A Reconciliation of Faith and
Science.
Jacek Błażewicz
Instytut Informatyki
Politechnika Poznańska
&
Instytut Chemii Bioorganicznej
Polska Akademia Nauk
Molecular biology
 Chemical foundations of life
 Information coded in chemical molecules
Computational biology
Computing Science
Molecular Biology
Problems
Methods
Problems
Methods
Operations Research
One dimensional structures
1. Reading DNA chains
2. Understanding an information contained in DNA



sequence alignment
finding motifs in sequences
assigning functions to subsequences (or motifs)
Levels
 Sequencing
 up to 700 (150) nucleotides
 combinatorial exact methods
Assembling
 up to 1000000 (100000000) nucleotides
 heuristics
Mapping
 greater than 1000000 nucleotides
 search in data bases
Genetic linkage map
Chromosome
(works on 107-108 bp
range)
Assembling
Clones
(works on 105-106 bp range)
Sequencing
(works on 103-104 bp range)
CGGACACCGACGTCATTCTCATGTGCTTCTCGGCACA
The different scales at which the human genome is studied
Hybridization Experiment
Hybridization reaction
DNA chip
TCCACTG... Many
labeled copies of an
original sequence
Reading results
Fluorescence
image of the chip
. .
. . .
. .
spectrum
Spectrum – a set of oligonucleotides complementary to
fragments of original sequence
A hybridization reaction between a probe of known
sequence (l-mer) and an unknown sequence (n-mer):
n-mer - . . . A A C T A G A C C T . . .
l-mer -
GAT
CTA
A sequence complementary to the probe exists in the target
DNA sequencing without errors
The original sequence: AACTAGACCT
Spectrum = {AAC,ACT,CTA,TAG,AGA,GAC,ACC,CCT}
(Two possible solutions: AACTAGACCT, AACCTAGACT)
 Lysov (1988)
A graph is based on l-mers (graph H)
AAC
ACT
CTA
CCT
TAG
ACC
GAC
AGA
Finding a Hamiltonian path – NP-hard
The above class of directed labeled graphs –
DNA graphs.
Characterization and recognition of these graphs and finding
conditions for which the above transformation is possible.
J.Blazewicz, A.Hertz, D.Kobler, D.de Werra,
On some properties of DNA graphs,
Discrete Applied Math., 1999.
DNA sequencing in the presence of positive and negative errors
Formulation as a variant of Selective Travelling Salesman Problem:
Given a complete digraph G=(V,A), V=spectrum, with all vertex profits equal to
1 and arc costs equal to values of overlaps between vertex labels, find a path
of maximal total profit and total cost not greater than n-l.
[J.Blazewicz, P.Formanowicz, M.Kasprzak, W.T.Markiewicz, J.Węglarz, Journal of the
Computational Biology, 1999]
CTT
CTT
TAC
GCG
ACG
ACT
CTA
cost = 1, e.g. T(AC)T
cost = 2, e.g. AC(T)AC
TAC
GCG
ACG
ACT
CTA
Two optimal solutions
How complicated is human genome?
How big is the information it contains?
DNA recognition
Human genome
 3 109 pairs of bases
 3% nucleotides coding an information
Die Bibel: Altes und Neues Testament. Einheitsübersetzung
Verlag Herder, Freiburg, 1999 (ca 1500 pp)
Die Bibel: Altes und Neues Testament. Einheitsübersetzung
Verlag Herder, Freiburg, 1999 (ca 1500 pp)
Human genome
1 cell bacteria
Some flies
1000 books
(valid information 90 books)
7 books
1600 books
The theory of the origin of the Universe
There was a definite beginning
in which all its matter and
energy were concentrated at
one point, around 13.7 billion
years ago
An opposition to the concept
of an eternal universe, infinite
in age and constant in its
general appearance
Proposed in 1927 by
Georges Lemaître –
a Belgian Roman
Catholic priest,
professor of physics
and astronomer
BIG
BANG
Evidence
 Redshift of galaxies resulting from
universe expansion (Doppler effect)
 Cosmic microwave background
 Abundance of light elements (production
of nuclei other than those of H-1)
 Large scale distribution and apparent
evolution of galaxies
The result of retrodiction,
based on remarks of the
expanding universe
Future predictions depend
on dark matter and dark energy
 Big Crunch
 Big Freeze
 Heat Death
 Flatness hypothesis
 etc.
Big Bang - timeline
0 – 10-43 s
Planck epoch
Extremely hot and dense universe starts to expand about 13.7 bilion years ago.
10–43 - 10–36 s
Grand unification epoch
The universe expands and cools down. Gravitation separates from electromagnetism .and
nuclear forces
10–36 - 10–12 s
Electroweak epoch
Lower temperature allows for separation of strong force from the electroweak force. W, Z and
Higgs bosons are created.
10–36 - 10–32 s
Inflationary epoch
The universe is flattened and dominated by radioation. The seeds of structure formation are
laid down: quarks, electrons and neutrinos form.
10–12 - 10–6 s
10–6 - 1 s
1 -10 s
Quark epoch
The fundamental interactions of gravitation, electromagnetism, the strong interaction and the
weak interaction have taken their present forms
Hadron epoch
Due to lower temperature baryons such as protons and neutrons can form.
Lepton epoch
Leptons are no longer created and are eliminated in annihilation reactions
Big Bang – timeline (2)
10 s - 380 000 years
3 -20 min
70 000 years
Photon epoch
The universe is dominated by photons, interacting frequently with charged protons,
electrons and (eventually) nuclei.
Protons (hydrogen ions) and neutrons begin to combine into atomic nuclei in the process
of nuclear fusion. There is about three times more hydrogen than helium-4 (by mass)
and only trace quantities of other nuclei.
Cold dark matter dominates; densing of dense regions of the universe.
377 000 years
Forming electrically neutral atoms by capturing electrons by ions. Photons can travel
free, the universe becomes transparent.
150 mln - 1 bln
years
Reionization
Most of the universe is composed of plasma, first stars and quasars are formed, then
galaxies and groups.
8 bln years
8.5 bln years
Solar system
Our galaxy is formed roughly 5 bln years ago.
Earth
The age of the Earth has been determined to 4.54 billion years
Life on Earth - timeline
4.54 - 3.8 bln
years ago
3.5 bya
3 bya
3 - 2.4 bya
2 bya
Formation of Earth
Heavy bombardments by meteorites, asteroids and commets. Volcanism resulting from the large
heat flow and geothermal gradient. Oceans and simple atmosphere is created, then tectonic
plates and first continents.
Cooling, first life on Earth
Beginning of the evolution of primordial life in an atmosphere without oxygen and an ozone layer
Formation of the first known continent, Ur.
Proliferation of cyanobacteria. – the evolution of photosynthesis, which leads to production of
oxygen as byproduct led to the Great Oxidation Event: the Earth's atmosphere got oxygen.
Evolution of cells with nuclei
1.6 bya
First blue-green algae.
Natural evolution
1.3 bya
First plants.
Charles Darwin
630-850 mya
670 mya
600-500 mya
The Cryogenian Period - the worst ice age in the Earth's history.
First animals.
Cambrian explosion – a sharp increase in the diversity and number of complex animals
440 mya
The Ordovician-Silurian extinction – most marine species died out.
395 mya
First insects on land.
Life on Earth – timeline (2)
365 mya
The Late Devonian extinction. 70% of marine species died out . First amphibians, trees.
313 mya
First reptiles.
250 mya
The Permian-Triassic extinction. 90% of all species died out. Formation of the supercontinent
Pangaea
235 mya
First dinosaurs, flowers.
150 mya
First birds
114 mya
First modern mammals. World begins to cool.
67 mya
Cretaceous-Tertiary extinction caused by asteroid hit in Mexico. End of dinosaurs. 50% of all
species died out. Intensification of world cooling trend.
21 mya
Apes split off from other monkeys.
5 mya
Humans split off from other apes (gorillas and chimpanzees).
3.9 mya
First known Australopithecus afarensis.
2.5 mya
First Homo habilis.
1.9 mya
First Homo erectus.
620-380 tya
Interglacias period
350 tya
First Homo neanderthalensis.
250 tya
First Homo sapiens.
Clock of the history of life
What is life – some definitions
Cosmology point of view
•
Living systems self-assemble against nature’s tendency
toward disorder, or entropy (Erwin Schrödinger)
• Life processes low-entropy solar energy changing it into an
order, releasing disorder (heat) into the outer space
(Michał Heller)
Biologically inspired
• Living systems are characterized by selfprocessed metabolism (acquiring energy) and
ability of autoreplication (Andrzej Legocki)
• Life is a compound set of chemical reactions
and electron processes in a semi-conductive
environment of proteins (Włodzimierz Sedlak)
Genomic perspective
• Life is defined by a minimal set of important
genes (Jan Barciszewski)
• Complex biochemical structures may be
considered as alive if they are capable of
evolution via natural selection (Jan Kozłowski)
• Life is a self-sustaining chemical system
capable of Darwinian evolution (Gerald Joyce’s
definition adopted by NASA)
Cybernetic point of view
• Life is a network of feedback mechanisms
(Bernard Korzeniewski)
Computer science point of view
• Life is a system carrying and processing
information, capable of replicating itself
without a help of other systems that do not
belong to the same type.
Biological primer
Protein synthesis (or gene expression): a two
stage process of information transfer involving
many smaller discrete steps and many molecular
machines (genetic code is a set of
correspondences between specific groups of
bases and individual amino acids):
• Transcription
• Translation
Transcription
•
•
•
S. C. Meyer, Signature in the Cell, HarperOne, NY, 2009.
RNA polymerase makes an
identical copy of the DNA in a
RNA format.
The resulting single-stranded
RNA copy moves from the
chromosomes to the ribosome
to begin translation.
RNA polymerase is a complex
protein machine of great
specificity.
Transcription
•
S. C. Meyer, Signature in the Cell, HarperOne, NY, 2009.
•
The structure of the RNA
polymerases reflects the
complexity
of
their
activities
in
RNA
transcription
(Stephen
Wolfe).
RNA polymerase alone does not ensure accurate
transcription. Even in prokaryotic organisms, many
separate proteins are necessary to facilitate and regulate
transcription.
Translation
•
•
S. C. Meyer, Signature in the Cell, HarperOne, NY, 2009.
The process of translating
information from the fourcharacter alphabets of DNA
and RNA into the twentycharacter
amino-acid
alphabet.
Even in the simplest
prokaryotic cells, the proces
of translation utilizes many
dozens of separate proteins
each one of which is
produced during translation.
Is this scheme universal for all the organisms?
What about the genetic code?
In human cells, the codon UGA codes for „stop”, meaning the
end of an ORF.
In Mycoplasma, the codon UGA codes for the amino acid
tryptophan.
Human and Mycoplasma cells do not read their DNA in the
same way.
http://www.ncbi.nlm.nih.gov/Taxonomy/taxonomyhome.html/index.cgi?chapter=cgencodes
Notion of the information
Shannon linked the concepts of information and
uncertainty (measured by probability).
The amount of information conveyed (and the amount
of uncertainty reduced) in a series of symbols is
inversely proportional to the probability of a particular
event or symbol occurring.
Ex: An outcome of rolling a six-sided die is more improbable
than an outcome of flipping a coin, thus, it conveys more
information.
Shannon’s theory implies also that information
increases as a sequence of characters grows
but
it cannot distinguish functional or message-bearing
sequences from random or useless ones.
Biological sequences carry not only potential
(Shannon’s) complexity but also a functional one (called
specificity).
Ex: Proteins display specificity in the arrangement of
aminoacids and in shape.
S. C. Meyer, Signature in the Cell, HarperOne, NY, 2009.
Hypotheses of the beginning
Chance alone
What is chance?
Random process
Chance hypothesis can be eliminated when a series of
events occurs that deviates too greatly from an
expected statistical distribution of the events in
question.
What is the probability of generating by chance a
functional protein of length 150 aa? (Sauer, 1990; Axe
2004).
1. Peptide bonds vs non-peptide ones
S. C. Meyer, Signature in the Cell, HarperOne, NY, 2009.
Pr{𝑝𝑒𝑝𝑡} =
1 149
1 45
( ) ≈ (10)
2
2. Left-handed (L-form) vs right-handed (D-form)
optical isomers
Two optical isomers of the same amino acid.
S. C. Meyer, Signature in the Cell, HarperOne, NY, 2009.
Pr{𝐿 − 𝑓𝑜𝑟𝑚} =
1 149
1 45
( ) ≈ (10)
2
Thus, probability of building 150 aa chain at random is:
Pr{150 𝑎𝑎 𝑐ℎ𝑎𝑖𝑛} ≈
1 45
( )
10
*
1 45
( )
10
=
1 90
( )
10
3. But if one required a particular 150 aa chain then:
Pr{𝑝𝑎𝑟𝑡𝑖𝑐𝑢𝑙𝑎𝑟 𝑎𝑎 𝑐𝑜𝑚𝑏. } =
1 150
1 195
( ) ≈ (10)
20
3’. On the other hand, because of existing
aa variance in protein chains, it may be
shown using „casette mutagenesis”
technique (Sauer, 1990; Axe 2004), that
Pr{𝑝𝑟𝑜𝑑𝑢𝑐𝑖𝑛𝑔 𝑎𝑛𝑦 𝑓𝑢𝑛𝑐𝑡𝑖𝑜𝑛𝑎𝑙 150 𝑎𝑎
protein from aminoacids} ≈
1 74
( )
10
Summing up:
The probability that a 150-amino-acid
compound assembled by random interactions
in a prebiotic soup would be a functional
protein (event X) can be estimated as:
Pr{𝑋} ≈
1 74
( )
10
*
1 45
( )
10
*
1 45
( )
10
≈
1 164
( )
10
But are there enough probabilistic resources in the
universe?
• How many chances had particles to interact since the
big-bang? (Borel, van de Sande, Dembski)
There are:
1. 1080 elementary particles in the observable universe
2. 1043 state changes of particles/s (inverse of the
Planck time)
3. 1016 s since the big bang
• Summing up we have:
1080 * 1043 * 1016 = 10139
observable events in the universe, which is equivalent
to the measure of the probabilistic resources of the
entire observable universe.
This is much too small for the required probability of
1 164
( )
of getting functionally fit protein of
10
length 150 aa. (Odds of producing the minimum
cell equipped with the desired set of proteins
1 41000
≤ (10)
.)
Conclusion
Chance alone hypothesis is very improbable!
Lawlike processes (determination)
II. Self-Organization and Biochemical
Predestination
Self-organization refers (in physics) to a spontaneous
increase in the order of the system due to some natural
process, force or law (e.g. a vortex forms in a bathub as
the water swirls down).
S-O theories of the origin of life try to attribute the
organization in living things to physical or chemical
forces or processes (laws of nature).
Biochemical Predestination (Kenyon and Steinman)
Simple monomers (amino-acids, bases and sugars) arose
from simpler atmospheric gases and energy.
Polymers (proteins and DNA) arose from monomers.
Primitive membranes formed around these polymers.
Primitive metabolism emerged inside these membranes
as various polymers interacted chemically with one
another.
All that was driven by forces of chemical necessity, which
were also responsible for the origins of life.
This protein-first model could not explain the origins
of DNA information.
It fails to find any significant chemical interaction
between the codons on mRNA and the amino-acids
on the acceptor arm of tRNA to which the codon
corresponds.
The triplet at the 3’ acceptor end of tRNA (ACC) is the
same for all 20 tRNA molecules.
S. C. Meyer, Signature in the Cell, HarperOne, NY, 2009.
In fact, the codon - aa relationship (defining genetic
code) is established and mediated by the catalytic
action of some 20 separate proteins (aminoacyl-tRNA
synthetases) – highly specific biopolymers (origin ?).
Moreover, the discovery of seventeen variant genetic
codes (in different microorganisms) indicates that
chemical properties of relevant monomers allow for
several „codes”, thus nothing here is biochemically
predestined.
III. Self-organization via external forces
In Self-Organization in Nonequilibrium Systems
Prigogine and Nicolis suggested that energy flowing
into primitive living systems might have played a role in
the origin of biological organization.
But what needs explaining here is not order (in the
sense of a symmetrical or repeating pattern), but
information, the kind of specified digital information
found in DNA (as well as in computer software).
Here this approach fails to explain the issue.
Kauffman in The Origins of Order: Self-Organization and
Selection in Evolution presents a new model –
metabolism first.
Here, a self-reproducing metabolic system might
emerge directly from a set of „low-specificity” catalytic
peptides and RNA molecules in a prebiotic soup.
In other words this is „a set of catalytic polymers in
which no single molecule reproduces itself but the
system as a whole does.”
Again fails to explain the orgins of specified complexity
of biological molecules.
Necessity alone fails to explain the origins of
life, but what about chance and necessity
together?
Hypotheses of the beginning
copyright Scripps Inst.
Interactions between Faith and Science
Creationism (in its pure form, i.e. verbatim understanding of
the biblical description of the creation of the
world)
Faith dominates Science
Atheism and Agnosticism
Science dominates Faith
The ways to reconcile Faith with Science
Intelligent Design (Ph.Johnson, M.Behe, W.Dembski, S.Meyer)
Evolution is fundamentally flawed, since it cannot account for
the intricate (irreducible) complexity of nature, thus, an
Intelligent Designer had to step in (several times) to provide the
necessary components during the course of evolution.
However, the existing gaps in evolution that ID wanted to fill by
God are now filled by the advances in science.
Biologos (F.Collins)
Based on Theistic Evolution (A.Gray, T.Dobzhansky)
God, who is not limited in space or time, created the universe
and established natural laws that govern it.
God chose also the mechanism of evolution to create microbes,
plants and animals, as well as men who would have intelligence,
a knowledge of right and wrong, free will, and a desire to seek
fellowship with Him (F.Collins).
www.biologos.org
Conclusion
• The world needs scientists, but a scientific
outlook becomes dangerously narrow if it
ignores the religious or ethical dimension of life,
just as religion becomes narrow if it rejects the
legitimate contribution of science to our
understanding of the world.
Pope Benedict XVI
(cited by HE Vincent Nichols)