OVEREXPRESSION OF THE TOMATO PLASMA MEMBRANE H+-ATPASE,
LHA2, IN ARABIDOPSIS THALIANA TO TEST ITS ROLE IN THE CONTROL OF
PLANT GROWTH AND DEVELOPMENT
A Thesis
Presented to the faculty of the Department of Biological Sciences
California State University, Sacramento
Submitted in partial satisfaction of
the requirements for the degree of
MASTER OF SCIENCE
in
BIOLOGICAL SCIENCES
(Molecular and Cellular Biology)
by
Robert Gar Bo Boyce
FALL
2012
OVEREXPRESSION OF THE TOMATO PLASMA MEMBRANE H+-ATPASE,
LHA2, IN ARABIDOPSIS THALIANA TO TEST ITS ROLE IN THE CONTROL OF
PLANT GROWTH AND DEVELOPMENT
A Thesis
by
Robert Gar Bo Boyce
Approved by:
__________________________________, Committee Chair
Nicholas Ewing, Ph. D.
__________________________________, Second Reader
Thomas Peavy, Ph. D.
__________________________________, Third Reader
Hao Nguyen, Ph. D.
____________________________
Date
ii
Student: Robert Gar Bo Boyce
I certify that this student has met the requirements for format contained in the University format
manual, and that this thesis is suitable for shelving in the Library and credit is to be awarded for
the thesis.
__________________________, Graduate Coordinator
Jamie Kneitel, Ph. D.
Department of Biological Sciences
iii
___________________
Date
Abstract
of
OVEREXPRESSION OF THE TOMATO PLASMA MEMBRANE H+-ATPASE,
LHA2, IN ARABIDOPSIS THALIANA TO TEST ITS ROLE IN THE CONTROL OF
PLANT GROWTH AND DEVELOPMENT
by
Robert Gar Bo Boyce
Plant plasma membrane H+-ATPases, such as LHA2, are primary active
transporters that play a role in many physiological processes including maintenance of
intra- and extracellular pH and cellular expansion. In order to gain a better understanding
of plant growth and development this study focused on plant primary and lateral roots
specifically looking at two areas of growth that the plasma membrane H+-ATPases effect,
the Acid Growth Theory and lateral root initiation. The Acid Growth Theory suggests
that the activation of plasma membrane H+-ATPases by auxin causes acidification of the
apoplast, which causes loosening of the cell wall allowing turgor driven cell expansion.
The other issue dealt with was lateral root initiation; currently there is no definitive early
signal that triggers lateral roots. This study supports the hypothesis that activation of the
H+-ATPase would cause both cell expansion according to the Acid Growth Theory and
would be an early signal in lateral root initiation. To observe adequately the plasma
membrane H+-ATPases, the development of two additional constitutively active
iv
overexpression lines were studied with two existing overexpression lines in Arabidopsis
thaliana. These plant lines insured permanent activation by means of artificial truncation
of the autoinhibitory domain and overexpression by coupling the LHA2 gene with the
32S promoter of the cauliflower mosaic virus. Results indicated that there was expression
of the LHA2 transgene in Arabidopsis confirmed by RT-qPCR and that expression of the
construct produced a fully functional H+ pump protein verified by fluorescent
extracellular acidification activity assays using the pH sensitive fluorescent dye, dextran
Oregon Green. The extracellular pH assay revealed that all overexpression lines had
significantly lower extracellular pH (p<0.05), LHA2-2C at pH 4.73, LHA2-3C at pH
4.61, LHA2-6H at pH 4.44 and LHA2-12K at pH 4.43, compared to the wild-type control
at pH 5.01. Phenotypic root results showed significant increases in primary root growth
of all single copy homozygous overexpression lines (p<0.01), LHA2-2C, LHA2-3C,
LHA2-6H and LHA2-12K with mean growth of 46.6 mm, 49.0 mm, 45.5 mm and 42.3
mm respectively compared to wild-type root growth at 39.2 mm in the 8 day primary root
growth experiment. The 8 day lateral root density experiment showed increased densities
of lateral roots in 3 of the 4 single copy homozygous overexpression lines (p<0.01).
Mean root numbers of LHA2-2C at 1.39 lateral roots/cm (LR/cm), LHA2-3C at 1.49
LR/cm and LHA2-6H with 1.30 LR/cm, when compared to wild-type root at 1.16 LR/cm
grown on M/S agar plates in our root growth assays. The wild-type and overexpression
lines were also grown with the auxin transport regulators, TIBA and NPA in order to
separate the effects of polar auxin flow and endogenous H+ pump activity. These results
v
showed that in the absence of polar auxin flow and endogenous pump activity, effects of
the transgenic H+ pumps in the overexpression lines were able to retain growth in primary
root length for 3 of the 4 overexpression lines, LHA2-3C, LHA2-6H and LHA2-12K.
They also increased retention of lateral root densities in all of the overexpression lines
when growing the plant lines on the auxin transport inhibitor, NPA and normalized to the
DMSO vehicle control data. Results for plants grown on TIBA and normalized to the
DMSO vehicle control, indicated that there were greater retention in lateral root density
of the overexpression lines compared to the wild-type but decreased primary root
retention which was contrary to our original hypothesis. To date, this study provides
some of the most direct evidence that the function of the H+ pump is directly involved
with acidification of the apoplast and cell expansion as stated by the Acid Growth
Theory. This study also strengthens the hypothesis that the activity of the H+ pump by
auxin activation creates transitory cytoplasmic alkalinization events, which may be
required as one of the earliest signals to trigger the initiation of lateral roots in plants.
_______________________, Committee Chair
Nicholas Ewing, Ph. D.
_______________________
Date
vi
ACKNOWLEDGEMENTS
This thesis would not be possible without the help of several individuals who have
contributed in both preparation and completion of this study. First I would like to express
my gratitude for Dr. Nicholas Ewing whose knowledge, guidance and patience helped me
to complete this research and thesis. I would also like to acknowledge and thank my
committee, Dr. Thomas Peavy and Dr. Hao Nguyen for all their help on the thesis. I want
to thank my friends and colleagues, Akihiro Tsuyada and Milo Careaga who initially
trained me in my pursuit of research and for providing insight and knowledge. I would
also like to acknowledge the support of Albert Deslisle and the scholarship and grants I
had received from his foundation to fund this research. A special thanks to Dr. Maria
Iturbide for her help with statistical analysis. Lastly, I would like to thank my family and
my wife, Sherry, who have encouraged me through this entire process.
vii
TABLE OF CONTENTS
Page
Acknowledgements ................................................................................................................ vii
List of Tables ........................................................................................................................... ix
List of Figures ........................................................................................................................... x
INTRODUCTION .................................................................................................................... 1
MATERIALS AND METHODS ............................................................................................ 20
RESULTS ............................................................................................................................... 31
DISCUSSION ......................................................................................................................... 82
Literature Cited ..................................................................................................................... 104
viii
LIST OF TABLES
Tables
Page
1.
Primer sequence data for use in PCR, RT-PCR and qPCR ……………………26
2.
Segregation analysis for the single insertion lines LHA2-6 and LHA2-12 ..…. 37
3.
Chi square (Χ2) test for LHA2-6 and LHA2-12 transgenic lines .......................38
4.
Pfaffl Method for fold expression ………….………………………………….47
5.
Summary of the pH analysis between the overexpression lines and the
wild-type ............................................................................................................55
6.
Lateral and primary root analyses of plants grown on MS agar plates at 8 dpg.65
7.
Two-way ANOVA on primary root length .…………………………………. .76
8.
Post Hoc Bonferroni analysis of the genotype for the primary roots.......... ………….77
9.
Two-way ANOVA on lateral roots ……….…………………………………. .79
10.
Post Hoc Bonferroni analysis of the genotype for the lateral roots ..................... …….80
ix
LIST OF FIGURES
Figures
Page
1.
LHA2/p2KGW7 Construct map …………… .………………………………. 21
2.
A black walled fluorescent plate loaded with plants before obtaining pH
fluorescent readings on a Promega Glomax plate reader ……………………. 30
3.
Selection on 40 µg/ml kanamycin sulfate (14 days post-germination) .. ……. 32
4.
Mendelian inheritance in the event of a single transgene insertion …………. 34
5.
Demonstrates the expected outcome of the self-cross of a line containing two
copies of the transgene ................................................ ………………………. 35
6.
PCR detection of the LHA2 transgene in the transgenic overexpression lines
and the wild-type parental line…………….…………………………………. 40
7.
Reverse Transcriptase PCR from total RNA from transgenic and wild type
Arabidopsis plants ………………………….……… .......... ………………… 42
8.
A melt peak chart run after the gradient temperature analysis ………………. 45
9.
The Pfaffl Method of Analysis was used to determine the fold expression
of a target mRNA to that of a target gene .................................. ..…………… 46
10.
Amplification chart showing the primer efficiency of the GAPDH primer
set…………………. ................................................................................................ 48
11.
Amplification chart of the primer efficiency for LHA2161 primer set ……… 49
12.
Amplification chart of the primer efficiency for TIP41 primer set . ………… 50
13.
Analysis of LHA2 mRNA expression using the Pfaffl Method ....................... 51
14.
Analysis of LHA2 mRNA expression using the Pffafl method……………… 52
x
15.
The standard curves of pH at different concentrations of dextran Oregon
Green ....................................................................... …………………………. 54
16.
Extracellular pH extrapolated from a 30 µm Oregon Green standard curve. ... 56
17.
Transgenic and wild-type plants grown vertically in a growth chamber...… ... 61
18.
Growth of transgenic and wild-type lines on MS agar plates ..................... …. 62
19.
Total primary root length at 8 dpg. ......................... …………………………. 63
20.
Total lateral root and lateral root density analysis of overexpression and
wild-type lines grown on MS agar plates ............... …………………………. 64
21.
Primary root growth in the presence of the DMSO solvent control…………. 66
22.
Retention in primary root growth of wild type and transgenic lines when
grown on 0.1 µm TIBA relative to the DMSO control at 8 dpg ......... ………. 67
23.
Retention in lateral root density of transgenic and wild-type plants when
grown on 0.1µm TIBA relative to the DMSO control at 8 dpg.…………… .. 68
24.
Primary root growth of the transgenic and wild-type lines when grown on
0.1 µm TIBA ........................................................... …………………………. 69
25.
Primary root growth of the transgenic and wild-type lines when grown on
1 µm TIBA .............................................................. …………………………. 70
26.
Primary root between the transgenic lines and the wild-type line grown on
0.1µm NPA relative to the DMSO control at 8 dpg …………………………. 71
27.
Retention of lateral root density of wild-type and transgenic plants when
grown on 0.1µm NPA relative to the DMSO control at 8 dpg ………………. 72
xi
28.
Primary root growth on 0.1µm NPA treatment of transgenic lines and
wild-type without normalization to the DMSO vehicle control……………… 73
29.
Primary root growth of transgenic and wild-type plants when grown on
1.0µm NPA without normalization to the DMSO vehicle control…………… 74
30.
Primary root length of all plant lines that were grown on MS,
DMSO, 0.1 µm TIBA, 1.0 µm TIBA, 0.1 µm NPA and 1.0 µm NPA………. 75
31.
Lateral root numbers of all plant lines that were grown on MS,
DMSO, 0.1 µm TIBA and 0.1 µm NPA ................. …………………………. 78
32.
Germination percentages of transgenic Arabidopsis and wild-type plants
when grown on MS agar for 5 days ........................ …………………………. 81
33.
Simplified model of auxin flow into plant root tissues………………………. 94
34.
A model for TIBA and NPA and their mode of inhibition on PIN auxin
efflux carrier............................................................................................ ……. 96
35.
A model of the H+ pump overexpression system along with auxin flow ……. 97
xii
1
INTRODUCTION
The Acid Growth Theory describes the fundamental mechanism by which plant
cells expand to control growth of the plant (Cleland, 1992; Hager, 2003; Hager, 1991;
Rayle and Cleland, 1992a). According to the Acid Growth Theory, the activation of
plasma membrane H+-ATPases by auxin causes acidification of the cell wall that, in turn,
causes loosening of the cell wall allowing turgor driven cell expansion. The activity of
the pump has been proposed to affect many other plant systems and cell functions as well
including lateral root initiation, a process in which founder cells are triggered to progress
from G2 arrest to re-enter the cell cycle. The purpose of this study is to test 1) whether
activation of the pump is able to cause cell expansion as proposed in the Acid Growth
Theory and 2) whether activation of the pump is an early signaling event in lateral root
initiation. To accomplish this we have overexpressed a constitutively active form of the
tomato H+ pump and examined its effects on root growth and lateral root initiation.
Overview of H+-ATPase Structure and Function
H+-ATPases are thought to participate in numerous physiological functions
including: plant defense, phloem loading, stomatal control, regulation of extracellular pH,
and in cell growth in response to the hormone auxin (Arango et al., 2003; Pardo and
Serrano, 1989).The plasma membrane H+ ATPase utilizes the energy of hydrolysis of
ATP to pump H+ out of the cell. Since one H+ is transported outward for each cycle of the
pump, its activity contributes directly to the generation of the membrane potential which
2
reaches approximately -200 mV in Arabidopsis (Robertson et al., 2004). In addition to
producing charge separation that yields an electrical potential across the plasma
membrane, the transport of H+ outward establishes and maintains a chemical gradient for
H+ as well. The electrochemical gradient for H+ is often referred to as the proton motive
force. The electrochemical gradient for H+ is used to drive a number of secondary active
transporters that couple the energy provided by the movement of H+ down their
electrochemical gradients to the uphill movement of other solutes. In addition, the
membrane potential contributes to the electrochemical gradients that provide the driving
force for the movement of charged solutes through ion channels and carriers. As a result
of the H+ pumps role in many plant processes, proton pump activity is essential to plant
survival (Haruta et al., 2010).
Analysis of pump structure can reveal a greater understanding of how the pump
itself functions. Cryoelectron microscopy and X-ray crystallography have been utilized
to analyze the structure of the plasma membrane H+ ATPase in plants and fungi. The
fully functional pump consists of multiple subunits in either a dimeric or a hexameric
protein complex (Duby et al., 2009). Each subunit of the pump consists of an
approximately 100 kD polypeptide with ten transmembrane -helical domains (M1-10),
several cytosolic domains including an actuator (A) domain, a nucleotide binding (N)
domain, a phosphorylation (P) domain and a C-terminal cytosolic autoinhibitory
regulatory (R) domain (Pedersen et al., 2007). The P domain comprises the ATP binding
domain (one on each subunit) which allows for ATP hydrolysis and the phosphorylation
event that provides the energy for proton transport. Proposed models place the R domain
3
in the last 100 or so amino acids and this domain then associates with the A domain of
the H+-ATPase protein to maintain it in a state of low activity (Ekberg et al., 2010;
Palmgren, 1990; Pedersen et al., 2007; Portillo, 2000). Activation of the pump is thought
to occur after several phosphorylation events, that cause a conformational change in the
tertiary structure of the proton pump, that allows 14-3-3 protein binding to the R domain
that activates the pump (Baekgaard et al., 2005; Portillo, 2000).
P-type ATPase Superfamily
Plant plasma membrane H+-ATPases are members of the P-type ATPase
superfamily that are characterized by the formation of a phosphorylated intermediate
during transport. The genes making up the P-Type ATPase superfamily have been
identified in Arabidopsis and rice whose genomes have been completely sequenced. This
has allowed for a total of 46 P-Type ATPase genes to be identified in Arabidopsis and 43
genes in rice (Duby and Boutry, 2009). The P-Type ATPase superfamily includes
members found in all organisms from bacteria to archea to eukaryotes and can be broken
down into several subfamilies which include Na+/K+ pumps of animals, heavy metal
pumps, Ca2+ pumps found in all eukaryotes, and the H+ pumps of plants and fungi. Of
this large superfamily, Arabidopsis has twelve genes encoding the plasma membrane H+
ATPase (AHA1- AHA12), nine H+-ATPase genes have been identified in tobacco
(PMA1-PMA9), ten in rice (OSA1-OSA10) and at least eight in tomato (LHA1-LHA8),
(Arango et al., 2003; Ewing and Bennett, 1994; Ewing et al., 1990; Kalampanayil, 2001;
Palmgren, 2001). The relatively large number of H+ ATPase genes highlights its
4
importance in the plant and suggests that there is a need for redundancy to carry out all
functions.
Auxin Regulation of Plant Growth and Development
Activation of the H+ pump by the plant hormone, auxin, is thought to be a key
component of the mechanism by which plants regulate growth and development. At the
whole plant level, auxins are responsible for controlling the changes in growth that are
necessary for phototropism, gravitropism and for controlling overall growth by regulating
cell division, cell expansion, and cell differentiation (Woodward and Bartel, 2005). The
mechanism by which auxin controls plant growth is not fully understood but is of
fundamental importance in plant biology. The current theory that describes how auxin
controls plant cell growth is the Acid Growth Theory, whereby auxin causes the efflux of
protons out of the cell by activating the plasma membrane H+-ATPase and this
acidification causes cell wall loosening which, in turn, allows turgor driven cell
expansion (Cleland, 1971; Cosgrove, 2000; Hager, 2003; Hager, 1991). That
acidification of the cell wall is able to cause cell expansion is well-supported, thus,
elevation in the literature of the Acid Growth Hypothesis to the Acid Growth Theory.
Most evidence supports the conclusion that it is activation of the pump that causes this
acidification; however, this has not been directly demonstrated. In fact, despite its
description as the Acid Growth Theory, this proposed mechanism is not without
contention (Kutschera and Niklas, 2007; Kutschera, 1985; Rayle and Cleland, 1992b).
5
Prior research using a variety of techniques has provided much support for the
Acid Growth Theory. A brief survey of these studies demonstrates the complexity of
auxin control of plant growth along with the depth of acceptance of the theory. First, it is
important to note that the Acid Growth Theory, though widely accepted, is still contested
by some, as more research is being completed on the subject it is filling in pieces of
information that have remained in contention. Some of the first experiments were
conducted by Charles Darwin and his father Francis. Using oat coleoptiles they
demonstrated that certain stimuli, such as light, cause the plants (coleoptile tips) to bend
toward the stimulus and that removal of the tip prevents the response (Berg, 2007;
Campbell, 1996). That growth was caused by a diffusible substance was demonstrated by
Frits Went who decapitated coleoptiles and replaced the tip with gelatin blocks (Berg,
2007; Campbell, 1996). Coleoptiles whose tips had been removed showed no bending
however if the same tips were replaced bending resumed. Gelatin blocks that were
incubated with the removed coleoptile tips were allowed to absorb any diffused substance
expelled from the tips. These gelatin blocks alone were then shown to stimulate growth
when placed on coleoptiles from which the tips had been removed.
As studies progressed towards more cellular and molecular approaches from
organismal and tissue specific analyses, studies to define the mechanisms that cause cell
growth started to become more refined. Many studies had shown that pH changes affect
the growth rates in plants (Bonner, 1934). For example, coleoptiles introduced to low pH
solutions show increased elongation but when introduced to neutral or basic pH will
cease elongation. Studies linking pH along with auxin movement led to the formation of
6
the Acid Growth Hypothesis by David Rayle and Robert Cleland in 1970 and Achim
Hager in 1971 (Hager, 1971; Rayle and Cleland, 1970). They first postulated that it was
auxin activated elements in the cell membrane that were responsible for cell expansion.
They realized that both pH and auxin caused elongation, however, acidic pH caused
almost instantaneous elongation while auxin had a lag time between addition of auxin
and elongation. This suggested that pH was the mechanism that facilitated elongation and
that auxin could affect the pH controlling machinery, which was proposed to be the
plasma membrane H+-ATPase. After acidification of the apoplast by the H+ pumps, there
are competing hypotheses on the cause of changes in the cell wall. The first is that acidlabile bonds are broken due to acidification and the second is that acidification causes the
increase in enzymatic and other machinery (expansins) involved in wall loosening.
A range of indirect evidence supports the Acid Growth Theory including an
observed decrease in cell wall pH in response to auxin that is thought to result from
activation of plasma membrane H+ -ATPase since H+-ATPase inhibitors are able to
reduce this response (Rayle and Cleland, 1992a). Studies have tried to determine whether
addition of exogenous auxin would cause an increase in the amount of expression of H+ATPases, several of these studies indicated that there was a small detectable increase in
expression of mRNA in some instances but no change or a reduction in H+-ATPase
mRNA levels was observed in highly auxin responsive tissues such as tomato hypocotyls
(Ewing and Bennett, 1994; Frias et al., 1996; Fukuda and Tanaka, 2006). Prior to work in
our lab, specific auxin regulated H+-ATPase isoforms have not been clearly identified nor
has a direct role for the pumps been clearly demonstrated. There have been implications
7
that the H+ pumps are responsible for acidification of the apoplast by using confocal and
light fluorescent microscopy, microelectrode studies and other assays (Nishiyama, 2007;
Pitann, 2009; Yu, 2001). Also, studies demonstrated that wall acidification causes
loosening of the cell wall structure by activating expansins and glucanases, followed by
the dissolving of cell wall elements (Cosgrove, 2005; Kotake et al., 2000; McQueenMason and Cosgrove, 1995). This loosening allows cell expansion driven by turgor
pressure in the cell, generated by vacuolar uptake of water (Hager, 2003; Kotake et al.,
2000; Rayle and Cleland, 1992a).
Auxin may regulate H+ pump activity at multiple levels possibly by regulating its
level of transcription, protein degradation, or activity of pumps through phosphorylation
of the autoinhibitory domain, by binding of 14-3-3 proteins or by other processes. A
range of studies have demonstrated that the pumps are regulated in numerous
physiological processes but the mechanism by which auxin regulates the pumps has not
been clearly defined in part since key auxin-regulated isoforms have not been identified
(Gaxiola et al., 2007).
While much still remains to be understood about the mechanisms by which auxin
regulates plant growth and development, key pieces of these processes are being
uncovered. For example, auxin has been shown to regulate gene expression by regulating
the activity of transcription factors that bind auxin responsive promoter elements through
ubiquitin-mediated degradation of repressor proteins. Auxin has been shown to regulate
the transcription of genes including the SAUR (small auxin-up RNAs), GH3, RolB, and
Aux/IAA genes (Gil et al., 1994; Hagen and Guilfoyle, 2002; Maurel et al., 1994). The
8
plasma membranes H+-ATPase, this study’s gene of interest, are among the genes
proposed to be regulated by auxin. Evidence for an increase in pump transcription or
translation in response to auxin has only been observed in limited studies. One study
showed that the amount of immunologically detectable maize isoform MHA2 increased
in response to auxin (Frias et al., 1996; Rober-Kleber et al., 2003). Other genes of
interest, such as SAURs, are small nuclear proteins that are rapidly degraded. These
proteins were first identified in soybeans but are now known to be present in a wide range
of plant species including Arabidopsis. Several forms of GH3, which also was initially
found in soybeans and are also now known to be present in many species, including
Arabidopsis, are auxin responsive (Hagen and Guilfoyle, 2002). GH3s are responsible for
conjugating free IAA (Indole-3-acetic acid) with various amino acids by means of IAAamido synthetase and are primarily involved in the regulation of the level of free IAA
through its activity in directing conjugation of free IAA to form bound, inactive, IAA.
These conjugates are then either degraded or stored (Staswick et al., 2005). The RolB
gene from Agrobacterium has also been found to be auxin responsive (Maurel et al.,
1994). Since the transcription of these genes increases in response to auxin, it is
hypothesized that their promoters include regulatory elements that are responsive to
auxin and, in some instances, these have been identified. Among the elements that have
been identified are the GH3 AUXREs (auxin response elements) that include the
sequence TGTCTC and the sequence ACTTCA from RolB (Mauro, 2001). All of these
sequences utilize auxin to modulate gene expression via ARFs, Auxin Response Factors
(Guilfoyle and Hagen, 2007). There are numerous activator and repressor ARFs that are
9
found in different levels throughout plant tissues that bind to AUXREs, these are in
constant competition with each other to maintain normal plant function.
Plant cells regulate binding of ARFs to auxin response elements in a process to
control the amount of circulating transcriptional repressors or activators through the
ubiquitin pathway. Ubiquination is a highly ordered pathway that is utilized by cells to
regulate protein level by tagging proteins which in turn directs them for destruction in the
proteosome. Among the proteins that are regulated by ubiquination are the AUX/IAA
proteins that are able to bind to ARFs (Hager, 2003; Tiwari et al., 2003). These
AUX/IAA proteins are small nuclear proteins that are repressor molecules which bind to
both ARFs and to regulatory elements and prevent transcription. Auxins, in high enough
concentrations within the cell, can promote the ubiquination of these repressor proteins
for rapid degradation by binding with an F-Box subunit, TIR1 and SCF (Skp, Cullin, FBox) to form a ubiquitin ligase complex which catalyzes ubiquination of the repressor
proteins. Following ubiquination, the repressor/complex is shuttled to the proteasome for
degradation (Mockaitis and Estelle, 2008) allowing essential gene transcription to occur.
Among the many other processes that auxin controls, is its ability to control the
initiation of lateral roots in plants. Lateral roots arise from the pericycle founder cells in
response to auxin and other hormones (Malamy and Ryan, 2001). Studies have suggested
that the lateral root founder cells are determined immediately after the cells exit from the
apical meristem and that these cells then enter cellular G2 arrest (Dubrovsky et al., 2000).
Auxins as well as other plant hormones, cytokinin and gibberellin, are thought to direct
re-entry into the cell cycle (Stals and Inze, 2001). In particular, auxin has been shown to
10
downregulate expression of KRP proteins (Kip-related protein) which are known to
inhibit cyclin dependent kinases (CDK) which, in turn, are key regulators of the cell cycle
(Himanen et al., 2002). Exogenous auxin starvation studies using cultured tobacco cells
also prevented cell division from occurring but when it was reintroduced cell division
resumed, indicating that it is a necessary initiator of the cell cycle (Rechenmann, 2002).
Presumably, with a decrease in the expression of cell cycle repressors in response to
auxin, cells may be able to progress through the cell cycle. Previous studies in our
laboratory in which 2.3 kb of the LHA2 promoter was fused to GUS, demonstrate that
this region of the LHA2 promoter is able to direct transcription very early in lateral root
initiation which suggests that the pumps themselves are activated very early in lateral
root initiation (Ro, 2000) and, therefore, may play a role in the control of lateral root
initiation by auxin. It is early in lateral root initiation that auxin is most important
(Dubrovsky et al., 2001), and it is possible that activation of the H+ pumps triggers lateral
root initiation.
Evidence from other organisms suggests that regulation of the proton pumps by
auxin could play a role in controlling the cell cycle. In yeast, proton pumps are
responsible for maintaining intracellular pH and have been shown to increase the rate of
cellular proliferation with the increased cytosolic pH that results from activation of the
pump (Perona and Serrano, 1988). Extensive work in the field of cancer biology has
demonstrated that pH changes can cause increased cellular growth and drive progression
through the cell cycle. One study using mouse NIH3T3 fibroblast cells found that
treatments that are able to increase the H+/Na+ antiporters/exchanger activity increase
11
intracellular pH and seem to cause progression into the cell cycle in tumorogenic
fibroblast cells and other transformed cell lines (Harguindey et al., 2005). Another study
conducted with transfected mouse fibroblast cells expressing the yeast proton pump,
PMA1, showed an increase in cellular proliferation (Perona et al., 1990). If activation of
proton pumps by auxin is an essential component in the regulation of the cell cycle in
plants, then their activation in the percicycle could be the trigger that drives lateral root
initiation.
Auxin Transport
All plant cells seem to be capable of producing auxin, however production is
mainly accomplished in younger rapidly dividing cells and, as a result, a transport system
is needed to shuttle the hormone around the plant (Taiz and Zeiger, 2010). The
directional, or polar, flow of auxin from root tip towards the root-shoot junction and from
the shoot apex downward is largely accomplished by movement of auxin molecules from
cell to cell with an apoplastic step between cells while only small amounts of movement
is accomplished entirely through the symplast (i.e. from cell to cell through
plasmodesmata). Polar auxin transport is a highly ordered process that requires ATP.
Auxin uptake is carried out around the whole cell through a combination of auxin influx
carrier proteins and diffusion. It has been demonstrated that the plant cell will rearrange
the auxin influx and efflux carriers to, in part, produce directional transport of auxin
through the cells. Diffusion, in combination with transporters, also contributes to this
directional movement. Acidification of the apoplast by the H+-ATPase causes auxin in
12
the apoplast to become protonated. The protonated form of auxin is uncharged (IAAH)
and these uncharged molecules are able to freely diffuse through the plasma membrane
and so move readily from the apoplast into the cytoplasm. After diffusing into the more
basic cytoplasm, they will become unprotonated and the resulting charged form (IAA-)
cannot diffuse back across the membrane (Blakeslee et al., 2005) . Anionic forms of IAA
(IAA-) are transported through protein carriers including AUX and PIN (Pin-formed)
family members. These transporters are H+- coupled secondary transporters, therefore
the proton gradient provided by the H+ pump provides the driving force for transport
through these carriers. These transporters are often differentially localized in the cell
and so produce polar transport as a result of their localization (Li et al., 2005).
H+-ATPase Mutagenesis, Overexpression, and Constitutive Activation
To be able to understand the roles that the H+ pumps plays in the cell, many
studies have utilized expression systems in which H+-ATPase expression has been
modified. Several types of studies have been shown that reduction of one isoform of the
H+ pump will cause no significant loss of function or organism death (Duby et al., 2009;
Haruta et al., 2010). However there are also studies where even a single loss of the H+
pump will cause retardation (Li et al., 2005; Zhao et al., 2000) or organism death. This is
true in the case of animal cells where mutation of the Na+/K+ pumps will often lead to
cell death. Multiple H+-ATPase pumps which have been silenced or knocked out have
also shown severe growth and developmental defects or lethality in plants when multiple
isoforms are inactivated (Haruta et al., 2010). As discussed earlier, the number of plasma
13
membrane H+ pump isoforms in plants implies that there may be overlap of function (i.e.
functional redundancy) between isoforms. Individual isoforms are expressed in cell and
tissue specific patterns that may overlap (Ewing and Bennett, 1994). The apparent
redundancy of H+-ATPases may allow cells to provide regulation of the pumps in a more
complex pattern than a single or a few isoforms might allow. The regulation of
individual isoforms may also allow cells to compensate for experimental manipulations
of pump activity. In order to further explore the roles of the H+ pump in vivo, we have
overexpressed a tomato H+-ATPase isoform in Arabidopsis. Several other studies have
explored the effects of overexpression of the H+ pump on the plant. The overexpression
construct used in this study utilizes the 35S Cauliflower Mosaic Virus promoter, which
will insure a high degree of expression in all cells (Benfey and Chua, 1990). In order to
bypass the effects of the autoinhibitory domain that will generally inhibit the function of
the pump without activation, our overexpression construct was designed to include a
truncated coding region that yields a pump that lacks the autoinhibitory domain. Other
studies have shown that removal of this 38 amino acid residue C-terminal autoinhibitory
region leads to activation of the pump (Baekgaard et al., 2005).
Overexpression of a constitutively activated pump will help us determine the
effects that the H+ pump has on plants. Several studies have overexpressed H+-ATPases
in order to define their roles in cell expansion and organogenesis. One study, that is
similar in design to this study, overexpressed the tobacco H+ pump PMA4 in the tobacco
plant (Gevaudant et al., 2007). This study used the 35S promoter to overexpress a native
PMA4 H+ pump and a constitutively activated native PMA4 H+ pump to look at
14
expression, cell expansion and H+-ATPase activity. Overexpression of the native PMA4
increased expression but the plants remained morphological and physiologically identical
to the wild-type tobacco, most likely due to the pump autoinhibitory domain, while
overexpression of the constitutively activated PMA4 had slightly elevated expression and
definitively increased activity of the H+ -ATPase activity compared to the wild-type
(Gevaudant et al., 2007). Several overexpression studies using the Nicotiana isoform
PMA4 demonstrated changes in expression patterns due to co-suppression of similar
pumps (Gevaudant et al., 2007; Zhao et al., 2000). Our study utilizes a H+ pump from
tomato (LHA2) introduced into Arabidopsis in order to avoid co-suppression. Cosuppression is the anomaly where introduced genes from the same species can suppress
similar endogenous genes and can have a wide range of deleterious effects on the plant,
such as silencing of both the transgene and its endogenous copies (Taylor, 1997; Zhao et
al., 2000). Co-suppression requires very high sequence similarity; therefore, the
utilization of a tomato isoform will reduce the likelihood of co-suppression. However,
these genes are still highly conserved and LHA2 is still over 90% identical at the
nucleotide level with the most similar Arabidopsis isoforms, so the possibility of cosuppression remains.
Plant Plasticity
In order to survive under different environmental conditions plants have
undergone many evolutionary adaptations. Arabidopsis thaliana is the model species for
plant biology and can reveal these adaptations, especially under extreme conditions such
15
as serpentine soils, which are characterized by lower calcium, higher magnesium, and
increased amounts of heavy metals while also being nutrient deficient. Studies involving
A. thaliana revealed a mutated gene, CAX1, which enables plants to handle the stress of
serpentine soils more effectively than wild-type plants. The normal wild-type gene is a
tonoplast (vacuolar membrane) calcium proton antiporter, that relies on the proton
gradient driven by the vacuolar H+ -ATPases (or pyrophosphatases), and it is normally
responsible for transporting calcium into the tonoplast maintaining homeostasis of
intracellular calcium. The mutated cax1 gene was found during a screening process in
which A. thaliana was grown under simulated serpentine soil and has been shown to be a
loss of function mutant (Bradshaw, 2005; Cheng et al., 2003). The studies showed that
under low calcium conditions (suboptimal calcium concentrations in soil), mutant A.
thaliana with the loss of function cax1 gene will maintain calcium at tolerable levels in
the cytoplasm as a result of not being able to transport calcium into the vacuole from the
cytoplasm. In natural systems selection will favor changes in genes and how they are
regulated that increase survival. In this case mutations have allowed the plant to survive
in low levels of calcium by a mutational deactivation of a calcium antiporter, effectively
keeping all available calcium in the cytoplasm (Bradshaw, 2005; Cheng et al., 2003).
Another member of the Arabidopsis genus, A. lyrata, when grown on serpentine and
normal soils were analyzed and revealed several polymorphic differences including many
in the P-type heavy metal pumps (Turner et al., 2010). Research using the heavy metal Ptype ATPases, AtHMA4 in yeast, revealed that this pump may allow plants to survive in
soils with higher concentrations of heavy metals such as zinc and cadmium (Mills et al.,
16
2003; Yang et al., 2005). Serpentine soil experiments using Arabidopsis species have
provided a means to determine which genes and P-Type ATPase pumps are expressed
under different conditions, which can direct our focus for our current and future studies.
Since there are multiple H+ -ATPase genes in plants, it is not surprising that these genes
are differentially expressed and can allow the plant to survive and grow in a range of
environments.
As noted above, plants are resilient but sedentary organisms and have adapted to
survive in many environments through cellular modifications and through the ability to
modify their growth and development in response to environmental conditions. Several
overexpression studies have tried to determine the effects of overexpression of the proton
pump on salt tolerance. High saline environments normally cause cellular desiccation as
the cells are not able to maintain normal turgor and water levels. In particular to salt
studies, overexpression of the vacuolar H+ pumps (which are not P-type ATPases) was
found to confer an increase in plant tolerance to high salinity as a result of sequestration
of salt in leaves (Gaxiola et al., 2001). The current understanding is that vacuolar H+ ATPase pumps drive the secondary transporters responsible for transport of sugar, ions
and other organic acids into the vacuole which is required to maintain internal cellular
water balance (Gaxiola et al., 2001). Our overexpression study using the 35S::LHA2
transgene could possibly have similar effects on the plant and promote resistance to a
wide range of conditions.
17
Objectives and hypotheses
Prior research in this laboratory has been focused on the tomato H+-ATPase
isoform, LHA2 including cloning and analysis of the promoter region. The LHA2
promoter region has been shown to contain three GH3 TGTCTC AuxREs and one rolB
ACTTCA element ((Idate, 1997; Ro, 2000). To test the possibility that these elements
play a role in the regulation of LHA2, Kathy Bradshaw, Manjari Dani, and Greg
Gambetta conducted studies in our lab using constructs consisting of 2.3 kb of the LHA2
promoter fused to the reporter gene GUS. These studies demonstrated that this region of
the promoter of LHA2 is auxin-responsive throughout plant structures in both
Arabidopsis and tomato, including the root, hypocotyl and shoot (Bradshaw, 2001;
Gambetta, 2005). Work by Manjari Dani, explored the affect that auxin has on lateral
root formation in both tomato and Arabidopsis plants. In her study, the application of
exogenous auxins caused a decrease in primary root growth compared to wild-type
control plants (Dani, 2007). Numerous other studies have shown these results and this
decreased root length has been attributed to auxin levels being driven above optimal
levels, with these higher levels causing a decrease in cell growth and cell division
(Rahman et al., 2007).
To test the role of the H+ pump isoform LHA2, Akihiro Tsuyada and Anna Lee,
former graduate students from this lab, successfully prepared a CaMV35S::LHA2 gene
construct and transferred it into Arabidopsis using Agrobacterium-mediated
transformation and carried out initial studies examining the effect of the overexpression
of LHA2 on Arabidopsis growth (Lee, 2007). The CaMV (Cauliflower Mosaic Virus)
18
35S RNA promoter causes constitutive gene expression and has been used in many
applications to drive transgene expression to high levels (Benfey and Chua, 1990). The
constructs generated in our lab consist of the 35S promoter fused to the LHA2 gene and
should cause overexpression of LHA2 upon transfer into Arabidopsis. The prior studies
examined two single-copy lines and one multi-copy line. The multi-copy line behaved
very differently from the two single-copy lines. This could be due to the effect of a higher
level of expression in the multi-copy line, to position effects resulting from where the
genes landed in the genome, or some other unknown effect. In order to determine the true
effect of overexpression, additional single copy lines were generated and analyzed along
with the previously isolated single copy lines.
In this study the overexpressing lines are used to test the hypotheses that 1)
activation of the plasma membrane H+ pump by auxin causes plant cell growth as
described in the Acid Growth Theory and 2) that activation of the plasma membrane H+
pump by auxin triggers lateral root initiation. Since it is possible that overexpression of
the pump affects auxin transport we also examined root growth and lateral root initiation
in the presence of the auxin transport inhibitors 2,3,5-triiodobenzoic acid (TIBA), and N1-naphthylphthalamic acid (NPA) in order to separate direct effects of activation of the
pump from effects on auxin transport. These two chemicals cause a restriction of the
polar flow of auxins by affecting auxin efflux carriers enough to limit the influence of
auxins on the cell cycle (Casimiro et al., 2001; Estelle, 2001). If we observe increases in
root length and/or lateral root initiation in overexpressing lines compared to wild-type
lines in the presence of these inhibitors this would provide additional support for the
19
hypotheses that activation of the pump causes cell growth and triggers lateral root
initiation.
20
MATERIALS AND METHODS
Assembly of the LHA2 Construct
The LHA2 construct was prepared prior to this study by previous graduate
researchers Anna Lee and Akihiro Tsuyada in the vector pK2GW7 destination vector and
designated LHA2/pK2GW7 (Figure 1). This construct consists of an LHA2 cDNA
placed downstream of the 35S Cauliflower Mosaic Virus promoter which should drive a
high level of expression in all cells. The cDNA was generated using reverse transcriptasePCR and a primer set that was designed to amplify a truncated cDNA with a new stop
codon that will yield a polypeptide that is shortened by 38 amino acids relative to the
normal LHA2 gene product. This resulted in removal of the autoinhibitory domain and,
based on previous studies (Regenberg et al., 1995) yields a constitutively activated pump.
Growth of Arabidopsis Plants for Floral Dip
Wild type Arabidopsis thaliana Col0 ecotype that were originally obtained from
the Arabidopsis Biological Resource Center (http://abrc.osu.edu/) and subsequently
propagated by students in our lab were planted on 4 inch diameter plastic pots with soil
filled to a mound above the rim of the pot. A nylon mesh cover was secured by rubber
band over the top of the mound to allow the shoots and leaves to exit through the mesh
and then to not fall out during floral dip. About 15-20 Arabidopsis plants were kept in
each pot with adequate spacing between each. The plants were grown for 5-6 weeks in a
growth chamber at 25 degrees under 16 hour day and 8 hour night cycles. All wild-type
21
Figure 1. LHA2/p2KGW7 Construct map
22
and transgenic plants were watered daily with the pots sitting in water, to prevent soil
desiccation. Inflorescences were periodically cut to promote to increase the number of
inflorescences and to cause more uniform flowering.
Floral dip infiltration of Agrobacterium tumerfaciens containing the plasmid
LHA2/pK2GW7
This is an adapted version of the floral dip method created by Clough in 1998
(Clough and Bent, 1998). Agrobacterium AGL1 cultures containing the plasmid
LHA2/pK2GW7 were started 3-4 days prior to infiltration. Starter solutions were used to
inoculate 600 ml of LB medium with spectinomycin (55 µg/ml). This culture was
allowed to grow until the culture reached 1.8-2.0 at an OD600 which was determined by
removing 1 ml samples and measuring the absorbance of these in a Shimadzu Bio-mini
DNA/RNA/Protein Analyzer. Cells were spun down at 5000 x g for 10 minutes in a
centrifuge. The pellet was re-suspended in an infiltration mixture consisting of 0.5 x
Murashige and Skoog Salt and Vitamin Mix (Sigma), 5% w/v sucrose (Sigma), 9.09x10-3
µm of benzylaminopurine (1mg/ml; Sigma), 0.03% v/v Silwet L-77 (Sigma) to a final
density of OD600 of 0.8-1.0. Wild type Arabidopsis thaliana, Col0, plants were grown as
described above and were used in floral dips when the inflorescences reached
approximately 10 cms. The plants were inverted and dipped into the Agrobacterium
solution, removed, and placed in an inverted position for an additional 20 minutes. The
plants were then removed, placed in an upright position and covered with a plastic dome
or plastic wrap to delay evaporation of the solution that remained after dipping. The
23
plants were allowed to continue to grow and mature seeds were collected over the next 45 weeks.
M/S agar selection plates
Selection was carried out on 0.5X M/S agar plates consisting of MS salt and
vitamin solution (final concentration is 0.5x), 1% w/v of sucrose (Sigma), 0.05% w/v of
MES buffering agent (Sigma) and 0.8% w/v phytagar (Sigma). The solution was brought
up to a pH of 5.8 using a 1N KOH solution, autoclaved for 22 minutes and kanamycin
was added to 40 µg/ml after cooling to 65 oC, The plates were poured under sterile
conditions and allowed to set overnight. They were stored at 4 oC until needed.
Seed Sterilization
In order to insure surface sterility during growth, seeds were sterilized before
addition to selection plates. The protocol used to sterilize seeds was adapted by previous
researchers in this lab. Seeds were placed in separate 1.6ml tubes. One ml of 100%
ethanol was added, mixed and allowed to incubate for 5 minutes. The ethanol was
removed and one ml of 20% bleach and 0.3% Triton-X100 solution was added, mixed by
inversion and allowed to stand for 10 minutes. The bleach solution was removed and one
ml of 100% ethanol was added, mixed and incubated for 5 minutes. In a laminar flow
hood, ethanol was removed and one ml of 100% ethanol was added and seeds mixed. The
ethanol was removed and one ml of sterilized water was added, removed and repeated 3
24
more times. The seeds were then placed at 4 oC for one week to promote even
germination.
Screening for transformed lines of 35S:LHA2 Arabidopsis
Transformed Arabidopsis seeds were grown on MS selection plates (solution
described above containing 40 µg/ml kanamycin) for 14 days under sterile conditions.
Segregation ratios were used to determine whether the transformed lines contained a
single insertion of the 35S:LHA2 gene or multiple insertions. Plants that turned yellow
and grew slowly before 10 days were scored as having failed selection and were
presumed to lack the transgene. Plants that remained green through the ten day growing
period were considered to have the transgene and allowed to self-fertilize for seed
collection. A ratio of approximately 3 green (live): 1 yellow (dying) indicates a single
insertion of the transgene (or two closely linked copies) whereas a double insertion is
expected to produce a ratio of approximately 15 green: 1 yellow with increasing numbers
of insertions showing increasing deviation from a 3:1 ratio. Homozygous lines were
selected for either single insertion or multiple gene insertions by carrying on lines from
which all plated seeds grown on kanamycin yielded only green plants. Seedlings from
these plates were moved to soil and seeds were collected.
Primer Design
All primers were ordered and synthesized through Eurofins, Operon Company
(Huntsville, Alabama). Primer design was done using the Invitrogen OligoPerfect
25
Designer and NCBI’s Primer-blast software. Primer sets were designed to have a similar
melting point and GC content. Multiple genes were used in this study for both gene
verification and real-time PCR see below (Table 1). The primers were designed to span
intron and exon sequences in order to differentiate between genomic DNA contamination
and cDNA during real-time PCR analysis whenever possible.
Verification of LHA2 gene insertion
To verify whether the transcript was inserted into the Arabidopsis genome, DNA
extractions were performed using Qiagen DNAeasy (Qiagen, Cat.No. 69104) spin
columns or a protocol adapted for plant tissue using BioRad’s Instagene Matrix. PCR was
performed using primers specific to the LHA2 transgene and GAPDH, mentioned above
at a concentration of 10 µm. Each PCR reaction consisted of 1x Finnzymes reaction
buffer, 1.25 units of Finnzymes Thermus brockianus Taq Polymerase, 1 µl 2 mM MgCl2
(Finnzymes), 0.1 mM Finnzyme dNTPs, 0.4 µM forward primer, 0.4 µM reverse primer,
plus 1 µl (100ng/ µl minimum after genomic extraction) of corresponding genomic DNA
and in sterile DNAase and RNAase free water. Typical reaction steps for each PCR were
as follows: 1. 5 minutes at 94 degrees Celsius 2. 30 seconds at 95 degrees Celsius for
denaturation 3. 30 seconds at 54 degrees Celsius for annealing 4. Cycle repeats 28 times
from step 2 5. Last extension is at 72 degrees Celsius for 10 minutes. The resulting DNA
was separated by electrophoresis through a 1.5% agarose gel in 1X TAE buffer. DNA
was visualized with ethidium bromide or SYBR safe (Invitrogen) staining and an
AlphaImager was used to view the gel and capture a gel image.
26
Table 1. Primer sequence data for use in PCR, RT-PCR and qPCR
Name
LHA2<250bpFPri
LHA2<250bpRPri
AraRev204CAC
AraFor204CAC
AraRev119TIP4
AraFor119TIP4
LHA2Rev161
LHA2For161
AraAct2<300bpRPri
AraAct2<300bpFpri
AraGAPDH831FPri
AraGAPDH1089RPri
Ara2GAPDH1002FPri
Ara2GAPDH1125RPri
Length (bp)
20
20
20
20
20
20
23
21
20
20
20
20
20
20
Sequence from 5' to 3'
TATTGTGCTTGGTTTTATGC
ACTGTCATCATTGCCAAGTA
TGTGTTTAATGTTCAGCAT
ATCCGTTCAAATCTTTTAT
TTCAGTTTCTGTGTCGTAT
GAAGCAACATTTCAGTCTC
AGTCATCAGTTGCTGTCCTCTG
GCCTGATAGTTGGAAGCTGG
TCCTGATATCCACATCACA
GAGACATCAAGGAGAAGCT
GACCAGAAATTCGGTATCAT
ACTTCCTCAGCAATGTCTT
AACCTCAAAGGAAAACTCAA
AGCTCTTTCTCTGCAGAATC
27
Quantification of RNA and cDNA
In order to ensure equal loading of RNA and cDNA in reverse transcription and
for loading in real time PCR reactions the concentration of isolated DNA and RNA was
determined using a Nanodrop ND-1000 instrument. Samples were run in triplicate at the
University of California at Davis GBSF building.
Verification of LHA2 expression using Reverse Transcriptase-PCR
To determine whether the overexpression lines were expressing the LHA2
transgene, reverse transcriptase-PCR was performed. Total RNA from each line, wildType, LHA2-2C, LHA2-3C, LHA2-6H and LHA2-12K was extracted using the
RNAeasy Mini Kit with a Qiashredder according to the manufacture instructions. Total
RNA was converted into cDNA by reverse transcription with by oligo dT and random
hexamer primers using Bio-Rad’s iScript cDNA Synthesis Kit according to the
manufacturer’s instructions. These cDNAs were used in PCRs using primers for the
LHA2 gene and GAPDH housekeeping gene (see table for LHA2-161 and GAPDH2
primer sets) in 30 cycle reactions. The PCR products were run on a 1.5% TAE agarose
gel and visualized under UV light.
Quantitative analysis of LHA2 expression
Gene expression levels were measured using real time quantitative-PCR on an
iCycler iQ5 thermocycler. A 2-step qPCR experiment was used whereby total RNA was
converted to cDNA (described above) and then run in a PCR reaction with primers
specific for LHA2 or the housekeeping genes TIP 41 and GAPDH. Briefly, 25 ul
28
reactions were prepared using Bio-Rad’s iQ Sybr Green Mastermix according to
manufactures specifications. Samples and blanks were performed in triplicate. Cycling
conditions were as followed; 1. Activation of the antibody tagged Taq polymerase at 95
degrees for 12 minutes, 2. Denaturation at 95 degrees for 30 seconds 3. Annealing at 56
degrees Celsius for 30 seconds 4. Repeat to cycle 2 for 35 cycles 5. Melt curve analysis
for 81 cycles at 0.5 degrees increments for 15 seconds each. Data analysis was completed
using Bio-Rad software and data was calibrated to either the wild-type control or the
LHA2 overexpression plant with least expression.
Phenotypic Analysis
Seeds were plated on 0.5X M/S Agar (see above) with 11 seeds per plate and the
plates were oriented vertically in a growth chamber at 24 oC with 16h/8h light/dark
cycles. Plants were allowed to grow for five days post-germination with germination
defined as the time of emergence of the radicle. After five days of growth seedlings were
transferred to 0.5X MS plates with either no additions, the solvent DMSO alone 0.005%
(volume/volume), or NPA or TIBA at 0 µm, 0.1µm, 1 µm or 10 µm. Primary root
lengths and the number of emerged lateral root growth were observed under a
stereomicroscope and recorded for 8 consecutive days post germination. The daily
measurements were no longer taken for individual plants once plants their roots reached
the bottom of the plate while plants were omitted entirely if there was fungal or bacterial
contamination or if the root grew in too tight a spiral to allow measurements to be taken.
29
Data for both the root and germination tests were analyzed using Student's t-tests of
individual overexpression lines compared to the wild type.
Extracellular Acidification Assay
Seeds were germinated vertically on M/S plates (described above) for 5 days.
Single 5 day old seedlings from wild-type and overexpressing lines, LHA2-2C, LHA23C, LHA2-6H and LHA2-12K were transferred to a well in a 96 Costar black walled
fluorescent 96 well plate (Figure 2) containing 250 µl per well of growth solution (0.25x
M/S solution, 1% sucrose, 30 µM Dextran Oregon Green MW 10000 (Invitrogen) for 16
hours. Fluorescent emissions were detected at 530 nm and excited at 490 nm using a
Promega GloMax microplate reader. The media pH was calibrated using a standard curve
range from pH 4.1 to 6.2.
30
Figure 2. A black walled fluorescent plate loaded with plants before obtaining pH
fluorescent readings on a Promega Glomax plate reader. Plants were removed prior to
reading after growing in solution for 16 hours.
31
RESULTS
Agrobacterium-mediated Transformation of Arabidopsis
The 35S::LHA2 construct was introduced into the wild-type Arabidopsis thaliana,
Col-0 ecotype, by Agrobacterium-mediated transformation using the floral dip method.
Approximately 1200 seeds were screened for the presence of the selectable marker that
confers kanamycin resistance by growth on 0.5 X MS agar plates containing kanamycin.
Following surface sterilization and plating, seeds that are capable of germinating do so
and begin to grow. Plants that are resistant to kanamycin thrive and remain green and are
selected for further analysis. Plants that are not resistant yellow and die (Figure 3). To
determine which seeds contained the transgene, seeds were surface sterilized and plated
on kanamycin. The majority of the seeds germinated on kanamycin containing plates
within one to three days. After 14 days of growth, nine individual plants remained green
and had significant leaf and root growth and, therefore, were selected for further analysis.
Plants that were not able to grow on kanamycin and did not have significant root growth
turned yellow after 14 days and were presumed to lack the transgene. The nine potential
lines, designated LHA2-4 through LHA2-12 that did not yellow was transferred to soil
and allowed to self-fertilize for an additional two months for seed collection. The seeds
from these nine lines were used to determine the copy number of the LHA2 gene.
32
.
Figure 3. Selection on 40 µg/ml kanamycin sulfate (14 days post-germination). An
overexpression line, LHA2-12-2, grown on agar plates with kanamycin showing both
green (live) and yellow (dead) plants. The number of live and dead plants was used to
calculate the segregation ratios which can be used to infer copy number and whether or
not the line is homozygous for the transgene.
33
Determination of Transgene Copy Number
One of the objectives of this study was to create independent single copy
Arabidopsis lines containing the 35S::LHA2 transgene which should lead to the
overexpression of the constitutively active plasma membrane H+-ATPase. As described
above, in previous work in our lab, Anna Lee and Akihiro Tsuyada generated two
overexpressing single copy lines (LHA2-2C and LHA2-3C) and a single multi-copy line
(LHA2-1C). While the two single copy lines behaved similarly, the multi-copy line
behaved quite differently. Therefore, in this study we set out to isolate additional
independent single-copy lines (which are completely independent biological replicates) to
determine if the phenotypic effects observed in the two single copy lines are the true
effects of H+-ATPase overexpression. Since Arabidopsis is self-pollinating, lines
segregating for the presence of the transgene can readily be analyzed to determine the
number of transgenes present using the principles of Mendelian inheritance. For
example, a plant with a single copy of the transgene (i.e a hemizygous plant) will yield
kanamycin resistant progeny in a 3:1 ratio of green to yellow plants since one-half of the
progeny will be hemizygous with a single copy of the transgene, one-quarter will be
homozygous for the transgene, and one quarter will lack the transgene entirely (Figure 4).
A ratio of 15:1 (resistant to non-resistant) is expected for a self-crossed plant with two
copies of the transgene (Figure 5).
Segregation analysis (Table 2) revealed that two of the lines from the original
nine plants, LHA2-6 and LHA2-12 were likely to be single copy lines. The observed
segregation ratios of, 1:3.54 for LHA2-6 and 1:3.3 for LHA2-12 follow the Mendelian
34
A
a
A
AA
Aa
a
aA
aa
Figure 4. Mendelian inheritance in the event of a single transgene insertion. Capital “A”
indicates the presence of the transgene at one location in the genome, the lower case “a”
indicates the lack of a transgene at that locus.
35
AB
Ab
aB
ab
AB
AA BB
AA Bb
aA BB
Aa Bb
Ab
AA Bb
AA bb
Aa Bb
Aa bb
aB
aA BB
aA Bb
aa BB
aa Ba
ab
aA bB
aA bb
aa Bb
aa bb
Figure 5. Demonstrates the expected outcome of the self-cross of a line containing two
copies of the transgene. Capital “A” indicates the presence of the transgene at one
location in the genome, the lower case “a” indicates the lack of a transgene at that locus.
Capital “B” indicates the presence of the transgene at a second locus and lower case “b”
denotes the lack of a transgene at this second locus. The parental genotype following the
primary transformation event in the instance of the insertion of two transgenes is then
AaBb. Of these progeny, one in fifteen is expected to have the genotype aabb and
therefore lack resistance to kanamycin.
36
inheritance pattern expected for a single transgene insertion. A standard Chi square test
was used to determine whether segregation ratios were statistically significant to qualify
these plants as single copy lines. To be able to accept the null hypothesis, in this instance,
that these transgenic lines are not single copy lines, Χ2 values would need to be above a
critical value of 3.85, for a P value of 0.05. The 1.852 Χ2 value for LHA2-6 and the
0.0275 Χ2 value for LHA2-12 were below the critical value meaning we can reject the
null hypothesis that these lines were “not” single copy. The Chi square test (Table 3)
supports the conclusion that these two lines, LHA2-6 and LHA2-12 are indeed single
copy lines. With the creation of these two new independent single copy lines and the two
homozygous single copy lines previously created by a former researcher in this lab, Anna
Lee, the single copy LHA2-2C and the LHA2-3C lines, there are a now a total of four
transgenic single-copy lines. The two new independent lines, LHA2-6 and LHA2-12,
however would need to undergo further development to ensure they are homozygous
lines.
Generation of Homozygous Single-copy Lines
Once the lines LHA2-6 and LHA2-12 were shown to have resulted from a single
transgene insertion event seeds from the F2 generations of each of the parental lines
LHA2-6 and LHA2-12 were screened on MS Agar plates with kanamaycin in order to
select for individuals that were homozygous for the transgene. Transgenic plants were
considered homozygous when all progeny remained green and healthy when grown on
kanamycin plates while wild-type plants growing on plates with identical media yellowed
37
Table 2. Segregation analysis for the single insertion lines LHA2-6 and LHA2-12.
LHA2-6:
Single insertion
Observed Expected
No. nontransgenic
No. transgenic
LHA2-12:
Single insertion
Observed Expected
13
18
28
81
59
54
27.25
81.75
Total sample No.
72
109
Non-transgenic /
Tot. sample No.
1/4.54
1/ 4
1/4.3
¼
Segregation
1:3.54
1:3
1:2.97
1:3
38
Table 3. Chi square (Χ2) test for LHA2-6 and LHA2-12 transgenic lines.
Χ2 values (1.852 and 0.0275) are smaller than critical value (3.85) for p=0.05.
Observed
Expected
O-E
(O-E)2
(O-E)2/E
Nontran
13
18
-5
25
1.389
LHA2-6
Trans
59
54
5
25
0.4630
Total
72
72
1.852
Nontran
28
27.25
-0.75
0.5625
0.0206
LHA2-12
Trans
81
81.75
0.75
0.5625
0.0069
Total
109
109
0.0275
39
and died. Over 100 seeds of each potential transgenic line were grown on kanamycin
plates in each screen. Several homozygous F2 plants were identified for each line,
designated with a letter (i.e. LHA2-6A, -6B, etc.). All 87 seeds from the plant LHA2-6H
that germinated survived on kanamycin as did the 82 seeds from LHA2-12K line. Plants
from these screens were transplanted to soil and grown for an additional two months for
seed collection to be used in the rest of this study. Several additional homozygous sublines from the primary transformants, LHA2-6 and LHA2-12 were identified and seeds
from these plants were also saved for future studies. The two resulting independent
homozygous single copy lines (LHA2-6H and 12K) were used in this study.
PCR Detection of Transgenes in Extracted Genomic DNA
In order to validate the kanamycin screening and the homozygous transformed
plants were in fact carrying the LHA2 transgene, genomic DNA extractions were taken
from 2 week old whole plants. The DNA extracts from the transgenic LHA2-2C, -3C, 6H and 12K and the wild-type line were then run using PCR to amplify the LHA2
transgene using the LHA2161 primer pair (see primer table, Table 1). The products were
separated using on a 1.5% agarose gel to discriminate size of the amplicons. Products that
were 161 bp represented the LHA2 transgene. Purified pCR8/LHA2 plasmid DNA was
used as the positive control and a 2-log ladder was used as a marker. The results confirm
that our transgene is found in the transgenic overexpression lines, lanes 3-6, but not in the
wild-type line, lane 2 (Figure 6).
40
Figure 6. PCR detection of the LHA2 transgene in the transgenic overexpression lines
and the wild-type parental line. The primer set LHA2-161 was used to determine if the
transgene was present. Predicted transgene bands of around 161 bp were observed. Lane
2, the wild-type lane contained no product for the transgene, Lanes 3-6 were LHA2-2C, 3C, 6H and 12K contained a band for the transgene. The positive control was the plasmid
pCR8 containing the LHA2 transgene, lane 8. The negative control was a no template
control.
41
Detection of LHA2 mRNA: Reverse Transcriptase PCR
Before functional and phenotypic root assays were performed it was necessary to
determine whether the overexpression lines were actually expressing the LHA2 mRNA
transcripts. In order to confirm mRNA expression, reverse transcriptase PCR was
utilized. RNA that was extracted from 14 day old transgenic and wild-type plants was
quantified to ensure that approximately equal amounts of RNA were used during reverse
transcriptase PCR. The resulting cDNA products were then quantified to ensure that
equal amounts of cDNA were used in the subsequent PCR. The amplified cDNA
products resulting from the reverse transcriptase PCR reactions for LHA2-2C, -3C, -6H
and -12K lines and the wild-type line were run on a 1.5% TAE gel using gel
electrophoresis to differentiate band sizes. Transgene products were generated using two
primer sets, LHA2<250bp and LHA2161 (see primer table) and run in tandem with the
housekeeping gene GAPDH (Ara2GAPDH primer set), a loading control and a 2-log
ladder size marker. The expected size of the LHA2 bands were 217 bp for the LHA2<250
primer set, 161 bp for the LHA2161 primer set and 123 bp for the GAPDH primer set
(Figure 7). The GAPDH primer set yielded Arabidopsis GAPDH at similar levels in all
plants, lanes 8-12 (top row) while LHA2 was found to be expressed in the overexpression
lines, lanes 3-6 (top row) and lanes 3-6 (bottom row) but not in the wild-type, lane 2 (top
and bottom row).
42
Figure 7. Reverse Transcriptase PCR from total RNA from transgenic and wild type
Arabidopsis plants. Amplification of LHA2 specific products in lanes 3-7 (top row) and
lanes 3-6 (bottom row). GAPDH specific products were run in lanes 8-12, and were used
to demonstrate that there was equal RNA loading amongst the transgenic and wild-type
lines.
43
Real Time Quantitative PCR
Real time PCR was used to verify quantitatively expression levels in the
transgenic overexpression lines and to address potential differences between lines. A twostep real time qPCR process was used to determine the mRNA levels. This entailed that
the RNA extracted from transgenic and wild-type lines were first converted to cDNA
using reverse transcription before running a quantitative qPCR. The RNA and cDNA was
quantified at The University of California in Davis using a nanodrop ND-1000, so that
even loads could be used during real time qPCR. One µg of RNA was converted to
cDNA during the first step of qPCR. Equal concentrations of cDNA were loaded in each
reaction vessel for real-time PCR to perform the second step of the real time qPCR. To
determine and calibrate expression data, several trial real time PCR reactions were run. A
gradient real time PCR was run using the LHA2161, Tip41 and GAPDH primer sets in
order to establish what the optimum annealing temperature to the optimum real time PCR
product (graphs not shown) was. The optimum temperature for real time PCR using the
three primer sets was 56 o C since this providing the best yield of product across all
samples. A melting curve established after running the real time PCR determined that
there was only one PCR product generated in each reaction (Figure 8). After establishing
the optimum temperature for the primer sets a real time PCR was run using cDNA from
the transgenic and wild-type lines with the LHA2161, Tip41 and GAPDH primer sets.
Using the Pfaffl Method of analysis we are able to determine the relative fold expression
level (Figure 9 and Table 4) in conjunction with the primer efficiencies of the three
primer sets (Figure 10, 11 and 12). Based on the gradient qPCR and the primer efficiency
44
trials, the gene with the highest level of expression was the Arabidopsis GAPDH gene
while the Arabidopsis TIP41 had the lowest level of expression. The LHA2 transgene
expression level fell between GAPDH and TIP41 expression. The results also indicated
that the expression levels were different across the four transgenic lines, while the wildtype line did not have any product for the transgene (Figure 13). The LHA2 expression
data was made relative to the lowest expressing transgenic plant, the LHA2-12K line.
Fold expression was calculated between LHA2 after normalization to GAPDH and
separately to Tip41, and then averaged together. LHA2-2C had the highest level of LHA2
expression approximately 23 times higher expression than the LHA2-12K line. LHA2-3C
had 15 times more and LHA2-6H had 1.1 times greater expression than LHA2-12K. A
second complete replicate of the real time PCR assay was performed to confirm the
expression levels across the transgenic lines. New RNA extracts were prepared from
freshly grown transgenic plants, the results confirmed that expression was indeed lower
in the LHA2-6H line and LHA2-12K (Figure 14). The LHA2-6H line had about 2 times
expression of the LHA2-12K line and the LHA2-3C line had about 9 times more
expression in this replicate.
Extracellular Root pH Assay
Proton pump activity is the primary contributor to the acidification of the region
surrounding the root. If the pump has been successfully overexpressed in an active form,
then the plants should acidify the region around the root to a greater extent than wild-type
roots. To quantify the ability of plants to acidify the medium, Arabidopsis plants were
45
Figure 8. A melt peak chart run after the gradient temperature analysis. The results
confirm that only a single product was created.
46
Fold Expression = (Efficiencytarget)ΔCt( target control-treatment)
(Efficiencyreference gene)ΔCt (reference gene control-treatment)
Figure 9. The Pfaffl Method of Analysis was used to determine the fold expression of a
target mRNA to that of a target gene.
47
Table 4. Pfaffl Method for fold expression. This is an example of how to use the Pfaffl
method to determine fold expression of LHA2 using the GAPDH housekeeping gene.
The Pfaffl method allows us to take into account primer efficiencies of both LHA2 and
GAPDH primer sets.
GAPDH
Primer Efficiency
94%
Efficiency of LHA2161 (Primer Efficiency +1)
ΔCt (Control-Treatment)
(Efficiencytarget)
ÄCt( target control-treatment)
Efficeincy of GAPDH (Primer Efficiency +1)
ΔCt (Control-Treatment)
(Efficiencyreference gene)
ΔCt (reference gene control-treatment)
Expression = (Efficiencytarget)ΔCt( target control-treatment)
(Efficiencyreference gene)ΔCt (reference gene controltreatment)
LHA2161
104%
2C
3C
6H
2.04
2.04
2.04
3.94
3.32
-0.72
16.55
10.64
0.60
1.94
1.94
1.94
-0.33
-0.59
-1.07
0.80
0.68
0.49
20.65
15.73
1.21
48
Figure 10. Amplification chart showing the primer efficiency of the GAPDH primer set.
A tenfold dilution series was used to determine the primer efficiency.
49
Figure 11. Amplification chart of the primer efficiency for LHA2161 primer set. A
tenfold dilution series was used.
50
Figure 12. Amplification chart of the primer efficiency for TIP41 primer set. A tenfold
dilution series was used.
51
Figure 13. Analysis of LHA2 mRNA expression using the Pfaffl Method. Fold
expression of LHA2 was determined by normalizing the LHA2 levels to GAPDH and
TIP41 reference genes. Data was made relative to the transgenic plant with the lowest
level of LHA2 expression, LHA2-12K, setting its expression level to one. Error bars
represent one standard deviation.
52
Figure 14. Analysis of LHA2 mRNA expression using the Pffafl method. The fold
expression was determined using both TIP41 and GAPDH as reference genes. Data was
made relative to the transgenic plant with the lowest level of LHA2 expression, LHA212K.
53
first germinated on M/S agar plates and allowed to grow for five days post germination
(dpg). These plants were then transplanted into unbuffered MS medium so that only their
roots were exposed to the medium. Dextran Oregon Green (Invitrogen), a fluorescent
molecule whose fluorescence intensity changes with pH, was used to quantify
extracellular pump activity. A pH standard curve was used to calibrate the experimental
values. A pH range of 4.1 to 6.2 was constructed to determine which concentration of
dextran Oregon Green 488 (Invitrogen) to use (Figure 15). The Oregon Green
Concentration that had the best regression value, 30µm at 0.9966, was used for the assay.
Using the linear equation from a generated standard curve an extracellular pH can be
interpolated from the fluorescent readings of the experimental values (Figure 16). Forty
wild-type, eight LHA2-2C, twelve LHA2-3C, fifteen LHA2-6H and twelve LHA2-12K
plants were grown for this assay. The transgenic overexpression lines, LHA2-2C had a
median pH of 4.73, LHA2-3C had a pH of 4.61, LHA2-6H had a pH of 4.44 and LHA212K had an extracellular pH of 4.42 while the wild-type plants had an average pH of
5.01. A Student’s T-test comparing overexpression lines to the wild-type values were
below the p<0.05 threshold (Table 5). The lower pH of the transgenic lines indicates that
the pump activity is acidifying the extracellular media at a greater rate than the wild-type.
Phenotypic Analysis of Primary Root Growth and Lateral Roots
The root acidification results above demonstrate that the pump is overexpressed in
roots. Since the overexpression construct is driven by the CMV 35S promoter it is
expected to be expressed at similarly high levels throughout the plant. It is also expected
54
2500000
Relative Flourescence Units
2000000
10 um pH y = 282525x - 992429
R² = 0.9937
1500000
20 um pH
y = 455805x - 1E+06
R² = 0.9893
30 um pH
y = 617997x - 2E+06
R² = 0.9966
1000000
500000
0
0
2
4
6
8
pH
Figure 15. Standard curves of pH at different concentrations of dextran Oregon Green.
Lines of best fit equation and regression values indicate a high correlation to all pH
standard curves.
55
Table 5. Summary of the pH analysis between the overexpression lines and the wild-type.
A student’s T-test comparing the transgenic lines to the wild-type was used to determine
the p-values.
Line
WT
2C
3C
6H
12K
Average PH
5.01
4.73
4.61
4.44
4.43
Standard Deviation
0.49
0.29
0.32
0.26
0.33
40
8
12
15
13
0.077
0.101
0.093
0.066
0.092
0.023
0.001
5.59E-07
1.82E-05
N
Standard Error
P values
56
5.2
5
4.8
4.6
4.4
4.2
4
3.8
WT
2C
3C
6H
12K
Figure 16. Extracellular pH extrapolated from a 30 µm Oregon Green standard curve.
Error bars are in standard error of the mean. LHA2-2C, -3C, -6H and -12K were all
statistically significant using a Student’s t-test with p<0.05.
57
to be constitutively active since the coding region was truncated to remove the
autoinhibitory domain. Any phenotypic trait acquired due to activation of the pump
should be able to be detectable by comparison to the wild-type lines which are not
expressing a permanently activated pump. The phenotypic assays used here focused on
both primary and lateral roots when grown under normal conditions (0.5 x MS Agar),
upright in a growth chamber (Figure 17), and under auxin inhibitory conditions (MS,
TIBA and NPA agar or a DMSO vehicle control) to determine effects of overexpression
of the pump on root growth and lateral root initiation. Plants were grown for eight days
post germination (germination being the start of day 1) and primary root lengths were
measured each day (Figure 18). A terminal 8th day graph was made to highlight the
differences in primary root lengths (Figure 19 and 30). When transgenic lines were grown
on MS plates with no additional treatments, all four single copy homozygous lines,
LHA2-2C, LHA2-3C, LHA2-6H and LHA2-12K exhibited longer roots than the control
wild-type plants. Average primary root growth for LHA2-2C was 46.6 mm, LHA2-3C
was 49.0 mm, LHA2-6H was 45.5 mm and LHA2-12K was 42.3 mm while the wild-type
primary root growth was 39.2 mm (Table 6). All results are statistically significant in
relation to the wild-type measurements using a Student’s T-test, p<0.01 (Table 6). For
lateral root numbers, transgenic and wild-type plants were grown on MS plates for 8
days. On the 8th day lateral root numbers were counted (Figure 20 and 31). Average total
number of lateral roots (nLR) of LHA2-2C was 6.46, LHA2-3C was 7.31, LHA2-6H was
5.90 and LHA2-12K was 4.47 while the wild-type was 4.57. Average root density
(nLR/Primary Root in cm) for LHA2-2C was 1.39, LHA2-3C was 1.49, LHA2-6H was
58
1.30, LHA2-12K was 1.06 and the wild-type was 1.16. Three of the four transgenic lines,
LHA2-2C, LHA2-3C and LHA2-6H exhibited significantly greater total lateral root
numbers and lateral root density when compared to the wild-type line using a student’s Ttest, p<0.01 (Table 6) however the results for the LHA2-12K line was not significant.
The second part of this root study was to determine the effects of the auxin
transport inhibitors, TIBA and NPA on both primary root and lateral root growth.
Transgenic and wild-type plants were grown on 0.1µm, 1µm or 10µm of NPA or TIBA
or with the vehicle control dosed to the highest concentration NPA or TIBA. 10 µm
treatments of either NPA of TIBA were not shown as roots could not be measured. TIBA
primary root growth at 0.1 µm (Figure 24) when comparing TIBA treated (DMSO
corrected as a percentage) transgenic plants to the wild type indicated that primary root
growth decreased in the transgenic lines, at almost a 10% decrease across all of the
transgenic lines (Figure 22). Lateral root density was greater in the transgenic lines
compared to the wild-type when using normalized data representing, the percent
differences between TIBA and DMSO (Figure 23). Primary and lateral root growth on
NPA differed from that observed in the presence of TIBA. The comparison of primary
root length and the number of lateral roots on 0.1 µM NPA compared to the DMSO
controls showed an increase in both the number of lateral roots (Figure 27) and in the
length of primary roots (Figure 26) compared to that of the wild type at eight dpg. LHA22C had retained 92.2% of primary root growth, LHA2-3C had 97.2%, lha2-6h had
105.2%, LHA2-12K had 108.7% growth while the wild-type had retained 90.0% primary
root growth (Figure 26). Compared to DMSO only controls, plants grown on 0.1 µM
59
NPA retained 51% in LHA2-2C, 48% for LHA2-3C, 45% for LHA2-6H and 45% for
LHA2-12K of the number of emerged lateral roots while the number of lateral roots
retained in wild-type plants was 7% (Figure 27). Statistical analysis using a two way
ANOVA, along with a Bonferroni correction, revealed that the variation within genotype
and also within treatment was significant for both primary and lateral roots. A Bonferroni
analysis allowed us to look at variation using multiple comparisons between our plant
line subsets. For primary roots length and lateral root number and density there were
significant differences within genotype between the wild-type and LHA2-2C, LHA2-3C
and LHA2-6H while the LHA2-12K line was not significantly different. While they
differed from wild-type and LHA2-12K, LHA2-2C, 3C and 12K were not significantly
different from each other (Tables 7, 8, 9 and 10).
Germination Rates of Transgenic vs. Wild-type Arabidopsis
In order to determine whether the transgene caused disruption in germination
rates plants were grown for 5 days on MS agar plates with no additional treatment under
sterile conditions. Cursory germination rates (Figure 32) were compiled and revealed that
the transgenic lines caused an overall decrease in the rates of germination over five days
growth. While this could be due to time of harvest of seed or storage conditions these
results suggest that overexpression affects seed dormancy or germination. Germination
percentages were predominantly lower in the transgenic lines when compared to the wildtype plants however only LHA2-2C and LHA2-12K were significantly lower when using
a Students T-test with P<0.05. However the LHA2-3C and LHA2-6H line were
60
approaching significance and with more replicates may potentially reveal a significant
effect of overexpression on germination.
61
Figure 17. Transgenic and wild-type plants grown vertically in a growth chamber. Plants
were grown for 8 dpg on 0.5X MS, 1 % SUC agar medium.
62
50.0
Growth (mm)
40.0
Wild Type
LHA2-2C
LHA2-3C
LHA2-6H
LHA2-12K
30.0
20.0
10.0
0.0
0.0
2.0
4.0
6.0
8.0
Day
Figure 18. Growth of transgenic and wild-type lines on MS agar plates. Plants were
grown for 8 dpg with root lengths measured daily. A Student’s t-test determined that
P<0.05 comparing the transgenic lines to the wild-type line. Error bars are standard error
of the mean.
63
Figure 19. Total primary root length at 8 dpg. P values are <0.01 using a Student’s t-test
comparing the transgenic lines to the wild-type. Error bars are standard error of the mean.
64
Number of Lateral Roots
8
7
6
5
4
3
Total # Lateral Root
Lateral Roots/cm
2
1
0
WT
2c
3c
6h
12k
Line
Figure 20. Total lateral root and lateral root density analysis of overexpression and wildtype lines grown on MS agar plates. LHA2-2C, 3C and 6H were found to be significant
with P<0.05, while the 12K line was not at P < 0.05 using a Student’s t-test. Error bars
are in standard error of the mean.
65
Table 6. Lateral and primary root analyses of plants grown on MS agar plates at 8 dpg. In
order to determine lateral root density the total number of lateral roots was divided by the
primary root length measured in centimeters. A * denotes a p<0.01 and is statistically
significant when comparing each transgenic line to the wild-type line using a Student’s ttest.
Lateral and Primary Root Analyses
WT
Average Primary Root
3.92
Length (PR cm)
N (Primary Root)
171
Average Total Lateral
4.56
Roots(#LR)
Lateral Root Density
1.16
(#LR/PR cm)
N (Lateral Root)
125
2c
3c
6h
12k
*4.65
*4.90
*4.54
*4.23
37
*6.45
77
*7.31
134
*5.90
98
4.46
*1.38
*1.49
*1.29
1.05
37
77
103
98
66
Primary Root Growth (mm)
60
50
WT
40
2C
30
3C
6H
20
12K
10
0
1
2
3
4
5
6
7
8
Day
Figure 21. Primary root growth in the presence of the DMSO solvent control. The data
was used to normalize both TIBA and NPA trials. Error bars are in standard error of the
mean.
67
100
% growth on TIBA relative to DMSO
90
80
70
60
50
40
30
20
10
0
WT
2C
3C
6H
12K
Figure 22. Retention in primary root growth of wild type and transgenic lines when
grown on 0.1 µm TIBA relative to the DMSO control at 8 dpg. Error bars are standard
error of the mean.
68
% growth on TIBA relative to DMSO
70
60
50
40
30
20
10
0
WT
2C
3C
6H
12K
Figure 23. Retention in lateral root density of transgenic and wild-type plants when
grown on 0.1µm TIBA relative to the DMSO control at 8 dpg. Error bars are standard
error of the mean.
69
50
45
Root Length (mm)
40
Wild Type
35
30
LHA2-2C
25
LHA2-3C
20
LHA2-6H
15
LHA2-12K
10
5
0
1
2
3
4
5
6
7
8
Day
Figure 24. Primary root growth of the transgenic and wild-type lines when grown on 0.1
µm TIBA. Error bars are standard of the mean.
70
Primary Root Growth (mm)
35
30
LHA2-2C
25
LHA2-3C
20
LHA2-6H
15
LHA2-12K
10
Wild-type
5
0
1
2
3
4
5
6
7
8
Day
Figure 25. Primary root growth of the transgenic and wild-type lines when grown on 1
µm TIBA. Error bars are standard error of the mean.
71
120
% growth on TIBA relative to DMSO
100
80
60
40
20
0
Wild Type
LHA2-2C
LHA2-3C
LHA2-6H
LHA2-12K
Figure 26. Primary root growth between the transgenic lines and the wild-type line grown
on 0.1µm NPA relative to the DMSO control at 8 dpg. Error bars are in standard error of
the mean.
72
70
60
% growth on TIBA relative to DMSO
50
40
30
20
10
0
Wild Type
LHA2-2C
LHA2-3C
LHA2-6H
LHA2-12K
Figure 27. Retention of lateral root density of wild-type and transgenic plants when
grown on 0.1µm NPA relative to the DMSO control at 8 dpg. Error bars are standard
error of the mean.
73
60
50
WT
40
2C
3C
30
6H
20
12K
10
0
1
2
3
4
5
6
7
8
Figure 28. Primary root growth on 0.1µm NPA treatment of transgenic lines and wildtype without normalization to the DMSO vehicle control. Error bars are standard error of
the mean.
74
Figure 29. Primary root growth of transgenic and wild-type plants when grown on 1.0µm
NPA without normalization to the DMSO vehicle control. Error bars are standard error of
the mean.
75
Figure 30. Primary root length of all plant lines that were grown on MS, DMSO, 0.1 µm
TIBA, 1.0 µm TIBA, 0.1 µm NPA and 1.0 µm NPA. Absolute primary root length was
gathered at eight days post germination.
76
Table 7. Two-way ANOVA on primary root length. The two-way ANOVA was used to
determine if there was a significant difference between genotype and treatment groups.
Type III Sum of
Source
Squares
df
Mean Square
F
Sig.
Corrected Model
48634.761a
29
1677.061
19.070
.000
Intercept
665821.193
1
665821.193
7571.146
.000
Treatment
32982.955
5
6596.591
75.011
.000
Genotype
3339.780
4
834.945
9.494
.000
treatment * genotype
5105.654
20
255.283
2.903
.000
Error
86710.744
986
87.942
Total
1835092.250
1016
135345.506
1015
Corrected Total
a. R Squared = .359 (Adjusted R Squared = .340)
77
Table 8. Post Hoc Bonferroni analysis of the genotype for the primary roots. Examination of the
variation between the wild-type lines and the overexpression lines revealed that the LHA2-2C,
LHA2-3c and the LHA2-6H lines were significantly different than the wild-type however the
LHA2-12K overexpression line was not significantly different.
(I)
95% Confidence Interval
genotype
(J) genotype Mean Difference (I-J) Std. Error
Wild
2c
-5.7298*
1.19680
.000
-9.0969
-2.3628
3c
-5.1694*
.87945
.000
-7.6436
-2.6952
6h
-4.1523*
.80572
.000
-6.4191
-1.8855
12k
1.4636
.84322
.829
-.9087
3.8359
Wild
5.7298*
1.19680
.000
2.3628
9.0969
3c
.5604
1.27487
1.000
-3.0262
4.1471
6h
1.5776
1.22517
1.000
-1.8693
5.0244
12k
7.1934*
1.25015
.000
3.6763
10.7106
Wild
5.1694*
.87945
.000
2.6952
7.6436
2c
-.5604
1.27487
1.000
-4.1471
3.0262
6h
1.0171
.91768
1.000
-1.5647
3.5989
12k
6.6330*
.95077
.000
3.9581
9.3079
Wild
4.1523*
.80572
.000
1.8855
6.4191
2c
-1.5776
1.22517
1.000
-5.0244
1.8693
3c
-1.0171
.91768
1.000
-3.5989
1.5647
12k
5.6159*
.88302
.000
3.1316
8.1001
Wild
-1.4636
.84322
.829
-3.8359
.9087
2c
-7.1934*
1.25015
.000
-10.7106
-3.6763
3c
-6.6330*
.95077
.000
-9.3079
-3.9581
6h
-5.6159*
.88302
.000
-8.1001
-3.1316
2c
3c
6h
12k
Based on observed means.
The error term is Mean Square (Error) = 87.942.
*. The mean difference is significant at the .05 level.
Sig.
Lower Bound
Upper Bound
78
Figure 31. Lateral root numbers of all plant lines that were grown on MS, DMSO, 0.1 µm
TIBA and 0.1 µm NPA. Absolute lateral root numbers were gathered at eight days post
germination.
79
Table 9. Two-way ANOVA on lateral roots.
Type III Sum of
Source
Squares
df
Mean Square
F
Sig.
2184.143a
19
114.955
11.499
.000
4305.135
1
4305.135
430.629
.000
Treatment
951.407
3
317.136
31.722
.000
Genotype
210.073
4
52.518
5.253
.000
treatment * genotype
254.363
12
21.197
2.120
.014
Error
7108.087
711
9.997
Total
28020.000
731
9292.230
730
Corrected Model
Intercept
Corrected Total
a. R Squared = .235 (Adjusted R Squared = .215)
80
Table 10. Post Hoc Bonferroni analysis of the genotype for the lateral roots. Examination of the
variation between the wild-type lines and the overexpression lines revealed that the LHA2-2C,
LHA2-3c and the LHA2-6H lines were significantly different than the wild-type however the
LHA2-12K overexpression line was not significantly different.
95% Confidence Interval
(I)
genotype
Wild
2c
3c
6h
12k
(J) genotype
Mean Difference (I-J)
Std. Error
Sig.
Lower Bound
Upper Bound
2c
-2.2076*
.47235
.000
-3.5377
-.8775
3c
-1.7393*
.34736
.000
-2.7174
-.7612
6h
-1.3053*
.32894
.001
-2.2315
-.3791
12k
.3411
.33708
1.000
-.6081
1.2903
wild
2.2076*
.47235
.000
.8775
3.5377
3c
.4683
.49222
1.000
-.9177
1.8543
6h
.9023
.47940
.602
-.4476
2.2522
12k
2.5487*
.48502
.000
1.1830
3.9144
wild
1.7393*
.34736
.000
.7612
2.7174
2c
-.4683
.49222
1.000
-1.8543
.9177
6h
.4340
.35689
1.000
-.5709
1.4389
12k
2.0804*
.36440
.000
1.0543
3.1065
wild
1.3053*
.32894
.001
.3791
2.2315
2c
-.9023
.47940
.602
-2.2522
.4476
3c
-.4340
.35689
1.000
-1.4389
.5709
12k
1.6464*
.34689
.000
.6696
2.6232
wild
-.3411
.33708
1.000
-1.2903
.6081
2c
-2.5487*
.48502
.000
-3.9144
-1.1830
3c
-2.0804*
.36440
.000
-3.1065
-1.0543
6h
-1.6464*
.34689
.000
-2.6232
-.6696
Based on observed means.
The error term is Mean Square (Error) = 9.997.
*. The mean difference is significant at the .05 level.
81
% Germination
Germination Percentage
100
90
80
70
60
50
40
30
20
10
0
WT
2c
3c
6h
12k
Line
Figure 32. Germination percentages of transgenic Arabidopsis and wild-type plants when
grown on MS agar for 5 days. A student’s T-test for LHA2-2C and LHA2-12K
germination percentage were significant, p<0.05 when compared to the wild type. LHA23C and LHA2-6H were approaching significance.
82
DISCUSSION
While this study’s ultimate purpose was to define the function of the H+ pump, it
was important to consider the possibility that overexpression of the pumps had caused the
unexpected changes in our transgenic plants. As is the case in most biological systems,
H+ pumps are controlled by multiple layers of regulatory mechanisms and in this study
we attempted to artificially circumvent these. Two independent single copy Arabidopsis
lines were generated (LHA2-6H and LHA2-12K) which are overexpressing a truncated
cDNA encoding the tomato plasma membrane H+-ATPase isoform LHA2. LHA2-6H and
LHA2-12K were analyzed alongside the two existing independent single-copy lines
LHA2-2C and LHA2-3C originally generated by Anna Lee. The LHA2 cDNA was
truncated as a means to avoid auto regulation by the autoinhibitory domain located in the
c-terminus of the functional protein. Several studies have indicated that auxin effects on
regulatory proteins such as 14-3-3 can modulate the activity of the pump by enhancing
phosphorylation events of the autoinhibitory domain and establish activation (Arango et
al., 2003; Darginaviciene, 2008; Ekberg et al., 2010). This enables the cell to modify
endogenous pump activity based on cellular needs. Removal of this domain has been
shown to confer permanent and stable activation in yeast and in other plants while
maintaining protein function (Gevaudant et al., 2007; Regenberg et al., 1995). The
truncated H+ pump in our overexpression construct was expected to be released from
regulation that was conferred by the autoinhibitory region. The LHA2 coding region
(without the autoinhibitory region), was artificially fused to the 35S promoter in order to
83
direct a high level of expression in all cells.
Previous overexpression studies have achieved high mRNA levels in plants using
the 35S CaMV promoter for transgene expression (Gevaudant et al., 2007; Li and
Steffens, 2002). Unlike the natural LHA2 promoter that confers cell specific regulation
and is responsive to multiple internal cellular signals, the 35S promoter is not dependent
on these organism specific cellular signals and maintains constitutive levels of expression
of its downstream gene. We examined the effects of the overexpression of the
35S::LHA2 construct and determined that the transgenic plants were all expressing the
LHA2 gene.
As is typical in overexpression analyses such as these, while all lines expressed
the transgene, both qPCR and semi-qPCR demonstrated that the level of expression
varied across lines. These results demonstrated that all lines were overexpressing LHA2
at the mRNA level as a result of the presence of the transgene. Of the two housekeeping
genes we have used for Arabidopsis expression analysis, GAPDH (glyceraldehyde-3phosphate dehydrogenase) was expressed at a high level throughout all plants (transgenic
plants and wild-type) while TIP41 (Tip-like protein) was expressed at a lower level.
LHA2 expression in the transgenic plants was less than GAPDH for all lines and greater
than TIP41 for LHA2-2C and LHA2-3C while LHA2-6H and LHA2-12K express LHA2
at a level similar to TIP41. The difference in absolute levels of expression between
transgenic lines is likely due to positional effects of insertion of the transgene into the
genome. For instance, in the LHA2-2C and LHA2-3C lines, if gene construct landed in
areas of the genome that were undergoing greater amounts of transcription while in
84
LHA2-6H and LHA2-12K lines, the construct inserted in an area of lower transcription.
This could explain why there is a difference in expression between overexpressing lines
(Harmon and Sedat, 2005). As is the case in prior studies, high expression normally
resulted in increased amounts of protein as was the case with poly-phenol oxidase
overexpression in studies aimed at understanding plant defense (Li and Steffens, 2002) or
with the AVP1 tonoplast H+-ATPases (Gaxiola et al., 2001) and plasma membrane H+
pumps, PMA4 (Gevaudant et al., 2007).
Even though artificially overexpressed plants can lead to an increase in gene
expression, it does not necessarily translate to more protein production in every case. For
instance, transgenic plants with natively derived transgenes that are artificially expressed
can potentially result in RNA-DNA and RNA-RNA, binding of complementary RNA
sequences which are then degraded thereby reducing the amount of circulating mRNA
(Taylor, 1997). In most cases, this gene silencing feedback mechanism occurs when high
levels of transcript are present and any effects that could have been caused by the
transgene are muted or masked by regulatory co-suppression. We selected the non-native
tomato H+-ATPase LHA2 for overexpression in Arabidopsis in order to decrease the
likelihood of co-suppression. The expression levels that we observed support the
conclusion that co-suppression is negligible or is not occurring since all lines showed
significant levels of LHA2 expression. We did not examine mRNA expression levels of
Arabidopsis H+ pump isoforms to determine if the native pumps were down-regulated,
however, the root acidification assays performed here demonstrate that total proton
85
pumping increased in overexpressing lines which suggests that Arabidopsis isoform
expression was not reduced due to co-suppression or any loss was compensated.
Housekeeping genes in qPCR
Typically in qPCR, a gene (or set of genes) is chosen against which the
expression of the gene of interest will be normalized and, importantly, the expression of
this gene should be constant across treatments examined. Other studies demonstrated that
the expression of the GAPDH and TIP41 housekeeping genes in Arabidopsis is relatively
stable and therefore are appropriate for use in expression studies (Exposito-Rodriguez et
al., 2008; Schmittgen and Zakrajsek, 2000). We used two housekeeping genes, GAPDH
and TIP41, as internal controls in order to reduce the effects of variation in expression
that might result from normalizing expression to that of just a single housekeeping gene.
In this study GAPDH and TIP41 were expressed at similar levels relative to each other
across all lines (wild-type and overexpressing) which provides support that these are
good internal controls upon which to base the expression of the LHA2 transgene.
Optimum range of biological systems
Biological systems work in an optimum range of environmental factors from pH
to salt balance, plant systems are no different when it comes to how its cells react to
changing to environments. In our study, we have manipulated the proton pumps through
overexpression of the pumps and auxin flow through the use of transport inhibitors. This
created a permanently activated H+ pump extruding protons into the apoplast, as long as
86
there is available ATP, responsible for acidification and for the electrochemical motive
force to drive secondary transporters. Auxin flow regulators are another artificial means
for us to impose changes on a plant system by effecting auxin availability. Plant systems
operate at or near physiological optimum conditions like the auxin system (Casimiro et
al., 2001). Any subsequent shift in conditions may result in significant changes within a
plant. For instance, if exogenous auxin is added to the root system, we see a phenotype
shift resulting in an increase in the number of lateral roots but a decrease in primary root
length (Casimiro et al., 2001; Dani, 2007). Our work here examining both primary and
lateral roots supports previous claims about acid growth and lateral root development and
that there is an organized balance between auxin and pH systems in plant growth.
Therefore, by manipulating the H+ pumps and auxin system by using auxin transport
inhibitors, we are able to observe at a more basic level, in roots, the growth of cells and
entry into the cell cycle.
The role of the H+ pump in cell elongation
One of the major roles of the plasma membrane H+ pumps in plants is to create
the membrane potential and proton gradients that are used to drive secondary
transporters. In addition, changes in intracellular and extracellular pH caused by
regulation of the activity of the pump are also thought to be of central importance in the
regulation of cell expansion as described in the Acid Growth Theory. Our results provide
support for this proposed role since overexpression of the pump resulted in increased
growth in primary roots. It showed that the four overexpression lines (LHA2-2C, -3C, -
87
6H and -12K) had increased primary root growth, (LHA2-2C was 46.6 mm, LHA2-3C
was 49.0 mm, LHA2-6H was 45.5 mm, LHA2-12K was 42.3 mm while the wild-type
was 39.2 mm) when grown on normal MS agar plates, strongly supporting the key
element of the Acid Growth Theory that an activated pump is directly responsible for
proton extrusion into the apoplast thereby allowing for cell expansion. Apoplast
acidification either directly causes cell wall loosening events or activity of the H+ pumps
will enable and maintain enzymes, exo- and endo-glucanases and expansin molecules, to
break down covalent and hydrogen bonds and loosen the cell wall cellulose and
polysaccharide elements to allow for turgor driven cell elongation. (Cosgrove, 2005;
Kotake et al., 2000; McQueen-Mason and Cosgrove, 1995). Our study did not determine
whether this increased growth was indeed due to an increase in cell expansion or, as
might also account for an increased root length, an increase in cell division. Nonetheless,
if the pump functions as described in the Acid Growth Theory, overexpression should
cause an increase in root length.
To date mostly indirect evidence for the Acid Growth Theory exists despite its
elevation from “Acid Growth Hypothesis” to “Acid Growth Theory” in many instances.
This study directly supports the Acid Growth Theory of cell elongation by providing a
direct means to test acid growth, by overexpressing an activated H+ pump without the
need for auxin activation, a means to determine if the H+ pumps are expressed, RTqPCR, and to determine if the H+ pumps are active and readily effecting the cell, e.g.
extracellular fluorescent pH assay to directly demonstrate activity, while the root
phenotype assays will provide evidence for cell elongation. Since we saw an increase in
88
primary root growth and the only difference between the wild-type and the
overexpression lines was the gene construct, the differences observed between the
primary root growth of the overexpression lines can be attributed to the H+ pump.
Our study also used the auxin flow regulators TIBA and NPA to isolate auxins
effects on the endogenous H+ pumps so we can begin to focus on the H+ pump activity
from the non-native overexpression H+ pumps. Our results show that auxin flow was
most likely affected by auxin transport inhibitors and not necessarily the H+ pumps were
causing significant changes in auxin flow since we had a decrease in lateral roots from
DMSO controls to results on both TIBA and NPA. Had auxin flow not been affected, we
would not have seen a drop in retention in the lateral roots. We did see a difference in our
TIBA and NPA primary root results but this may have been due to a difference in the
modes of inhibition between these chemicals which will be discussed later in this
discussion. Since the MS and NPA data shows that all transgenic lines had greater
primary root growth retention than the wild-type, this supports our hypothesis that
activation of the plasma membrane H+ pump by auxin causes plant cell growth as
described in the Acid Growth Theory. The TIBA results, on the other hand, show an
effect that is opposite to what we predicted since we expected that TIBA would have
caused a similar effect to the NPA experiments but instead the transgenic lines had less
primary root growth retention comparing the transgenic lines to the wild-type line.
89
The role of the H+ pump in cell cycle regulation
The second area that this study focused on was the hypothesis that changes in
cytosolic pH resulting from activation of the H+ pump might contribute to regulation of
the cell cycle and, as a result, promote lateral root initiation. Prior research in our
laboratory using LHA2::GUS reporter gene analysis in Arabidopsis and tomato indicated
that the promoter directs expression very early in lateral root formation. Our previous
analysis of single-copy overexpression lines indicated that there was a general increase in
the number and density of lateral roots. As a result, we were careful to examine this
phenotype in the current study. The main difference between this study and other
overexpression studies is that we used a non-native plasma membrane H+ pump transgene
from tomato, LHA2 and inserted it into Arabidopsis thaliana. As suggested earlier, this
addressed the issues with co-suppression and regulation that others studies may have
witnessed. The results here suggest that lateral root initiation can be separated from the
effects of auxin transport and hence the endogenous H+ pumps through auxin transport
inhibitors while activity from the H+ pump alone is able to cause the initiation of lateral
roots.
Several theories surround the initiation of lateral roots. This includes the G2 cell
cycle arrest theory, where all pericycle cells leaving the apical meristem enter a period of
non-replication by exiting the cell cycle at G2 and must de-differentiate and re-enter the
cell cycle to complete lateral root initiation (Blakely, 1982). The other theory is that the
pericycle cells never leave the cell cycle after moving from the apical meristem, only
stopping at G1 phase and with the right trigger will progress through the cell cycle.
90
Although this was found to only be typified by young lateral roots as older root pericycle
tissues are stalled in G2 further up the root and still able to develop into lateral roots
(Beeckman et al., 2001; Dubrovsky et al., 2000). Lateral root phenotypes in the present
study when grown on MS medium indicated that 3 out of the 4 overexpression lines,
LHA2-2C, LHA2-3C and LHA2-6H all had significantly increased lateral root densities
at 1.39 LR/cm (# lateral roots/ cm of primary root), 1.49 LR/cm, and 1.30 LR/cm
respectively while the wild-type plants had lower lateral root density at 1.16 LR/cm. This
strongly suggests that the proton pump is involved in lateral root ontogeny.
Another contributing factor in lateral root development is auxin. Auxin has been
shown to be required for the initial cell divisions in lateral root organogenesis; research
excising young lateral root primordia found that cell division stopped and did not
progress until exogenous auxin was added to the system. This was also supported in
alfalfa protoplast studies although a direct mechanism has not been found (Casimiro et
al., 2001; Pasternak et al., 2002). The results of this study suggest that activation of the
H+ pump and the resulting change in cytosolic and/or apoplastic pH may cause the reentry or progression of pericycle cells into the cell cycle and that this drives lateral root
initiation. This coupled with our previous LHA2::GUS analysis provides support for the
conclusion that, in tomato, activation of LHA2 by auxin drives lateral root initiation. It
also supports lateral root initiation hypothesis that auxin acts to stimulate lateral root
initiation by activation the H+ pump, which then triggers progression through the cell
cycle beginning the development of a new organ.
91
As discussed earlier, yeast and mouse fibroblast studies have shown that when a
proton pump was expressed in these systems that there was an increase in cell
proliferation as intracellular pH became alkaline, which suggests that cell division and
proliferation is dependent on changes in cytoplasmic pH in other eukaryotic systems
(Harguindey et al., 2005; Perona and Serrano, 1988). Only a couple of studies have tried
to explain pH and cell cycle regulation in plants. A plant study using Bidens pilosa,
Spanish Needle, explored alkalinization events further in the cytoplasm and discovered
that during cell division transient fluxes in cytoplasmic pH occurred (Pichon, 1994). A
protoplast study in plants using cells from alfalfa determined that there were increases in
cytoplasmic pH during cell activation and division (Pasternak et al., 2002). Both these
studies along with our own research indicate potential for regulation of the H+ pump to be
the mechanism by which transient cytosolic pH changes may be generated to control the
cell cycle. The function of the H+ pump to move protons out of cytoplasm into the
apoplast led us to support the hypothesis initially proposed by Pichon and colleagues.
They believed that the H+ pump is able to cause this effect, transient cytoplasmic
alkalinization demonstrated in the overexpression lines in this study. It is important to
note that exogenous auxin added to roots increase the lateral root density similar to this
study perhaps suggesting the mechanism that auxin plays in lateral root development is
activation of the H+ pump and subsequent alkalinization triggers lateral root initiation.
We cannot rule out the possibility that perhaps the overexpression of the H+ pump is
increasing auxin flow through increased diffusion of protonated IAA and that this
increase is the cause of the increase in lateral root initiation. As mentioned earlier, auxin
92
has been specifically implicated in the development of lateral roots and complete removal
of auxin will cause the cessation of cell division (Himanen et al., 2002). All cells are
capable of producing auxin so a basal level may be maintained for nominal cell function
while use of the auxin transport inhibitors will severely diminish auxin flow between
cells and allow us to isolate the H+ pump from the effects of increased auxin transport
potentially due to overexpression.
Our extracellular pH assay and lateral root density data comparing the wild-type
and transgenic plants also supports our second hypothesis that activation of the pump is
an early signaling event in lateral root initiation and suggests that pH changes caused by
activation of the pump are sufficient to trigger the initiation of lateral roots. Both the
results using the auxin transport inhibitors NPA and TIBA suggested that the
overexpression of the H+ pumps caused a greater percentage of lateral root density with
the overexpression lines compared to the wild-type. Combined with the data for the
primary root growth, this could explain that we have inhibited auxin flow using the
receptor based NPA and the H+ pumps are able to trigger lateral roots and increase
primary root growth in transgenic lines due to function of the H+ pump, our second
hypothesis. It is necessary to take a more in depth approach to look at auxin flow to
determine whether there is a mechanistic change polar auxin flow or whether results are
due to function of the pump triggering lateral roots.
93
Auxin flow dynamics
All plants cells are capable of producing auxin, however; most production occurs
in rapidly dividing cells and tissue like shoot apical meristems and leaves. Therefore
there is a need to transport auxin to distant tissues which produce small quantities of
auxin including the roots. This long distance movement of manufactured auxin toward
the root tip is accomplished through phloem sieve-tube elements in the vascular cylinder
after which root polar auxin flow back up the root toward the root-shoot junction is
maintained by transport through nonvascular tissue of the cortex. We tried to separate the
effects of auxin flow through cells by adding auxin transport inhibitors to isolate the
transgenic plants with the overexpression H+ pumps from the wild-type endogenous H+
pumps (Figure 33).
We had used the auxin transport inhibitors NPA and TIBA to determine the
effects of these chemicals had specifically on plant roots, whether they changed growth
patterns and we could examine the transgenic pump in absence of endogenous pump
activity. NPA is an effecter of plant auxin efflux carriers effectively sequestering auxin,
-
IAA, inside the cells and at the tissue level, in the root tip. Studies show that NPA and
plant flavonols bind plasma membrane bound flavanoid receptors in the plant cell that
has the ability to shut down the activity of the efflux carriers such as the PIN-formed
family of proteins preventing auxin transport and sequestration within the cell and
surrounding tissue (Figure 34) (Murphy et al., 2000; Peer et al., 2004). TIBA, the other
auxin flow regulator used in this study, is structurally similar to auxin, and is thought to
compete with auxin for binding with the auxin efflux carriers to be transported out of the
94
Figure 33. Simplified model of auxin flow into plant root tissues. Auxin is transported
through vascular tissue to the root tip, after which auxin is transported through cells back
up the root. TIBA and NPA work to effectively sequester auxin in the root tip.
95
cell (Casimiro et al., 2001; Peer et al., 2004; Wu, 2007). Since TIBA is a competitive
inhibitor; it can prevent or severely hinder auxin flow by competing with the circulating
auxin to be extruded from the cell at the auxin efflux carrier (Figure 34). Why we saw
decreased primary roots in overexpression lines compared to the wild-type is that we may
see a marked increased amount of diffusion of protonated IAA that has entered the cell
due to activity of the transgenic H+ pump. This is due to the nature of our gene construct,
as mentioned earlier; the transgene H+ pump was designed so that it is always activated
compared to a normal endogenous H+ pump which is self-regulated. The gene construct
also conferred constitutive expression by way of the 35s promoter meaning that there
should be a high amount of the transgenic H+ pump proteins in the cell. Both amount of
transgene and activity level may translate to a marked decrease in pH of the apoplast
which in turn may lead to increased diffusion of protonated IAA into the cytoplasm.
Another possibile interpretation for the TIBA results is that if the organism were to
increase auxin production to be transported to auxin deficient areas, then this may allow
auxin flow to resume because TIBA is a competitive inhibitor. As long as either TIBA or
auxin concentrations are high enough, significant changes in auxin flow may occur.
However, it could also be another compensatory mechanism that is affecting primary root
growth with TIBA. The consensus of various studies have indicated that the use of TIBA
and NPA on roots will cause a decrease in the overall growth rates and length of primary
roots (An, 2001). We believed that a potential artifact of overexpression of the H+ pumps
would be a greater amount of IAA to be transported through diffusion or transport
systems compared to the wild-type plants (Figure 35). Our hypothesis postulates that
96
Figure 34. A model for TIBA and NPA and their mode of inhibition on PIN auxin efflux
carrier. TIBA works through competitive inhibition with auxin and is concentration
dependent. NPA works through non-competitive inhibition and is receptor based.
97
Figure 35. A model of the H+ pump overexpression system along with auxin flow. The
overexpression system (right) may lead to decreased pH compared to a wild-type system
(left) due to quantity and activity of the pumps. The overexpression system (right) can
lead to an increased rate of diffusion of IAA into the cell which may in turn effect TIBA
competitive inhibition.
98
activation of the pump causes growth according to the acid growth theory and would
result in greater primary root and lateral root growth of the overexpression lines even in
the presence of auxin transport inhibitors.
The TIBA root phenotype results indicated that we had diminished primary root
growth but increased numbers of lateral roots in transgenic plants compared to the wildtype. We had predicted that the overexpression plants would have greater primary root
lengths compared to the wild-type plants when grown on TIBA, however, our results
showed the opposite effect. Looking at the lateral roots of plants grown on TIBA, our
results indicated that the wild-type line had lower numbers of lateral roots when grown
under auxin inhibitor constraints than the transgenic lines and significantly lower than
when the wild-type plants were grown on normal MS or DMSO media. This implies that
auxin flow is, in fact, being inhibited. In prior research in this laboratory and other studies
as well, the addition of exogenous auxin decreased the growth of the primary root while
also increased the number of lateral roots in the transgenic lines compared to wild-type
(An, 2001). Since we are trying to competitively limit auxin transport through TIBA via
auxin efflux proteins, an increase in production at the organismal level for instance, due
to low levels of circulating auxins, could have overwhelmed competitive inhibition
leading to diminished primary root growth in our overexpression lines.
For NPA, we proposed that the overexpression and function of the H+ pump,
extruding protons across the membrane into the apoplast, would cause alkalinization of
the cytoplasm and acidification of the apoplast that would lead to both a greater primary
root length (i.e. greater percentage in primary root) and greater number of lateral roots
99
comparing our transgenic lines to our wild-type. Several studies that looked at plant root
growth under NPA conditions can provide insight into our study. Casimiro and
colleagues studied the effects of NPA on plant roots (Casimiro et al, 2001). They found
that as concentrations of NPA were increased various stages of lateral roots were
prevented from progressing to form full lateral root primordia, demonstrating the effect
of auxin inhibition on plant roots. This was also supported when the roots were added to
plates with exogenous auxin since the plants continued with normal lateral root initiation
(Casimiro et al., 2003; Casimiro et al., 2001). This study demonstrated greater primary
root length and lateral root density of plants grown on M/S, DMSO and NPA (TIBA with
just lateral roots) in transgenic lines compared to wild-type plants. These results support
both of our hypotheses, 1) that activation of H+ pumps will cause cell growth as
suggested in the Acid Growth Theory in primary roots and also 2) cause an increase in
the initiation of lateral roots. The primary and lateral root growth experiments
demonstrated that even in the presence of auxin transport inhibitors overexpression and
activity of the H+ pump was causing an effect in plant growth and lateral root initiation.
Our results, even though the TIBA results were not expected, demonstrate that activity of
the pump is a driving factor in primary root growth and an important factor in lateral root
development.
Activity
Evidence of a pH effect of the H+ pumps can be directly supported by our
extracellular pH activity assays where we observed a significant decrease in the pH of
100
medium comparing the transgenic plants to the wild-type plants. We attribute this
difference between wild-type and transgenic lines to a decrease in pH caused by the
activity of the transgenic H+ pumps acidifying the medium. While this decrease does not
directly demonstrate a concomitant alkalinization of the cytoplasm, it does show the
capabilities of the pump to maintain or cause pH changes in plant cells and surrounding
cell tissue and environment. Separated from the effects of auxin, by auxin transport
inhibitors, our results suggest that the H+ pumps cause cell growth (primary root) due to
pump activity and cytoplasmic pH can initiate re-entry into the cell cycle (lateral roots)
and even in the absence of auxin flow thereby supporting our first hypothesis that
activation of the pump can lead to cell growth as stated by the Acid Growth Theory and
our second hypothesis, that activation of the pump is an early trigger in lateral root
initiation.
Conclusions
The purpose of this study was to answer the question of whether activation of the
pumps causes cell growth according to the Acid Growth and can cause cell cycle
progression in order to define the function of the pump in plant growth and
organogenesis. We have successfully used a non-native overexpressed and permanently
activated pump to explore whether we would see changes in root phenotypes of
Arabidopsis. Our results for cell growth indicate that plant growth is highly influenced by
the activity of the pumps by acidification of the apoplast causing wall loosening events in
accordance with the Acid Growth Theory. This was shown by all four of the
101
overexpression lines LHA2-2C, LHA2-3C, LHA2-6H and LHA2-12K exhibiting greater
primary root growth than the wild type in our root growth experiments on normal
medium. There also is support for the H+ pumps to be involved with the initiation of
lateral roots as 3 of the 4 overexpression lines have greater lateral root densities,
suggesting that the activation of the pump by auxin begins movement of protons into the
apoplast causing alkalinization events in the cytoplasm which may be the trigger involved
with re-entry of the founder cells into the cell cycle. Separating the effects of auxin flow
and auxin activation of the endogenous H+ pumps, we were able to reasonably ascertain
that the H+ pump is involved with acid growth. Overexpression plants grown on the
receptor based, auxin transport inhibitor, NPA revealed greater lateral root densities and
primary root growth consistent with our hypothesis that an activated pump will retain
primary root growth and increase lateral root numbers in transgenic plants compared to
wild-type Arabidopsis. If NPA was able to dampen the effects of auxin flow and our
hypotheses about acid growth and lateral root ontogeny are correct then this would
explain why there were longer primary roots and greater lateral root densities of the
overexpression lines over the wild-type lines because of increased activity of the pumps
causing acid induced cell elongation and triggering lateral root initiation through
cytoplasmic pH fluctuations. Our TIBA results with lateral roots helped to strengthen our
ideas that the H+ pump can be involved as an early signaler in lateral root ontogeny. The
TIBA primary root results, while not what we were anticipating, suggests that our data
must be reconciled with further experimentation. Finally, our extracellular pH
experiments provided a direct test to functionality of our H+ pumps in acidification and
102
supported a key element in our hypothesis that the H+ pumps were directly involved with
acidification. This study helps support the Acid Growth Theory by providing a
straightforward understanding of both the functionality and phenotypic changes
surrounding the plant root with activated H+ pumps by utilizing an overexpression
system. It also helps support the hypothesis that an integral signaling or mechanism
involved in lateral root initiation is the H+ pumps and its ability to cause transient
intracellular pH alkalinization.
Future Directions
This study characterized the roots of lines overexpressing a single copy of the
plasma membrane H+-ATPase. We have successfully determined the presence of gene
and RNA however we only have indirect tests for the protein through activity and
phenotypic root evidence since we are missing a direct test for pump protein. A western
blot using antibodies directed to our LHA2 transgene will provide direct evidence that the
protein is indeed present. It would also be interesting to visualize, using fluorescent
confocal or light microscopy, cytoplasmic pH or immunohistochemistry in the
development of lateral roots to strengthen our idea that pH and the H+ pumps are directly
involved in lateral root initiation.
This study also touched upon germination effects that the overexpression exerts
on the plant, we are currently exploring a phenotype where germination rates are
decreased in overexpression lines compared to the wild-type (Figure 32). Germination is
a highly ordered process and can be further studied to determine the effects of the H+
103
pump on plant germination. Along those lines, are responses of overexpression of the H+
pump to environmental conditions such as high salt, heavy metals or drought conditions.
Currently, experiments are underway looking at the H+ pump and salt, looking at
different mechanisms that the H+ pump are involved, expression seems to be directed
differently in the overexpression lines compared to the wild-type.
104
Literature Cited
An, N.D., Wang, L. J., Ding, C. and XU, Z. H. (2001) Auxin distribution and transport
during embryogenesis and seedgermination of Arabidopsis. Cell Research, 11,
273-278.
Arango, M., Gevaudant, F., Oufattole, M., Boutry, M. (2003) The plasma membrane
proton pump ATPase: the significance of gene subfamilies. Planta, 216, 355-365.
Baekgaard, L., Fuglsang, A.T., Palmgren, M.G. (2005) Regulation of plant plasma
membrane H+- and Ca2+-ATPases by terminal domains. Journal Bioenerg
Biomembr, 37, 369-374.
Beeckman, T., Burssens, S., Inze, D. (2001) The peri-cell-cycle in Arabidopsis. Journal
of Experimental Botany, 52, 403-411.
Benfey, P.N. and Chua, N.H. (1990) The Cauliflower Mosaic Virus 35S Promoter:
Combinatorial Regulation of Transcription in Plants. Science, 250, 959-966.
Berg, L.R. (2007) Introductory Botony: Plants, People and the Environment. Thompson
Brooks/Cole, Belmont: 622 pp.
Blakely, L.M., Durham, T.A. and Blakley R.M. (1982) Experimental Studies on Lateral
Root Formation in Radish Seedling Roots. I. General Methods, Developmental
Stages, and Spontaneous Formation of Laterals. Botanical Gazette, 143, 341-352.
Blakeslee, J.J., Peer, W.A., Murphy, A.S. (2005) Auxin transport. Current Opinion in
Plant Biology, 8, 494-500.
Bonner, J. (1934) Studies on the Growth Hormone of Plants: V. The Relation of Cell
Elongation to Cell Wall Formation. Proceedings of the National Academy of
Sciences of the United States of America, 20, 393-397.
Bradshaw, H.D., Jr. (2005) Mutations in CAX1 produce phenotypes characteristic of
plants tolerant to serpentine soils. The New Phytologist, 167, 81-88.
Bradshaw, K.G. (2001) The effect of an auxin transport inhibitor n-1-naphthylphthalamic
acid (NPA) and sucrose on expression of LHA2 in Arabidopsis thaliana and
Lycopersicon esculentum. Master's Thesis, California State University,
Sacramento, Sacramento.
Campbell, N.A. (1996) Biology. The Benjamin/Cummings Publishing company: 1206
pp.
105
Casimiro, I., Beeckman, T., Graham, N., Bhalerao, R., Zhang, H., Casero, P., Sandberg,
G., Bennett, M.J. (2003) Dissecting Arabidopsis lateral root development. Trends
in Plant Science, 8, 165-171.
Casimiro, I., Marchant, A., Bhalerao, R.P., Beeckman, T., Dhooge, S., Swarup, R.,
Graham, N., Inze, D., Sandberg, G., Casero, P.J., Bennett, M. (2001) Auxin
transport promotes Arabidopsis lateral root initiation. Plant Cell, 13, 843-852.
Cheng, N.H., Pittman, J.K., Barkla, B.J., Shigaki, T., Hirschi, K.D. (2003) The
Arabidopsis cax1 mutant exhibits impaired ion homeostasis, development, and
hormonal responses and reveals interplay among vacuolar transporters. The Plant
Cell, 15, 347-364.
Cleland, R. (1971) The mechanical behavior of isolated Avena coleoptile walls subjected
to constant stress: properties and relation to cell elongation. Plant Physiology, 47,
805-811.
Cleland, R.E. (1992) Auxin-induced growth of Avena coleoptiles involves two
mechanisms with different pH optima. Plant Physiology, 99, 1556-1561.
Clough, S.J. and Bent, A.F. (1998) Floral dip: a simplified method for Agrobacteriummediated transformation of Arabidopsis thaliana. Plant Journal, 16, 735-743.
Cosgrove, D.J. (2000) Loosening of plant cell walls by expansins. Nature, 407, 321-326.
Cosgrove, D.J. (2005) Growth of the plant cell wall. National Revue Molecular Cell
Biology, 6, 850-861.
Dani, M. (2007) Regulation of the promoter of the tomato plasma membrane H⁺-ATPase,
LHA2 by auxin in tomato (Solanum lycopersicum) and Arabidopsis thaliana.
Masters Thesis, California State University, Sacramento, Sacramento.
Darginaviciene, J., Jurkoniene, S., Bareikiene, N., and Šveikauskas, V. (2008) H+ATPase functional activity in plant cell plasma membrane. Scientific works of the
Lithuanian Institute of Horticulture and Lithuanian University of Agriculture, 27
.
Dubrovsky, J.G., Doerner, P.W., Colon-Carmona, A., Rost, T.L. (2000) Pericycle cell
proliferation and lateral root initiation in Arabidopsis. Plant Physiology, 124,
1648-1657.
Dubrovsky, J.G., Rost, T.L., Colon-Carmona, A., Doerner, P. (2001) Early primordium
morphogenesis during lateral root initiation in Arabidopsis thaliana. Planta, 214,
30-36.
106
Duby, G. and Boutry, M. (2009) The plant plasma membrane proton pump ATPase: a
highly regulated P-type ATPase with multiple physiological roles. Pflugers Arch,
457, 645-655.
Duby, G., Poreba, W., Piotrowiak, D., Bobik, K., Derua, R., Waelkens, E., Boutry, M.
(2009) Activation of plant plasma membrane H+-ATPase by 14-3-3 proteins is
negatively controlled by two phosphorylation sites within the H+-ATPase Cterminal region. Journal Biological Chemistry, 284, 4213-4221.
Ekberg, K., Palmgren, M.G., Veierskov, B., Buch-Pedersen, M.J. (2010) A novel
mechanism of P-type ATPase autoinhibition involving both termini of the protein.
The Journal of Biological chemistry, 285, 7344-7350.
Estelle, M. (2001) Plant hormones. Transporters on the move. Nature, 413, 374-375.
Ewing, N.N. and Bennett, A.B. (1994) Assessment of the number and expression of Ptype H(+)-ATPase genes in tomato. Plant Physiology, 106, 547-557.
Ewing, N.N., Wimmers, L.E., Meyer, D.J., Chetelat, R.T., Bennett, A.B. (1990)
Molecular Cloning of Tomato Plasma Membrane H-ATPase. Plant Physiol, 94,
1874-1881.
Exposito-Rodriguez, M., Borges, A.A., Borges-Perez, A., Perez, J.A. (2008) Selection of
internal control genes for quantitative real-time RT-PCR studies during tomato
development process. BMC Plant Biology, 8, 131.
Frias, I., Caldeira, M.T., Perez-Castineira, J.R., Navarro-Avino, J.P., Culianez-Macia,
F.A., Kuppinger, O., Stransky, H., Pages, M., Hager, A., Serrano, R. (1996) A
major isoform of the maize plasma membrane H(+)-ATPase: characterization and
induction by auxin in coleoptiles. Plant Cell, 8, 1533-1544.
Fukuda, A. and Tanaka, Y. (2006) Effects of ABA, auxin, and gibberellin on the
expression of genes for vacuolar H+ -inorganic pyrophosphatase, H+ -ATPase
subunit A, and Na+/H+ antiporter in barley. Plant physiology and biochemistry :
PPB / Societe Francaise de Physiologie Vegetale, 44, 351-358.
Gambetta, G. (2005) Characterization of the Expression Pattern of the Tomato H+
ATPase LHA2 Promoter During Plant Development. Masters Thesis. California
State University Sacramento, Sacramento.
Gaxiola, R.A., Li, J., Undurraga, S., Dang, L.M., Allen, G.J., Alper, S.L., Fink, G.R.
(2001) Drought- and salt-tolerant plants result from overexpression of the AVP1
H+-pump. Proc Natl Acad Sci U S A, 98, 11444-11449.
107
Gaxiola, R.A., Palmgren, M.G., Schumacher, K. (2007) Plant proton pumps. FEBS Lett,
581, 2204-2214.
Gevaudant, F., Duby, G., von Stedingk, E., Zhao, R., Morsomme, P., Boutry, M. (2007)
Expression of a constitutively activated plasma membrane H+-ATPase alters plant
development and increases salt tolerance. Plant Physiol, 144, 1763-1776.
Gil, P., Liu, Y., Orbovic, V., Verkamp, E., Poff, K.L., Green, P.J. (1994) Characterization
of the auxin-inducible SAUR-AC1 gene for use as a molecular genetic tool in
Arabidopsis. Plant Physiology, 104, 777-784.
Guilfoyle, T.J. and Hagen, G. (2007) Auxin response factors. Current Opinion Plant
Biology, 10, 453-460.
Hagen, G. and Guilfoyle, T. (2002) Auxin-responsive gene expression: genes, promoters
and regulatory factors. Plant Molecular Biology, 49, 373-385.
Hager, A. (2003) Role of the plasma membrane H+-ATPase in auxin-induced elongation
growth: historical and new aspects. Journal of Plant Research, 116, 483-505.
Hager, A., Debus, G., Edel, H.G., Stransky, H., Serrano, R. (1991) Auxin Induces
Exocytosis and the Rapid Synthesis of a High-Turnover Pool of Plasmamembrane H+ -ATPase. Planta, 185, 527-537.
Hager, A., Menzel, H., and Krauss, A. (1971) Versuche und Hypothese zur
Primarwirkung des Auxins beim Streckungswachstum. Planta, 100, 47-75.
Harguindey, S., Orive, G., Luis Pedraz, J., Paradiso, A., Reshkin, S.J. (2005) The role of
pH dynamics and the Na+/H+ antiporter in the etiopathogenesis and treatment of
cancer. Two faces of the same coin--one single nature. Biochim Biophys Acta,
1756, 1-24.
Harmon, B. and Sedat, J. (2005) Cell-by-cell dissection of gene expression and
chromosomal interactions reveals consequences of nuclear reorganization. Public
Library of Science Biology, 3, e67.
Haruta, M., Burch, H.L., Nelson, R.B., Barrett-Wilt, G., Kline, K.G., Mohsin, S.B.,
Young, J.C., Otegui, M.S., Sussman, M.R. (2010) Molecular characterization of
mutant Arabidopsis plants with reduced plasma membrane proton pump activity.
The Journal of Biological Chemistry, 285, 17918-17929.
Himanen, K., Boucheron, E., Vanneste, S., de Almeida Engler, J., Inze, D., Beeckman, T.
(2002) Auxin-mediated cell cycle activation during early lateral root initiation.
Plant Cell, 14, 2339-2351.
108
Idate, R. (1997) Identification and characterization of the promoter region of the tomato
plasma membrane proton atpase gene LHA2. Masters Thesis, California State
University, Sacramento, Sacramento.
Kalampanayil, B.D., and Wimmers, L.E. (2001) Identification and characterization of a
salt-stree-induced plasma membrane H+-ATPase in tomato. Plant, Cell and
Environment, 24, 999-1005.
Kotake, T., Nakagawa, N., Takeda, K., Sakurai, N. (2000) Auxin-induced elongation
growth and expressions of cell wall-bound exo- and endo-beta-glucanases in
barley coleoptiles. Plant Cell Physiology, 41, 1272-1278.
Kutschera, U. and Niklas, K.J. (2007) The epidermal-growth-control theory of stem
elongation: an old and a new perspective. Journal of Plant Physiology, 164, 13951409.
Kutschera, U.a.S., P. (1985) Evidence against the acid-growth theory of auxin action.
Planta, 483-493.
Lee, J. (2007) The Effect of Overexpression of Tomato H+ Atapase isoform LHA2 on the
Growth and Development of Arabidopsis thaliana. Masters Thesis. California
State University, Sacramento, Sacramento.
Li, J., Yang, H., Peer, W.A., Richter, G., Blakeslee, J., Bandyopadhyay, A.,
Titapiwantakun, B., Undurraga, S., Khodakovskaya, M., Richards, E.L., Krizek,
B., Murphy, A.S., Gilroy, S., Gaxiola, R. (2005) Arabidopsis H+-PPase AVP1
regulates auxin-mediated organ development. Science, 310, 121-125.
Li, L. and Steffens, J.C. (2002) Overexpression of polyphenol oxidase in transgenic
tomato plants results in enhanced bacterial disease resistance. Planta, 215, 239247.
Malamy, J.E. and Ryan, K.S. (2001) Environmental regulation of lateral root initiation in
Arabidopsis. Plant Physiol, 127, 899-909.
Maurel, C., Leblanc, N., Barbier-Brygoo, H., Perrot-Rechenmann, C., Bouvier-Durand,
M., Guern, J. (1994) Alterations of auxin perception in rolB-transformed tobacco
protoplasts. Time course of rolB mRNA expression and increase in auxin
sensitivity reveal multiple control by auxin. Plant Physiology, 105, 1209-1215.
McQueen-Mason, S.J. and Cosgrove, D.J. (1995) Expansin mode of action on cell walls.
Analysis of wall hydrolysis, stress relaxation, and binding. Plant Physiology, 107,
87-100.
109
Mills, R.F., Krijger, G.C., Baccarini, P.J., Hall, J.L., Williams, L.E. (2003) Functional
expression of AtHMA4, a P1B-type ATPase of the Zn/Co/Cd/Pb subclass. The
Plant Journal: for Cell and Molecular Biology, 35, 164-176.
Mockaitis, K. and Estelle, M. (2008) Auxin receptors and plant development: a new
signaling paradigm. Annual Revue Cell Developmental Biology, 24, 55-80.
Murphy, A., Peer, W.A., Taiz, L. (2000) Regulation of auxin transport by
aminopeptidases and endogenous flavonoids. Planta, 211, 315-324.
Nishiyama, H., Ohya, T., Tanoi, K., and Nakanishi, T. M. (2007) A simple measurement
of the pH of root apoplast by the flourecence ratio method. Plant Root, 3-6.
Palmgren, M.G. (1990) An H-ATPase Assay: Proton Pumping and ATPase Activity
Determined Simultaneously in the Same Sample. Plant Physiology, 94, 882-886.
Palmgren, M.G. (2001) PLANT PLASMA MEMBRANE H+-ATPases: Powerhouses for
Nutrient Uptake. Annual Revue Plant Physiology Plant Molecular Biology, 52,
817-845.
Pardo, J.M. and Serrano, R. (1989) Structure of a plasma membrane H+-ATPase gene
from the plant Arabidopsis thaliana. Journal of Biological Chemistry, 264, 85578562.
Pasternak, T.P., Prinsen, E., Ayaydin, F., Miskolczi, P., Potters, G., Asard, H., Van
Onckelen, H.A., Dudits, D., Feher, A. (2002) The Role of auxin, pH, and stress in
the activation of embryogenic cell division in leaf protoplast-derived cells of
alfalfa. Plant Physiology, 129, 1807-1819.
Pedersen, B.P., Buch-Pedersen, M.J., Morth, J.P., Palmgren, M.G., Nissen, P. (2007)
Crystal structure of the plasma membrane proton pump. Nature, 450, 1111-1114.
Peer, W.A., Bandyopadhyay, A., Blakeslee, J.J., Makam, S.N., Chen, R.J., Masson, P.H.,
Murphy, A.S. (2004) Variation in expression and protein localization of the PIN
family of auxin efflux facilitator proteins in flavonoid mutants with altered auxin
transport in Arabidopsis thaliana. The Plant Cell, 16, 1898-1911.
Perona, R., Portillo, F., Giraldez, F., Serrano, R. (1990) Transformation and pH
homeostasis of fibroblasts expressing yeast H(+)-ATPase containing site-directed
mutations. Molecular Cellular Biology, 10, 4110-4115.
Perona, R. and Serrano, R. (1988) Increased pH and tumorigenicity of fibroblasts
expressing a yeast proton pump. Nature, 334(6181), 438-440.
110
Pichon, O.a.D., M. (1994) Is cytoplasmic pH involved in the regulation of cell cycle in
plants? Physiologica Plantarum (92), 261-265.
Pitann, B., Kranz, T., and Muhling, K. (2009) The apoplastic pH and its significance in
adaption to salinity in maize (Zea mays L.): Comparison of fluorescence
microscopy and ph-sensitive microelectrodes. Plant Science, 176, 497-504.
Portillo, F. (2000) Regulation of plasma membrane H(+)-ATPase in fungi and plants.
Biochim Biophys Acta, 1469, 31-42.
Rahman, A., Bannigan, A., Sulaman, W., Pechter, P., Blancaflor, E.B., Baskin, T.I.
(2007) Auxin, actin and growth of the Arabidopsis thaliana primary root. Plant
Journal, 50, 514-528.
Rayle, D.L. and Cleland, R. (1970) Enhancement of wall loosening and elongation by
Acid solutions. Plant Physiology, 46, 250-253.
Rayle, D.L. and Cleland, R.E. (1992a) The Acid Growth Theory of auxin-induced cell
elongation is alive and well. Plant Physiology, 99, 1271-1274.
Regenberg, B., Villalba, J.M., Lanfermeijer, F.C., Palmgren, M.G. (1995) C-terminal
deletion analysis of plant plasma membrane H(+)-ATPase: yeast as a model
system for solute transport across the plant plasma membrane. Plant Cell, 7, 16551666.
Ro, S. (2000) Transcriptional regulation of genes controlling plant growth and
development: LHA2, a H+-ATPase, and LeEXP1, and expansin. Masters Thesis.
California State University, Sacramento, Sacramento.
Rober-Kleber, N., Albrechtova, J.T., Fleig, S., Huck, N., Michalke, W., Wagner, E.,
Speth, V., Neuhaus, G., Fischer-Iglesias, C. (2003) Plasma membrane H+-ATPase
is involved in auxin-mediated cell elongation during wheat embryo development.
Plant Physiol, 131, 1302-1312.
Robertson, W.R., Clark, K., Young, J.C., Sussman, M.R. (2004) An Arabidopsis thaliana
plasma membrane proton pump is essential for pollen development. Genetics,
168, 1677-1687.
Schmittgen, T.D. and Zakrajsek, B.A. (2000) Effect of experimental treatment on
housekeeping gene expression: validation by real-time, quantitative RT-PCR.
Journal of Biochemical and Biophysical Methods, 46, 69-81.
Stals, H. and Inze, D. (2001) When plant cells decide to divide. Trends in Plant Science,
6, 359-364.
111
Staswick, P.E., Serban, B., Rowe, M., Tiryaki, I., Maldonado, M.T., Maldonado, M.C.,
Suza, W. (2005) Characterization of an Arabidopsis enzyme family that
conjugates amino acids to indole-3-acetic acid. Plant Cell, 17, 616-627.
Taiz, L. and Zeiger, E. (2010) Plant Physiology. Sinauer Associates, Sunderland, MA.
782 pp.
Taylor, C.B. (1997) Comprehending Cosuppression. The Plant Cell, 9(1245).
Tiwari, S.B., Hagen, G., Guilfoyle, T. (2003) The roles of auxin response factor domains
in auxin-responsive transcription. Plant Cell, 15, 533-543.
Turner, T.L., Bourne, E.C., Von Wettberg, E.J., Hu, T.T., Nuzhdin, S.V. (2010)
Population resequencing reveals local adaptation of Arabidopsis lyrata to
serpentine soils. Nature Genetics, 42, 260-263.
Woodward, A.W. and Bartel, B. (2005) Auxin: regulation, action, and interaction.
Annual Botanical (London), 95, 707-735.
Wu, X.a.M., P. (2007) The role of auxin tansport during inflorescence development in
Maize (Zea mays, Poaceae). American Journal of Botany, 94, 1745-1755.
Yang, X., Feng, Y., He, Z., Stoffella, P.J. (2005) Molecular mechanisms of heavy metal
hyperaccumulation and phytoremediation. Journal of Trace Elements in Medicine
and Biology: Organ of the Society for Minerals and Trace Elements, 18, 339-353.
Yu, Q., Kuo, J., and Tang, C. (2001) Using confocal laser scanning microscopy to
measure apoplastic pH change in roots of Lupinus angustifolius L. in response to
high pH. Annals of Botany, 87, 47-52.
Zhao, R., Dielen, V., Kinet, J.M., Boutry, M. (2000) Cosuppression of a plasma
membrane H(+)-ATPase isoform impairs sucrose translocation, stomatal opening,
plant growth, and male fertility. The Plant Cell, 12, 535-546.