Interest Grabber
Section 13-1
A New Breed
The tomatoes in your salad and the dog in your
backyard are a result of selective breeding. Over
thousands of years, humans have developed breeds
of animals and plants that have desirable characteristics. How
do breeders predict the results of crossing individuals with
different traits?
On the next slide, work with a partner. Pick two breeds of dogs
and give 4 characteristics for each. In the middle green circles,
list those characteristics you might see if you bred the two
dogs together.
13–1 Changing the Living World
A. Selective Breeding
Hybridization-Zorses, wholphins, tigons, and
beefaloes. Lepjags, zonkeys, camas, and bonanzees.
These are some of the captive-bred mammalian hybrids
that exist, and they're joined by a host of hybrid birds,
fish, insects, and plants. Thanks to new techniques that
allow scientists to isolate and compare DNA, more
hybrids are turning up every year, and we're learning that
some of them—such as the pizzly, a cross between a
polar bear and a grizzly—can occur naturally in the wild.
2. Inbreeding
``There are over 350 known, inherited
diseases among purebred dogs, and that's
pretty scary,'' said Alison Schaffer, a
researcher at the University of California at
Davis' Veterinary Genetics Laboratory.
http://www.upei.ca/~cidd/intro.htm
Link to Canine inherited disorders database
B. Increasing Variation
Scientists and breeders can increase the genetic variation in
a population by inducing mutations
1.Producing New Kinds of Bacteria
a. Oil eating bacteria
2. Producing New Kinds of Plants
a. Polyploidy
i. Durham semolina wheat
ii. Bananas
iii. Citrus fruits
Concept Map
Section 13-1
Selective
Breeding
consists of
Inbreeding
Hybridization
which crosses
which crosses
Similar
organisms
Dissimilar
organisms
for
example
for
example
Organism
breed A
Organism
breed B
Organism
breed A
which
which
Retains desired
characteristics
Combines desired
characteristics
The Smallest Scissors in the World
Have you ever used your word processor’s
Search function? You can specify a sequence
of letters, whether it is a sentence, a word, or
nonsense, and the program scrolls rapidly
through your document, finding every
occurrence of that sequence. How might such
a function be helpful to a molecular biologist
who needs to “search” DNA for the right place
to divide it into pieces?
1. Copy the following series of DNA nucleotides onto a
sheet of paper.
GTACTAGGTTAACTGTACTATCGTTAACGTAAGCTACG
TTAACCTA
2. Look carefully at the series, and find this sequence
of letters: GTTAAC. It may appear more than once.
3. When you find it, divide the sequence in half with a
mark of your pencil. You will divide it between the T
and the A. This produces short segments of DNA. How
many occurrences of the sequence GTTAAC can you
find?
13–2 Manipulating DNA
Scientists use their knowledge of the structure of DNA and its
chemical properties to study and change DNA molecules.
A. The Tools of Molecular Biology
1. DNA Extraction-interactive link
http://learn.genetics.utah.edu/units/biotech/extraction/
2. Cutting DNA-restriction enzymesinteractive link
http://www3.interscience.wiley.com:8100/legacy/college/bo
yer/0471661791/animations/agarose/agarose.htm
3. Separating DNA-interactive link
http://learn.genetics.utah.edu/units/biotech/gel/
B. Using the DNA Sequence
If scientists can figure out the sequence then
they can use this knowledge to diagnose disease
and to change the DNA.
1. Reading the Sequence interactive link
http://www.pbs.org/wgbh/nova/genome/sequencer.html#
2. Cutting and Pasting-recombinant DNA
video
http://www.present.udel.edu/biotech/rDNA.html
3. Making Copies-interactive Polymerase
Chain reaction:
http://lifesciences.envmed.rochester.edu/movies/PCR_final.sw
f
Sneaking In
You probably have heard of computer viruses.
Once inside a computer, these programs follow
their original instructions and override instructions
already in the host computer. Scientists use small
“packages” of DNA to sneak a new gene into a cell,
much as a computer virus sneaks into a computer.
1.
Computer viruses enter a computer attached
to some other file. What are some ways that a file
can be added to a computer’s memory?
2.
Why would a person download a virus
program?
3.
If scientists want to get some DNA into a cell,
such as a bacterial cell, to what sort of molecule
might they attach the DNA?
13–3 Cell Transformation
During transformation, a cell takes in
DNA from outside the cell. This
external DNA becomes a component
of the cell's DNA.
A. Transforming Bacteria-interactive
link-choose “techniques”
http://www.dnai.org/b/index.html
B. Transforming Plant Cellsinteractive link. –scroll down and view
“Gene Gun”
http://plantandsoil.unl.edu/croptechnology20
05/gen/?what=animationList
C. Transforming Animal Cells-same
as plants
The Good With the Bad
The manipulation of DNA allows scientists to do
some interesting things. Scientists have
developed many transgenic organisms, which
are organisms that contain genes from other
organisms. Recently, scientists have removed a
gene for green fluorescent protein from a
jellyfish and tried to insert it into a monkey.
1.
Transgenic animals are often used in research.
What might be the benefit to medical research of a
mouse whose immune system is genetically altered to
mimic some aspect of the human immune system?
2.
Transgenic plants and animals may have
increased value as food sources. What might happen
to native species if transgenic animals or plants were
released into the wild?
13–4Applications of Genetic Engineering
The universal nature of genetic mechanisms makes it possible to
construct organisms that are transgenic, meaning that they contain
genes from other species.
A. Transgenic Organisms
1. Transgenic Microorganisms-insulin, HGH,
Blood- clotting factor.
2. Transgenic Animals-grow faster and leaner
3.Transgenic Plants-make their own
pesticides
B. Cloning-may help save endangered species