the
identity of the knockdown. A mixed population of cells carrying different knockdowns with
their corresponding barcodes was then used in both experimental tail-vein metastasis
assays and orthotopic mammary transplants. While an experimental metastasis assay
involves tail-vein injection of the cell mixture and analyzes the number of lung
metastases that form, thus focusing primarily on survival, extravasation and growth, the
orthotopic experiment includes all stages of tumorigenesis and metastasis and can
therefore more closely recapitulate the metastatic cascade. DNA isolated from the tumor
or metastases was isolated and analyzed quantitatively to determine relative increases
or decreases of the barcode populations in the primary tumor or metastases. When
normalized to the barcode signal in the primary tumor, an increase or decrease in a
knockdown barcode signal compared to the control barcode signal indicated an increase
or decrease in metastatic potential of the cells in which we had knocked down the gene
in question.
44
To optimize and establish the assay we used two approaches. In one, the highly
metastatic 4T1 cell line was used to determine whether there is a decrease in metastatic
potential following knockdown of the metastasis enhancer ezrin and its close homologs
radixin and moesin. In the second approach, the poorly metastatic cell line 67NR was
used to determine whether there is an increase in metastatic potential following
knockdown of the metastasis suppressor 4.1 B.
Two separate barcoded hairpins were used for each gene and decreased expression of
the ERM proteins following knockdown was validated in the 4T1 cell line (Figure 2a) and
of 4.1B protein levels in the 67NR cell line (Figure 2b).
45
a.
COO
Ezrin
mm
GAPDH
N,
CD
M
wpm,
Radixin
GAPDH
11"
Moesin
GAPDH
C,
COO
H4.1B
4Sk
e GA
- PDH
Figure 2: Knock down of FERM-domain-containing proteins in murine mammary carcinoma
a. Knock down of ERM proteins in 4T1:
Western blot showing knockdown of ezrin, radixin or moesin in the highly metastatic
4T1 murine mammary carcinoma cell line using a Luminex-barcoded retroviral vector
containing a mir30-based shRNA for each of the ERM proteins or a control.
Two separate hairpins targeting each gene are shown.
b. Knock down of 4.1B in 67NR:
Western blot showing knock down of 4.1 B in the poorly metastatic 67NR cell line
using a Luminex-barcoded retroviral vector containing a mir30-based shRNA for 4.1 B or
a control. Two separate hairpins targeting 4.1 B are shown.
46
3. Orthotopic and tail vein assays following loss of ERM proteins
Once we established knockdown of the FERM-domain proteins ezrin, radixin or moesin
in the 4T1 cell line we initially performed both orthotopic transplants and tail-vein
injections in the traditional manner investigating only the loss of one protein per
experiment. In these experiments, mice (n=5) were injected either via the tail vein or
orthotopically into the mammary gland with 4T1 cells in which ezrin had been knocked
down using a barcoded mir30 shRNA vector containing a fluorescent label or expressing
a control vector containing a fluorescent label, and the numbers of lung metastases were
counted. There was no significant difference between the control and the ezrin
knockdown cells in the number of metastases following tail-vein injection in an
experimental metastasis assay, or the number of metastases following an orthotopic
mammary transplant. In addition, there was no significant difference between the control
and the ezrin knockdown in the size of the tumor formed in the orthotopic transplant
(Figure 3a). We next performed the experiment as a screen using a mix of multiple
barcoded knockdowns and a control injected simultaneously into the same mouse. In
this way, we could control for any internal variability during the injection or transplant,
screen multiple genes at the same time and limit the number of mice required for the
experiment. In these experiments the mice were injected via tail vein (n=6), or orthotopic
transplant (n=20) with a mixture of 4T1 cells containing barcoded knockdowns for ezrin,
radixin, moesin, or a control. Two different validated hairpins were used for each gene of
interest. There were no significant differences in metastasis between the control cells
and cells where ezrin, radixin or moesin had been knocked down assayed either by tailvein injection (Figure 3b) or following orthotopic transplant (Figure 3d). There were also
no significant differences between the control and the knockdown cells in contribution
towards establishing the primary tumor in the orthotopic transplant (Figure 3c, cohorts
were sacrificed and tumors analyzed at 3 separate time points).
47
Metastasis assays for 4T1 cells with Ezrin knockdown:
a.
Tail vein lung metastases
Orthotopic lung metastases
Orthotopic primary tumor
30 -4
-I
25-
~'*-7
[209C
I.S
I
E~Fi.
I
L~JLJ
irn
T..2
I3
control
control shEZR1 shEZR2
*1
59
*05
0I
control shEZRI shEZR2
shEZRI shEZR2
Luminex experimental metastasis assay for 4T1 cells with ERM knockdown:
b. 1.0
1A
1.12
I
0.4
6i
0
EZR shRNA I
EZR shRNA 2
RDX shRNA I
RDX
shRNA 2
MSN
shRNA
I
MSN *hRNA 2
Control I
Control 2
Luminex orthotopic transplant experiment, primary tumor:
1.6
C.
IA
IM
day
daylIs
Eday 30
0.8
404
0.2
I
0
EZR shRNA I
EZR shRNA 2
RDX shRNA I
RDX shRNA 2 MSN shRNA I
MSN shRNA 2
Control 2
Control I
Luminex orthotopic transplant experiment, metastases:
d.
2.
a
2
0.6
0
EZR
shRNA
I EZR
shRNA 2
RDX shRNA I ROX *hRNA 2
MON shRNA I
MSN
shRNA 2
Control I
da0 lungs
day 30lung
Control 2
48
Figure 3
a. Metastasis assays for 4T1 cells with Ezrin knockdown:
Ezrin was knocked down in 4T1 cells using two separate validated hairpins in an MSCV retroviral
vector. Cells were injected into the tail vein (n=5) or transplanted orthotopically into the mammary
gland (n=5) and metastases counted. For the orthotopic transplant the resulting primary tumor was
weighed.
b. Luminex experimental metastasis assay for 4T1 cells with ERM knockdown:
Ezrin, radixin, or moesin knockdown cells along with 2 barcoded control lines were mixed and
injected into the tail vein. (n=6) Lungs containing metastases were collected and the total lung DNA
analyzed for the knockdown or control vector barcodes. The average relative signal generated from
the barcodes associated with each hairpin was quantified as described.
c. Luminex orthotopic transplant experiment, primary tumor:
Ezrin, radixin or moesin knockdown cells along with 2 barcoded control lines were mixed and
injected orthotopically into the mammary gland.
Primary tumors were collected on day 5 (n=4), day 15 (n-4) and day 30 (n=10) and the DNA
analyzed for knockdown or control vector barcode contribution. The average relative signal
generated from the barcodes associated with each hairpin was quantified as described.
d. Luminex orthotopic transplant experiment, metastases:
Ezrin, radixin or moesin knockdown cells along with 2 barcoded control lines were mixed and
injected orthotopically into the mammary gland. Total lungs containing metastases or tumor cells
were collected on day 5 (n=4), and day 30 (n=1 0) and the DNA analyzed for knockdown or control
vector barcode contribution.
The average relative signal generated from the barcodes associated with each hairpin was
quantified as described.
4. Migration and invasion in vitro following loss of ERM proteins
As with the in vivo experiments, in vitro proliferation (Figure 4a), migration (Figure 4b,c)
and invasion (Figure 4d) experiments showed no change in migration or invasion
following knockdown of ERM proteins individually in the 4T1 cell line.
49
a.
.
b.
2
1.4
U
T
0
*
.0
WontroN
1 otNN2ER RAN XX
NA
SN
2
00..
0
0
1
sRNA
shRNA120R02
hR NA01
02
MShRN1
68
RNA
1000
a600
800
control
Mn
shRAD MSN
1000
control 2
EZR
ER1
O
EZ
ERN2
shRNA
XI RD2
sh
NI
00
0
1S600P4 1400
0
Figure 4
a. Luminox cell proliferation in vitro of ERM knockdown 4T1 cells:
Two separate ERM knockdown 4T1 cell lines and 2 control lines were mixed and plated. DNA was isolated
and analyzed from the culture at timepoints post-plating to determine contribution of each cell line to the
culture. The average relative signal generated from the barcodes associated with each hairpin was
quantified as described.
b. Luminex cell migration experiment with ERM knockdown 4T1 cells:
Two separate ERM knockdown 4T1 cell lines and 2 control lines were mixed and plated ina Transwell
culture system. DNA was isolated and analyzed from the cells which had migrated 16 hours post-plating to
determine contribution of each cell line to the migrating cells. The average relative signal generated from
the barcodes associated with each hairpin was quantified as described.
c. Migration of 4T1 cells with ERM knockdown or control: 4T1 cells with stable knockdown of ezrin,
radixin, moesin or control were plated in Transwell plates inmedia lacking serum, and migration into 10%
serum was counted 16 hours later.
d. Invasion of 4T1 cells with ERM knockdown or control: 4T1 cells with stable knockdown of ezrin,
radixin, moesin or control were plated in Matrigel-coated Transwell plates and cells that had invaded through
the Matrigel were counted 16 hours later.
50
5. Compensation and redundancy of ERM proteins
There is a possibility that these close homologs can compensate for each other and that
all three proteins, ezrin, radixin and moesin need to be knocked down simultaneously in
order to achieve a change in the metastatic potential of the cell. In work by Takeuchi et
al. (15) they show single knockdown of ezrin, radixin or moesin in thymoma cells using
antisense phosphorothioate oligonucleotides (PONs). Knockdown of these proteins
singly had no effect on the presence of microvilli on the cell surface. Only the disruption
of all three proteins simultaneously could eliminate the microvilli on the cell surface.
We attempted to knock down these three proteins simultaneously using two different
approaches. In one approach, we infected the cells sequentially with MSCV retroviral
vectors containing the mir30 shRNA hairpin which had been successful in the single
protein knockdown experiment (Figure 5a). In another approach, we infected cells with
an MSCV retroviral vector containing concatemerized mir30 shRNA hairpins for all three
proteins (Figure 5b). Both of these approaches were unsuccessful in knocking down all
three proteins simultaneously.
51
a.
NC
Ezrin
Radixin
GAPDH
Moesin
GAPDH
GAPDH
b.
2APuroR
c
0%
V?
-
4o6
LTR
\~
,,m Ezrin
GAPDH
Figure 5
a. Sequential knockdown of ezrin, radixin and moesin in the 4T1 cell line:
Western blot showing an attempt at knockdown of ezrin, radixin and moesin simultaneously in the
highly metastatic 4T1 murine mammary carcinoma cell line using Luminex-barcoded retroviral vectors
infected at single copy levels containing a mir3O-based shRNA for each of the ERM proteins or a control.
The cells were infected sequentially with each vector, then lysates were collected to examine knockdown
efficiency. A control which was infected only once at single copy level with a hairpin targeting
one gene is shown to illustrate single knockdown efficiencies.
b. Simultaneous knockdown of ezrin, radixin and moesin in the 4T1 cell line:
Western blot showing an attempt at knockdown of ezrin, radixin and moesin simultaneously in the highly
metastatic 4T1 murine mammary carcinoma cell line using a Luminex-barcoded retroviral vector, containing
three concatemerized mir30-based shRNAs targeting each of the ERM proteins, as depicted in the
illustration. (Ezr indicates shRNA targeting ezrin, EM indicates shRNA targeting ezrin and moesin, and
ERM indicates shRNA targeting ezrin, radixin and moesin)
52
6. Analysis of metastasis suppressor 4.1 B knockdown
Knockdown of the metastasis suppressor 4.1 B in the poorly metastatic cell line 67NR did
not increase metastasis in experimental tail-vein metastasis assays, either in a singlecell-line experiment (Figure 6a, n=10, p=0.35) or using a barcoded mixture of
knockdown and control vectors (Figure 6b n=4, p=0.28). Furthermore, metastasis of the
control cell line indicates that the 67NR cell line did not act in this system as previously
described (11). In an orthotopic experiment the control line failed to form a tumor (Figure
6c), however, the cell line has been described as able to form tumors in an orthotopic
experiment and the failure to form tumors in this experiment (n=5) might be due to a
technical issue or an immune response to the fluorescent label ZS-Green. The
knockdown cells which also expressed ZS-Green in addition to the barcoded mir30
shRNA targeting 4.1B showed a lower expression of ZS-Green compared to the control
(data not shown). In vitro experiments to determine whether loss of 4.1B expression in
the 67NR cell line affected growth (Figure 6e) or migration (Figure 6f) again showed no
significant difference between the knockdown line and the control.
53
b. Luminex tail vein assay
a. Tail vein assay
-
350
-
300
1.2
- 250
-1i
- 200
5a
150
.a
1
C
'0
0
0
0
I
0.8
0.6
0.4
100
'0
50
0
0.2
0shRNA 4.16
control
shRNA 4.1B
control
c. Orthotopic experiment- primary tumor
d.Orthotopic experiment- metastases
5
4
4 v
3
2
S
0
2
+
C,
0
control
shRNA 4.1B 1 shRNA 4.1B 2
control
1.4
2500
1.2
B
1.
CO
0
-+-control
0.8
SshRNA4.1B
0.6
.7
0
shRNA 4.1B 2
f. Migration
e. Luminex cell proliferation
.0
shRNA 4.1B 1
2000
I
0.
I
15001000
0.4
0
0.2
0
control
0
2
10
shRNA 4.10
17
days in culture
54
Figure 6
a. Experimental metastasis assay for 67NR cells with 4.1B knockdown:
4.1 B was knocked down in 67NR cells using two separate validated hairpins in an MSCV retroviral
vector. Cells were injected into the tail vein (n=5) and lung metastases were counted.
b. Luminex experimental metastasis assay for 67NR cells with 4.1B knockdown:
4.1 B knockdown cells along with 2 barcoded control lines were mixed and injected into the
tail vein. (n=4)
Lungs containing metastases were collected and the total lung DNA analyzed for the knockdown
or control vector barcodes. The average relative signal generated from the barcodes associated
with each hairpin was quantified as described.
c. Orthotopic transplant experiment, primary tumor:
Two separate 4.1 B knockdown 67NR cell lines and a control cell line were injected orthotopically
into the mammary gland. Primary tumors were collected on day 30 (n=5) and tumor weight
recorded.
d.Orthotopic transplant experiment, metastases:
Two separate 4.1B knockdown 67NR cell lines and a control cell line were injected
orthotopically into the mammary gland. Lungs were collected on day 30 (n=5) and number of
metastases recorded.
e. Luminex cell proliferation in vitro experiment:
Two separate 4.1B knockdown 67NR cell lines and two control cell lines were mixed and plated.
DNA was isolated and analyzed from the culture at timepoints post plating to determine
contribution of each cell line barcode to the culture. The average relative signal generated from
the barcodes associated with each hairpin was quantified as described.
f.Migration of 67NR cells with 4.1B knockdown or control:
67NR cells with stable knockdown of 4.1B or control were plated in transwell plates in media
lacking serum, and migration into 10% serum was counted 16 hours later.
55
Discussion
FERM domain proteins act as linkers between the actin cytoskeleton and the cell
membrane, and regulating the attachment of the membrane to cytoskeletal actin has
been implicated in many cellular processes including cell adhesion and migration,
membrane protein localization and transport, and signal transduction. A number of
proteins belonging to the larger 4.1 superfamily have been implicated in tumorigenesis
and metastasis, and in these experiments I attempted to establish a screen in order to
determine whether other proteins in the FERM domain family of proteins are also
relevant to roles in suppressing or promoting tumorgenesis and metastasis. In order to
do so, I initially chose to look at the ERM proteins, ezrin, radixin and moesin. Ezrin has
already been established as a metastasis promoter in osteosarcoma (5) and is
expressed at higher levels in numerous human cancers, as well as being correlated with
a poor outcome in breast cancer (16).
In addition, some other FERM domain proteins have been implicated in tumor or
metastasis suppression, merlin being the most extensively studied in this category.
Merlin, the product of the Nf2 gene which is lost in neurofibromatosis type 2, a
dominantly inherited disease which leads to the formation of multiple tumors in the
nervous system. Furthermore, mice which have lost merlin expression can develop a
variety of highly metastatic tumors, indicating a role for merlin not only in tumorgenesis
but also in metastasis (17). Another FERM domain protein implicated in metastasis
suppression is 4.1 B/DAL-1, which has been described as a growth suppressor in vitro in
non-small cell lung carcinoma (18) and as a metastasis suppressor in prostate cancer
(3).
In a microarray analysis of existing microarrays (19) from the 4T1 panel of murine
mammary carcinoma cell lines ezrin and another FERM domain protein, Epb4.114b
(Ehm2) (described previously as being expressed in highly metastatic murine melanoma
56
cells (20)), were at least 2-fold higher in the highly metastatic 4T1 cell line compared to
the cell line described as poorly metastatic, 67NR. FERM-domain-containing proteins
that showed at least 2-fold lower expression in the highly metastatic 4T1 cell line
compared to 67NR, and might be acting as metastasis suppressors included Epb4.113
(4.1B/DAL-1), FRMD4b, Talin2, and Epb4.111 (4.1N).
Considering the roles of FERM domain proteins as both metastasis suppressors and
enhancers, the FERM domain family of proteins appeared to be good candidates to use
in developing an in vivo screen for metastasis. In this screen, cells which have sustained
a knock-down of the proteins of interest are mixed with control cells. Both the knockdown and control cells stably express a unique DNA-based barcode which correlates
with either the control or a knock-down vector. This mixture is then either plated as an in
vitro experiment or introduced into mice through orthotopic injection or tail-vein injection.
As tumors or metastases grow, the contribution of the cells to the tumors or metastases
can be measured by the contribution of the barcoded vector, with cells that have
undergone a knock-down which results in decreased metastasis showing a decreased
contribution of the barcode in the resulting metastases, compared to cells which have
undergone a control treatment, and cells in which the knockdown results in an increase
in metastasis showing an increase in the barcode contribution compared to a control
barcode. This method of in vivo screening was established successfully in our lab and
used to determine the metastatic potential of breast cancer cells expressing various
mutated forms of the oncogene YAP (21). However, when this system was implemented
as a screen for FERM domain proteins we did not see a change in the contribution of
ezrin, radixin or moesin knockdown 4T1 cells to metastasis when compared to control
cells. Since ezrin and radixin had been previously described to enhance metastasis we
expected to see a decrease in metastasis in 4T1 cells in which these proteins were
knocked down. In both the in vivo screen and in vitro migration and invasion experiments
57
we did not see a change in the cells' metastatic potential or ability to migrate or invade in
culture following knock down.
The literature tells us that these proteins may have a functional redundancy, and that
knocking down one of them merely leads to compensation through one of the other
close family members (15). This led to the next step, of attempting to knock down all
three family members, ezrin, radixin and moesin, simultaneously, to see if elimination of
these proteins could result in a decrease in metastasis in 4T1 cells. However, despite
trying both successive knockdown in the cells and simultaneous knockdown using a
concatemerized vector including all three hairpins, we were not able to successfully
eliminate expression of all three proteins in the 4T1 cells. An alternative method to
attempt this now would be by using the Crispr-Cas9 genome editing system to knock out
all three genes simultaneously, assuming cells are able to survive without all three ERM
proteins.
Along with experiments in which FERM-domain proteins described as metastasis
enhancers were knocked down, where we expected a decrease in metastasis, we also
knocked down a FERM domain protein described as a metastasis suppressor, 4.1B, in a
cell line described as poorly metastatic. We hoped to establish FERM-domain family
controls of both metastasis enhancers and suppressors before screening additional
family members whose functions in metastasis are currently unknown. However, when
4.1B was knocked down in the 67NR cell line, which was described as poorly metastatic,
we did not see a difference in metastasis between the knockdown line and the control.
Surprisingly, we saw metastasis in the control despite the fact that the cell line had been
described as poorly metastatic. We also attempted to repeat these experiments in a
different murine mammary carcinoma cell line panel of varying metastatic potential, the
58
D2 panel (22), however in our hands the D2.1 cell line which had been described as
poorly metastatic still was able to form lung metastases upon orthotopic injection into the
fat pad, which had not been described in the original literature regarding these cells. We
saw no significant differences in expression in other 4.1 family proteins (Figure 1, c-f),
and decided not to pursue the screen any further.
In summary, although ezrin and its close homologs radixin and moesin have been
implicated in promoting metastasis, we could not show that loss of either of the proteins
singly effected metastasis in a murine mammary carcinoma model. In addition, loss of
the FERM-domain family metastasis suppressor 4.1 B could not promote metastasis in
the murine mammary carcinoma cell line 67NR, which proved to be more metastatic in
our hands than originally described. A wide-scale screen of FERM-domain-containing
proteins to establish whether other FERM-domain proteins can enhance or suppress
metastasis was not performed, and more recent literature (Valderrama, 2012) suggests
that although some of these proteins can play a role in tumorigenesis and metastasis,
they do not necessarily play a role in breast cancer metastasis and a screen specific for
a mammary carcinoma model may not be entirely useful in elucidating the roles of these
proteins in metastasis.
References
1.
McClatchey Al. Merlin and ERM proteins: unappreciated roles in cancer
development? Nat Rev Cancer 2003;3:877-83.
2.
Johnson KC, Kissil JL, Fry JL, Jacks T. Cellular transformation by a FERM
domain mutant of the Nf2 tumor suppressor gene. Oncogene 2002;21:5990-7.
3.
Wong SY, Haack H, Kissil JL, et al. Protein 4.1B suppresses prostate cancer
progression and metastasis. Proc Natl Acad Sci U S A 2007;104:12784-9.
59
4.
Elliott BE, Meens JA, SenGupta SK, Louvard D, Arpin M. The membrane
cytoskeletal crosslinker ezrin is required for metastasis of breast carcinoma cells. Breast
Cancer Res 2005;7:R365-73.
5.
Khanna C, Wan X, Bose S, et al. The membrane-cytoskeleton linker ezrin is
necessary for osteosarcoma metastasis. Nat Med 2004;10:182-6.
6.
Bretscher A, Edwards K, Fehon RG. ERM proteins and merlin: integrators at the
cell cortex. Nat Rev Mol Cell Biol 2002;3:586-99.
7.
Mackay DJ, Esch F, Furthmayr H, Hall A. Rho- and rac-dependent assembly of
focal adhesion complexes and actin filaments in permeabilized fibroblasts: an essential
role for ezrin/radixin/moesin proteins. J Cell Biol 1997;138:927-38.
8.
McClatchey Al, Fehon RG. Merlin and the ERM proteins--regulators of receptor
distribution and signaling at the cell cortex. Trends Cell Biol 2009;19:198-206.
9.
Morrison H, Sherman LS, Legg J, et al. The NF2 tumor suppressor gene product,
merlin, mediates contact inhibition of growth through interactions with CD44. Genes Dev
2001;15:968-80.
10.
Ng T, Parsons M, Hughes WE, et al. Ezrin is a downstream effector of trafficking
PKC-integrin complexes involved in the control of cell motility. EMBO J 2001;20:272341.
11.
Aslakson CJ, Miller FR. Selective events in the metastatic process defined by
analysis of the sequential dissemination of subpopulations of a mouse mammary tumor.
Cancer Res 1992;52:1399-405.
12.
Akisawa N, Nishimori 1, Iwamura T, Onishi S, Hollingsworth MA. High levels of
ezrin expressed by human pancreatic adenocarcinoma cell lines with high metastatic
potential. Biochem Biophys Res Commun 1999;258:395-400.
13.
Khanna C, Khan J, Nguyen P, et al. Metastasis-associated differences in gene
expression in a murine model of osteosarcoma. Cancer Res 2001;61:3750-9.
60
14.
Ohtani K, Sakamoto H, Rutherford T, Chen Z, Satoh K, Naftolin F. Ezrin, a
membrane-cytoskeletal linking protein, is involved in the process of invasion of
endometrial cancer cells. Cancer Lett 1999;147:31-8.
15.
Takeuchi K, Sato N, Kasahara H, et al. Perturbation of cell adhesion and
microvilli formation by antisense oligonucleotides to ERM family members. J Cell Biol
1994;125:1371-84.
16.
Bruce B, Khanna G, Ren L, et al. Expression of the cytoskeleton linker protein
ezrin in human cancers. Clin Exp Metastasis 2007;24:69-78.
17.
McClatchey Al, Saotome 1, Mercer K, et al. Mice heterozygous for a mutation at
the Nf2 tumor suppressor locus develop a range of highly metastatic tumors. Genes Dev
1998;12:1121-33.
18.
Tran YK, Bogler 0, Gorse KM, Wieland I, Green MR, Newsham IF. A novel
member of the NF2/ERM/4.1 superfamily with growth suppressing properties in lung
cancer. Cancer Res 1999;59:35-43.
19.
Dutertre M, Lacroix-Triki M, Driouch K, et al. Exon-based clustering of murine
breast tumor transcriptomes reveals alternative exons whose expression is associated
with metastasis. Cancer Res 2010;70:896-905.
20.
Shimizu K, Nagamachi Y, Tani M, et al. Molecular cloning of a novel
NF2/ERM/4.1 superfamily gene, ehm2, that is expressed in high-metastatic K1735
murine melanoma cells. Genomics 2000;65:113-20.
21.
Lamar JM, Stern P, Liu H, Schindler JW, Jiang ZG, Hynes RO. The Hippo
pathway target, YAP, promotes metastasis through its TEAD-interaction domain. Proc
NatI Acad Sci U S A 2012;109:E2441-50.
22.
Morris VL, Tuck AB, Wilson SM, Percy D, Chambers AF. Tumor progression and
metastasis in murine D2 hyperplastic alveolar nodule mammary tumor cell lines. Clin
Exp Metastasis 1993;11:103-12.
61
Chapter 3. Both major merlin isoforms regulate cell growth
Introduction
Merlin (NF2) is a well-characterized FERM-domain protein, identified as the protein
product of the Nf2 tumor-suppressor gene which is lost in the familial neurofibromatosis
type II (NF2) syndrome. In addition, mice that are heterozygous for NF2 are prone to a
large variety of tumors, which show a high rate of metastasis. Merlin has two major
isoforms (1) which I will refer to hence as isoform I (NF2a) and isoform II (NF2b). These
two isoforms differ only by one exon at the C-terminus. Isoform I contains exons 1-15,
and exon 17, whereas isoform I contains an alternative exon, exon 16, instead of exon
17, which introduces an alternate reading frame and an early termination. Isoform II is
therefore 16 amino acids shorter than isoform I and contains a different C-terminus
(Figure 1a.). Early literature in the field regarded isoform II as unable to suppress
growth both in vitro and in vivo. In an experiment where rat schwanomma cells were
injected subcutaneously into mice cells expressing isoform I failed to grow, but cells
expressing isoform II were not suppressed (2). This inability to suppress growth was
attributed to an inability of isoform II to achieve or maintain a closed conformation, due to
a reduced ability of the isoform I C-terminus to bind the N-terminus (3). FERM-domain
proteins, such as merlin, are classically described as switching between a closed
conformation, in which the C-terminus binds the N-terminus, and an open conformation.
This switch is regulated by a phosphorylation event. In Merlin, a major phosphorylation
event that controls growth suppression occurs at S518 and is mediated by PAK (4) or
PKA (5). Phosphorylation of Merlin results in loss of contact inhibition and increased
proliferation (6). Initial research suggested that phosphorylated merlin was unable to
form intramolecular associations and was in an open conformation, and therefore
62
suggested that the open conformation of merlin was inactive in suppressing growth (7).
However, further investigation revealed that phosphorylated merlin could be
preferentially found in the closed conformation, and that the switch between open and
closed conformations appears to be a lot more dynamic than originally considered (8).
Considering that the intramolecular associations between the N-terminus and the Cterminus of merlin are dynamic and not necessarily indicative of merlin being "active" or
"inactive" in growth suppression, this raises the question of whether isoform II is indeed
unable to suppress growth merely due to a decreased ability to form those
intramolecular associations. Thus, we investigated whether isoform 11 is able to suppress
growth, and whether there is a possible differential regulation of these two isoforms.
Results
1. Expression of two major merlin isoforms in multiple cell lines
In order to determine whether expression of either of the two major merlin isoforms
(Figure 1a) is able to suppress growth, and whether phosphorylation of merlin influences
its growth-suppressive ability, we generated MSCV-based retroviral vectors to stably
deliver each merlin isoform, as well as merlin phospho-mutants and phospho-mimetics
for each isoform. In the phospho-mutant expression vector the main regulatory
phosphorylation site, Ser518, is mutated into an alanine. The phospho-mimetic consists
of the Ser518 residue mutated into an aspartate, both mutants described previously (9).
These constructs were then stably transduced into several cell lines, including normal
epithelial mouse mammary gland cells (NMuMG, Figure 1b) and human mammary
carcinoma cells (MDA-MB-231, Figure 1c), both of which express low endogenous levels
of merlin , and two human mesothelioma cell lines which lack endogenous merlin
(Meso428 and Meso59, Figures Id and le). As expected, when the phospho-mutant
and phospho-mimetic versions of merlin were expressed they were not recognized by an
63
C'
Coiled coil
FERM domain
a.
S-PAK
S-Akd
S
W
1
W
417a7
W
E E
14
13
-
Isoform A
K f
-s--r
T-PKC
S-Akt
S-PKA
T-KK1P1A
S-PAK
17
11WGR
P141
Isoform B
TIKKIPQAQGRRPICI-
c.MDA-MB-231 cell line
b. NMuMG cell line
40 +ol
Aa~?
99
0*
d. Meso428
o9
7Aq
7
pS518
pS518
Merlin
Merlin
GAPDH
GAPDH
e. Meso59
0%
0
0/
,6
pS518
owwww Merlin
Merlin
GAPDH
GAPDH
Figure 1: Merlin isoform a and b expression in multiple cell lines using an MSCV-based
retroviral vector
a. Illustration of the two major merlin isoforms with main phosphorylation sites noted.
b. Western showing expression of both major merlin isoforms and phospho-mutants or empty
vector control in the normal mouse mammary gland epithelial cell line NMuMG.
c. Western showing expression of both major merlin isoforms in the MDA-MB-231 human
mammary carcinoma cell line
d. Westem showing expression of both major merlin isoforms or an empty vector control in the
human mesothelioma cell line Meso428
e. Western showing expression of both major merlin isoforms in the human mesothelioma cell
line Meso59
64
antibody specific for the phosphorylated Ser518 residue. Surprisingly, isoform 11 showed
low phosphorylation of Ser518 when compared to isoform I in MDA-MB-231 and
NMuMG cells, and showed a corresponding hypophosphorylated band when
immunoblotting with a general merlin antibody. This initial result indicated that there
could be differential regulation between the two isoforms.
2. Both major merlin isoforms can suppress growth
We next wanted to test the ability of each merlin isoform to suppress growth. For these
experiments, cells were infected with either a retroviral vector expressing merlin and
GFP, or a control vector expressing GFP alone. The percent of GFP-positive cells after
culture following infection was determined, and all future measurements were
normalized to the starting point. The cultures were followed over the course of 25-30
days post-infection, with cells being split post-confluency but kept at near confluent
levels throughout the experiment. This was done to maintain merlin activity, since merlindependent growth suppression has been shown to occur upon contact inhibition of cells
(10). In both immortalized mouse fibroblast cells (Figure 2a) and NMuMG cells (Figure
2c), both merlin isoforms were able to suppress growth, as shown by a decrease of
GFP-positive (i.e merlin positive) cells in the culture compared to the starting point,
whereas the percentage of GFP-positive control cells (GFP alone) remained stable over
time. In 4T1 cells (Figure 2b), which have a high amount of endogenous merlin, although
both isoforms showed a suppression of growth, the decrease was only significant in the
cells expressing isoform 1. This might be due to endogenous merlin already acting in
these cells, so expression of additional merlin does not significantly increase the amount
of merlin-derived regulation.
Next, merlin was expressed in mesothelioma cells that have lost endogenous merlin.
Malignant mesothelioma frequently shows a loss of NF2 (11) and therefore human
65
mesothelioma cell lines were selected as a biologically relevant model in which to of
either of the two major merlin isoforms resulted in a significant suppression of growth, as
measured by total cell number over time (Meso59, figure 2d, Meso428, figure 2e).
a.
1.4
,
1.2
c
+*-control
' 0.4(9
T
T
C* 0.8
0.
c 0.8
**
0
6
9
12
15
19
22
25
C.
days post Infection
b.
1.2
1.2
0.8
I
0.8
00
LL
a
-0-Nf2a
Nf2b
ns
0.6
0.6
0.4
0.4
0.2
0.2
-TT4 -control
I
-U-NF2a
NF2b
0
0
0
3
9
16
22
3
29
5
10
20
days post infection
days post infection
d.
26
e.
0
3.5
3
-Control
-*-NF2a
C
E
2.5
NF2b
C
0
8
6
2
1.5
1
0.5
-
4
2
401
control
-U-NF2a
NF2b
0
0
0
4
8
14
days post plating
21
U
0
U
U
days post plating
Figure 2: Both major merlin isoforms are able to suppress growth in multiple cell lines
Cells were infected with a merlin-GFP expressing retroviral vector or a control GFP+ vector at low titer,
resulting in a mixed population of GFP+ cells expressing merlin, and GFP- cells not expressing merlin.
The cells were normalized to the starting point and loss of GFP+ merlin expressing cells was measured
over time, indicating a disadvantage in growth for merlin expressing cells. For the mesothelioma cell line
experiments a standard growth curve was measured by counting cells over time post plating.
Astrisks denote significance at <0.05(*), <0.01(**), and <0.001(***).
p-values were taken at the end point of each experiment,
a. Both major merlin isoforms can suppress growth in MEF cells, n=3.
b. Merlin isoform a can suppress growth in 4T1 cells, n=3
c. Both merlin isoforms can suppress growth in NMuMG cells, n=3
d. Both merlin isoforms can suppress growth in Meso59 human mesothelioma cells, n=3
e. Both merlin isoforms can suppress growth in Meso428 human mesothelioma cells, n=4
examine rescue of merlin function. In two separate mesothelioma cell lines expression
66
3. Growth suppression requires contact inhibition and is regulated by
PhosphorVlation
Next, we wanted to determine whether suppression of growth by isoform II was contact
inhibition-dependent, and phosphorylation-dependent, as described by Shaw et al., 1998
for isoform I. Proliferation experiments as described above were carried out in cells
expressing each merlin isoform or a control, or a merlin S518A phospho-mutant, and
maintained at near confluency or at non-confluent levels. At confluency, cells are contact
inhibited and therefore merlin should suppress growth, whereas cells maintained at nonconfluency should not be suppressed by merlin.
When NMuMG cells were maintained at non-confluent levels and the percentage of
GFP-positive cells was measured over time, there was no change in the percentage of
merlin expressing cells when compared to the starting point for either merlin isoform I
(Figure 3a) or isoform II (Figure 3b). This indicates that, at subconfluent levels, there is
no growth disadvantage to merlin-expressing cells. However, when NMuMG cells were
maintained at confluent levels, both isoform I (Figure 3c) and isoform 11 (Figure 3d)
showed a decrease in GFP-positive, merlin-expressing cells over time. This decrease
was potentiated when a merlin mutant (of either isoform) that could not be
phosphorylated on serine 518 was expressed. It is interesting to note that in
subconfluent cells, a presumably constitutively active unphosphorylated merlin is still
unable to significantly suppress growth. Thus it appears, that similarly to isoform I,
isoform Il is able to suppress growth and is active in growth suppression when cells are
contact-inhibited. Furthermore, a mutant in which the regulatory phosphorylation event
on Ser518 can not occur suppresses growth even further in confluent cells, but has no
effect on non-confluent cells in both isoforms, indicating that both merlin isoforms are
active as growth suppressors only on contact inhibited cells, and even a constituitively
67
Low density cultures
a.
0
08
C
0A
1.2
1.4
1.2
1
0.8
0.6
0.4
0.2
0
+
U.
b.
U.
0.8
0.6
0
0.4
0.2
0
0
0
10
7
14
17
21
--
control
0
C
days post infection
14
10
7
21
17
days post infection
C
NF2a S518A -*-Nf2a
"-
control
NF2b S518A
NF2b
High density cultures
d.
C.
L
1.4
1.2
aL
0
4.
1.41.2
0.8-
C
0.8
0.6-
0
C
0.4
0.2
0.2
0
0
0
--
7
14
days post Infection
Nf2a 8518A
control -*-Nf2a
21
0
14
7
21
days post infection
C
-4-control
NF2b
-
NF2b s518A
Figure 3: Both merlin Isoforms regulate cell growth through a contact-dependent
mechanism
a. NMuMG cells infected with GFP +NF2a, NF2a $518 phosphorylation mutant, or a GFP+
control were maintained at low density and proliferation of merlin-expressing cells was measured
by analyzing retention of GFP+ cells in the culture, normalized to the starting point.n=2
b. NMuMG cells infected with GFP +NF2b, NF2b S518 phosphorylation mutant, or a GFP+
control were maintained at low density and proliferation of merlin-expressing cells was measured
by analyzing retention of GFP+ cells in the culture, normalized to the starting point.n=2
c.NMuMG cells infected with GFP +NF2a, NF2a S518 phosphorylation mutant, or a GFP+
control were maintained at high density and proliferation of merlin-expressing cells was
measured by analyzing retention of GFP+ cells in the culture, normalized to the starting point.n=2
d.NMuMG cells infected with GFP +NF2b, NF2b S518 phosphorylation mutant, or a GFP+
control were maintained at high density and proliferation of merlin-expressing cells was
measured by analyzing retention of GFP+ cells in the culture, normalized to the starting point.n=2
68
active form will not significantly suppress growth of non-confluent cells.
4. Isoform I and isoform 11 are differentially regulated and differ in stability in
culture
As seen from these results, both isoforms of merlin are able to suppress growth and this
suppression of growth relies on contact inhibition and can be regulated through
phosphorylation of S518. However, in both NMuMG cells and in MDA-MB-231 cells, we
observed that phosphorylation of S518 was reduced in isoform B (Figure 1 b and 1 c).
This indicated that there could be a difference between the two isoforms in upstream
regulation through phosphorylation.
Merlin is subject to multiple post-translational modifications. In addition to a PAK-driven
phosphorylation on S518, merlin is phosphorylated on additional serine and threonine
residues by both PKA and Akt (12) and these phosphorylation sites are present in both
merlin isoforms (Figure 1a).
Merlin isoform I (NF2a) expressed in NMuMG cells migrates on SDS-PAGE as a
doublet. This doublet has been interpreted previously (10) to indicate that the slower
migrating band is a hyperphosphorylated form of merlin and, indeed, immunoblotting
with an antibody that recognizes phosphorylated S518 detects this band (Figure 1b).
However, in NMuMG cells expressing isoform II (NF2b) merlin does not migrate as a
doublet, but only as the hypophosphorylated form even though it does show some
phosphorylation on serine 518. Similarly, in MDA-MB-231 cells, isoform I does not
migrate as a doublet, but only as the hyperphosphorylated slower migrating band,
(Figure 1c), while isoform I migrates exclusively as the faster migrating band, showing
significantly less Ser518 phosphorylation when immunoblotted with the phospho-specific
antibody. As a major regulatory event that determines merlin activity, the fact that
isoform II is less prone to phosphorylation indicates that isoform 11 could not only be an
active form of merlin, but have increased activity over isoform I depending on the
69
context.
Meso428 cells did not show a difference in S518 phosphorylation (Figure 1d), further
indicating that cellular context could play a role in determining the differences in
regulation between the isoforms. However, when Meso428 mesothelioma cells
expressing both major merlin isoforms were plated for a proliferation experiment, both
isoform I and isoform 11 showed high levels of the slower migrating hyperphosphorylated
band, with isoform I migrating almost exclusively as the slower band while isoform 11
appeared as a doublet (Figure 4a, day 3 lysates). By day 12 the lysates showed a loss
of isoform I (Figure 4a, day 12 lysates) and, along with that loss, the cells expressing
isoform I continued to proliferate despite reaching confluence. This indicated a difference
in protein stability in culture between isoform I and isoform II, even in a case where both
isoforms showed initially similar levels of inhibitory phosphorylation.
MDA-MB-231 cells, which show differential phosphorylation between the two isoforms
(Figure 1c) showed a similar lack of similar lack of stability for isoform I as seen in the
mesothelioma cell lines. In a lysate collected shortly after infection of MDA-MB-231 cells
with the MSCV-based expression vectors of either isoform I or isoform II, isoform I is
present in the lysate almost completely in the slower migrating (i.e. phosohorylated)
form, while isoform 11 is present in the faster migrating form (Figure 4b, left). In a lysate
collected from cells cultured for several weeks post-infection, isoform I is completely lost
from the culture while isoform II is still present (Figure 4b, right).
There is precedence for differential phosphorylation of isoforms I and II. Tang et al., (12)
show that isoform I is phosphorylated by Akt on residues T230 and S315.
Furthermore, they show that this phosphorylation leads to merlin ubiquitination and
degradation. In a pull down experiment to establish that Akt binds merlin directly, Akt
binds the N-terminal fragment or C-terminal fragment of isoform I, indicating that Akt acts
upon the "open" form of merlin. However, Akt only weakly binds the C-terminal fragment
70
a.
control
10
NF2a
NF2b
i
Merlin
T
8.6E0
-4 -control
.8
E
2
S--NF2a
,
S0..
5 10
15
12
'U
AGAPH
-*-NF2a
NF2b
NF2b
20
control
Merlin
0
days post plating (confluent at day
10)
U)
GAIPDH
b.
Day 12 lysates
Day 3 lysates
Merlin
GAPDH
C.
+ CIP
-CIP
z
z
z
0l
r
O
z
0r
a
___
-
pS518
Merlin
GAPDH
Figure 4: Isoform I and isoform 11 of merlin differ in stability in culture
a. Left: Proliferation curve of mesothelioma Meso428 cells in culture. Cells reached confluence
at day 10. Right: Western blots of mesothelioma cell lines corresponding to proliferation at
early vs. late time points. Isoform I is lost at the later time point, which corresponds with a loss
of growth suppression.
b. Western blot of early culture vs. late culture MDA-MB-231 lysates.
c. Meso428 lysates expressing isoform I or isoform II were treated with CIP or control, and
immunoblotted for pS518 and merlin.
71
of isoform II. Since this modification leads ultimately to merlin degradation, this could
explain how phosphorylation of isoform I, but not isoform II, on S518 might lead to
increased accessibility of isoform I to further Akt phosphorylation, resulting in
ubiquitination and degradation. This might explain both the results from the NMuMG and
MDA-MB-231 cells, and the mesothelioma cells. In mammary epithelial or carcinoma
cells, isoform I is phosphorylated on Ser518, leading to additional phosphorylation
events and a gel shift to the hyperphosphorylated position. Isoform II, however,
experiences less phosphorylation on Ser518 and therefore is not a target for additional
phosphorylation events and therefore runs in the hypophosphorylated position on an
SDS-PAGE gel. In mesothelioma cells, both isoforms are phosphorylated on Ser518.
However, isoform 11 might be protected from additional phosphorylation, ubiquitination,
and ultimate degradation due to decreased accessibility to the phosphorylation sites
even when phosphorylated on S518. This protection could lead to increased stability of
isoform 11 in culture. To investigate whether there was decreased accessibility to the
Ser518 site on isoform II, compared to isoform I, Meso428 lysates expressing a
hyperphosphorylated isoform I and isoform II were treated with calf intestinal protease
(CIP). CIP treatment led to elimination of the pS518-recognized bands in isoform I, but
not in isoform II (Figure 4c). This could explain how despite being hyperphosphorylated,
isoform 11 is protected from further modifications and is not able to be ubiquitinated and
degraded, leading to a persistence of isoform II in culture when compared to isoform 1.
Surprisingly, in the non-CIP treated sample we noted that both the slower and faster
migrating bands of isoform I were recognized by the pS518 antibody, which could
indicate that phosphorylation of S518 alone does not lead to the slower migrating band,
but rather additional phosphorylation events or other post-translational modifications
lead to the hyperphosphorylated state indicated by the slower migrating band.
72
Discussion
Merlin has been studied extensively due to its role in human disease, yet some
confusion remains in the field regarding the regulation of merlin. Initially discovered to
have a high homology to the ERM proteins ezrin, radixin and moesin (13), merlin was
assumed to have a conformational regulation similar to the canonical model introduced
for the ERM proteins (14), where the protein can be activated or inactivated through a
phosphorylation event that induces conformational change. The conformational change
described for ERM proteins involves a switch between a "closed" conformation,
mediated by an intramolecular interaction between the FERM domain and the C-terminal
domain of the protein, and, following phosphorylation, loss of this intramolecular
interaction and acquisition of an "open" conformation. In the context of ERM proteins this
phosphorylation and switch to an open conformation leads to activation of the protein,
since the open conformation allows multiple intermolecular interactions at the
membrane-cytoskeleton interface. In merlin it had long been thought that the open
conformation was an inactive conformation, since phosphorylation of merlin proved to
lead to an inability of merlin to suppress growth and it was posited that, similar to the
canonical ERM proteins for which merlin was named, phosphorylation led to an open
conformation (2). However, recent studies (8) show that, in the case of merlin, this is not
as clear cut. The unique C-terminal of merlin is able to fit in a groove of the N-terminal
FERM-domain when merlin is phosphorylated (15), leading to a closed conformation
despite phosphorylation. Furthermore, the switch between an "open" and "closed"
conformation in merlin appears to be much more fluid.
When merlin was described and characterized, it was noted that it could be found as one
of two major isoforms, products of alternative splicing. Due to decreased intramolecular
interaction in isoform II, and a reported failure of isoform 11 to mediate growth inhibition in
73
vivo or in vitro (2)or to impair cell migration (16) in rat schwanomma cells it was
generally assumed that isoform 11 was unable to act as a tumor suppressor. We have
shown that isoform 11 is able to suppress growth, and similarly to isoform I, to suppress
growth in the context of contact inhibition. Only when cells were maintained at a
confluent level was isoform I able to suppress growth.
Phosphorylation of merlin on serine 518 has been described as inhibitory (4) and,
following this phosphorylation, merlin is more susceptible to additional phosphorylation
events (12) which leads to eventual ubiquitination and degradation (Okada 2009).
Hyperphosphorylation leads to an increase in intramolecular associations between the
N-terminal domain (NTD) and the C-terminal domain (CTD), and isoform I is more likely
to be found in a closed conformation when phosphorylated, whereas isoform II is found
in an open conformation more frequently, whether phosphorylated or not (8). When
serine 518 is mutated to an alanine, both isoforms I and 11 exhibit increased suppression
of growth, indicating that isoform 11 can be regulated through phosphorylation in a
manner similar to isoform 1. However, both NMuMG and MDA-MB-231 cell lysates show
a difference between isoform I and isoform II in migration on SDS-PAGE. While isoform I
migrates as a doublet with a slower band indicating hyperphosphorylation (10), isoform II
migrates as a faster band, level with the bands from lysates of cells expressing phosphomutant forms of merlin. This suggests that there could be differential regulation between
the isoforms despite the fact that both can be inhibited by phosphorylation on S518. In
MDA-MB-231 cells and in mesothelioma cells, isoform I was lost in culture over time; in
mesothelioma cells this occurred along with a resumption of cell growth that coincided
with loss of merlin. Isoform II was maintained in culture although the majority was
present as the hyperphosphorylated slower migrating band. When lysates of
mesothelioma cells were treated with CIP, the upper bands on the immunoblot of merlin
74
were reduced, and those recognized by an antibody specific for S518 disappeared, but
only for isoform 1. In the case of isoform 11 the phosphorylated band remained despite
treatment with CIP. A possible explanation for this difference between the isoforms could
be that the conformation of isoform 11 C-terminal domain protects the phosphorylated
residues from phosphatase treatment.
Tang et al. addressed the phosphorylation of merlin by Akt, and showed that both merlin
isoforms, when expressed as full-length proteins, were unable to bind Akt. However, the
N-terminal domain (NTD, which is shared between the isoforms) and the C-terminal
domain (CTD) of isoform I were able to bind Akt in a pull-down assay. The CTD of
isoform 11 was unable to pull down Akt. Since phosphorylation by Akt is followed by
ubiquitination and degradation, this could explain a mechanism where differential
phosphorylation of the isoforms by Akt can lead to differences in protein stability
between the isoforms. The inaccessibility of the isoform 11 CTD to phosphatase
treatment could also explain its inaccessibility to Akt, and to subsequent phosphorylation
events, ubiquitination and degradation, explaining how isoform II is maintained in cells
longer than isoform I, despite being phosphorylated on S518. In order to examine this
hypothesis additional experiments are needed. Initially, it remains to be seen whether
isoform I can be phosphorylated on residue S315 by Akt, using the anti-phospho S315
antibody developed by Tang et al. In addition, lysates from cells expressing isoform I or
I at time points post infection with the merlin expressing vector can be used to examine
the change in merlin protein levels over time. Merlin phosphorylation and ubiquitination
levels could also be assayed to determine whether there is an increase in ubiquitination
in isoform I concomitant with an increase in phosphorylation, that is not present in
isoform II. Finally, treatment with an Akt inhibitor or mutating the Akt target serine 315
should allow for persistence of isoform I in culture in a manner similar to isoform 11.
75
In summary, both of the major merlin isoforms are able to suppress growth in multiple
cell lines. Both of the isoforms are dependent on contact inhibition in order to suppress
growth, and can be regulated through an inhibitory phosphorylation on S518. However,
isoform I is able to persist in culture longer than isoform I, despite being
hyperphosphorylated in some contexts although not in others and depending on cell
type. This indicates a differential regulation between the isoforms that might be related to
accessibility of the isoforms to Akt phosphorylation and subsequent ubiquitination and
degradation.
References
1.
Bianchi AB, Hara T, Ramesh V, et al. Mutations in transcript isoforms of the
neurofibromatosis 2 gene in multiple human tumour types. Nat Genet 1994;6:185-92.
2.
Sherman L, Xu HM, Geist RT, et al. Interdomain binding mediates tumor growth
suppression by the NF2 gene product. Oncogene 1997;15:2505-9.
3.
Shaw RJ, Paez JG, Curto M, et al. The Nf2 tumor suppressor, merlin, functions
in Rac-dependent signaling. Dev Cell 2001;1:63-72.
4.
Kissil JL, Johnson KC, Eckman MS, Jacks T. Merlin phosphorylation by p21-
activated kinase 2 and effects of phosphorylation on merlin localization. J Biol Chem
2002;277:10394-9.
5.
Alfthan K, Heiska L, Gronholm M, Renkema GH, Carpen 0. Cyclic AMP-
dependent protein kinase phosphorylates merlin at serine 518 independently of p21activated kinase and promotes merlin-ezrin heterodimerization. J Biol Chem
2004;279:18559-66.
76
6.
Okada T, Lopez-Lago M, Giancotti FG. Merlin/NF-2 mediates contact inhibition of
growth by suppressing recruitment of Rac to the plasma membrane. J Cell Biol
2005;171:361-71.
7.
Rong R, Surace El, Haipek CA, Gutmann DH, Ye K. Serine 518 phosphorylation
modulates merlin intramolecular association and binding to critical effectors important for
NF2 growth suppression. Oncogene 2004;23:8447-54.
8.
Sher I, Hanemann CO, Karplus PA, Bretscher A. The tumor suppressor merlin
controls growth in its open state, and phosphorylation converts it to a less-active moreclosed state. Dev Cell 2012;22:703-5.
9.
Surace El, Haipek CA, Gutmann DH. Effect of merlin phosphorylation on
neurofibromatosis 2 (NF2) gene function. Oncogene 2004;23:580-7.
10.
Shaw RJ, McClatchey Al, Jacks T. Regulation of the neurofibromatosis type 2
tumor suppressor protein, merlin, by adhesion and growth arrest stimuli. J Biol Chem
1998;273:7757-64.
11.
Bianchi AB, Mitsunaga SI, Cheng JQ, et al. High frequency of inactivating
mutations in the neurofibromatosis type 2 gene (NF2) in primary malignant
mesotheliomas. Proc Natl Acad Sci U S A 1995;92:10854-8.
12.
Tang X, Jang SW, Wang X, et al. Akt phosphorylation regulates the tumour-
suppressor merlin through ubiquitination and degradation. Nat Cell Biol 2007;9:1199207.
13.
Bretscher A, Chambers D, Nguyen R, Reczek D. ERM-Merlin and EBP50 protein
families in plasma membrane organization and function. Annu Rev Cell Dev Biol
2000;16:113-43.
14.
Gary R, Bretscher A. Ezrin self-association involves binding of an N-terminal
domain to a normally masked C-terminal domain that includes the F-actin binding site.
Mol Biol Cell 1995;6:1061-75.
77
15.
Li Y, Wei Z, Zhang J, Yang Z, Zhang M. Structural basis of the binding of Merlin
FERM domain to the E3 ubiquitin ligase substrate adaptor DCAF1. J Biol Chem
2014;289:14674-81.
16.
Gutmann DH, Sherman L, Seftor L, Haipek C, Hoang Lu K, Hendrix M. Increased
expression of the NF2 tumor suppressor gene product, merlin, impairs cell motility,
adhesionand spreading. Hum Mol Genet 1999;8:267-75.
78
Chapter 4. Merlin regulation of YAP
Introduction
Yes-associated protein (YAP) and its close paralog, TAZ (WWTR1), are transcriptional
co-activators that mediate expression of proliferation and anti-apoptotic genes through
interaction with TEAD transcription factors (1).
YAP and TAZ can be regulated by multiple upstream inputs, including extracellular
factors (2), cell-cell adhesions (3), and mechanotransduction (4). Since YAP/TAZ are
homologs of the Drosophila transcription factor Yki, much of the original research into
the regulation of YAP/TAZ focused on the canonical Hippo pathway (Figure 1), which
regulates Yki/YAP/TAZ as described in flies (5), and conserved in mammals. The
serine-threonine kinase Hippo (MST1/2 in mammals) phosphorylates Warts (Lats1/2 in
mammals)(6) which in turn phosphorylates Yki, promoting cytoplasmic sequestration of
Yki and preventing transcription mediated by the interaction of Yki with the TEAD
transcription factor family member, Scalloped (7). In Drosophila, the FERM-domain
protein Merlin (NF2) links the Hippo kinase cascade to signals from the cell membrane
(8). However, the role of merlin regulation of YAP in mammals is not as clear-cut.
Many of the studies involving mammalian regulation of YAP by merlin focus on the
function of these proteins in the liver. YAP-deficient livers show impaired function and
bile-duct deficiencies (9), while Merlin-deficient livers show corresponding bile-duct
hamartomas and hepatocellular carcinomas in older mice (9) and hyperplasia of
undifferentiated liver progenitors, termed oval cells, in younger mice (10). However,
whether the YAP-deficient liver phenotype is a direct result of merlin activity is unclear.
79
-eli
4ail
Adherens junctions
Proteasomal
degradation
NUCLEUS
Cytoplasmic equestration
Figure 1: The canonical Hippo pathway and possible
avenues for regulation by merlin
80
Zhang et al. (9) showed that heterozygous deletion of YAP was able to suppress the
merlin-deficient overgrowth phenotype. However, considering merlin's multiple roles and
mechanisms in suppressing cell growth, merlin might only be indirectly involved in YAP
regulation through the Hippo pathway in the liver, as merlin is also able to control liver
growth through its role in controlling EGFR signaling (10). Complicating these results is
the fact that crosstalk exists between EGFR signaling and YAP activity, both through
upstream regulation of YAP by EGFR via regulation of MST2 (11) or Lats (12) and
downstream since the EGFR ligand AREG is a transcriptional target of YAP (13).
Aside from its role in the developing liver, the question of how merlin might regulate YAP
in mammals has also been investigated in mesothelioma. Merlin is frequently mutated in
mesothelioma (14) and this tumor model has also shown high-copy amplification of
YAP(1 5). Furthermore, transfection of a merlin-null mesothelioma cell line with merlin
and YAP showed that merlin was able to relocate YAP from the nucleus to the
cytoplasm, and showed an increase of Lats-phosphorylation of YAP on serine 127 (15).
Since our lab had been studying the role of YAP in metastasis (16) and the role of FERM
domain proteins in metastasis, we decided to investigate further how the two major
merlin isoforms, described in the previous chapter, might regulate YAP, and decided to
focus on merlin regulation of YAP in the context of mesothelioma.
Results
1. Merlin expression decreases nuclear localization of YAP in mesothelioma cells
In order to determine whether merlin expression was able to regulate YAP, we first
investigated nuclear localization of YAP following expression of merlin. YAP promotes
81
a.
100%
80%
.860%
80
cytoplasmic
40%
Unuclear
20%
control
NF2a
0%
control
NF2a
b.
100%
80%
cytoplasmic
Unuclear
60%
40%
20%
ML
0%
NF2a
control
control
NF2a
C.
nuclear
cytoplasmic
Figure 2: Merlin expression decreases nuclear localization of YAP
a. Meso59 cells stably expressing merlin or a control were fixed at confluency and stained for
YAR On the left, a representative image is shown. On the right, the bar graph illustrates a
quantification of YAP nuclear localization. (n=8 fields, in a total of 2 separate experiments)
b. Meso59 cells stably expressing merlin or a control were infected with a retroviral WT YAP
construct, fixed at confluency and stained for YAR (n=8 fields in a total of 2 separate
experiments)
c. Image depicts how cells were scored and quantified in the above experiments for nuclear or
mostly nuclear YAP compared to cytoplasmic YAP.
Astrisks denote significance at <0.05(*), <0.01 (**), and <0.001(***)
82
growth through nuclear localization, where it acts as a transcriptional co-activator. We
acquired two merlin-null mesothelioma cell lines, Meso59 and Meso428 (a kind gift from
Dr. Jonathan Fletcher) for these experiments. In confluent merlin-null mesothelioma
cells, YAP localized to the nucleus, however, upon expression of merlin, YAP localized
predominantly to the cytoplasm (Figure 2a). Furthermore, when wild-type YAP was
overexpressed in these mesothelioma cells, merlin expression was still able to relocate
YAP to the cytoplasm (Figure 2b).
2. Merlin expression decreases TEAD reporter activity
Next, we wanted to determine whether YAP relocalization to the cytoplasm following
merlin expression also reflected a decrease in YAP transcriptional activity. To do this we
used a YAP/TAZ-responsive luciferase reporter (Mahoney et al. 2005) to directly assess
YAP/TAZ transcriptional activity (see illustration, Figure 3a, left). In Meso59
mesothelioma cells stably expressing either merlin or a control vector, and transiently
transfected with the reporter, we saw a significant decrease in reporter activity following
expression of either of the two major merlin isoforms (Figure 3a). These results were
corroborated with an additional merlin-null mesothelioma cell line, Meso428. Again,
mesothelioma cells stably expressing the two major merlin isoforms were transiently
transfected with the reporter and expression of either merlin isoform showed a decrease
in TEAD reporter activity. Furthermore, this decrease in TEAD activity was not
associated with an increase in an inhibitory phosphorylation of YAP on the major Lats
target serine 127 (Figure 3b).
In order to determine whether merlin expression was able to regulate YAP in additional
non-mesothelioma contexts we examined the impact of merlin expression on HMLER
cells, a ras-immortalized human mammary epithelial cell line which has very low levels
83
Meso59
1.2
a.
1
..
-
0.8
0.60.4
0
-
-
se
luci
-
o0.2
02-
control
Nf2b
Nf2a
Meso428
b.
6
0 E 0.4
pYAP S127
1
S0.2
YAP
U
Nf2a
control
Nf2b
contrwl
C.
0.25
HMLER
'
_
4
HMLE
GAPDH
3
0.15
0.1
0*
0.05
OhRNA2
Merlin
***
0.2
8
d.
SMNAI
2.
1
1
n
control
Nf2a
Nf2b
0
control
shRNAI
shRNA2
Figure 3: Merlin expression decreases TEAD reporter activity
a. Expression of either major merlin isoform in Meso59 cells decreases TEAD reporter activity.
The illustration depicts the TEAD reporter vector used in these experiments.
For NF2a n=20, for NF2b n=6.
Astrisks denote significance at <0.05 (*), <0.01 (**), and <0.001 (***)
b. Expression of either major merlin isoform in Meso428 cells decreases TEAD reporter activity
(n=1 0) but with no change in YAP phosphorylation on the LATS target S1 27 when
immunoblotted for pYAp S127.
c. Expression of merlin in HMLER cells decreases TEAD reporter activity. Cells were infected
with a retroviral vector expressing Merlin-IRES-GFP or a GFP alone control and sorted for
GFP-positive cells. (n=4)
d. Knockdown of merlin in HMLE cells increases TEAD reporter activity (n=4, two separate
hairpins tested, labeled shRNA1 and shRNA2, inset shows Western depicting knockdown)
84
of endogenous merlin. Expression of either merlin isoform in HMLER cells significantly
decreased YAP activity as measure by our TEAD reporter assay (Figure 3c). Next we
knocked down merlin in the HMLE cell line, a human mammary epithelial cell line which
expresses merlin; when merlin was knocked down in HMLE cells, there was a
concomitant increase in YAP/TAZ transcriptional activity compared to the merlinexpressing control (Figure 3d).
In summary, merlin expression in multiple cell lines decreases YAP nuclear localization
and transcriptional activity, however it does not affect the levels of Hippo-pathway
mediated phosphorylation of YAP.
3. Merlin can regulate a LATS-insensitive YAP mutant
In Drosophila, merlin has been implicated as an upstream regulator of the Hippo
pathway. However, when merlin was expressed in mesothelioma cells, there was no
increase in phosphorylation of the major Lats phosphorylation site, serine 127 (Figure
3b). This suggests that merlin may be regulating YAP in a Hippo-pathway-independent
manner. To determine whether Lats phosphorylation was necessary for merlin regulation
of YAP we established Meso59 mesothelioma cells which stably expressed a mutant
form of YAP in which either one or two major Lats phosphorylation sites, S127 and
S381, had been mutated to alanines, along with merlin or an empty vector control.
Surprisingly, even when YAP is not regulated by the Hippo pathway through the two
canonical Lats phosphorylation sites, merlin is still able to suppress YAP activity, as
indicated by a decrease in YAP/TAZ reporter activity (Figure 4a). Furthermore, in
confluent Meso59 cells stably expressing both merlin and a Lats-insensitive mutant form
of YAP, YAP is localized primarily in the cytoplasm, suggesting that merlin promotes
cytoplasmic localization of YAP independent of LATS phosphorylation on S127 and
S381 of YAP (Figure 4b).
85
5
-
a.
0
6
(U
a0
I
4-
'I-
control
I
T
*NF2a
0
NF2b
I
C
0
-1r-
control
YAP S127A;S381A
YAP S127A
YAP
b.
**
100%
80%
.1 60%'
I
cytoplasmic
40%'
*nuclear
0%
-
20%'
control
NF2a
Figure 4: Merlin expression decreases TEAD reporter activity and YAP nuclear localization
in presence of LATS-Insensitive YAP
a. Merlin expression decreases TEAD reporter activity in Meso59 cells expressing either WT YAP,
a YAP S127A mutant or a YAP S127A;S381A mutant. (For isoform a n=6, for isoform b n=4
except in YAP SI 27A mutant where n=2.)
Astrisks denote significance at <0.05 (*), <0.01 (**), and <0.001 (***)
b. Merlin expression decreases YAP nuclear localization in Meso59 cells expressing a
YAP S127A;S381A mutant. On the left, a representative image. On the right, quantification of
immunofluorescently stained YAP in confluent mesothelioma cells.
(n=8 fields from 2 separate experiments)
86
4. Hippo-pathway-independent regulation of YAP by merlin requires the WW
domains of YAP
In the canonical model of YAP regulation described in Drosophila and homologous in
mammals, a kinase cascade leads to YAP phosphorylation by LATS, which in turn leads
to YAP cytoplasmic sequestration and degradation. In mammals, however, there are
additional regulatory arms controlling YAP that do not involve the canonical Hippo kinase
cascade. In addition to mechanotransduction being able to determine YAP localization in
a Hippo-independent manner (4), YAP/TAZ can be sequestered in the cytoplasm either
in a complex with P-catenin (17) or in a complex with Angiomotin-like 2(AMOTL2) (18),
without LATS phosphorylation being necessary for this cytoplasmic sequestration;
instead, the YAP WW domains interact with the AMOTL2 PPxY motif. In order to
investigate whether the WW domains of YAP are necessary for suppression of YAP
activity by merlin, we generated a YAP mutant in which the tryptophans in both of the
YAP WW domains were mutated to phenylalanines, as described in (19). When Meso59
cells stably expressing merlin or a control were infected with wild-type YAP or a LATSinsensitive YAP mutant, YAP/TAZ reporter activity decreased, as described previously
(Figure 4). However, cells expressing wild-type YAP or LATS-insensitive YAP with
mutated WW domains maintained high YAP/TAZ transcriptional activity when merlin was
expressed (Figure 5a), suggesting that mutation of the YAP WW domain renders it
insensitive to merlin.
Furthermore, mRNA levels of a YAP/TAZ target gene, CTGF, were significantly
decreased by merlin expression in Meso59 cells expressing wild-type YAP or LATSinsensitive YAP mutants
(YAPS127A
or YAPS127A;S 3 8 1 A), but not in cells expressing the same
constructs with mutated WW domains. This suggests that merlin is unable to suppress
YAP activity when YAP WW domains are mutated (Figure 5b). These experiments
establish a function for merlin in inhibiting YAP/TEAD-mediated transcription that does
87
a.
-
12
0
OA
(U
10
-
T i
8-
* control
6.
,
* Nf2a
0
4-
C
2
0
YAP SUA YAP s127A;s381A YAP
YAP
control
YAP SUTA
YAP 5127A;83a1A
WWI+2
b.
3.5
I~
3
I
2.5
U.
2
0
* control
1.5
*Nf2a
1
z
0.5
0
k
control
YAP
YAP
S127A yAp S127A:S:31A
YAP
YAP
S127A
YAP
SI
i.S381A
WW1+2
Figure 5: The YAP WW domains are required for merlin regulation of YAP
a. Merlin expression is unable to regulate TEAD reporter activity in Meso59 cells expressing
YAP with mutated WW domains.(n=7)
Astrisks denote significance at <0.05 (*), <0.01 (**), and <0.001 (***)
b.Merlin expression is unable to regulate the YAP target gene CTGF expression in Meso 59
cells expressing YAP with mutated WW domains. (n=2)
88
NF2a
control
100%
80%
e 60%
4rcytoplasmic
nuclear
40%
20%
0%
control
NF2a
Figure 6: The YAP WW domains are required for YAP cytoplasmic relocation by merlin
Above, representative images of Meso59 cells expressing WW-mutant YAP and merlin
or an empty vector control. Below, quantification of nuclear localization.
(n=8 fields, from a total of 2 separate experiments)
89
not require Hippo pathway signaling but relies instead on direct interactions of merlin
with the WW domains of YAP.
Note, however, that merlin is still able to suppress the activity of wild type (LATSsensitive) YAP with mutated WW domains, presumably through merlin's ability to
stabilize LATS at the plasma membrane and activate the canonical Hippo pathway (20).
Therefore, merlin has at least two independent mechanisms to regulate YAP/TEAD
transcription, one LATS-independent and one dependent on LATS-mediated
phosphorylation of YAP.
Finally, as shown previously, merlin expression can lead to cytoplasmic localization of
YAP, including LATS-insensitive YAP mutants. However, in confluent Meso59 cells
expressing merlin and a LATS-insensitive, WW domain-mutated form of YAP, merlin is
no longer able to mediate cytoplasmic localization of YAP, and the majority of YAP is
found in the nucleus as shown through immunofluorescence imaging (Figure 6).
To determine whether merlin's suppression of YAP nuclear localization and activity, as
evidenced through a decrease in reporter activity and CTGF expression, was able inhibit
cell growth, we measured mesothelioma cell proliferation over time using a standard
assay in which cell numbers were counted over time post-plating. As expected, merlin
expression in mesothelioma cells resulted in a decrease in cell proliferation over time
(Figure 7a). This decrease was also seen when mesothelioma cells were infected with
wild-type YAP vector (Figure 7b) or with a LATS-insensitive YAP vector (Figure 7c).
However, merlin expression was not able to decrease proliferation of mesothelioma cells
infected with a LATS-insensitive YAP vector in which the WW domains were mutated
(Figure 6d). This is further evidence that Hippo-independent regulation of YAP by merlin
requires the WW domains of YAP in order to mediate suppression of YAP activity.
90
b.
10
-
a.
0
8
I
0
0
-4-control
6
+*NF2a
+*-control
4
+0NF2a
2
0
2
0
10
8
4
days post plating
12
6
2
0
12
10
8
days post plating
d.
C.
20
12
0D
0
0
**
10
15
8
0
0
0
10
6
-e-control
-4-control
4
-+-NF2a
2
0
5
0
0
2
6
8
10
days post plating
12
-+-NF2a
W0000
0
2
6
8
10
12
days post plating
Figure 7: Merlin expression decreases proliferation of mesothelioma cells in presence of
YAP, but not YAP WW domain mutants
Astrisks denote significance at <0.05 (*), <0.01 (**), and <0.001 (***)
a. Cell growth of Meso59 cells expressing Merlin or a control vector, n=4
b. Cell growth of Meso59 cells expressing Merlin or a control vector and wild type YAP, n=4
c. Cell growth of Meso59 cells expressing Merlin or a control vector and YAP with mutated
Lats target serines S127 and S381, n=4
d. Cell growth of Meso59 cells expressing Merlin or a control vector and YAP with mutated
Lats target serines S127 and S381
and mutated WW domains, n=4
91
5. Merlin binding of YAP requires the WW domains of YAP
We next wanted to determine whether merlin regulation of YAP stemmed from a
physical interaction between merlin and YAP. We expressed a FLAG-tagged version of
either of the two major merlin isoforms in Meso59 cells (Figure 8a) and were able to
immunoprecipitate endogenous YAP from the lysate of confluent cells using an antiFLAG antibody. In a reciprocal experiment, endogenous merlin was immunoprecipitated
from 293 cells expressing FLAG-tagged YAP or YAP mutants using an anti-FLAG
antibody. However, FLAG-tagged YAP with mutated WW domains was unable to pull
down endogenous merlin in 293 cells (Figure 8b). These results indicate the merlin is
able to bind to YAP, and that this interaction requires the WW domain of YAP. However,
this results do not prove that this interaction is necessarily a direct interaction, and
whether other proteins associate with merlin and YAP and are required for this
interaction to take place remains to be seen.
92
a. Total cell lysate
00
IP FLAG
4 ,
0.
0?
0.-
YAP
FLAG Merlin
J4,~
b.
%2~
4
IP FLAG
04,
~
1;
i
0
00'/
Merlin
YAP
Total cell
lysate
Figure 8: Merlin binds YAP and requires WW domains
a. Immunoprecipitation of FLAG-tagged merlin isoforms can pull down endogenous YAP in
Meso59 cells expressing FLAG-tagged merlin.
b. Immunoprecipitation of FLAG-tagged YAP can pull down merlin, but YAP WW mutants are
unable to pull down endogenous merlin in 293 cells expressing YAP or YAP mutants.
93
Discussion
Although many studies on YAP regulation have focused on the Hippo pathway, there
has recently been research indicating that there are other factors that come into play.
We initially focused on the role of merlin in regulating YAP due to its role in Drosophila,
considering the high homology between members of the Hippo pathway in flies and
mammals. Many mechanisms have been described to explain how merlin is able to
suppress growth in multiple cell types; however, a mechanism for merlin regulation of
YAP has not been shown. In these experiments we used a number of merlin-null
mesothelioma cell lines. Since mesothelioma is one of the human diseases which shows
a loss of merlin, and it has been previously implied that YAP may be regulated by merlin
in mesothelioma, we decided that mesothelioma cell lines would be a biologically
relevant context in which to investigate the possible functions of merlin and its role in
YAP regulation.
Merlin expression in mesothelioma cells led to a decrease in YAP activity as evidenced
proximally through reporter activity and target gene expression, and to a decrease YAP
nuclear localization, as well as a decrease in cell proliferation. Surprisingly, merlin was
able to suppress YAP activity even in the presence of a LATS-insensitive YAP.
However, it is important to note that this LATS-insensitive YAP is only mutated on the
two residues, S127 and S381, that have been most intensively investigated as targets of
LATS, with S127 showing the most dramatic increase in YAP activity when mutated (3).
It remains to be tested whether merlin can regulate a YAP in which all LATS target
residues are mutated. Furthermore, in order to answer completely the question of
whether merlin acts independently of the Hippo pathway when regulating YAP, these
experiments should be done in the context of LATS knockdown. Due to difficulty in
94
completely eliminating both LATS1 and LATS2 these experiments were not done, but
could possibly now be attempted following elimination of LATS1/2 expression through
Crispr-Cas9 genome editing.
The role of angiomotin and its family members, angiomotin-likel and angiomotin-like2, in
YAP regulation is still unclear, with literature describing these proteins as YAP inhibitors
(21, 22) or promoters (23) of YAP activity. However, one of the mechanisms described
involves a Hippo-independent mechanism of YAP regulation, in which angiomotin PPxY
motifs bind the WW domains of YAP and sequester it in the cytoplasm without requiring
prior YAP phosphorylation by LATS (18). This hints at the ability of YAP to be regulated
independently of the Hippo pathway. In Drosophila, Hippo-independent regulation of
Yki, the YAP homolog, is mediated by the FERM-domain protein Expanded in a similar
manner; PPxY motifs on Expanded can bind the Yki WW domain and sequester Yki in
the cytoplasm (24). The mammalian homolog of Expanded, FRMD6, lacks these PPxY
motifs, leaving open the question whether FERM-domain-mediated direct regulation of
YAP through the WW domains can occur in mammals. We attempted to address this by
showing that although merlin can suppress YAP activity, WW-mutated YAP is no longer
regulated by merlin. In addition, merlin can bind YAP in immunoprecipitation
experiments, but fails to bind a WW domain mutated YAP. An experiment that remains
to be done is to determine whether merlin binds YAP in the biologically relevant
mesothelioma cell lines and, furthermore, determine whether YAP can bind merlin
directly. Merlin does contain a PPxY motif and mutating this motif would be an initial step
in investigating the interaction between YAP and merlin. However, Yokoyama et al. (15)
suggest through direct binding in-vitro experiments that merlin does not bind YAP
directly, in which case the question remains which other proteins may be associated with
the complex and, angiomotin, which has been shown separately to bind merlin (25) and
95
YAP (18) remains a candidate for this interaction. It remains to be seen whether
angiomotin is pulled down in a complex with YAP and merlin. Another possible
candidate which has been shown to bind both merlin and YAP is a-catenin (26, 27)
which might also be involved.
In summary, merlin is able to regulate YAP in a manner which appears to be largely
Hippo-pathway independent. This regulation is dependent on a functional WW domain of
YAP. Merlin can bind YAP but requires the WW domain to do so. These results indicate
that merlin might be able to regulate YAP through binding the WW domains, whether
directly or with an intermediate, and might be a mechanistic link between FERM
domains and YAP in mammals.
References
1.
Hong W, Guan KL. The YAP and TAZ transcription co-activators: key
downstream effectors of the mammalian Hippo pathway. Semin Cell Dev Biol;23:785-93.
2.
Yu FX, Zhao B, Panupinthu N, et al. Regulation of the Hippo-YAP pathway by G-
protein-coupled receptor signaling. Cell 2012; 150:780-91.
3.
Zhao B, Wei X, Li W, et al. Inactivation of YAP oncoprotein by the Hippo pathway
is involved in cell contact inhibition and tissue growth control. Genes Dev 2007;21:274761.
4.
Dupont S, Morsut L, Aragona M, et al. Role of YAP/TAZ in mechanotransduction.
Nature 2011;474:179-83.
96
5.
Huang J, Wu S, Barrera J, Matthews K, Pan D. The Hippo signaling pathway
coordinately regulates cell proliferation and apoptosis by inactivating Yorkie, the
Drosophila Homolog of YAP. Cell 2005;122:421-34.
6.
Wu S, Huang J, Dong J, Pan D. hippo encodes a Ste-20 family protein kinase
that restricts cell proliferation and promotes apoptosis in conjunction with salvador and
warts. Cell 2003; 114:445-56.
7.
Wu S, Liu Y, Zheng Y, Dong J, Pan D. The TEAD/TEF family protein Scalloped
mediates transcriptional output of the Hippo growth-regulatory pathway. Dev Cell
2008; 14:388-98.
8.
Hamaratoglu F, Willecke M, Kango-Singh M, et al. The tumour-suppressor genes
NF2/Merlin and Expanded act through Hippo signalling to regulate cell proliferation and
apoptosis. Nat Cell Biol 2006;8:27-36.
9.
Zhang N, Bai H, David KK, et al. The Merlin/NF2 tumor suppressor functions
through the YAP oncoprotein to regulate tissue homeostasis in mammals. Dev Cell
2010; 19:27-38.
10.
Benhamouche S, Curto M, Saotome 1, et al. Nf2/Merlin controls progenitor
homeostasis and tumorigenesis in the liver. Genes Dev 2010;24:1718-30.
11.
O'Neill E, Rushworth L, Baccarini M, Kolch W. Role of the kinase MST2 in
suppression of apoptosis by the proto-oncogene product Raf-1. Science 2004;306:226770.
12.
Reddy BV, Irvine KD. Regulation of Hippo signaling by EGFR-MAPK signaling
through Ajuba family proteins. Dev Cell;24:459-71.
13.
Zhang J, Ji JY, Yu M, et al. YAP-dependent induction of amphiregulin identifies a
non-cell-autonomous component of the Hippo pathway. Nat Cell Biol 2009;11: 1444-50.
14.
Sekido Y. Molecular biology of malignant mesothelioma. Environ Health Prev
Med 2008;13:65-70.
97
15.
Yokoyama T, Osada H, Murakami H, et al. YAP1 is involved in mesothelioma
development and negatively regulated by Merlin through phosphorylation.
Carcinogenesis 2008;29:2139-46.
16.
Lamar JM, Stern P, Liu H, Schindler JW, Jiang ZG, Hynes RO. The Hippo
pathway target, YAP, promotes metastasis through its TEAD-interaction domain. Proc
Natl Acad Sci U S A 2012;109:E2441-50.
17.
Azzolin L, Panciera T, Soligo S, et al. YAP/TAZ incorporation in the beta-catenin
destruction complex orchestrates the Wnt response. Cell 2014;158:157-70.
18.
Zhao B, Li L, Lu Q, et al. Angiomotin is a novel Hippo pathway component that
inhibits YAP oncoprotein. Genes Dev 2011;25:51-63.
19.
Zhao B, Kim J, Ye X, Lai ZC, Guan KL. Both TEAD-binding and WW domains
are required for the growth stimulation and oncogenic transformation activity of yesassociated protein. Cancer Res 2009;69:1089-98.
20.
Yin F, Yu J, Zheng Y, Chen Q, Zhang N, Pan D. Spatial organization of Hippo
signaling at the plasma membrane mediated by the tumor suppressor Merlin/NF2. Cell
2013;154:1342-55.
21.
Chan SW, Lim CJ, Chong YF, Pobbati AV, Huang C, Hong W. Hippo pathway-
independent restriction of TAZ and YAP by angiomotin. J Biol Chem 2011;286:7018-26.
22.
Wang W, Huang J, Chen J. Angiomotin-like proteins associate with and
negatively regulate YAP1. J Biol Chem 2011;286:4364-70.
23.
Yi C, Shen Z, Stemmer-Rachamimov A, et al. The p130 isoform of angiomotin is
required for Yap-mediated hepatic epithelial cell proliferation and tumorigenesis. Sci
Signal 2013;6:ra77.
24.
Badouel C, Gardano L, Amin N, et al. The FERM-domain protein Expanded
regulates Hippo pathway activity via direct interactions with the transcriptional activator
Yorkie. Dev Cell 2009;16:411-20.
98
25.
Yi C, Troutman S, Fera D, et al. A tight junction-associated Merlin-angiomotin
complex mediates Merlin's regulation of mitogenic signaling and tumor suppressive
functions. Cancer Cell 2011; 19:527-40.
26.
Gladden AB, Hebert AM, Schneeberger EE, McClatchey Al. The NF2 tumor
suppressor, Merlin, regulates epidermal development through the establishment of a
junctional polarity complex. Dev Cell; 19:727-39.
27.
Schlegelmilch K, Mohseni M, Kirak 0, et al. Yap1 acts downstream of alpha-
catenin to control epidermal proliferation. Cell;144:782-95.
99
Chapter 5. Discussion
The role of FERM domain proteins in tumorigenesis and metastasis
Although our study did not find any additional roles for ERM proteins in tumorigenesis
and metastasis using a murine mammary carcinoma model, this does not rule out a role
for these proteins in other tumor models. Indeed, the ERM proteins specifically and the
4.1 family of proteins in general have been shown to play roles in both metastasis and
tumorigenesis (reviewed in (1), and in (2)). The question still remains as to whether other
4.1 family proteins, which were not screened in these experiments, contribute to tumor
formation or metastasis. Using a more efficient system such as CRISPR-Cas9 to knock
out the proteins in question, while using an in vivo barcoded vector system such as the
one we developed to analyze the contribution of the knockdown or overexpressing cells
to the tumor or metastases in the tumor model could serve to address this question.
Choosing the appropriate model in which to screen these proteins remains difficult, since
expression levels vary in different tissues and it appears that, depending on the model
used, there can be redundancies. For example, although in vivo expression of the ERM
proteins is dependent on cell type, cells in culture express ezrin, radixin and moesin
simultaneously and redundantly, such that these proteins compensate for one another.
This could be the case for other 4.1 proteins as well.
Despite these difficulties, the 4.1 family of proteins remain interesting candidates for
future study of metastasis due to their roles in maintaining cell-cell contacts, determining
cell polarity, and organizing the cell cortex, all necessary in preventing metastasis.
100
Suppression of cell growth by both major merlin isoforms
While investigating the role of ERM proteins in tumorigenesis and metastasis, I became
interested in merlin, a FERM-domain-containing tumor suppressor that has been
extensively studied and well characterized. Merlin was originally considered to be
regulated in a manner similar to its close homologs, the ERM proteins, through
intramolecular associations that determine whether it is in a closed or open
conformation, and this was thought to govern merlin's activity. Since isoform 11 had been
shown to be unable to achieve the closed conformation (3) and the closed conformation
had been shown to regulate growth (reviewed by (4)) it was assumed that isoform 11 was
an inactive form of merlin. As recent literature suggested that the conformational switch
was more fluid and that the closed form of merlin was not required for merlin activity (5),
I questioned whether isoform 11 was able to suppress cell growth, and whether it was
regulated similarly to isoform I. I have shown conclusively that isoform II indeed does
suppress cell growth. Furthermore, isoform I experiences differential phosphorylation
when compared with isoform I in a number of cell lines. The inhibitory phosphorylation
on Ser518 is decreased in isoform II when compared to isoform I under similar culture
conditions, and isoform 11 is more stable in culture than isoform 1. This indicates that the
isoforms experience different regulatory control and, rather than being a non-active
isoform, isoform I can persist in culture. This might be a consequence of the Ser518 site
in isoform 11 being protected by the alternate C-terminal tail, which is the only difference
between the two major isoforms. In the unprotected isoform I, phosphorylation of Ser518
leads to additional phosphorylation events and ultimately to ubiquitination and
degradation of merlin (6). Hypothetically, if the Ser518 residue on isoform II were to be
shielded by the C-terminal tail, that might protect it from further phosphorylation events
and consequentially, from degradation, leading to improved stability of isoform 11 in
culture. It remains to be seen whether these additional events of phosphorylation,
101
ubiquitination and degradation indeed differ in isoform II, and what would be the in vivo
contexts of such differential regulation.
One experiment to address the differences between the isoforms would be phosphopeptide mapping. Although the major phosphorylation sites are shared between the two
isoforms, and the short C-terminal tail that distinguishes between the isoforms does not
contain known phosphorylation sites, the fact that isoform I shows hyperphosphorylation
under some circumstances when isoform I does not shows that hyperphosphorylation
could be a way to investigate the differences between the isoforms- determining where
the additional phosphorylation occurs would be the first step in elucidating the
differences in regulation between the isoforms.
Another way to address the difference between the two major isoforms would involve
determining the localization of the two isoforms. Merlin has been shown to localize to the
cell cortex, to the cytoplasm, and to the nucleus. Is there a preference for either of the
isoforms for any single compartment? Since the localization could determine the
mechanism by which merlin inhibits cell growth, a preference of an isoform for a certain
location within the cell could determine the way by which merlin inhibits proliferation in
that cell type, and differential regulation between the isoforms might explain how merlin
can sustain multiple modes of regulation. An experiment to determine isoform
localization would best be done using isoform-specific antibodies or tagged versions of
each form, maintaining expression at endogenous levels, preferably in cells which are
otherwise merlin-null.
Merlin has been shown to be more fluid in conformation than other FERM-domain
proteins (5), which utilize a phosphorylation-driven conformational change to switch
between an active and inactive form (7). Although merlin can experience regulatory
phosphorylation, that does not necessarily coincide with a change in conformation. I
have shown that isoform II, which does not readily achieve a closed conformation, can
102
suppress growth and even do so more efficiently than isoform I under certain conditions
- as it can persist in culture longer. Similarly to localization, the conformation of merlin
might dictate which mechanism merlin uses to suppress growth, and again, this might
explain the multiple mechanisms described for merlin regulation.
Hippo-independent regulation of YAP by merlin
Merlin can suppress cell growth through a number of intertwined mechanisms. Merlin
can inhibit Rac-PAK (8, 9), P13K-Akt (10) and FAK (11) signaling, as well as negatively
regulate EGFR signaling through control of EGFR localization (12). Merlin has also been
shown to localize to the nucleus, where it may act as an inhibitor of the ubiquitin ligase,
CRL4 DCAF1(1 3 ). In addition to modulating signal transduction and gene expression,
merlin has also been shown act as a scaffold, stabilizing adherens junctions through
binding alpha-catenin (14), and potentiating Hippo pathway activity by recruiting Lats to
the membrane (15). Merlin's role as a scaffold protein explains its ability to orchestrate
growth suppression through multiple pathways and players, but its regulation of YAP
might be a clue to a common upstream input for the many subsequent pathways used to
regulate growth suppression. YAP regulation has been shown to correlate with cell
shape and stiffness, with YAP activity being inhibited in cells plated on a soft matrix, or
cells experiencing contact inhibition (16). Merlin, as a FERM-domain protein which acts
as a scaffold linking the actin cytoskeleton to the plasma membrane, could be a link
between the cytoskeleton and YAP, allowing the cell to sense and respond to changes in
its environment. In Drosophila, merlin was placed upstream or parallel to the growthsuppressing Hippo pathway through epistasis experiments. Further biochemical
experiments demonstrated multiple interactions between merlin, expanded, a FERMdomain protein, and kibra, a WW-domain-containing protein, which together provided
upstream input into the Hippo pathway (reviewed by (17)).
103
I used
Lats-insensitive YAP mutants to show that merlin is able to regulate YAP
independently of the Hippo pathway. Merlin has been shown to stabilize Lats at the cell
membrane and allow potentiation of Hippo signaling (15), however this is the first time
that Hippo-independent regulation of YAP through merlin has been shown. Furthermore,
I showed that merlin regulation of YAP is dependent on the WW domains of YAP. This is
a similar mode of regulation to that seen in Drosophila, where expanded mediates Yki
cytoplasmic retention and inhibition through binding the Yki WW domain. The
mammalian ortholog of expanded, FRMD6, does not contain a PPxY motif necessary for
binding the WW domains of YAP, however, a similar Hippo-independent regulation has
been shown in mammals and is mediated through the PPxY-containing protein
angiomotin (18, 19). We show that the WW domains of YAP are necessary for merlinmediated regulation of YAP. Merlin can bind YAP and requires the WW domains of YAP
to do so efficiently. It remains to be seen whether this binding is direct, for example,
through an interaction between merlin proline-proline motifs and YAP WW domains.
Although merlin lacks traditional PPxY motifs, some evidence has shown that other
proline-proline motifs (20) or proline-serine/proline-threonine motifs (21) can bind WW
domains. Alternatively, a direct binding interaction could occur through an interaction
between the merlin coiled-coil domain and the YAP coiled coil domain. If merlin is
binding YAP indirectly, possible proteins that might be involved or required in a YAPmerlin interaction are a-catenin and angiomotin, as well as angiomotin family members
AMOTL1 and AMOTL2. Both have previously been shown to bind merlin (14, 22) and
YAP and regulate YAP in a Hippo-pathway independent manner (19, 23). a-catenin has
been described as a binding partner for YAP in keratinocytes, and promotes cytoplasmic
sequestration through forming a complex with YAP and 14-3-3. Although phosphorylated
YAP is preferentially bound to 14-3-3 (24), the a-catenin-YAP interaction does not
104
require prior phosphorylation of YAP by the Hippo pathway (23). a-catenin also binds
merlin (14), and this interaction has been shown to stabilize adherens junctions in
keratinocytes, coordinating cell polarity and adhesion by creating a complex with Par3
proteins. Merlin might be playing a dual, linked role in binding a-catenin, by maintaining
cell junctions and contact inhibition while inhibiting downstream YAP transcriptional
activity. The FERM domain of merlin is required for its interaction with a-catenin, and it
would be interesting to see if the FERM domain of merlin is also responsible for its
interaction with YAP.
Angiomotin and its close family members AMOTL1 and AMOTL2 have also been shown
to bind merlin and YAP. Angiomotin binds Rich, a GAP for Rac. Merlin competes with
Rich for angiomotin binding, releasing Rich to inhibit Rac. Angiomotin has also been
shown to bind YAP and sequester it in the cytoplasm. As an inhibitor of Rich, leading to
cell proliferation and migration, yet also an inhibitor of YAP, angiomotin seems to have
conflicting roles in cell growth, which are also reflected in the literature regarding its role
in YAP regulation [(25-27) for inhibition, (28-31) for activation]. Merlin might provide a
mechanism to explain how angiomotin can act as either an inhibitor or an enhancer of
cell growth. This might depend on the cell type, the expression levels of angiomotin,
angiomotin isoforms or angiomotin family members, and the expression and activity of
merlin. Merlin binds angiomotin through an interaction between the merlin coiled-coil
domain and the angiomotin coiled-coil domain. Since angiomotin has already been
shown to bind YAP through the YAP WW domains, it seems a likely candidate as an
interacting protein in a merlin/YAP complex. Considering the complexity of the multiple
isoforms and closely related family members in the angiomotin family, careful
consideration of the cell line used for these experiments would be necessary, utilizing
knock down or knockout to establish a framework of players while eliminating
redundancies or competition. Finally, mass spectrometry might be useful in determining
105
any other proteins involved in the merlin-YAP interaction, and especially in elucidating
the possible differences in different cell lines.
Our lab has shown that YAP is a promoter of metastasis (32), and it will be interesting to
see in what contexts merlin can suppress tumorigenesis or metastasis through
regulation of YAP. I have shown that merlin can regulate YAP in mesothelioma cell lines
which have lost endogenous merlin. Mesothelioma is an aggressive tumor of the lung
mesothelium that has been directly linked to asbestos exposure. Inhalation of asbestos
fibers results in localized fibrosis and inflammation, followed by lung cancer and
mesothelioma. Studies have proposed that the fibrosis and repeated inflammation in the
lung pleura could cause the development of cancer at the site (reviewed in (33, 34)).
Interestingly, inhalation of another hazardous environmental particulate, silica, causes
fibrosis as well, but it does not progress into lung cancer or mesothelioma. A study which
exposed human lung epithelial cells to silica dust versus asbestos fibers showed distinct
changes in gene expression depending on the substance to which the cells were
exposed (34). Although both the silica-exposed samples and the asbestos-exposed
samples showed a common response with an upregulation of genes involved in
inflammation, fibrotic response, and apoptosis, gene profiling was able to distinguish
between the cells exposed to silica and those exposed to asbestos. In the cells exposed
to asbestos, there was a change in expression in genes associated with tumorigenesis,
tumor remodeling, and cell proliferation (34). A number of these genes have also been
implicated as targets of YAP/TEAD through Chip-Seq experiments (35). It would be
interesting to determine whether exposure to asbestos fibers results in an increase in
YAP activity, and the mechanism that might be involved. The fact that silica dust doesn't
promote mesothelioma or the associated changes in gene expression despite causing
similar inflammation and fibrosis could be related to the structure of the asbestos fibers,
106
and insertion of these fibers into the cells and surrounding matrix might affect
mechanotransduction and the cytoskeleton, leading to an increase in YAP activity. If
YAP activity is a driver of tumorigenesis in mesothelioma, and merlin regulates YAP
activity in mesothelial cells, it could explain why cells that have lost merlin would be
sensitized to an increase in YAP activity following dysregulation by asbestos fibers.
In addition to its role in tumorigenesis, YAP also plays a role in organ size regulation,
and consequently, in organ regeneration. The liver has been an amenable model in
which to study organ regeneration, since it has the ability to regenerate following
hepatocyte loss, as seen clinically following liver resection or transplant. Interestingly,
the liver is also extremely responsive to alterations in YAP expression or the Hippo
pathway. Overexpression of YAP or conditional knockout of Hippo pathway components
in the liver results in an increase in liver size and ultimately in the development of
hepatocellular carcinoma (36-40). In rats that have undergone a partial hepatectomy,
YAP activity is increased as the liver regenerates, with activity decreasing as the liver
approaches normal ratios of body weight to liver size (41). Interestingly, during the first
three days post-hepatectomy, when there is a large increase in liver size, along with
nuclear localization of YAP and an increase in YAP target gene expression,
phosphorylation of YAP does not decrease concomitantly. The greatest decrease in YAP
phosphorylation only occurs later, after day three, with YAP phosphorylation being at its
lowest on day seven post-hepatectomy (41). This could indicate that the YAP-inhibitory
mechanism being targeted at the earliest stages of liver regeneration is a Hippopathway-independent mechanism, which precedes the downregulation of the canonical
Hippo pathway at later stages in regeneration. An interesting experiment to do using this
model of rat hepatectomy would be to examine the expression levels and
phosphorylation status of merlin at early points in regeneration, and see if conditional
expression of a constitutively active merlin could decrease the regenerative ability of the
107
liver post-hepatectomy. Another possible regeneration model is the heart. Adult hearts
have lost the ability to regenerate, leading to loss of cardiomyocytes and decreased
contractility after injury. However, the hearts of neonatal mice have the ability to
regenerate following partial resection or injury within the first week after birth (42). This
regenerative ability is lost after one week, and subsequently injury will result in a fibrotic
response that leads to decreased contractility and heart function. Similarly to studies in
the liver, conditional knockout of Hippo pathway components (43) or overexpression of
YAP (44, 45) lead to increased cardiomyocyte proliferation in the mouse embryo.
Similarly, conditional expression of activated YAP in the neonatal heart led to an
extension of the window of regeneration in neonates, with improved heart function and
less fibrotic scarring following injury (46). The question remains how upstream regulation
of YAP affects its ability to be active in the case of regeneration, and how this upstream
regulation changes during development to prevent regeneration in the adult. Of course,
ultimately the question would be how this regulation could be reversed when the need
arises to induce regeneration in an adult heart following injury. As regeneration is a
process that must be closely regulated through cell-contact inhibition and the dynamics
of the actin cytoskeleton, merlin, as a link between these processes and YAP regulation,
could hold the key to understanding YAP-driven organ regeneration.
In summary, there are many exciting questions that remain unanswered when
considering the upstream regulation of YAP and its clinical implications. In this thesis I
present one mechanism by which merlin can regulate YAP, but it remains to be seen
what the physiological implications of this regulation are, and in which contexts this
regulation is relevant.
108
References
1.
Clucas J, Valderrama F. ERM proteins in cancer progression. J Cell Sci
2014;127:267-75.
2.
Moleirinho S, Tilston-Lunel A, Angus L, Gunn-Moore F, Reynolds PA. The
expanding family of FERM proteins. Biochem J 2013;452:183-93.
3.
Sherman L, Xu HM, Geist RT, et al. Interdomain binding mediates tumor growth
suppression by the NF2 gene product. Oncogene 1997;15:2505-9.
4.
McClatchey Al. Merlin and ERM proteins: unappreciated roles in cancer
development? Nat Rev Cancer 2003;3:877-83.
5.
Sher 1, Hanemann CO, Karplus PA, Bretscher A. The tumor suppressor merlin
controls growth in its open state, and phosphorylation converts it to a less-active moreclosed state. Dev Cell 2012;22:703-5.
6.
Tang X, Jang SW, Wang X, et al. Akt phosphorylation regulates the tumour-
suppressor merlin through ubiquitination and degradation. Nat Cell Biol 2007;9:1199207.
7.
Bretscher A, Edwards K, Fehon RG. ERM proteins and merlin: integrators at the
cell cortex. Nat Rev Mol Cell Biol 2002;3:586-99.
8.
Kissil JL, Wilker EW, Johnson KC, Eckman MS, Yaffe MB, Jacks T. Merlin, the
product of the Nf2 tumor suppressor gene, is an inhibitor of the p21-activated kinase,
Pak1. Mol Cell 2003;12:841-9.
9.
Shaw RJ, Paez JG, Curto M, et al. The Nf2 tumor suppressor, merlin, functions
in Rac-dependent signaling. Dev Cell 2001;1:63-72.
10.
Rong R, Tang X, Gutmann DH, Ye K. Neurofibromatosis 2 (NF2) tumor
suppressor merlin inhibits phosphatidylinositol 3-kinase through binding to PIKE-L. Proc
Natl Acad Sci U S A 2004;101:18200-5.
109
11.
Poulikakos PI, Xiao GH, Gallagher R, Jablonski S, Jhanwar SC, Testa JR. Re-
expression of the tumor suppressor NF2/merlin inhibits invasiveness in mesothelioma
cells and negatively regulates FAK. Oncogene 2006;25:5960-8.
12.
Curto M, Cole BK, Lallemand D, Liu CH, McClatchey Al. Contact-dependent
inhibition of EGFR signaling by Nf2/Merlin. J Cell Biol 2007;177:893-903.
13.
Li W, You L, Cooper J, et al. Merlin/NF2 suppresses tumorigenesis by inhibiting
the E3 ubiquitin ligase CRL4(DCAF1) in the nucleus. Cell 2010;140:477-90.
14.
Gladden AB, Hebert AM, Schneeberger EE, McClatchey Al. The NF2 tumor
suppressor, Merlin, regulates epidermal development through the establishment of a
junctional polarity complex. Dev Cell 2010;19:727-39.
15.
Yin F, Yu J, Zheng Y, Chen Q, Zhang N, Pan D. Spatial organization of Hippo
signaling at the plasma membrane mediated by the tumor suppressor Merlin/NF2. Cell
2013;154:1342-55.
16.
Dupont S, Morsut L, Aragona M, et al. Role of YAP/TAZ in mechanotransduction.
Nature 2011;474:179-83.
17.
Grusche FA, Richardson HE, Harvey KF. Upstream regulation of the hippo size
control pathway. Curr Biol 2012;20:R574-82.
18.
Wang W, Huang J, Chen J. Angiomotin-like proteins associate with and
negatively regulate YAP1. J Biol Chem 2011;286:4364-70.
19.
Zhao B, Li L, Lu Q, et al. Angiomotin is a novel Hippo pathway component that
inhibits YAP oncoprotein. Genes Dev 2011;25:51-63.
20.
Ermekova KS, Zambrano N, Linn H, et al. The WW domain of neural protein
FE65 interacts with proline-rich motifs in Mena, the mammalian homolog of Drosophila
enabled. J Biol Chem 1997;272:32869-77.
21.
Lu PJ, Zhou XZ, Shen M, Lu KP. Function of WW domains as phosphoserine- or
phosphothreonine-binding modules. Science 1999;283:1325-8.
110
22.
Yi C, Troutman S, Fera D, et al. A tight junction-associated Merlin-angiomotin
complex mediates Merlin's regulation of mitogenic signaling and tumor suppressive
functions. Cancer Cell 2011; 19:527-40.
23.
Schlegelmilch K, Mohseni M, Kirak 0, et al. Yap1 acts downstream of alpha-
catenin to control epidermal proliferation. Cell 2011;144:782-95.
24.
Zhao B, Wei X, Li W, et al. Inactivation of YAP oncoprotein by the Hippo pathway
is involved in cell contact inhibition and tissue growth control. Genes Dev 2007;21:274761.
25.
Hsu YL, Hung JY, Chou SH, et al. Angiomotin decreases lung cancer
progression by sequestering oncogenic YAP/TAZ and decreasing Cyr6l expression.
Oncogene.
26.
Mana-Capelli S, Paramasivam M, Dutta S, McCollum D. Angiomotins link F-actin
architecture to Hippo pathway signaling. Mol Biol Cell;25:1676-85.
27.
Yi C, Shen Z, Stemmer-Rachamimov A, et al. The p130 isoform of angiomotin is
required for Yap-mediated hepatic epithelial cell proliferation and tumorigenesis. Sci
Signal 2013;6:ra77.
28.
Adler JJ, Johnson DE, Heller BL, et al. Serum deprivation inhibits the
transcriptional co-activator YAP and cell growth via phosphorylation of the 130-kDa
isoform of Angiomotin by the LATS1/2 protein kinases. Proc Natl Acad Sci U S
A; 110:17368-73.
29.
Chan SW, Lim CJ, Guo F, Tan 1, Leung T, Hong W. Actin-binding and cell
proliferation activities of angiomotin family members are regulated by Hippo pathwaymediated phosphorylation. J Biol Chem;288:37296-307.
30.
Dai X, She P, Chi F, et al. Phosphorylation of angiomotin by Lats1/2 kinases
inhibits F-actin binding, cell migration, and angiogenesis. J Biol Chem;288:34041-51.
111
31.
Lv M, Chen L, Qin T, Zhang X, Liu P, Yang J. Angiomotin promotes breast
cancer cell proliferation and invasion. Oncol Rep;33:1938-46.
32.
Lamar JM, Stern P, Liu H, Schindler JW, Jiang ZG, Hynes RO. The Hippo
pathway target, YAP, promotes metastasis through its TEAD-interaction domain. Proc
Natl Acad Sci U S A 2012;109:E2441-50.
33.
Robinson BW, Musk AW, Lake RA. Malignant mesothelioma. Lancet
2005;366:397-408.
34.
Perkins TN, Peeters PM, Shukla A, et al. Indications for distinct pathogenic
mechanisms of asbestos and silica through gene expression profiling of the response of
lung epithelial cells. Hum Mol Genet;24:1374-89.
35.
Lian I, Kim J, Okazawa H, et al. The role of YAP transcription coactivator in
regulating stem cell self-renewal and differentiation. Genes Dev;24:1106-18.
36.
Camargo FD, Gokhale S, Johnnidis JB, et al. YAP1 increases organ size and
expands undifferentiated progenitor cells. Curr Biol 2007;17:2054-60.
37.
Dong J, Feldmann G, Huang J, et al. Elucidation of a universal size-control
mechanism in Drosophila and mammals. Cell 2007;130:1120-33.
38.
Lu L, Li Y, Kim SM, et al. Hippo signaling is a potent in vivo growth and tumor
suppressor pathway in the mammalian liver. Proc Natl Acad Sci U S A;107:1437-42.
39.
Song H, Mak KK, Topol L, et al. Mammalian Mstl and Mst2 kinases play
essential roles in organ size control and tumor suppression. Proc NatI Acad Sci U S
A;107:1431-6.
40.
Zhou D, Conrad C, Xia F, et al. Mstl and Mst2 maintain hepatocyte quiescence
and suppress hepatocellular carcinoma development through inactivation of the Yap1
oncogene. Cancer Cell 2009; 16:425-38.
112
41.
Grijalva JL, Huizenga M, Mueller K, et al. Dynamic alterations in Hippo signaling
pathway and YAP activation during liver regeneration. Am J Physiol Gastrointest Liver
Physiol;307:G196-204.
42.
Porrello ER, Mahmoud Al, Simpson E, et al. Transient regenerative potential of
the neonatal mouse heart. Science;331:1078-80.
43.
Heallen T, Zhang M, Wang J, et al. Hippo pathway inhibits Wnt signaling to
restrain cardiomyocyte proliferation and heart size. Science;332:458-61.
44.
von Gise A, Lin Z, Schlegelmilch K, et al. YAP1, the nuclear target of Hippo
signaling, stimulates heart growth through cardiomyocyte proliferation but not
hypertrophy. Proc Natl Acad Sci U S A;109:2394-9.
45.
Xin M, Kim Y, Sutherland LB, et al. Regulation of insulin-like growth factor
signaling by Yap governs cardiomyocyte proliferation and embryonic heart size. Sci
Signal;4:ra7O.
46.
Xin M, Kim Y, Sutherland LB, et al. Hippo pathway effector Yap promotes cardiac
regeneration. Proc Natl Acad Sci U S A; 110:13839-44.
113
Materials and Methods Chapter 2
Cell culture
All cells were cultured in a 5% CO2 humidified incubator at 370C.
The 4T1, 66C14, 168FARN, 4T07 and 67NR murine mammary carcinoma cell lines (a
gift from Fred Miller, Wayne State University, Detroit, MI) were described previously (1)
and were cultured in DMEM with 5% fetal bovine serum, 5% newborn calf serum, 2mM
L-glutamine, 1OOU/ml penicillin and streptomycin, and 1mM of non-essential amino
acids.
The murine mammary carcinoma cell lines D2, D2.1 and D2A1 (a gift from Robert
Weinberg, Whitehead Institute for Biomedical Research, Cambridge, MA) were
described previously (2) and were cultured in DMEM with 10% fetal bovine serum, 2mM
L-glutamine, 10OU/ml penicillin and streptomycin.
Retroviral packaging and production was performed using 293FT cells (ATCC), cultured
in DMEM with 10% fetal bovine serum, 2mM L-glutamine, 100U/ml penicillin and
streptomycin.
Vectors
All knockdowns were done using the MSCV-ZSGreen-2A-Puro-mir30 vector or the
MSCV-Puro-2A-GFP-mir30 vector (3). The following mir30-based shRNA sequences
were used for targeting (2 sequences per gene):
Ezrin shRNA 1: TGCTGTTGACAGTGAGCGACTCCAGTATGTAGACAATAAATAGTGA
AGCCACAGATGTATTTATTGTCTACATACTGGAGGTGCCTACTGCCTCGGA
Ezrin shRNA2: TGCTGTTGACAGTGAGCGCAGCGATAATATGGGTTTGTAATAGTGA
AGCCACAGATGTATTACAAACCCATATTATCGCTTTGCCTACTGCCTCGGA
114
Radixin shRNA 1: TGCTGTTGACAGTGAGCGCAAGGATATTCTACATGGCTTATAG
TGAAGCCACAGATGTATAAGCCATGTAGAATATCCTTTTGCCTACTGCCTCGGA
Radixin shRNA2: TGCTGTTGACAGTGAGCGACTGCAATATGTAGACAGCAAATAGT
GAAGCCACAGATGTATTTGCTGTCTACATATTGCAGCTGCCTACTGCCTCGGA
Moesin shRNAI:TGCTGTTGACAGTGAGCGATTGGCTGAAACTCAATAAGAA
TAGTGAAGCCACAGATGTATTCTTATTGAGTTTCAGCCAAGTGCCTACTGCCTCGGA
Moesin shRNA2: TGCTGTTGACAGTGAGCGATAGGATTTAGCCTCTTAATTAT
AGTGAAGCCACAGATGTATAATTAAGAGGCTAAATCCTAGTGCCTACTGCCTCGGA
4. lB shRNA I:TGCTGTTGACAGTGAGCGCACCAATATTAGTGAGCTGAAATAGTGAA
GCCACAGATGTATTTCAGCTCACTAATATTGGTTTGCCTACTGCCTCGGA
4. lB shRNA2: TGCTGTTGACAGTGAGCGCAACTCTCAATATGTAAATGAATAGTGAA
GCCACAGATGTATTCATTTACATATTGAGAGTTTTGCCTACTGCCTCGGA
For retroviral production the MLV gag-pol and VSVg expression vectors were used as
described previously (3).
Retroviral production and infection
For production of retrovirus, 293FT cells were seeded in 6-well plates and transfected
the following day with 2[Lg of the MSCV vector along with 1 [g each of MLV gag/pol and
VSVg, using Fugene6 (Roche) per manufacturer protocol. Media was changed the
following day, and collected at 48 hours. Collected media was filtered with a 0.45 m
filter, and added to target cells with 4[tg/ml Polybrene (Sigma). On day 2, media was
changed on the target cells. On day 4, 2Rg/ml puromycin was added for selection of
transduced cells.
115
Western blotting and quantitative PCR
For immunoblotting, cells were lysed in RIPA buffer (10mM Tris, 1mM EDTA, 0.5mM
EGTA, 1% Triton X-100, 0.1% Na-DOC, 0.1% SDS, 140mM NaCl) with protease and
phosphotase inhibitors (Roche) and 20Rg of protein was used for SDS/PAGE using 420% Tris-Glycine gels (Invitrogen), transferred to nitrocellulose membranes and assayed
by immunoblotting. Primary antibodies were diluted in Tris-buffered saline with 3% milk
at the following concentrations: rabbit anti-ezrin (#3145, Cell Signaling Technology)
1:5000; rabbit anti-radixin (C4G7, #2636, Cell Signaling Technology) 1:5000; rabbit antimoesin (#3146, Cell Signaling Technology)1:5000; mouse anti-GAPDH (Millipore)
1:10000, and rabbit anti-4.1B (McCarty et al. 2005). HRP-conjugated secondary
antibodies were used at the following concentrations: goat anti-rabbit IgG (Jackson
Labs) 1:10000, goat anti-mouse IgG (Jackson Labs) 1:10000.
For quantitative PCR (qPCR) cells were lysed in TRizol reagent (Invitrogen) and RNA
was isolated according to manufacturer protocol. 1 [tg of RNA was reverse transcribed to
produce cDNA using the Promega Reverse Transcription System (Promega). qPCR was
carried out using 2[i of cDNA, with 12.5[tl of SYBR Green Supermix (Bio-Rad) and
0.4[tmol of each primer, following manufacturer protocol. Analysis was performed using
the MyIQ real-time PCR detection system (Bio-Rad). PCR conditions were 940C for 5
minutes, followed by 35 cycles of 94 0C for 30sec, 600C for 30sec, and 720 C for 30sec.
Primers for qPCR:
4.1 G fwd CCCGCACAGAGTTAATGGAGAGGT, rev GTACGGCGTTAAGACTTGGATGG
4.1 N fwd GACCGACCCGCCCCCTTCTTTG, rev CGTGGGCGTGGTGGTTTGACTTTC
4.1 RI fwd CCCTTCCGGACTCTTAACATCAAC rev GCTGCAGGCTGGCTTCTTTATCAC
4.1 RI I/Ill fwd TGAGACCCGGATCGAGAAGAGAAT rev CAACCACCCCATAAAAACATCAAA
116
Invasion and migration assays
To assay invasive or migratory potential, 4x10 4 4T1 or 67NR cells were seeded into the
wells of a transwell plate (Costar #3422 for migration assay, BD BioCoat Matrigel
Invasion Chamber #354480 for the invasion assay). After 24 hours the cells on top of the
well were removed with a cotton swab, and the cells were fixed in 3.7% formalin for 15
minutes. Cells were then stained with Hoechst nuclear staining (1OOg/ml) for 10 minutes,
and the cells that had invaded onto the bottom of the well filter were counted. For the
Luminex assay of migration the cells at the bottom of the filter were washed off with PBS
and collected for analysis.
In-vivo tumor growth and metastasis assays
All animal experiments and husbandry were approved by the MIT Department of
Comparative Medicine. For tail vein experimental metastasis assays 5x1 05 cells were
injected into the lateral tail vein of 6-10 week old female syngeneic Balb/C mice
(Taconic) in 100i of HBSS. After 20 days the mice were sacrificed and lungs were
inflated and fixed with 3.7% formalin for 24 hours, followed by 75% ethanol for 24 hours.
Metastasis were counted in whole lungs. For Luminex analysis, genomic DNA was
isolated from fresh lungs.
Orthotopic transplants were performed to assay tumor growth and spontaneous
metastasis to the lung. For these assays 6-10 week old female Balb/C mice (Taconic)
were anesthetized by intraperitoneal injection of 125-250 mg/kg body weight of Avertin,
followed by 100 I of 12 g/ml of buprenorphine for analgesia. A small incision was made
on the right flank, and 2x10 5 of cells were injected in 25I of HBSS into the right #4 fat
pad using a Hamilton syringe. Mice received three additional injections of buprenorphine
at 24-hour intervals following the surgery. After the indicated number of days tumors
117
were removed and weighed, and lungs were fixed and assayed for metastasis as
described above. For Luminex experiments genomic DNA was isolated from the lungs
and tumors.
Luminex-based assays
Unique oligo barcodes were cloned into MSCV retroviral vectors containing mir30-based
shRNA targeting the genes of interest as described above. Equal numbers of cells that
had been validated for knockdown were mixed and used in the Luminex-based assays.
For tumor growth and metastasis, cells were injected orthotopically or into the tail vein as
described above, for migration cells were plated in transwell plates as described above
and for in vitro proliferation cells were plated in 6 well plates and cultured for the
indicated number of days, with cells being collected at intervals for analysis. For all
experiments, a starting population was collected when the cell populations were mixed
and used for normalization of subsequent samples. Genomic DNA was collected from all
samples and the barcodes were amplified using biotinylated primers that bound to
common regions flanking the barcodes. The PCR output was then quantified at the
Genetic Analysis Platform at the Broad Institute (Cambridge, MA) using Luminex
technology as described previously (4).
118
Materials and Methods Chapter 3
Cell culture
All cells were cultured in a 5% CO 2 humidified incubator at 370C.
The human mesothelioma cell lines Meso59 and Meso428 (a gift from Jonathan
Fletcher, Brigham and Women's Hospital and Harvard Cancer Center, Boston, MA) were
cultured in RPMI or in DMEM with 10% fetal bovine serum, 2mM L-glutamine, 10OU/ml
penicillin and streptomycin. The human mammary carcinoma cell line MDA-MB-231
,
(ATCC) was cultured in DMEM with 10% fetal bovine serum, 2mM L-glutamine
100U/ml penicillin and streptomycin. The murine mammary epithelial cell line NMuMG
(ATTC) was cultured in DMEM with 10% fetal bovine serum, 2mM L-glutamine, 10OU/ml
penicillin and streptomycin, and 10[tg/ml insulin.
Retroviral packaging and production was performed using 293FT cells (ATCC), cultured
in DMEM with 10% fetal bovine serum, 2mM L-glutamine, 10OU/ml penicillin and
streptomycin as described in chapter 2.
Vectors
Merlin (pBABE NF2/WT, isoform II, Addgene) was cloned into the MSCV-IRES-GFP and
the MSCV-IRES-Puro expression vectors (Stern et al. 2008). Using standard molecular
biology techniques and the following oligos, the sequence corresponding with isoform II
was replaced with a sequence corresponding with isoform 1:
5'ggagcagctcaacgagctcaagacggagatcgaggccttgaaactcaaagagcgggagacggcctggacgtcctacacagcgagagctcag
acagaggcggccccagcagcaagcataataccataaaaagctcactctgcagagcgccaagtcccgagtggccttcttgaagaactctag 3'
5'aatctagagttcttcaaagaaggccactcgggacttggcgctctgcagagtgagctttaatggtattatgcttgctgctggggccgcctctgtctgagct
ctcgctgtgtaggacgtccaaggccgtctcccgctctttgagtttcaaggcctcgatctccgtcttgagctcgttgagctgctcctgca
3'
119
Mutant forms of merlin isoform I or isoform II were generated via PCR-mediated sitedirected mutagenesis using a pcDNA shuttle vector, and cloned into the MSCV-IRESPuro or MSCV-IRES-GFP vectors.
Western blotting
For immunoblotting, cells were lysed in CSK buffer (100mM NaCl, 300mM sucrose,
3mM MgCI 2:6H 20, 10mM PIPES, 0.5% IPEGAL, 1mM EDTA) with protease and
phosphotase inhibitors (Roche). 20Rg of protein was used for SDS/PAGE using 4-20%
Tris-Glycine gels (Invitrogen), transferred to nitrocellulose membranes and assayed by
immunoblotting. For phosphotase treatment of lysates no phosphotase inhibitors or
EDTA was used in the lysis buffers. Calf Intestinal Phosphotase (CIP) was added at 20U
CIP for 20tg of protein and incubated at 370C for one hour.
Primary antibodies were diluted in Tris-buffered saline with 5% BSA at the following
concentrations: rabbit anti-merlin monoclonal D1 D8,(#6995, Cell Signaling Technology)
1:5000; rabbit anti-phospo S518 merlin (#9163, Cell Signaling Technology) 1:5000; and
mouse anti-GAPDH (Millipore) 1:10000. HRP-conjugated secondary antibodies were
used at the following concentrations: goat anti-rabbit IgG (Jackson Labs) 1:10000, goat
anti-mouse IgG (Jackson Labs) 1:10000.
Proliferation assays
For standard proliferation assays cells were seeded at starting numbers as indicated,
collected at days post seeding as indicated, and counted manually with a
hemacytometer.
For flow-cytometry based proliferation assays, GFP- and GFP+ merlin-expressing cells
were mixed at equal numbers and plated and cultured over time. After the indicated
number of days, culture cells were collected, trypsinized, and resuspended in PBS with
120
5% fetal bovine serum, and stained with propidium iodide. The percentages of green vs.
non-green cells were quantified using a FACSCalibur flow cytometer (BD). In all flowcytometry based proliferation assays samples were normalized to a starting population.
Raw flow data was analyzed using Flow Jo version 8.8.
121
Materials and Methods Chapter 4
Cell culture
All cells were cultured in a 5% CO2 humidified incubator at 370C.
The human mesothelioma cell lines Meso59 and Meso428 (a gift from Jonathan
Fletcher, Brigham and Women's Hospital and Harvard Cancer Center, Boston, MA) used
were described in chapter 3. The human mammary epithelial cells lines HMLE and
HMLER (5)(a gift from Robert Weinberg, Whitehead Institute for Biomedical Research,
Cambridge, MA) were grown in a 1:1 mixture of Mammary Epithelial Cell Growth Media
(C-21 110, PromoCell) and DMEM/F12 (1:1) with 10OU/ml penicillin and streptomycin,
10ug/ml insulin, lug/ml hydrocortisone, and lOng/ml EGF.
Vectors
Merlin-GFP and Merlin-Puro vectors, for both isoforms, were described in chapter 3.
For knockdown of merlin, mir30-based shRNA targeting sequences were:
NF2 shRNA1: TGCTGTTGACAGTGAGCGCCAGCTTGTCATTTGACTTCAATAGTGAAGC
CACAGATGTATTGAAGTCAAATGACAAGCTGTTGCCTACTGCCTCGGA
NF2 shRNA2: TGCTGTTGACAGTGAGCGCAAGGGTGATAAATCTCTATCATAGTGAA
GCCACAGATGTATGATAGAGATTTATCACCCTTTTGCCTACTGCCTCGGA
Knockdown was performed and validated as described in chapter 2.
Generation of the YAP and YAP mutant vectors used was described previously (4). The
TEAD-dependent luciferase reporter construct, pGL3-5xMCAT(SV)-49 (a gift from Ian
Farrance, Virginia Technological Institute and State University, Blacksburg, VA) was
described previously (6).
122
Western blotting and immunoprecipitation
For immunoprecipitation, cells were lysed in CSK buffer (as described in chapter 3) with
protease and phosphotase inhibitors (Roche) and 0.1% SDS, 0.5% NP-40, 0.1% NaDOC. 1 mg of total cell lysate was used for immunoprecipitation. 1:2 CSK-diluted lysate
was precleared with 1 [tg of mouse IgG (Santa Cruz Biotechnology) along with 30[i of
either magnetic beads or protein A/G agarose and incubated at 4 0C for 30 minutes, then
samples were spun down or beads removed with a magnet. Following preclear, 3[d of
anti-mouse FLAG primary antibody (Sigma) was added to the cleared supernatant and
incubated at 40C for one hour. 30[i of either magnetic beads or protein A/G agarose was
added and incubated overnight at 40C on a rotating device. Immunoprecipitate was
collected by magnet or gentle spin, and pellet washed 4 times with CSK buffer before
resuspension in Laemmeli sample buffer with P-mercaptoethanol (Biorad).
For immunoblotting, immunoprecipitate or 20[tg of total cell lysate was used for
SDS/PAGE using 4-20% Tris-Glycine gels (Invitrogen), followed by transfer to
nitrocellulose membranes and assayed by immunoblotting. Primary antibodies were
diluted in Tris-buffered saline with 5% BSA at the following concentrations: rabbit antimerlin monoclonal D1 D8,(#6995, Cell Signaling Technology) 1:5000; rabbit antiYAP(#4912, Cell Signaling Technology) 1:5000; rabbit anti-phospho YAP S127 (#4911,
Cell Signaling Technology) 1:5000; and mouse anti-GAPDH (Millipore) 1:10000. HRPconjugated secondary antibodies were used at the following concentrations: goat antirabbit IgG (Jackson Labs) 1:10000, goat anti-mouse IgG (Jackson Labs) 1:10000.
Immunofluorescence
Confluent cells on coverslips were fixed for 5 minutes in 4% paraformaldhyde, then
permeabilized for 5 minutes with 0.5% NP-40, 0.2% Triton in PBS. Coverslips were then
123
blocked in 2% BSA in PBS for one hour, and incubated overnight at 4 0C with rabbit
monoclonal anti-YAP (YAP [D8H1X] XP, #14074 Cell Signaling Technology) primary
antibody in 2% BSA in PBS. Coverslips were rinsed four times in PBS and then
incubated for 45 minutes at 370C in Alexa 488-conjugated anti-rabbit secondary
antibodies (Invitrogen) diluted with 2% BSA with PBS and DAPI (Invitrogen). Coverslips
were mounted on slides using Fluoromount-G (Southern Biotech).
Dual luciferase reporter assay
For TEAD transcriptional activity assays, cells stably expressing the vectors indicated
were plated on 12-well plates in duplicate or triplicate and co-transfected with 500ng of a
20:1 mixture of pGL3-5xMCAT(SV)-49 and PRL-TK (Promega) using Lipofectamine Plus
(Invitrogen) as per manufacturer instructions. Alternatively cells were co-transfected with
the reporter mixture and with YAP or merlin vectors described above. After 48-72 hours,
luciferase activity was assayed in duplicate for each sample using the dual luciferase
reporter assay system (Promega) and a Tecan Infinite 200Pro plate reader. For each
well the signal of firefly luciferase (pGL3-5xMCAT(SV)-49) was normalized to the signal
for Renilla luciferase (PRL-TK).
Proliferation assay
Proliferation experiments were done as described in chapter 3.
References
1.
Aslakson CJ, Miller FR. Selective events in the metastatic process defined by
analysis of the sequential dissemination of subpopulations of a mouse mammary tumor.
Cancer Res 1992;52:1399-405.
124
2.
Rak JW, McEachern D, Miller FR. Sequential alteration of peanut agglutinin
binding-glycoprotein expression during progression of murine mammary neoplasia. Br J
Cancer 1992;65:641-8.
3.
Stern P, Astrof S, Erkeland SJ, Schustak J, Sharp PA, Hynes RO. A system for
Cre-regulated RNA interference in vivo. Proc Natl Acad Sci U S A 2008;105:13895-900.
4.
Lamar JM, Stern P, Liu H, Schindler JW, Jiang ZG, Hynes RO. The Hippo
pathway target, YAP, promotes metastasis through its TEAD-interaction domain. Proc
Natl Acad Sci U S A 2012;109:E2441-50.
5.
Elenbaas B, Spirio L, Koerner F, et al. Human breast cancer cells generated by
oncogenic transformation of primary mammary epithelial cells. Genes Dev 2001;15:5065.
6.
Mahoney WM, Jr., Hong JH, Yaffe MB, Farrance 1K. The transcriptional co-
activator TAZ interacts differentially with transcriptional enhancer factor-1 (TEF-1) family
members. Biochem J 2005;388:217-25.
125
126
127