DNA
The rest of the story
Discovering the structure of DNA
• DNA = Deoxyribose nucleic acid
• Made out of sugars (deoxyribose), phosphates
and nitrogen bases
Discovering the structure of DNA
• Structure was discovered in 1953 by James
Watson and Francis Crick
Discovering the structure of DNA
Rosalind Franklin’s DNA image
“Chargoff’s rule”
A=T & C=G
Cell division and DNA replication
• Cells divide (a process called mitosis)
Why divide?
Growth, Repair,
Replacement of cells
• Before cells divide they must first copy the
DNA so both cells will have a copy.
DNA replication: When the cell copies the DNA
2 daughter cells are
both identical to the
parent cell
Steps to DNA replication
1. DNA helicase (an enzyme) unwinds and
unzips the DNA
2. DNA polymerase (another enzyme) reads the
two DNA strands and lays down the new DNA
3. DNA polyermase checks the base pairs and
makes sure there are no mistakes
4. DNA helicase zips the half old/ half new
strands of DNA back up and winds it back into
a helix
DNA replication occurs at the replication fork
* Replication occurs from 5’ to 3’
* One strand is the leading strand, one is the lagging
strand. The Okazaki fragments are fused together by
DNA ligase, an enzyme.
DNA replication
Replication results in 2 identical
strands of DNA.
Each strand is half old, half new.
mistakes, or changes
in the DNA are called
mutations.
Transcription of DNA
•DNA is in the nucleus, right?
•DNA cannot leave the nucleus
•So DNA must send a messenger to carry its code
outside of the nucleus, so the cell machinery in the
cytoplasm can read the message and use it to make
a protein
•DNA codes for PROTEIN!!!
•The messenger that DNA sends is called mRNA.
•Transcription is the process by which DNA makes
RNA. It has 4 steps.
Transcription of DNA
1. DNA helicase unwinds and unzips the DNA
2. RNA polymerase reads the DNA code and lays
down the mRNA strand.
3. There is no Thymine in mRNA, use Uracil
instead!
4. DNA helicase winds the DNA strand back up
5. The mRNA gets a cap and a tail, and leaves
the nucleus
Translation: translating the code into protein
Translation steps:
Codon = three bases on the mRNA strand
1. Enzymes “read” the message three bases at
a time on the mRNA and attach amino acids
into a chain, corresponding to the code. The
start codon on mRNA is always AUG.
2. The amino acid chain grows until it comes to
a stop codon... Then it is snipped off and is a
finished protein.
So DNA codes for
Protein!
The genetic code
Translate this code:
AUGAAAGCUGACUCAGGGCCGACUGCAUAA