In the Beginning….There was Recombinant DNA
Aka “Cloning”
Using paper models and a modified “carnival” game, we’ll see how
DNA from any species can be replicated and produced inside
bacteria.
Materials
• Image of plasmid pTI2008; one or more per student
• Page of four strands of DNA; one or more per student
• Tape, one per student group
• Scissors, one per student group
• Large heavy paper clips, several per student
• 50 ml beakers or other cups that do not easily tip; 8 per station, two
stations per class
To Do and Notice
Preparing “Recombinant DNA”
• Examine the plasmid, pTI2008. What features does it have? (A
restriction site for EcoRI, an ampicillin resistance gene that confers
ampicillin resistance to bacteria, a lac z gene whose product
converts a substance in agar to a blue color, and “ori”, the origin of
replication of the plasmid.
• After an introduction to restriction enzymes, invite the students to
cut their plasmid pTI2008 and their four DNA sequences at any
EcoRI restriction site that they find. Remind them of the
characteristic overhangs of the cut (see illo later in packet)/
• Examine all of the cut pieces and sticky ends. How many different
ways could the various fragments re-connect (ligate) because of
complementary sticky ends?
• Make several different recombinant plasmids, using various sticky
ended inserts and tape as the “ligase”. Also reanneal (seal) some
plasmids without extra DNA. (a variation is listed at the end of the
document).
• Supercoil the plasmids by rolling them up tightly, and use a heavy
paperclip to hold together.
Transforming Bacteria
Karen E. Kalumuck, Ph.D.
Exploratorium
Copyright 2008
• Split the class in half. For each half, create a station with 8-10 50ml beakers closely spaced and upside down. Have the students
position themselves 7-8 meters from the beakers.
• Shout “heat shock!” Invert the beakers to the upright position.
Students should then toss each of their plasmids into the beakers,
with the intent of having some enter the beaker “bacteria”. Allow
several minutes for this. A long throwing distance is critical. When
you shout “stop”, all activity must cease.
Plating of the Bacteria
• Remove the beakers and observe. Did all of the beaker bacteria
receive a plasmid? Did some receive more than one? If you couldn’t
see inside the beaker, would you be able to tell? How do scientists
distinguish between the different possibilities?
• Place the beaker bacteria on trays or areas covered with paper that
says “Ampicillin”. You are plating the cells on agar that contains
ampicillin. Which type of bacteria will grow here (ones with or without
plasmids?)
• How can scientists distinguish between bacteria that took up a
plasmid with an insert, and those without?
What’s Going On?
There are literally hundreds of different restriction enzymes produced
by bacteria as their own defenses against bacterial viruses and other
invaders. In the early 1970’s scientists discovered that these
enzymes cut all types of DNA, and that DNA from virtually every
species could be introduced into a plasmid (a small circular extrachromosomal piece of DNA carried in bacteria). When plasmids are
introduced into bacteria, the plasmids replicate within the bacteria
and the bacteria will reproduce and pass the plasmids on to progeny
cells, yielding millions of copies in just a few hours. In addition, the
product of the gene inserted that was inserted into the plasmid can be
produced by the bacteria, and can be detected with antibodies
specific to the protein.
Each restriction enzyme cuts a specific sequence of DNA.
Overhanging (single stranded) sequences that are complementary
can be made to join, and the enzyme DNA ligase will seal the ends.
Bacteria are treated in the lab to allow DNA to adsorb to their surface
(by chilling) then induced to bring the DNA into them with the heat
shock (typically 49 degrees C). The heat shock period is very brief –
Karen E. Kalumuck, Ph.D.
Exploratorium
Copyright 2008
if it lasted too long the cells will die, so the window of opportunity to
transform bacteria with recombinant DNA is brief.
The rate of transformation is very, very low – the carnival game of
tossing the plasmids at a distance illustrates this. Many bacteria will
not be transformed, but there are tricks to help in the identification.
Plasmids have been engineered to help scientists conveniently
identify bacteria that have been transformed with potential
recombinant plasmids. The bacteria, after a recovery period at 37
degrees C in a nutrient broth, begin producing the products of genes
on their plasmid. If a bacterium is transformed, it will be ampicillin
resistant. It will grow on media impregnated with the antibiotic
ampicillin. Bacteria that were not transformed will not grow.
But how can you distinguish insert-containing bacteria from resealed
plasmids? This plasmid is engineered to have the Lac Z gene, which
will produce beta-galactosidease. This enzyme will degrade a
chemical in the medium and turn the colony a blue color. The
insertion site of the “foreign” DNA, the EcoR1 site, is within this gene.
If the plasmid is recombinant (has some foreign DNA) the lac Z gene
is nonfunctional, and the colony will appear white.
What Next? The cloned plasmids may contain inserts different than
what is desired. Their sizes and orientation are analyzed by
restriction electrophoresis and/or PCR. The cDNA of interest can be
checked to see if it makes a functional protein by growing up bacterial
colonies containing the plasmid with DNA of interest, (which will make
the protein, if the plasmid has a strong bacterial promoter before the
insert). The cells are lysed, transferred to a replica plate, and mixed
with radioactively labeled antibodies. Colonies producing the protein
of interest will hybridize to the label, resulting in a black spot on X-ray
film.
So What?
The cut-and-paste nature of restriction enzymes with DNA and the
ability to produce millions of copies of any gene through “cloning” is
the foundation of the biotech revolution. A few of the many important
breakthroughts attributable to this basic technology include:
Karen E. Kalumuck, Ph.D.
Exploratorium
Copyright 2008
• mass production of human medically significant substances, such
as insulin and human growth factor
• sequencing of the human genome – and every other genome.
Variation for Creating Recombinant plasmids
Provide each team of students two dye (dice). For each ligation
event, allow the roll of the dice determine which event will take place.
Each student should do at least 5 (or, your choice) ligations. All
students at one lab table put their cut out fragments into a pile, and
draw their insertions from this pile
Roll of Dice
Type of Ligation Event
#2
2 plasmids ligate together
# 3, 4, 5, 6, 7
Plasmid recircularizes without
insert
# 8, 9, 10
One copy of insert from pool into
plasmid
# 11, 12
Karen E. Kalumuck, Ph.D.
Exploratorium
Copyright 2008
Two copies of inserts from pool
ligate together, and into single plasmid
Randomized Ligation Events – Plasmids in Las Vegas!!!
Groups at a table place all of their cDNA fragments and
plasmids (both cut with EcoRI) into a single pile in the center
of the table.
Each individual will creat 5 ligated plasmids – with or without
cDNA inserts as indicated by the following formula for the
toss of two dice:
Roll of Dice
Type of Ligation Event
#2
2 plasmids ligate together
# 3, 4, 5, 6, 7
Plasmid recircularizes without
insert
# 8, 9, 10
into
One copy of insert from pool
plasmid
# 11, 12
Karen E. Kalumuck, Ph.D.
Exploratorium
Copyright 2008
Two copies of inserts from
pool ligate together, and into single
plasmid
pTI 2008
Karen E. Kalumuck, Ph.D.
Exploratorium
Copyright 2008
5’
3’
ACTGGAATTCACATGCGAATTCGAACT
TGACCTTAAGTGTACGCTTAAGCTTGA
CGATGAAATTGGAGCATTCGAGACTTA
GCTACTT TAACCTCGTAAGCTCTGAAT
TGGCAGAATTCCGTATATCCTGAATTC
ACCGTCT TAAGGCATATAGGACTTAAG
GAATTCATGAATT CTAGCGCTAGCTAC
CTTAAGTACT TAAGATCGCGATCGATG
5’
3’
ACTGGAATTCACATGCGAATTCGAACT
TGACCTTAAGTGTACGCTTAAGCTTGA
CGATGAAATTGGAGCATTCGAGACTTA
GCTACTT TAACCTCGTAAGCTCTGAAT
TGGCAGAATTCCGTATATCCTGAATTC
ACCGTCT TAAGGCATATAGGACTTAAG
GAATTCATGAATT CTAGCGCTAGCTAC
CTTAAGTACT TAAGATCGCGATCGATG
Karen E. Kalumuck, Ph.D.
Exploratorium
Copyright 2008
Karen E. Kalumuck, Ph.D.
Exploratorium
Copyright 2008
Karen E. Kalumuck, Ph.D.
Exploratorium
Copyright 2008
“Sticky Ends” of EcoRI Restriction Endonuclease Cuts
Karen E. Kalumuck, Ph.D.
Exploratorium
Copyright 2008