Slide 1 / 199
Slide 2 / 199
AP BIOLOGY
Gene Expression
Summer 2013
www.njctl.org
Slide 3 / 199
Gene Expression Unit Topics
Slide 4 / 199
Discovery of DNA
Click on the topic to go to that section
· Discovery of DNA
· Nucleic Acid Structure
· DNA Replication
· Transcription & Translation
· Recombinant DNA
Return to
Table of
Contents
Slide 5 / 199
Nucleic Acid
Slide 6 / 199
Nucleic Acid
The precipitate at the bottom of
this flask is Deoxyribose Nucleic
Acid. This chemical is the
informational basis for all life.
Every molecule, organelle, cell,
organ, organ system, organism
and population is built by this
molecule.
Its properties allow for the
storage of instructions to build
living things.
It is the building block of the
genes that control how bodies
are shaped and how organisms
react to environmental factors.
This molecule is evolution.
Slide 7 / 199
Slide 8 / 199
The Selfish Gene
Genes Live Beyond Individuals
As an example, blue eyes are a
phenotype; a physical trait, controlled by
a single gene.
"Individuals are not stable things, they are
fleeting. Chromosomes too are shuffled into
oblivion, like hands of cards soon after they
are dealt. But the cards themselves survive
the shuffling. The cards are the genes. They
merely change partners and march on.
They are the replicators and we are their
survival machines. When we have served
our purpose we are cast aside. But genes are
denizens of geological time: genes are
forever."
Richard Dawkins,
Evolutionary Biologist
and Oxford University
professor.
A recent study showed that a mutation in one individual's OCA2
gene, which produces the pigment that gives color to eyes, created
a gene for blue eyes. This occurred 8,000 years ago and the new
gene was passed generation to generation.
Slide 9 / 199
Slide 10 / 199
Genes live beyond individuals
Primary Discovery
Nucleic acids were first isolated by the
Swiss physician Friedrich Miescher who,
in 1869, discovered a microscopic
substance in the pus of discarded
surgical bandages.
Today approximately 560,000,000 people have blue eyes. Each
individual carries 2 copies of the original mutation. The gene has
long outlived the human that it originated in.
At the time it was an unknown cellular
substance and was not considered
important until many years later.
Slide 11 / 199
The Search for Genes
Frederick Griffith in 1928 conducted the following experiment
using 2 different strains of the bacterium Streptococcus
pneumoniae.
Slide 12 / 199
S strain bacteria
kills mice.
R strain bacteria
does not kill mice.
Killed S strain does
not kill mice.
Killed S strain
mixed with living R
strain kills mice.
Dead mouse
blood contains
living S strain.
Miescher's Lab where
he discovered nucleic
acid
Slide 13 / 199
The Search for Genes
In Griffith's experiment why does the dead mouse contain
living S strain when only dead S strain was injected? Theorize
what may be happening.
Griffith's conclusion: Living R strain absorbs a chemical left
from the dead S strain. This chemical transforms the living
bacteria into the deadly S strain.
Slide 14 / 199
1
Which strain of S. pneumoniae was virulent?
A R strain
B S strain
C both
D neither
What we know now: Bacteria is capable of transformation.
This is when DNA is taken in from the environment and
incorporated into the bacteria's DNA. In this case the gene
that produces the deadly toxin is absorbed.
Slide 15 / 199
2
What does Griffith's experiment illustrate?
A Bacteria can transfer genes via sex pili
B
Phages increase the genetic variation of bacteria
C DNA is the genetic material of cells
D Bacteria can absorb genetic information from their environment
Slide 17 / 199
Closing in on the Genetic Material
Avery used a test tube
assay. This is when a
scientist compares
differences in test tubes after
treating each differently. The
benefit is that you can
discover more specific
reactions.
This approach will lead to
more information than dead
or living mice can provide.
Slide 16 / 199
Closing in on the Genetic Material
After Griffith's experiment most scientists believed that the
chemical transforming bacteria was a protein, not a nucleic
acid.
In the early 1940s experiments performed by Oswald T.
Avery and his colleagues at the Rockefeller Institute for
Medical Research challenged that assumption.
Slide 18 / 199
Closing in on the Genetic Material
First he heat-killed the S strain bacteria and
mixed it with detergent. This caused the
bacterial cells to break apart. Their
membranes lysed and spilled out the cell's
contents.
lysate
The upper portion of the test tube, the lysate,
contains less dense materials like proteins,
enzymes, and nucleic acids.
precipitate
Slide 19 / 199
Slide 20 / 199
Closing in on the Genetic Material
Closing in on the Genetic Material
The precipitate contained the large organelles and proteins of the
cell. Avery isolated the lysate to use because it contained smaller
molecules that were more likely to be the genetic material.
To be sure he took the lysate and mixed it with R strain to see if it
would transform the bacteria to S strain and it worked.
RNA
Proteins
lysate
DNA
lysate
R strain
lysate
precipitate
S strain
Slide 21 / 199
Closing in on the Genetic Material
It is easy to tell the difference from R and S because they look
different when grown on a petri dish. (R for rough edge; S for
smooth edge).
R strain
S strain
Slide 23 / 199
Slide 22 / 199
Closing in on the Genetic Material
Next Avery put in an enzyme that digests proteins into the lysate
and did the same experiment. What do you suspect is the result
and why?
lysate mixed with an
enzyme that digests
protein
R strain
Slide 24 / 199
Closing in on the Genetic Material
Closing in on the Genetic Material
Next Avery put in an enzyme that digests proteins into the lysate
and did the same experiment. What do you suspect is the result
and why?
What could you do to confirm this result? In other words what
would be another way to treat the lysate that would give usable
data?
S strain
Slide 25 / 199
Closing in on the Genetic Material
Avery and his team devised a technique that used alcohol to
isolate and purify nucleic acids from solution.
In a later experiment they mixed the
purified nucleic acid from S strain with
R strain bacteria. What is the expected
result?
S strain
Slide 26 / 199
3
Avery's work retested Griffith's hypothesis using a test
tube assay. What was the purpose of Avery's
experiment?
A To test the validity of Griffith results
To determine the macromolecule responsible for genetic
B information
C To determine the accuracy of a modern technique
To illustrate that the R and S strains were two separate species
D of bacteria
Slide 27 / 199
Slide 28 / 199
The Definitive Proof
The Hershey–Chase experiments were a series of experiments
conducted in 1952 by Alfred Hershey and Martha Chase that
confirmed DNA was the genetic material.
By this time many new discoveries allowed these scientists to
go beyond what others had been able to discover about nucleic
acids.
The Definitive Proof
Most importantly, intense research on viruses at the time
expanded the knowledge of these tiny particles.
Hershey and Chase concentrated on bacteriophages. These
viruses that infected and killed bacteria were known to only be
composed of 2 things: proteins and DNA
Slide 29 / 199
Slide 30 / 199
The Definitive Proof
Secondly, a lot was being learned about radioactivity. Since
they could not see the viruses, Hershey and Chase used a
novel approach that took advantage of a new technique called
radioactive labeling. This allowed them to track different parts
of the virus by looking for radiation.
The Definitive Proof
Hershey and Chase began by creating 2 kinds of radioactive virus
using a labeling technique. Below is how they made virus A.
bacteriophages
A geiger counter can find and
measure radioactive particles
bacteria
radioactive
SULFUR
Viruses grow via lytic cycle.
When they make proteins
they must use the
radioactive sulfur.
Slide 31 / 199
Slide 32 / 199
The Definitive Proof
Since proteins, not DNA, need sulfur to be constructed only the
proteins in these new phages are radioactive
The Definitive Proof
The procedure is repeated to make virus B with a change in the
radioactive material.
bacteriophages
radioactive
PHOSPHORUS
bacteria
Viruses grow via lytic cycle.
When they make DNA they
must use the radioactive
phosphorus.
Slide 33 / 199
Slide 34 / 199
The Definitive Proof
Since DNA, not proteins, need phosphorus to be constructed only
the DNA in these new phages are radioactive.
The Definitive Proof
Virus A is mixed with bacteria.
If the bacteria were sampled and isolated, would it be radioactive?
Apply what you know about the lysogenic cycle and genes to
hypothesize.
36 hours
radioactivity?
Slide 35 / 199
Slide 36 / 199
The Definitive Proof
Virus B is mixed with bacteria.
The Definitive Proof
Summary of Hershey Chase experiments:
If the bacteria were sampled and isolated, would it be radioactive?
Apply what you know about the lysogenic cycle and genes to
hypothesize.
36 hours
radioactivity?
Slide 37 / 199
4
Hershey and Chase utilized phages in their research
because phages...
Slide 38 / 199
5
After viral infection, radioactive phosphorus was found
in the bacterial cells. This result occurred because...
A have easily controlled reproductive cycles
Expression of the viral DNA incorporated radioactive phosphorus
A into the proteins
B are inexpensive to maintain
C
contain only nucleic acids and proteins
D
have a higher mutation rate than living organisms
B
Only viral DNA was inserted into the host cell
The viral DNA was incorporated in the host DNA during the
C lysogenic cycle
DNA and proteins require phophorus while only proteins require
D sulfur
Slide 39 / 199
6
Which of the following illustrates the sequence of
events leading to the confirmation of nucleic acids as
the genetic material of the cell?
A
Hershey-Chase experiments, Avery experiments, Miescher's
discovery, Griffith experiments
B
Griffith experiments, Miescher's discovery, Avery experiments,
Hershey-Chase experiments
C
Miescher's discovery, Griffith experiments, Avery experiments,
Hershey-Chase experiments
D
Miescher's discovery, Avery experiments, Hershey-Chase experiments,
Griffith experiments
Slide 40 / 199
The Double Helix
With the data collected by Hershey and Chase the focus of the
scientific community shifted to nucleic acids. DNA in particular
became the focus of scientists looking to make the next big
discovery.
Two pairs of scientists working in the same facility ultimately made
the discoveries about DNA that lead to the modern understanding
of the genetic material.
Slide 41 / 199
Slide 42 / 199
The Double Helix
Working at King's College London in 1951, Rosalind Franklin and
Maurice Wilkins produced x-ray diffraction images of DNA to try to
discover its shape and understand its mechanisms.
The Double Helix
X-ray diffraction shoots subatomic particles into a substance. The
collison of these particles with those of the molecules in the
substance cause them to diffract, or ricochet, at specific angles.
This gives insight to the structure of the substance.
X-rays
Crystalized
DNA
photo paper
sensitive to
x-rays
Slide 43 / 199
Slide 44 / 199
The Double Helix
The Double Helix
Wilkins shared this now famous "photo 51" (that was prepared by
Franklin) with his colleagues James Watson and Francis Crick.
Watson and Crick deciphered from the
photo that DNA was a double helix.
They began to build models of the
structure so they could speculate on
how DNA can:
1) Self replicate
2) Code for all the traits of living things
photo 51
James Watson
Francis Crick
The discoverers of the DNA structure, James Watson,
left, and Francis Crick, with their model of a DNA
molecule. (A. Barrington Brown/Photo Researchers, Inc.)
Slide 45 / 199
Slide 46 / 199
Nucleic Acid Structure
RNA and DNA
1
RNA and DNA are the 2
nucleic acids necessary for
living organisms.
Uracil is a nitrogenous
base in RNA but not DNA.
Thyamine is a nitrogenous
base in DNA but not RNA.
RNA is single stranded
and can fold into many
shapes.
Return to
Table of
Contents
Slide 47 / 199
DNA is double stranded
and can only be a double
helix.
Slide 48 / 199
DNA
DNA is an informational
molecule encoding the
genetic instructions used in
the development and
functioning of all known
living organisms.
This diagram highlights the
major chemical features.
Notice that guanine and
cytosine form 3 hydrogen
bonds, while adenine and
thymine for only 2 hydrogen
bonds.
DNA
The two strands run in
opposite directions to each
other and are therefore antiparallel, one backbone
being 3' (three prime) and
the other 5' (five prime).
This refers to the direction
the 3rd and 5th carbon on
the sugar molecule is
facing.
1
2
Slide 49 / 199
RNA
RNA makes the molecular
machinery necessary for the
function of DNA. It plays a major
role in the replication of DNA and
the reading of the information
stored in DNA.
Slide 50 / 199
7
Which of the following is not true regarding DNA and
RNA?
A Ribose has one more hydroxyl group than DNA
Both RNA and DNA backbones consist of a sugar-phosphate
B chain
C Only DNA bases form hydrogen bonds
D DNA forms only one shape. RNA forms many shapes
Three-dimensional representation of the
small ribosomal subunit. RNA is in brown,
protein in blue. The active site is in the
middle (red). This molecule reads the
genetic code.
Slide 51 / 199
8
Which of the following is true regarding uracil?
A It is only found in DNA
B It forms 2 hydrogen bonds with adenine
C It is more stable than thymine
D It is only found outside the nucleus of eukaryotic cells
Slide 53 / 199
Chromosomes Defined
Chromosomes vary widely between different organisms. The DNA
molecule may be circular or linear, and can be composed of 100,000
to over 3,750,000,000 nucleotides in a long chain.
Typically, eukaryotic cells have large linear chromosomes and
prokaryotic cells have smaller circular chromosomes.
Slide 52 / 199
Chromosomes Defined
A chromosome is an organized
structure of DNA and protein
found in cells. It is a single piece
of coiled DNA containing many
genes.
Slide 54 / 199
Prokaryotic Chromosomes
This is a chromosomal map of a
bacteria, H. orenii.
Like all bacteria, this circular DNA
molecule contains all the genes
that are needed to make the entire
organism.
This particular bacterial genome is
made of ~2,500,000 nucleotides.
Each different color in the outer
circle represents another gene.
Slide 55 / 199
Slide 56 / 199
Eukaryotic Chromosomes
Eukaryotic Chromosomes
In eukaryotes, nuclear chromosomes are packaged by proteins into a
condensed structure called chromatin. This allows the very long DNA
molecules to fit into the cell nucleus.
Since eukaryotes are larger and more complex, eukaryotic
chromosomes are much larger and require more complex methods for
storage of their numerous genes.
Chromosomes are the essential unit for cellular division and must be
replicated, divided, and passed successfully to their daughter cells to
ensure the genetic diversity and survival of offspring.
Special proteins called histones and scaffolds pack the DNA strand
into tight coils.
Slide 57 / 199
Slide 58 / 199
Eukaryotic Chromosomal Structure
Eukaryotic Chromosomal Structure
see next
slide
Slide 59 / 199
Eukaryotic Chromosomal Structure
see next
slide
Slide 60 / 199
Eukaryotic Chromosomal Structure
This diagram represents a
eukaryotic chromosome after
replication has occurred.
(1) Chromatid – one of the two
identical copies of the chromosome.
(2) Centromere – the point where
the two chromatids touch, and
where the microtubules attach
during cell division.
(3) Short arm.
(4) Long arm.
Slide 61 / 199
Slide 62 / 199
Eukaryotic Chromosomal Structure
3
2
Chromosomes are often represented as
genetic maps that show the loci of
genes. This is a representation of
human chromosome 7
Human Chromosomes
Each band represents a gene or a group of genes that code for a
phenotype of the human. Humans have 23 pairs of chromosomes in
each of their cells that contain multiple copies of ~40,000 genes.
4
Slide 63 / 199
Chromosome Number
Chromosomes can be diploid, 2 versions of
each chromosome, or haploid, 1 version of
each chromosome.
N= Number of chromatids
Slide 64 / 199
9
How is prokaryotic and eukaryotic DNA similiar?
A It is double stranded
B
The DNA is wrapped around histone proteins
The DNA condenses into chromosomes during cellular
C replication
D Chromosomes are located in the cell nucleus
Slide 65 / 199
10
When would human chromosomes have this
appearance?
A in gametes
B in somatic cells
C during interphase
D during mitosis
Slide 66 / 199
Human Karyotype
A karyotype is a photograph of the actual chromosomes of an
individual human. A nucleus is isolated and the chromosomes are
removed and arranged. They can be used to learn about possible
chromosomal abnormalities.
Slide 67 / 199
Slide 68 / 199
Human Karyotype
Human Karyotype
What can you learn about this individual from their chromosomes?
What can you learn about this individual from their chromosomes?
Abnormal
number of sex
chromosomes
Most likely
a normal
female
Klinefelter
syndrome
XXY
Slide 69 / 199
Slide 70 / 199
DNA Replication
Human Karyotype
What can you learn about this individual from their chromosomes?
Male with extra
chromosome 21
Down
Syndrome
Return to
Table of
Contents
Slide 71 / 199
Replication
The functions of a cell are determined by its DNA.
Cells have to reproduce many times. In complex organisms,
trillions of copies are made from one original cell.
But when cells reproduce, they must replicate (or copy) their
DNA.
The structure of DNA reveals how trillions of copies of the
DNA in one of your cells can be made, and be almost exactly
the same each time.
Slide 72 / 199
Watson & Crick
When Watson and Crick published the structure of DNA in a short article
in 1953 they stated:
"It has not escaped our notice that the specific pairing we have
postulated immediately suggests a possible copying mechanism for the
genetic material."
The fact that there are two DNA strands that are mirror imagesof one
another suggested how copies could be made of each DNA sequence.
Slide 73 / 199
Slide 74 / 199
DNA Molecule as Template
Separation of Strands
template
strand
Each molecule of DNA is made
of a template strand and a new
strand.
The template strands of the DNA
molecule separate and the new
strands are made on the inside.
The template is used to make
the new strand.
The template strand is also
known as the parent strand
since it came from the original
DNA molecule.
Click here to see an animation of the
mechanism of replication
The new strand is also known
as the daughter strand.
Slide 75 / 199
Slide 76 / 199
Enzyme Catalyzed Reaction
Adding New Nucleotides
Nucleotides can only be added to the -OH end (3`), not the 5`so
all new strands are made in the 5' - 3' direction.
DNA nucleotide
monomers are made
ahead of time and stored
in the cell.
DNA polymerase is the
enzyme responsible for
adding each new
nucleotide to the growing
strand.
Slide 77 / 199
Slide 78 / 199
Semi-Conservative DNA Replication
The result of this process is 2 new DNA molecules each having an
old template strand and new strand. This is called semi-conservative
because it "conserves" some of the old DNA in each copy.
Two parent strands
One parent and
one daughter
strand
One parent and
one daughter
strand
11
The 3' end of a DNA strand has a phosphate at the end.
True
False
Slide 79 / 199
12
Slide 80 / 199
Replication Practice
Why does a DNA strand only "grow" in the 5' to 3' direction?
A
because DNA can only add nucleotides to the 3'
end of the molecule
B
because DNA can only add nucleotides to the 5'
end of the molecule
C
because mRNA can only read a DNA molecule
from 5' to 3'
D
because mRNA can only read a DNA molecule
from 3' to 5'
3'
ATCGGGTTAACGCGTAAA
5'template strand
5'
______________________
3'
new strand
What is the sequence of
the new strand?
3'
GGTTACTAATCGAGCCCCT
5' template strand
5'
______________________
3'
new strand
What is the sequence of
the new strand?
Slide 81 / 199
13
If the parent DNA strand is 5' ATCGATACTAC 3', what will the
daughter stand be
A
5' TAGCTATGATG 3'
B 3' ATCGATACTAC 5'
Slide 82 / 199
The Molecular Process of Replication
A strand of DNA is replicated in segments. At intervals down the DNA
molecule portions of the 2 strands separate creating replication
bubbles. Either side of the replication bubble is know as a
replication fork.
C 5' UAGCUAUGAUG 3'
D 3' TAGCTATGATG 5'
Slide 83 / 199
Replication Fork
DNA replication is a precise process that must minimize error. To do
this cells use many enzymes in a complex process that uses
template strands to create new DNA molecules
Slide 84 / 199
Topoisomerase
Topoisomerase is an enzyme that controls winding of DNA during
replication. A winding problem in DNA arises due to the intertwined
nature of its double helical structure. During DNA replication, DNA
becomes overwound ahead of a replication fork. This tension would
eventually stop replication.
Slide 85 / 199
Helicase
Helicase breaks the weak hydrogen bonds that hold nucleotides
together opening up both strands to become templates for new
strands. Helicase is the molecule that creates the replication fork.
Slide 87 / 199
Leading vs. Lagging Strands
Since the strands are anti-parallel they are arranged in opposite
directions. In order to replicate both strands in the same direction
there are 2 different strategies, one for each template ( leading and
lagging).
Slide 89 / 199
Primase
DNA polymerase can only read in the 3' to 5' direction. So on the
lagging strand there has to be a way to make the new strand in
reverse. It starts with an enzyme called primase that adds RNA
nucleotides as a primer for DNA polymerase.
Slide 86 / 199
Single Stranded Binding Proteins
Single stranded binding proteins ensure that the nucleotide pairs do
not re-bind after helicase passes.
Slide 88 / 199
DNA Polymerase
The leading strand is simple since it runs 3' to 5'. DNA polymerase
can follow behind helicase and simply copy the template as it is
being exposed.
Slide 90 / 199
DNA Polymerase
DNA polymerase can latch onto the RNA primers and begin to write
fragment of the new strand. Since it is going away from the
replication fork it only does a portion, then it jumps back in front of
the portion it just did to start again.
Slide 91 / 199
Slide 92 / 199
Ligase
Okazaki Fragments
The fragments formed by this process are called Okazaki fragments.
When the RNA primers fall away from the strand gaps are left
between the fragments that must be repaired.
DNA ligase finishes the job by filling in the gaps between the Okazaki
fragments.
Slide 93 / 199
14
Hydrogen bonds hold base pairs together in DNA.
Which enzyme severs these bonds during replication?
15
A mutation has caused a change in the shape of the
topisomerase enzyme. This would most likely affect...
A Ligase
A the directionality of DNA synthesis
B Polymerase
B
the formation of bonds between Okazaki fragments
C Primase
C
the tension in the DNA double helix
D Helicase
D
the separation of the DNA strands
Slide 95 / 199
16
Slide 94 / 199
Incorrect base pairing does occur during the replication
process, however, most of these errors are corrected.
Which enzyme effectively decreases the mutation rate
of cells?
A helicase
B ligase
C primase
D polymerase
Slide 96 / 199
Polymerase Chain Reaction
PCR (Polymerase Chain Reaction) is a
technique which uses the principles of
DNA replication to amplify the amount of
DNA available for testing and
manipulation.
This reaction is carried out by a special
machine that utilizes repeating cycles of
heat, DNA polymerase, DNA primers
and free nucleotides to build copies of
the DNA fragment.
This technology enables small amounts
of DNA to be turned into large amounts.
Slide 97 / 199
Polymerase Chain Reaction
1. DNA is heated to high
temperature, the DNA
strands denature,
separating the double
helix
Slide 98 / 199
17
A single DNA molecule is placed in a PCR machine.
After 20 cycles, how many copies of DNA will be
present?
2. DNA is cooled, primers
and polymerase in the
mixture anneal to the DNA
3. The temperature is
increased slightly to increase
the rate of replication
reactions
The cycle is repeated, doubling the amount of DNA each cycle.
Slide 99 / 199
18
Taq polymerase is typically used in polymerase chain
reactions. This polymerase enzyme is found in
thermophilic bacteria, Thermus aquaticus. What is the
best explanation for the use of this enzyme?
Slide 100 / 199
Transcription & Translation
Enzymes from thermophilic bacteria are stable at high
A temperatures
Bacterial enzymes are easier to replicate than eukaryotic
B enzymes
Ethical objections exist to the use of human macromolecules,
C such as DNA polymerase
Return to
Table of
Contents
D Only Taq polymerase is available commerically
Slide 101 / 199
Gene Expression
Gene expression is the molecular
process of reading the order of
nucleotides in a DNA molecule and
making the coded product. This
product is usually a protein but RNA is
also coded for in genes.
Gene expression occurs whenever a
specific protein or RNA molecule is
needed by the cell.
Slide 102 / 199
DNA to RNA to Protein
Expressing the information stored on a gene into a
protein requires :
· translating from the 4 letter language of DNA to RNA
· Then from the 4 letter language of RNA, to the 20
letter language of proteins (their amino acid
sequence).
Slide 103 / 199
Slide 104 / 199
The Universal Genetic Code
Codons
The mRNA "message" is read in 3-letter
words called codons. Each codon codes
for an amino acid or tells the process to
stop.
There are 64 codons (4x4x4) but only 20
amino acids. So some codons code for
the same amino acid.
· 61 of the codons code
for an amino acid
· 3 of the remaining
codons are "STOP"
codons that do not code
for an amino acid. They
just signal that
translation is over.
· 1 codon that codes for
the amino acid
"methionine" is also the
"START" codon.
Methionine is always the
first amino acid in a
protein.
Slide 105 / 199
The Universal Genetic Code
Slide 106 / 199
The codon UAA specifies:
19
This is called a "universal" code because ALL LIFE uses
the same genetic code... from the smallest bacteria or
virus to the largest animal or tree.
A Adenine
C
STOP
This tells us that this code goes back billions of years, in
the first cell...or even before that.
D
Arginine
B Glycine (Gly)
E Valine
If there were alternative codes that could work, they would
have appeared in nature.
There are very minor alterations, but they are rare and
insignificant in their effect.
Slide 107 / 199
20
The codon GGG
specifies:
A Adenine
Slide 108 / 199
21
Why is methionine the very first amino acid in all proteins?
B
Glycine
B
because it is coded by the stop codon
because it is coded for by AUG which is the start codon
C
STOP
C
Methionine is coded for by more than one codon
D
Arginine
D
none of the above
E
Valine
A
Slide 109 / 199
Slide 110 / 199
The Central Dogma
The Central Dogma
The Central Dogma is a one way process.
transcription
DNA
Changes in DNA affect mRNA and protein.
translation
RNA
PROTEIN
transcription
DNA
replicatio n
The processes of replication, transcription and translation are so
critical that they are called the Central Dogma of Biology.
A "Dogma" is a postulate; an idea; a philosophy.
translation
mRNA
Protein
But changes in proteins or mRNA do not affect the DNA.
This will have important implications when we study
genetics.
It is "Central" because it is what life is based on.
Slide 111 / 199
Slide 112 / 199
The First Step - Transcription
Transcription is the first step of gene expression, in which a
particular segment of DNA is copied into RNA by the enzyme RNA
polymerase.
Gene Anatomy
Transcription of genes is regulated by the cell. Genes are turned on
and off in response to environmental signals.
Slide 113 / 199
Control Region
Slide 114 / 199
Transcription - Initiation
Transcription initiated when RNA polymerase and cofactors bind to the
promoter (a section of the control region). The RNA polymerase
unwinds the DNA creating aninitiation bubble . This is a space that
grants RNA polymerase access to a single strand of the DNA molecule.
This control region is where transcription
factors bind to the gene. When all the
necessary factors are combined RNA
polymerase can bind to the gene and initiate
transcription.
olymerase
NonTemplate
Promotor
Region
Slide 115 / 199
Slide 116 / 199
Transcription: DNA Strands
Template vs. Non-Template Strands
This makes sense in that the RNA will be the mirror image
of the DNA it is transcribed from. And the non-coding strand
is the mirror image of the gene.
The RNA polymerase never attaches to the strand that
actually contains the gene.
The strand with the genes is called the "non-template strand."
This IS NOT the strand that is transcribed.
non-template strand of DNA
template strand of DNA
The other strand is the mirror image of the first, it carries the
mirror image of the gene, not the gene itself. It is called the
"template strand."
This IS the strand where the RNA polymerase attaches.
transcription of template strand
RNA
Note:
the non-template strand of DNA (the gene) matches the new
RNA strand
Slide 117 / 199
Slide 118 / 199
22 The strand that is transcribed into RNA is called the
23
What is the function of the controlling sequence on the DNA?
A Template Strand
A
B Non Template Strand
C
RNA Strand
D
Amino Acid Strand
it is where the RNA polymerase recognizes and binds
to initiate translation
B it is where the RNA gets copied
C it where transcription terminates
D
it is where the RNA polymerase binds to on the 3' end
of the DNA initiating transcription
Slide 119 / 199
Slide 120 / 199
Base Pairing
Transcription - Elongation
To make the RNA strand, RNA polymerase runs down the DNA
template strand reading the bases and bringing in the new RNA
nucleotides with the proper complementary bases.
As the RNA polymerase runs down the DNA, it unwinds the DNA.
NonTemplate
new
mRNA
Transcription is made possible by the
fact that the different bases are
attracted to one another in pairs based
on the number of hydrogen bonds they
can make.
RNA
DNA
A
bonds with
U
bonds withA
G
bonds withC
C
bonds withG
T
Note: In DNA replication adenine paired with
thymine, in DNA transcription uracil is now paired
with adenine. Remember that RNA does not
contain thymine as a nucleotide base.
Slide 121 / 199
Slide 122 / 199
Transcription
24
Just like in DNA replication,
If the template strand of DNA is 5' ATAGATACCATG 3', which is
the RNA strand produced from transcription
A 5' UAUCUAUGGUAC 3'
RNA is made from the 5' end to the 3' end.
B
5' TATCTATGGTAC 3'
C 3' UAUCUAUGGUAC 5'
DNA("template strand")
3' TACGGCATTA
5'
RNA
5' AUGCCGUAAU 3'
being made in 5'--------->3' direction.
D 3' TATCTATGGTAC 5'
Slide 123 / 199
25
Slide 124 / 199
If the template strand of DNA is 5' AAAGACACTATT 3', which is
the RNA strand produced from transcription
A 5' UUUCUGUGAUAA 3'
B
5' TTTCTGTGATAA 3'
26
If the non-template strand of DNA is 3' ACGATTACT 5', which is
the RNA strand produced through transcription
A
5' TGCTAATGA 3'
B
3' UGCUAAUGA 5'
C 3' UUUCUGUGAUAA 5'
C 5' UGCUAAUGA 3'
D 3' TTTCTGTGATAA 5'
D 3' ACGAUUACU 5'
Slide 125 / 199
Slide 126 / 199
Transcription - Termination
RNA polymerase gets to a sequence on the DNA called a
termination sequence. This sequence signals the RNA
Polymerase to STOP transcription.
Controlling Gene Expression
Individual cells respond to environmental change by regulating
their gene expression.
Prokaryotes and eukaryotes have evolved different
mechanisms for regulating their gene expression.
NonTemplate
Termination
Sequence
The RNA polymerase falls off the DNA.
The new RNA strand separates from the DNA.
The DNA recoils into a helix.
Click here to see an
animation of transcription
Remember: one of the properties of life is
"response to the environment"
Slide 127 / 199
Prokaryotic Gene Expression
Slide 128 / 199
Regulating Prokaryotic Gene Expression
The following are 2 examples of the regulation of gene
expression in prokaryotes:
Lac Operon
Trp Operon
Slide 129 / 199
Operons: The Basic Concept
In prokaryotes, genes are often clustered into
operons within the
chromosome.
Operons consist of 3 parts...
An operator - essentially an “on-off” switch
A promoter - an area that attracts RNA polymerase
The genes - which code for the protein needed by the cell
Slide 131 / 199
Inducible Operons
An inducible operon is one that is usually off; a molecule called an
inducer inactivates the repressor and turns on transcription.
An example of an inducible operon is thelac operon, which contains
genes coding for enzymes that break down lactose into glucose so the
bacteria can use it for energy.
If no lactose is present then no enzyme needs to be made. The bacteria
saves energy this way.
In this operon, the lactose molecule is the inducer.
Click here to see an
animation of the Lac Operon
Slide 130 / 199
Repressors
An operon can be switched off by a protein called a repressor.
The repressor can be controlled through allosteric regulation with
co-repressors and inducers.
A co-repressor is a small molecule that cooperates with a
repressor to help switch an operon off.
An inducer is small molecule that inhibits a repressor to help switch
an operon on.
Slide 132 / 199
Repressible Operons
A repressible operon is one that is usually on.
When a repressor binds to an operator, transcription is shut off.
The trp operon is a repressible operon. Thetrp operon codes for a
number of genes responsible for the production of the amino acid
tryptophan. If tryptophan is present in the environment, the
trp operon is
not used.
Tryptophan acts as the co-repressor in this operon.
Click here to see an
animation of the Trp Operon
Slide 133 / 199
27
Slide 134 / 199
The lac operon is an example of an _____.
28
In the presence of Trp ______.
A inducible operon
A the repressor is activated
B repressable operon
B the cell makes more Trp
C the operon is turned on
Slide 135 / 199
29
Slide 136 / 199
Gene Expression in Eukaryotes
In the presence of lactose ______.
A the lac operon is turned off
B the lac operon is turned on
Eukaryotes have much
more complex
chromosomes that require
multiple levels of
regulation including:
· "unpacking" of genes
· transcription factors
· RNA processing
C the repressor becomes active
Slide 137 / 199
Slide 138 / 199
Chromatin's Role in Gene Expression
Chromatin Modifying Enzymes
When DNA is packed in chromatin it is not accessible to RNA
polymerase so transcription can not happen.
The main factor in the specialization of cells in multi-cellular
organisms is what genes are "unpacked" from the chromatin to be
exposed to RNA polymerase.
All gene sequences are
exposed to RNA
polymerase
Some genes exposed
No genes exposed
The genes that need to be expressed are unwound from histones by
chromatin modifying enzymes in order to expose their nucleotide
sequences.
Genes that are unnecessary to a particular cell will remain packed while
the neccessary ones are unpacked.
Slide 139 / 199
Slide 140 / 199
mRNA Processing
Alteration of mRNA Ends
After transcription of eukaryotic DNA, the transcript is known as premRNA. Enzymes in the nucleus modify pre-mRNA before the
genetic messages are sent to the cytoplasm. This is know mRNA
processing.
During mRNA processing, both ends of the pre-mRNA are altered.
Some interior sequences of pre-mRNA may be cut out, and other
parts spliced together.
The 5`end of the pre-mRNA receives a molecule known as a
nucleotide (or 5') cap.
This cap is a modified guanine molecule (the G in A, T, C, G)
pre-mRNA
5' cap added
Slide 141 / 199
Alteration of mRNA Ends
The 3` end of the pre-mRNA
gets a poly-A tail. This tail is series
of adenosine (A) nucleotides.
A
A
A
A
original pre-mRNA
3' tail added
A
A
A
A
GAUGCCCUUAGCC
Slide 142 / 199
Alteration of mRNA Ends
A
AUGCCCUUAGCC
A
A
A
The modifications to the ends of the pre-mRNA have several
functions:
· They facilitate the export of mRNA from the nucleus to the
cytoplasm
· They protect mRNA from hydrolytic enzymes once it is in the
cytoplasm
· They help ribosomes attach to the mRNA so they can be
translated into a protein.
AUGCCCUUAGCC
GAUGCCCUUAGCCAAAAAAAA
Slide 143 / 199
RNA Splicing
Most eukaryotic genes and their RNA transcripts have long
noncoding stretches of nucleotides that lie between coding regions.
These noncoding regions are called intervening sequences, or
introns.
The other regions called
exons (because they are eventually
expressed), are usually translated into amino acid sequences.
RNA splicing removes introns and joins exons, creating an mRNA
molecule with a continuous coding sequence.
Slide 144 / 199
mRNA Processing
This is an example of a pre-mRNA becoming a final transcript.
Slide 145 / 199
Slide 146 / 199
Alternative RNA Splicing
Alternative RNA Splicing
DNA sequence
AAATTTCCCGGGAAATTTCCCGGG
Some genes can code more than one kind of polypeptide,
depending on which segments are treated as exons during
RNA splicing.
Alternative splicing allows the number of different proteins
an organism can produce to be much greater than its
number of genes.
Pre-mRNA
(Cap)- UUUAAAGGGCCCUUUAAAGGGCCC-(Tail)
(Cap)- UUU
Alternate splices
AAA UUU AAA-(Tail) OR (Cap)- GGC CCG GGC-(Tail)
Resulting polypeptide (protein)
Phe - Lys - Phe - Lys
OR
Gly - Pro - Gly
Alternate splicing can dramatically change the length and/or the
sequence of the polypeptide chain that will be made
Slide 147 / 199
30
The first step in eukaryotic gene expression is...
A
B
C
D
transcription
translation
RNA processing
unraveling the gene
Slide 148 / 199
31
Where does transcription occur in eukaryotic
cells?
A nucleus
B nucleiod
C cytoplasm
D cell membrane
Slide 149 / 199
32
Once the DNA is unwound from the chromatin, which of
the following is necessary to begin transcription?
A
B
C
D
RNA polymerase
ribosome
transcription factors
both A & C
Slide 150 / 199
33 A transcription unit that is 8,000 nucleotides long may use
1,200 nucleotides to make a protein consisting of 400 amino
acids. This is best explained by the fact that
A many introns are present in mRNA.
B
there is redundancy and ambiguity in the genetic code.
C many nucleotides are needed to code for each amino acid.
D
many exons are present in mRNA
Slide 151 / 199
34 A mutation in which of the following parts of a gene is likely to
be most damaging to a cell?
Slide 152 / 199
Entrance into the Cytoplasm
After the finalized mRNA transcript is complete and correct, the
pores in the nuclear envelope allow it to pass to the cytoplasm where
it can be translated into proteins by ribosomes.
A intron
B exon
C
The nuclear pore is a
protein structure that
controls the traffic flow
of the nucleus. Each
nuclear pore is made up
of hundreds of
individual proteins that
insure only mRNAs with
proper caps and tails
can make it to the
cytoplasm.
both would be equally
damaging.
Slide 153 / 199
Degradation of mRNA
Hydrolytic enzymes in the cytoplasm breakdown mRNA molecules.
The length of time an mRNA survives in the cytoplasm relates to how
much protein is made from it. Longer time in the cytoplasm means
more translation by ribosomes.
The length of the poly-A tail is one of many factors that determines
the time of survival in the cytoplasm. The longer the tail, the longer it's
survival.
Slide 154 / 199
Summary of Gene Expression
Regulation in Eukaryotes
· The gene must be unpacked from chromatin
· The right transcription factors must be present
Transcription occurs
· Cap and tail must be added to the mRNA
· Pre-mRNA must be edited (spliced)
· Nuclear pores allow passage to the cytoplasm
· mRNA comes into contact with a ribosome
Translation occurs
· Protein is used within the cell or exported to the environment
Slide 155 / 199
Translation
Slide 156 / 199
Three Types of RNA
Translation is the process by which RNA strands are read to
build proteins.
Translation requires 3 types of RNA that are created using
transcription.
Translate means to convert something from one language to
another, you can remember that the process of making protein
from RNA is called translation because the "language" of
nucleotides" is being changed to the "language" of amino
acids.
1. mRNA or messenger RNA, carries the information for
protein synthesis. This type of RNA is key to The Central
Dogma.
2. rRNA or ribosomal RNA, is a catalyst for protein
synthesis
3. tRNA or transfer RNA, helps in the assembly of amino
acids during protein synthesis
Slide 157 / 199
Slide 158 / 199
Messenger RNA (mRNA)
The specific RNA that contains the protein's information
from DNA is called Messenger RNA (mRNA); it carries the
genetic message to ribosomes, where it is translated.
Ribosomal RNA (rRNA)
Ribosomal RNA (rRNA) and
some additional proteins
make up the ribosome.
Large
subunit
The ribosome includes two
subunits: one small, and
one large.
During translation, the
ribosome catalyzes the
reaction that makes covalent
bonds between amino acids,
thus building the protein.
Slide 159 / 199
Transfer RNA (tRNA)
Transfer RNA (tRNA) carries amino acids to the ribosome so that the
ribosome can covalently bond them together to form the protein.
RNA, being single stranded,
can fold in on itself. In tRNA,
the RNA folds into a t-shape.
Small
subunit
Slide 160 / 199
35 What is the function of the ribosome?
A
to make an ionic bond between amino acids
B
to make a covalent/peptide bond between amino
acids thus building the protein
C
to make hydrogen bonds
D
to make RNA
The Amino Acid Attachment Siteis
where the amino acid will attach to the
tRNA.
The Anticodon Loop is a 3 base
sequence on the tip that is
complementary to the codon on
the mRNA.
Slide 161 / 199
36 Why does tRNA fold into its specific shape?
A
The sequence and bonding of its amino acids
B
The sequence of and bonding of nucleotides
C
Its protein structure
D
A and B
E
A and C
Slide 162 / 199
37 What is the anticodon for GGU?
A CCT
B CCA
C GGU
D GGA
Slide 163 / 199
Slide 164 / 199
Translation - An Overview
38 If the anticodon of a tRNA is AUG, what is attached to
the amino acid attachment site of that tRNA molecule?
All the pieces are ready to begin translation:
A RNA
a coded strand of mRNA
a set of 20 amino acids
ribosomes
tRNA to match all the amino acids
B methionine
C tyrosine
D glycine
Slide 165 / 199
Slide 166 / 199
Proteins: Words
Amino Acids :: Letters
Translation - An Overview
tRNAs bond to the amino acid specified by their anti-codon.
The length and sequence of these amino acids allow all
the proteins in the world to be created from only 20
amino acids.
The opposite side of each tRNA, the anti-codon, bonds to the
matching codon on the mRNA, creating a string of amino acids
in the proper sequence.
This is very similar to how all the words can be created
from only 26 letters in the alphabet.
The ribosome makes covalent bonds between the amino acids.
The result is a protein chain with the specified sequence of
amino acids.
Slide 167 / 199
Slide 168 / 199
Translation - Initiation
Translation - Initiation
The ribosome goes to the 5' end of the mRNA because the 5' end is
the beginning of where the gene on the DNA was transcribed into
mRNA.
Also notice that there are 2
sites within the ribosome.
The small subunit of the
ribosome attaches to the
mRNA at the bottom of the
start codon(at the 5' end).
Then the large subunit of
the ribosome comes in over
the top.
The result is that the mRNA
is "sandwiched" between
the mRNA at the start
codon (and the second
codon as well!)
3'
3'
5'
5'
· The P-site where the new protein will
emerge
· The A-site where the Amino Acids are
delivered in
Slide 169 / 199
Slide 170 / 199
Translation - Initiation
Translation - Initiation
The tRNAs, hydrogen bonded to their specific amino acids, surround
the ribosome.
As the leading edge of
the mRNA, with the
starting code AUG, is
exposed in the A site,
Each tRNA will carry the appropriate amino acid into the ribosome to
be bonded in the proper sequence, since each tRNA anticoding site
matches the coding site on the mRNA, which is located at the A site of
the ribosome.
Met
UA
C
the tRNA with the code
UAC enters the site and
hydrogen bonds with it,
carrying methionine into
the ribosome.
The methonine is removed from the tRNA and stays in the ribosome to
be bonded with the next amino acid. The tRNA leaves the ribosome so
another tRNA can enter.
A UG
Because each tRNA has an anticoding sequence it complimentary
base pairs with the codon on the mRNA.
Slide 171 / 199
39
How does the anticodon on the tRNA and the codon on the
mRNA match up?
Slide 172 / 199
40
What is the P site of the ribosome?
A
by hydrogen bonding/complimentary base pairing
A it is where the amino acids are delivered in
B
by ionic bonding
B it is where the protein or peptide will emerge
C
by peptide bonds
C
D
none of the above
it where the tRNA's will deliver in the next amino acid after
each translocation
D
it is where the proteins fold into their 3-d shape
Slide 173 / 199
Translation - Elongation
The 2nd tRNA with its
amino acid is delivered
into the A-site in the
ribosome.
The ribosome
catalyzes a covalent
bond between the
amino acids.
Slide 174 / 199
Translation - Elongation
The ribosome moves the mRNA using chemical energy.
The tRNA that was in
the A-site moves to the
P-site and the tRNA that
was in the P-site
separates from its
amino acid.
Notice the protein
emerging from the Psite!
Slide 175 / 199
Translation - Elongation
Elongation continues by adding one amino acid after
another.
Each amino acid is delivered to the A-site by its matching
tRNA.
Slide 176 / 199
Translation - Termination
The ribosome reaches a STOP codon. Remember that STOP
codons do not code for amino acids. This signals the end of
translation.
The protein is complete.
The 2 subunits (large and small) separate from each other.
The ribosome makes a peptide bond between the 2 amino
acids in the P and A sites.
until......
UAA is 1 of the 3
possible STOP codons.
Slide 177 / 199
Translation - Termination
The Result- A protein in its "primary sequence".
Remember that Primary level (10 ) of protein
structure is the sequence of amino acids.
Slide 178 / 199
41 What is the first event of translation?
A
the tRNA comes in
B
the small subunit of the ribosome and the 1st tRNA brings in
Methionine to the start codon
C
elongation happens
D
the large subunit of the ribosome comes in
Click here to see an
animation of translation
Slide 179 / 199
42 What is the function of the ribosome in translation?
A
it makes a peptide/covalent bond using the energy
from translocation
B
it makes hydrogen bonds between the codons
C
D
Slide 180 / 199
43 What does termination in translation involve?
A
translocation of the ribosome
B
the ribosome gets to a stop codon and the small
and large subunits of the ribosome separate
it makes covalent/peptide bonds between the codons
C
RNA polymerase falls off the DNA
none of the above
D
a tRNA brings in an amino acid
Slide 181 / 199
Slide 182 / 199
Recombinant DNA
Biotechnology
Understanding the structure, replication, and expression of
genes has allowed scientists to create biotechnologies which
improve human lives.
One of the first procedures to use DNA to successfully was
recombinant DNA technology.
In this procedure genes from one organism are spliced into the
genome of another. Since all organisms use the same genetic
code the cells that contained the recombined DNA will produce
the protein encoded by the new gene.
Return to
Table of
Contents
Slide 183 / 199
Slide 184 / 199
Diabetes
Diabetes is a disease in which a person has high blood sugar
either because the pancreas does not produce enough insulin,
or because cells do not respond to the insulin that is
produced.
Insulin structure
(a protein)
The cells of the pancreas release insulin in
response to high levels of glucose in the blood.
Cells respond by taking glucose in, out of the blood,
to reduce the concentration.
Slide 185 / 199
Slide 186 / 199
Diabetes
Early Treatment of Diabetes
Untreated, diabetes
causes many
problems. Most
severe is damage to
the kidneys resulting
from the increased
solute of the blood for
extended periods.
At first doctors treated by injecting bovine insulin harvested
from cows blood. This had some effect but the protein is not
exactly the same as the human insulin protein. The
symptoms would eventually overcome the patient.
Slide 187 / 199
Slide 188 / 199
Recombinant DNA
In the late 1970s scientists started to
look for a way to make human insulin
in a laboratory. Their efforts produced
the first product ever made using
genes from multiple organisms.
Humulin
The result was a new product called Humulin. The first
human hormone to ever be produced by another organism.
They recombined fragments of DNA
from humans with the bacterial
chromosome of E. coli. The new
bacteria was then able to produce
human insulin.
Slide 189 / 199
Recombinant DNA Technology
DNA pieces can be recombined to
make unique, man made
sequences. There are 7 main
steps.
Slide 190 / 199
Recombinant DNA Technology
Step 1: Find the piece of DNA in the genome, the gene of
interest.
Today this step is done by
computers attached to robotic
DNA sequencers that fragment,
analyze and find a gene based
on user input.
Slide 191 / 199
Recombinant DNA Technology
Step 2: "Cut" the gene of interest from the genome
This is made possible byrestriction enzymes. In nature these
enzymes are used by bacteria as weapons against invading viruses.
For example: EcoRI is a restriction enzyme that makes a staggered
cut when it reads the sequence GAATTC. The staggered ends are
called sticky ends because they leave a few unpaired nucleotides
that will easily stick to another piece of DNA with the same sticky
end.
Slide 192 / 199
Recombinant DNA Technology
If the sequence of the gene of interest, say the insulin gene, is
known and the sequences in the surrounding DNA are known, then
restriction enzyme cut sites that are on opposite sides of the gene
can be utilized to cut the gene out.
EcoRI cut site
EcoRI cut site
DNA fragment
Insulin Gene
(gene of interest)
Slide 193 / 199
Slide 194 / 199
Recombinant DNA Technology
Step 3: Isolate the gene of interest
If we look at the insulin gene again we can see that the
sequence between the two EcoRI cut sites has a unique length.
EcoRI cut site
Insulin Gene
(gene of interest)
Recombinant DNA Technology
Gel electrophoresis is used to separate DNA fragments based on
length.
start
EcoRI cut site
15k
DNA fragment
5,000 nucleotides (bp)
15,000 nucleotides (bp)
to end of fragment
10,000 nucleotides (bp)
to end of fragment
10k
So in this digest there are DNA fragments
that are 5k,10k, and 15k nucleotides long.
The gene of interest here is the 5k piece.
5k
Slide 195 / 199
Recombinant DNA Technology
Step 4: Make more of the gene of interest (amplification)
Once the gene of interest is isolated in the gel, the band that
contains the gene can be cut from the gel, but this is a very small
sample. More copies of the can be made using polymerase chain
reaction (PCR).
Insulin gene
Slide 196 / 199
Recombinant DNA Technology
Step 5: "Paste" the gene of interest into the host's DNA
Sticking to the insulin example, the technique utilized to get the
insulin gene into the E. Coli bacteria involved using a plasmid,
the small circular pieces of DNA that bacteria use to trade
pieces of genetic information.
EcoRI cut site
A plasmid with an EcoRI cut site is "digested" using the same
restriction enzyme that was used to cut out the insulin gene.
Slide 197 / 199
Recombinant DNA Technology
Mix the cut plasmid with the gene of interest to create a
recombinant DNA plasmid that contains a human insulin gene
Slide 198 / 199
Recombinant DNA Technology
Step 6: Put the recombined piece of DNA into the host organism
Now that the gene of interest is in a plasmid, it can be mixed with
bacterial cells and be taken up into the bacterial chromosome.
Remember, all living things use the universal genetic code.
The bacterial cells will read the newly acquired gene,
transcribe it into mRNA and its ribosomes will translate the
mRNA into a protein.
Insulin gene with sticky ends
The bacterial cells will reproduce and express the gene. Each time a
recombinant bacterial cell divides by binary fission it will make a new
copy of the gene.
Recombinant DNA Plasmid
Plasmid with sticky ends
Slide 199 / 199
Recombinant DNA Technology
Step 7: Collect the protein product
The protein can be extracted from bacterial cultures using various
techniques. It can then be delivered to the patient.
Currently there is no cure for diabetes, but with advancements in
insulin therapy patients can now avoid many of the life threatening
complication.