DNA AND GENETIC MATERIAL
Griffith’s Experiments
 Frederick Griffith
 1928 while creating a vaccine for a pneumonia-
causing bacteria
 2 types of bacteria
 S – kills mice
 R – harmless
Griffith’s Experiments
 Frederick Griffith
 Group 1 – injects S bacteria, mice die
 Group 2 – injects R bacteria, mice live
 Group 3 – injects dead S bacteria, mice live
 Wanted to see if it was the bacteria or a reaction with
part of the bacteria (capsule)
 Group 4 – injects dead S bacteria and live R bacteria,
mice die
 Determines bacteria take up genetic information from
dead S bacteria to make them Virulent.
 Virulent – able to cause disease
Griffith’s Experiments
Griffith’s Experiments
 Virulent – able to cause disease
 Vaccine – substance that is prepared from a
killed or weakened microorganism and
introduced into the body to protect the body
against future infections by the
microorganism.
 Transformation – a change in phenotype
caused when bacterial cells take up foreign
genetic material.
Transformation
 The idea of transformation is how viruses
work.
 A virus injects its DNA into a cell which is
taken up by the nucleus and place into its
own DNA sequence
 When the cell is copying DNA and making
proteins, it makes new viruses as well.
 The viruses create a large enough population
and destroy the cell to be released. Then
infect other cells.
Transformation
 If you would like more information, go to
http://www.khanacademy.org/video/viruses?
playlist=Biology
Structure of DNA
 James Watson and Francis Crick – 1950’s
determined the shape of DNA
 Double Helix – twisted ladder or twisted railroad
tracks.
Structure of DNA
 The 2 strands linked by nucleotides
 Nucleotide – subunit that makes up DNA
Structure of DNA
 The 2 strands linked by nucleotides
 Nucleotide – subunit that makes up DNA
 3 parts of a nucleotide
 deoxyribose sugar
 Phosphate group
 Base
 DNA – Deoxyribonucleic Acid
Structure of DNA
 Bases –
 Adenine (A) - purine
 Thymine (T) - purine
 Cytosine (C) - pyrimidine
 Guanine (G) - pyrimidine
 Complimentary pairs – like puzzle pieces, two
things that fit together, compliment each
other.
 A-T, C-G (base-pairing rule)
Structure of DNA
Structure of DNA
 Each strand of DNA is complimentary to the
opposite.
 If the first row is a strand of DNA, finish its
complimentary strand below.
 ATCCGATCGAAGGTTTACGATCGGGTTAACA
 T
Structure of DNA
 Others contributing to our knowledge of DNA
Structure
 Erwin Chargaff – 1949, determined the amount of
A and T were always equal and that C and G were
always equal, however they varied from each
other.
 A=T and C=G, but A-T was not the same as C-G
Review Questions
 Summarize Griffith’s transformation




experiments
Name the 3 parts of a nucleotide
Relate the base pairing-rule to the structure of
DNA
Explain why the 2 strands of the double helix are
described as “complimentary.”
Suppose a strand of DNA has a nucleotide
sequence of CCAGATTG. What is the nucleotide
sequence of the complimentary strand?
Replication of DNA
 DNA Replication – process of copying DNA
 Step 1
 DNA needs to be unwound and the 2 strands
separated by DNA Helicase.
 Additional proteins prevent the two strands from
reattaching.
 Replication forks - where the 2 strand separate
and create a “Y” shape
Replication of DNA
Replication of DNA
 Step 2
 At the replication forks, enzymes (DNA
Polymerase) moves along strands adding
nucleotides to the exposed bases according to
base-pairing rules
 2 new strands are formed.
Replication of DNA
Replication of DNA
 Step 3
 DNA polymerase will remain attached until all the
DNA has been copied and it is signaled to detach
 2 new DNA molecules are formed
 Each has a brand new strand and an original
strand.
Replication of DNA
 Checking for errors
 Inevitably, errors will occur when copying and the




wrong nucleotide will be added.
DNA polymerase in addition to adding
nucleotides will also proof-read the DNA
If there is a mismatch the DNA polymerase will
replace the error with the correct nucleotide.
Normal error is 1 in 1 billion nucleotides.
Each human cell has 6 billion nucleotide pairs.
Replication of DNA
 Having multiple replication forks increases
speed for replication
 Because DNA in eukaryotic cells is so long, it
cannot be copied from one end to the other
or it would take 33 days to copy.
 A human chromosome is duplicated in 100
sections that are 10,000 nucleotides long
 Due to this human DNA can be copied in 8
hours.
Review Questions
 Describe the role of DNA Helicase in DNA
replication.
 What are the 2 roles of DNA polymerase in
replication?
 What is the effect of multiple replication forks
on the speed of replication in eukaryotes?
Review Questions
Review Questions
 What did Griffith find in his experiments with
the Streptococcus pneumoniae bacteria?
 What was the name of the process that was
involved in changing Griffiths R bacteria into
S bacteria?
 What are the 3 parts of a nucleotide?
 During which part of interphase is DNA
replicated (from mitosis/meiosis unit)?
Review Questions
 What did Watson and Crick discover?
 What is the complimentary sequence of the
following DNA molecule: GCCATTG?
 What enzyme unwinds and unzips DNA?
 What enzyme is responsible for DNA
replication and proofreading the new DNA
strand?
 What is the benefit of having multiple
replication forks along a DNA strand?
Review Questions
 What bases are purines? Pyrimidines?
 If a human is made of 30% adenine, what
percentage of DNA would be thymine?
guanine? cytosine? How do you know?
Review Questions
 Make sure you do review questions on slides
16 and 24-28
From genes to protein
 Decoding the information in DNA
 Traits are determined by the proteins that are
built. Hair color, eye color, build, etc.
 RNA (ribonucleic acid)
 Differs from DNA – 3 ways
 1. 1 strand instead of 2
 2. made of ribose sugar backbone instead of
deoxyribose
 3. uracil (U) replaces thymine (T)
From genes to protein
 Here is the story – information needs to be
taken from DNA in the nucleus and turn it
into a protein
 1. DNA is copied in the form of RNA
 2. RNA is transported to a ribosome
 3. Ribosome is going to read the RNA and put
proteins together.
 We will break it down in a little more detail,
but to understand the rest, you need to know
this much.
From genes to protein
 Transcription – transferring info from DNA to
RNA
 “scribe” – to write, “trans” - change from one to
another
 Step 1 on previous slide
 Translation – making a protein
 “translate” – change form/language
 Changes info into a protein
 Step 3 on previous slide
From genes to protein
 Transcription – change info from DNA to RNA
 RNA polymerase – an enzyme that transcribes
DNA into RNA by attaching and adding
complimentary RNA
 1. RNA polymerase binds to the gene promoter – a
specific sequence of DNA that acts as a “start” signal
for transcription
 2. RNA polymerase unwinds and separates DNA
 Transcription - RNA polymerase adds
complimentary RNA nucleotides.
From genes to protein
 Transcribe the following DNA sequence into
RNA
 CGTATTAGAAC
 G
From genes to protein
From genes to protein
 When copying DNA, the entire sequence is
copied, but when copying RNA only specific
parts of the DNA are transcribed.
 How does the RNA Polymerase know where
to start and stop copying?
 Start and stop codons.
From genes to protein
 Transcription – in nucleus
 Translation – once RNA is made it is sent to
the cytoplasm where translation will occur
 The RNA that takes the information from nucleus
to ribosomes is called mRNA (messenger RNA)
 Codon – 3 base segments that code for amino
acids.
From genes to protein
From genes to protein
 In 1961, Marshall Nirenberg, an American
biochemist, deciphered the first codon by
making an artificial UUU codon and it
produced a protein made entirely of
Phenylalanine amino-acid subunits.
 Scientists were later able to decipher other
codons.
 Genetic Code – amino acids and “start” and
“stop” codons that are made by each of the
possible 64 mRNA codons.
From genes to protein
 Quick review.
 DNA is transcribed (copied) into mRNA
segements in nucleus
 mRNA leaves nucleus and is taken to ribosomes
 Ribosomes will read the mRNA and translate it
into proteins.
From genes to protein
 Translation
 Ribosomes read the mRNA
 tRNA (transfer RNA) – RNA molecules that
recognize 3 base segments and bring specific
amino acids to the ribosomes.
 Each type of amino acid has a specific tRNA that
carries it to the ribosome.
 Anticodon – 3 nucleotide sequence on the tRNA
that recognizes the codon on the mRNA
From genes to protein
From genes to protein
 Transcription / Translation
From genes to protein
 Mutations can cause a nonfunctional protein
 Point mutation – mutations that change one or
just a few nucleotides in a gene on a chromosome.
 Normal sequence
 DNA -
TAC ACA CGT ATT
 mRNA AUG UGU GCA UAA
 Amino acid - Met Cys Ala Stop
From genes to protein
 Substitution Mutation
 DNA -
TAC ACA CGT ATT
 mRNA AUG UGA GCA UAA
 Amino acid - Met Stop
 Insertion Mutation
 DNA -
TAC ACA CGT ATT
 mRNA AUG UGU CGC AUA A
 Amino acid - Met Cys Arg Ile
From genes to protein
 Deletion
 DNA -
TAC ACA CGT ATT
 mRNA AUG UG_G CAU AA
 Amino acid - Met Trp His
 Think of it in terms of a sentence: “THE CAT ATE”
Turns into “THE ATA TE” no longer makes sense.
Review Questions
 Distinguish 3 differences between RNA




structure and DNA structure.
Describe how RNA is made during
transcription.
What is the DNA sequence that would code
for the amino acid for the codon CCU?
What is mRNA and tRNA?
What is a codon? Anticodon?
Review Questions
 Define transcription and translation.
 What is the process of making proteins from
mRNA?
 Where are anticodons found?
 What is a change in genetic code called?
 Mutations that change one or just a few
nucleotides in a gene are called?
Genetic engineering
 Genetic engineering – manipulating genes
for practical purposes
 4 steps of genetic engineering
 Cutting DNA
 Making recombinant DNA
 Cloning
 Screening
Genetic engineering
 1. Cutting DNA
 Isolate and cut the portion of DNA that codes for a
certain trait
 In our example it is insulin (diabetes)
 2. Make recombinant DNA – DNA made
from 2 or more different organisms
 Human gene is added to bacterial DNA and
inserted into bacteria cell to be produced.
Genetic engineering
Genetic engineering
Genetic engineering
 3. Gene Cloning – many copies of the gene
are made each time the host cell reproduces.
 4. Screening
 Isolation of the bacterial cells with the insulin
gene.
 That segment of DNA can then be extracted and
used.
Genetic engineering
 Is genetic engineering good or bad?
 What are some examples of how genetic
engineering are used?
Genetic engineering in
medicine
 Find malfunctioning gene, use a functioning
gene to include in a medication
 In hemophilia, blood cannot clot
 Medications can use proteins that someone with
hemophilia cannot produce and put it into a
medication to help regulate the condition.
 Other examples
 Growth hormone – growth defects, burns, ulcers
Genetic engineering in
medicine
 Vaccines – a solution containing all or part of
a harmless version of a pathogen.
Genetic engineering in
medicine
 There is a risk to vaccines
 If pathogen is incorrectly processed, you can
infect someone with a dangerous pathogen
 Some of the substances used to store and and
process the vaccine can cause adverse effects in
the body.
Genetic engineering in
medicine
 Gene therapy – putting a healthy copy of a
gene into cells of a person whose copy of the
gene is defective.
 Cell is removed from patient
 Healthy genes are inserted
 Cells returned
 Cells will produce substance they were lacking
Genetic engineering in
medicine
 DNA fingerprint – a pattern of dark band on
a photographic film that is made from an
individuals DNA fragments.
 Each person has a unique DNA fingerprint
 Often used for DNA identification in CSI forensics
or paternity cases.
Genetic engineering in
medicine
 DNA fingerprinting activity
Genetic engineering in
medicine
 Human Genome Project – Attempting to
determine the nucleotide sequence of the
entire human genome and to map the
location of every gene on each chromosome.
 Human genome contains about 6 billion base-
pairs and about 25,000 genes.
 Scientists have identified approximately 4,000
genetic disorders
Genetic engineering in
medicine
 Cloning
 How is it done?
 Is it good? Bad?
 Discuss.
Review Questions
 What are 3 food crops that have been
improved through genetic engineering
 Write a 1-page opinion paper on genetic
engineering and cloning.
 Define recombinant DNA, gene cloning,
vaccine, gene therapy, DNA fingerprint,
Human Genome Project.
 _____ is used to identify individuals in
paternity cases and criminal cases.