So, where were we?
• The risk of getting skin cancer, particularly melanoma, can be reduced by taking precautions in the sun.
• In this workshop we will focus more on the association between disease and genes.
• Scientists have found three possible DNA sequences which are associated with skin cancer.
• At the end, you will need to decide which is more important, your genes or your lifestyle?

• First, find a group of people with the disease (cases) and a group without (controls).
• Each group is genotyped.
• A set of markers, i.e. S.N.Ps.
(or ‘snips’), are scanned into computers.
• S ingle N ucleotide P olymorphism = a single DNA sequence variation in a base pair (i.e. a nucleotide A, G,
C or T) in the genome of a single species.
• e.g. AAGC C TA to AAGC T TA
• In this case the variation is between C and T

• Epidemeologists look for variations that are readily identified from a known panel of SNPs.
• Sometimes as many as 500,000 at one time, scattered across the three billion base pairs in the human genome.
• When the study attempts to examine genetic variation across the whole genome it is called a G enome W ide
A ssociation S tudy, or GWAS.

• If unique genetic variations are more frequent in people with the disease, the variations are said to be
"associated" with the disease.
• The associated genetic variations are then considered as pointers to the region of the human genome where the disease-causing problem is likely to reside.
• So let’s look at melanoma – GWA studies have shown three loci .
(a locus, plural loci , is the specific location of a particular
DNA sequence)

MC1R
• Polymorphisms or mutations in MC1R make it function less well.
• These people make less black melanin and so have white skin.
• Some variants cause red hair and freckles.
• Little variation seen in African populations: there is strong evolutionary pressure against change in this gene.
• Much variation in European populations: there is much less evolutionary pressure because of less UV radiation at higher latitudes.

MC1R

MC1R
9% in GWAS had the higher risk variant
TTACGTTTACCCAGAAATGGTACAA T GTTTGTGATAACTACATCA
AATGCAAATGGGTCTTTACCATGTT A CAAACACTATTGATGTAGT
91% have the lower risk variant
TTACGTTTACCCAGAAATGGTACAA C GTTTGTGATAACTACATCA
AATGCAAATGGGTCTTTACCATGTT G CAAACACTATTGATGTAGT
Odds Ratio 1.67 for malignant melanoma
(Odds ratio is the odds of getting the disease for someone who has the harmful variant compared to the odds of getting the disease for someone who doesn’t have the harmful variant.)

• An enzyme that converts tyrosine to melanin, the skin pigment.
• Mutations in this gene cause variations in skin pigment.
• Mutations which disrupt the function of the enzyme entirely cause albinism.

TYR
27% in GWAS had the higher risk variant
TCTTCCTCAGTCCCTTCTCTGCAAC A AAATCTGTGTGGTCTTTTA
AGAAGGAGTCAGGGAAGAGACGTTG T TTTAGACACACCAGAAAAT
73% had the lower risk variant
TCTTCCTCAGTCCCTTCTCTGCAAC G AAATCTGTGTGGTCTTTTA
AGAAGGAGTCAGGGAAGAGACGTTG C TTTAGACACACCAGAAAAT
Odds Ratio 1.29 for malignant melanoma

CDKN2A
• Cyclin-dependent kinase inhibitor 2A.
• Makes 3 different proteins.
• Is an important tumour suppressor.
• Expression increases with age.
• Decreases number of own stem cells.

CDKN2A
50% have this higher risk variant
TGGTAACCTTGAGTCCTGTGAATCT A TGCCTGCAGAGGGATCAAT
ACCATTGGAACTCAGGACACTTAGA T ACGGACGTCTCCCTAGTTA
50% have this lower risk variant
TGGTAACCTTGAGTCCTGTGAATCT G TGCCTGCAGAGGGATCAAT
ACCATTGGAACTCAGGACACTTAGA C ACGGACGTCTCCCTAGTTA
Odds Ratio 0.85 for malignant melanoma

• You may have inherited a genetic variation that is statistically linked to, or associated with, a disease but this association may not signify a causal link.
• The fact that hundreds of thousands of base pairs have been “searched” in a
GWA study, as individual “hypothesis tests”, is bound to lead to some “false positive” clues.

• 1 st December 2009 a new genetic marker was announced – based on a GWA study.
• 156 known heart disease patients (cases) were compared with 41 healthy adults (control).
• The marker is a slight, but precise variation in the chemistry of one gene detected in the DNA of the patients’ white blood cells.
• Patients were found to be more than three times as likely as non-sufferers to have the variant in the genetic material of their cells.
• Question: is this a normal variation in the gene? Or is the abnormality related in someway to hardening of the arteries?

• If you were told you had a marker based on this study of
156 known heart disease patients (the cases) and 41 healthy adults (the controls)… what should you be asking?

• Is the sample size big enough to infer a link?
– no, a bigger sample size is required.
• Is the sample size balanced between controls and cases?
– no, it would be better to have them equal in number.
• Should you think about the age and sex of the sample?
– yes, to avoid too many variables.
• If it is a robust association and a patient has the variant gene will they definitely get heart disease?
– no, there is a difference between relative and absolute risk. We can only say they have a higher relative risk.
• Should a patient eat a low fat diet to reduce the risk?
– YES!
• Fact – in Northern Ireland, our diet contains too much saturated fat.

• Cholesterol is a significant heart disease risk factor. It is diet related.
• But cholesterol is needed for cell membranes, vit. D metabolism and steroid-based hormones.
• The ratio between high and low density lipoproteins attached to the cholesterol is related to cardiovascular risk.
• HDL has a useful effect in reducing cholesterol and taking it back to the liver. HDL actually protects against thickening of arteries. HDL l evels can be raised by exercise.
• LDL can contribute to diseases of the heart. Levels can be lowered by eating a low fat diet and, if necessary, taking medication.

In the UK, the average total cholesterol level is 5.7mmol/l.
The levels of total cholesterol fall into the following categories:
• ideal level: cholesterol level in the blood less than
5mmol/l.
• mildly high cholesterol level: between 5 to
6.4mmol/l .
• moderately high cholesterol level: between 6.5 to
7.8mmol/l.
• very high cholesterol level: above 7.8mmol/l.
•In rare cases, a young person can present with high levels of low density lipoproteins. This is sometimes due to rare mutations in some genes that have been inherited from their parents.

• A rare condition.
• Caused by a gene mutation on chromosome 19.
• Passed through families as a dominant, autosomal gene.
• Heterozygous patients (FH N) show some symptoms of the disease.
• Homozygous patients (FH FH) show much more severe symptoms.

• Family A are the Whites. Their son Brian is in his mid-
30s and has high cholesterol levels (8mmol/l) with high levels of LDL.
• You decide to run a test to see if he has FH (familial hypercholesterolemia).
• You also test his sister Anna and brother Colin.
• To do this you are going use gel electrophoresis.
• A sample of their DNA is taken and prepared using
Restriction Length Polymorphism analysis and PCR.

• 2 metres per cell!
• 3 billion letters long (i.e. ACTG and so on).
• Like a piece of string.
• Specific enzymes can cut the DNA at specific nucleotide sequences. e.g. GTTAAC is cut by one sort of enzyme and TTAA cut by another.

R
F
L
P
PCR
• RFLP is defined as a variation in the number of restriction sites, or nucleotide sequences, in a specific
DNA region of one individual compared with another.
• RFLP analysis – a specific region of DNA (usually within or near the gene of interest) is amplified using
Polymerase Chain R eaction (PCR).
• PCR makes millions of copies of DNA – enough to work with and test.
• A PCR machine (thermalcycler) automates the process.
It effectively ‘photocopies’ DNA.

• Uses a gel made of seaweed (agarose). It is porous thus allowing DNA strands to ‘wiggle’ through.
• The DNA fragments have been pre-prepared.
• Enzymes have been added that cut the DNA at a sequence associated with the FH mutation.
• DNA has an overall negative charge due to its phosphate backbone.
• When a current is run through the gel the DNA fragments will move from the negative toward the positive electrode.
• Small DNA fragments are able to move further than larger ones.
• Brian’s sample (E) will be loaded in Lane 5
• Anna’s (B) is loaded in lane 2 and Colin (D) lane 4

big
-ve medium small
+ ve

• Gels are run in an electrophoresis tank for approximately 30 minutes at 150 volts.
• Check for bubbles at the electrodes.
• After, gels are placed in a DNA stain solution for 5 mins.
• They are then de-stained in distilled water for 20 mins. or more until the DNA banding can be clearly seen in the gel.

• Family B are the Smiths. The parents are 11&12.
• Their son Fred (25) is showing signs of a minor heart disorder (*) but both parents are clear.
• You create the family pedigree below:

•The disease * is dominant.
•Who had it first?
•Does the condition only affects males?

Down the left-hand side the number of sequence repeats in locus K are shown.
Can you find the repeat sequence of DNA which is shared by all those with the disease *?

• Is 25 the child of 11 and 12? Why or why not?
• Notice anything else? Do you need a hint?

(an example of co-dominance)
Phenotype
A
(dominant)
B
(dominant)
AB
(co-dominant)
O
(recessive)
Genotype
AA or AO
BB or BO
AB
OO

Parents’ blood phenotypes
O O
O
Blood group inheritance
A
O, A
B
O, B
A
B
AB
O, A O, A
O, B
AB
O, A, B,
A, B A, B, AB
O, A, B, AB
O, B
A, B, AB
AB
A, B
A, B, AB
A, B, AB
A, B, AB

• Genetic profiles can reveal information that presents an ethical dilemma.
• In this case, blood types reveal that 11 is also not the father of 21. 21 and 25 share the same mother as their siblings but assuming he is the same person for both, who is their father?
• Here is some help….
– 25 has the disease. The disease is dominant so the father must also have it.
– Also, 21 is blood type A so the father cannot be type O and must be A or AB. So the father could be 7 or 9.
– The father of 25 (O) cannot be AB-type, so the father cannot be
9.
• So, what are you going to tell the parents/children? How certain are you, just using this test?

Your personal genetic profile…

Electrophoresis Controls
1 2 3
1. DNA Standard Markers
2. Normal Control
3. Control Homozygous for
FH mutation

Electrophoresis results
1 2 3 4 5 6
(Anna) (Colin) (Brian)
1 = DNA standard markers
3 & 6 = controls for FH patient

• Lane 1 DNA control
• Lane 2 Anna homozygous normal = N N
• Lane 3 homozygous FH = FH FH
• Lane 4 Colin – homozygous normal = N N
• Lane 5 Brian heterozygous FH = FH N
• Lane 6 homozygous FH = FH FH
What are the parents? (use the sheet)

• GWA studies are an indication of a genetic association with disease but they are a ‘scattergun’ approach.
• Disease can be associated with one or more gene mutations.
• It helps to know family history/pedigree/socioenvironmental circumstances.
• You can now pay to have your genetic profile analysed to determine your risk of certain diseases. But how reliable are these tests and who should have access to the information they contain?

• So, once more, considering all we have learned, can you always blame ‘it’ on your genes?
Thank you