Online Appendix for the following November 11 JACC article
TITLE: Ectopic Expression of the Sodium-Iodide Symporter Enables Imaging of
Transplanted Cardiac Stem Cells In Vivo by Single-Photon Emission Computed
Tomography or Positron Emission Tomography
AUTHORS: John Terrovitis, MD,* Keng Fai Kwok, BS, Riikka Lautamäki, MD, PHD,
James M. Engles, BS, Andreas S. Barth, MD, PHD, Eddy Kizana, MBBS, PHD, Junichiro
Miake, MD, PHD, Michelle K. Leppo, BS, James Fox, BS, Jurgen Seidel, PHD, Martin
Pomper, MD, PHD, Richard L. Wahl, MD, Benjamin Tsui, PHD, Frank Bengel, MD,
Eduardo Marbán, MD, PHD, M. Roselle Abraham, MD
APPENDIX
Online Methods
Cell isolation/culture. Rat CDCs were cultured from explanted hearts derived from 3month old (syngeneic) Wistar Kyoto rats (WKY-Harlan, Indianapolis, Indiana, USA).
Explants of 1 to 3 mm3 were cut into small pieces, digested with 0.25% trypsin
(Invitrogen, Carlsbad, CA, USA) and then cultured on fibronectin-coated tissue culture
dishes using media (complete explant media, referred to as CEM) consisting of Iscove’s
Modified Dulbecco’s Medium (IMDM, Invitrogen), supplemented with 20% fetal calf
serum, 100 U/ml penicillin G, 100 µg/ml streptomycin, 2 mmol/l L-glutamine, and 0.1
mmol/l 2-mercaptoethanol. In the following 2 weeks, a layer of fibroblast-like adherent
cells and a smaller number of small phase-bright cells migrated from the explants. The
latter cells were collected by pooling one washing with Ca2+-Mg2+-free PBS, one wash
with 0.53 mmol/l EDTA (Invitrogen), and one wash with 0.5 g/l trypsin and 0.53 mmol/l
EDTA (Invitrogen) at room temperature under visual control. The harvested cells were
then seeded in poly-D-lysine coated multiwell plates (2 × 104 cells/well), in media
containing 35% IMDM/65% DMEM-Ham F-12 (Invitrogen) containing 2% B27, 0.1
mmol/l 2-mercaptoethanol, 10 ng/ml epidermal growth factor (Peprotech, Rockville, NJ,
USA), 20 ng/ml basic fibroblast growth factor (Peprotech), 40 nmol/l cardiotrophin-1
(Peprotech), 40 nmol/l thrombin (Peprotech), antibiotics, and L-Glutamine. Under these
conditions, the cells aggregate in spherical formations (cardiospheres) in 5–10 days; these
cardiospheres were harvested, seeded in fibronectin-coated tissue culture flasks for
expansion as monolayers and cultured in CEM. These cells when grown as monolayers
express several stem cell markers and are referred to as cardiosphere-derived stem cells
or CDCs.
Lentivirus preparation. A third-generation lentiviral vector system (kindly supplied by
Professor Inder Verma, Salk Institute, USA) was used to label the rCDCs. The cDNA
encoding the human sodium iodide symporter gene (hNIS, kind gift from Dr. Jhiang,
Ohio) was subcloned in place of eGFP into the vectors
pRRLsin18.cPPT.CAG.eGFP.Wpre or pRRLsin18.cPPT.CMV.eGFP.Wpre resulting in
plasmids designated cPPT.CAG.hNIS and cpPPT.CMV.hNIS, respectively. Viral vectors
were produced by Lipofectamine 2000 (Invitrogen) transfection of four lentiviral vector
plasmids into 293T cells (ATCC, Manassas, VA, USA). Vector-containing supernatant
was collected 48 and 72 hours after transfection, filtered (0.45 μm, cellulose acetate,
Corning, Acton, MA, USA), and concentrated by ultrafiltration (100,000 MWCO,
Centricon Plus-70, Millipore, Billerica, MA, USA). Viral titer was assigned on
concentrated supernatant by HIV-1 p24 ELISA (Dupont, Wilmington, DE, USA). For
genetic labeling, rCDCs were transduced at a multiplicity of infection of 25 yielding
transduction efficiencies of >70%. NIS expression in transduced cells was confirmed by
immunostaining using a monoclonal mouse anti-hNIS antibody (Abcam, Cambridge,
MA, USA) and by an in-vitro 99mTc (pertechnetate) uptake assay (see below).
Viability/proliferation. A WST-8 based (Cell Counting Kit-8, Dojindo Molecular
Technologies, MD, USA), colorimetric proliferation assay was performed daily for 7
days on nontransduced and NIS+ rCDCs, starting 5 days after transduction. Cells were
incubated with 10 μl of WST-8 tetrazolium salt for 2 hours and absorbance was measured
at 450 nm (Spectramax M2, Molecular Devices, Sunnyvale, CA, USA). Cell number was
deduced by using a standard curve (absorbance versus cell number) that was created by
performing the assay on known numbers of cells. Proliferation experiments were repeated
3 times, with each condition tested in triplicate.
In-Vitro Angiogenesis Assays were performed as recommended by the
manufacturer (Becton-Dickinson, Franklin Lakes, NJ), in triplicate in a 96 well plate with
2 × 104 Human Vascular Endothelial Cells (HUVEC) and 1.5 × 104 rCDCs in Endothelial
Growth Media (Cambrex, Walkersville, MD). Vascular tube formation was documented
within seven hours after plating of the cells using an inverted microscope.
Animal model. Thirty-one male WKY rats underwent left thoracotomy in the 4th or 5th
intercostal space under general anesthesia (isoflurane inhalation, 4% for induction and
2.5% for maintenance). The heart was exposed, myocardial infarction was induced by
permanent ligation of the left anterior descending coronary artery, using a Prolene 7.0mm suture and syngeneic rCDCs (106 in twelve, 2 × 106 in sixteen, and 4 × 106 in three
animals) were injected intramyocardially (in two sites for the 2 × 106 and four sites for
the 4 × 106 cell injections, 50 μl of injectate per site) into the infarct using a 30-G needle.
Subsequently, the chest was closed and the animals were allowed to recover.
Reverse transcription (RT-) PCR. In order to confirm cell transplantation in vivo, RTPCR was performed in 4 animals sacrificed 24 hrs after injection of 2 × 106 NIS+ rCDCs.
Two animals injected with the same number of nontransduced cells were used as a
negative control. RNA was isolated using the Qiagen RNEasy Fibrous Tissue kit
(Qiagen, Valencia, CA, USA). Reverse transcription was performed using the Accuscript
High Fidelity 1st strand cDNA synthesis kit (Stratagene, La Jolla, CA, USA). The
sequence of hNIS primers was as follows: a) forward: GGTCGTGGTGATGCTAAGTG,
b) reverse: GGTCGCAGTCAGTGTAGAAC. RT-PCR was performed on an ABI
GeneAmp PCR cycler 2400 (Applied Biosystems, Foster City, CA, USA). All reactions
were performed in duplicate. β-actin was used as house-keeping gene (forward primer:
TGCTGAGTATGTCGT GGAGTCT, reverse primer:
CAGTCTTCTGAGTGGCAGTGAT).
Real time quantitative PCR. In order to validate and provide a molecular correlate of
the results obtained of CDC engraftment by SPECT imaging, we injected cells isolated
from male donor WK rats into the myocardium of female recipients and quantified
engrafted donor cell numbers, as a function of time, by real-time PCR for the SRY gene
located on the Y chromosome.
One million rCDCs resuspended in 100 μl of PBS were injected in two sites of the
left ventricle, at the infarct border zone. Four rats were sacrificed at day 1, and 5 at day 8
post MI. The whole heart was weighed, homogenized, and genomic DNA isolated from
aliquots of the homogenate corresponding to 30 mg of myocardial tissue using the
Allprep DNA/RNA minikit (Qiagen), according to the manufacturer’s protocol. The
TaqMan® assay (Applied Biosystems) was used to quantify the number of transplanted
cells with the rat SRY gene as template (forward primer: 5'-GGA GAG AGG CAC AAG
TTG GC-3', reverse primer: 5'-TCC CAG CTG CTT GCT GAT C-3', TaqMan probe:
6FAM CAA CAG AAT CCC AGC ATG CAG AAT TCA G TAMRA, Applied
Biosystems). For absolute quantification of gene copy number, a standard
curve was constructed with samples derived from multiple log dilutions of genomic DNA
isolated from male rat CDCs. All samples were spiked with 50 ng of female genomic
DNA to control for any effects this may have on reaction efficiency in the actual samples.
The copy number of the SRY gene at each point of the standard curve is calculated based
on the amount of DNA in each sample and the total mass of the rat genome per diploid
cell. (http:www.cbs.dtu.dk/databases/DOGS/index.html). All samples were tested in
triplicates. For each reaction, 50 ng of template DNA was used. Real time PCR was
performed in an ABI PRISM 7700 instrument. The result from each reaction, copies of
the SRY gene in 50 ng of genomic DNA, was expressed as the number of engrafted
cells/heart, by first calculating the copy number of SRY gene in the total amount of DNA
corresponding to 30 mg of myocardium and then extrapolating to the total weight of each
heart (since there is one copy of the SRY gene per cell).
In-Vitro luciferase assay. In order to compare levels of transgene expression in cells
transduced by lentivirus driven by CMV versus the CAG promoter, 3rd generation
lentiviruses expressing the firefly luciferase (fluc) reporter gene driven by CMV and
CAG promoters were constructed; 5 × 104 rCDCs were transduced with an MOI of 25 by
both viruses (each condition tested in triplicates). Luciferase activity was measured 7
days after transduction, using an in-vitro luciferase assay (Promega, Madison, WI, USA)
as per manufacturer’s protocol with a Monolight 2010 luminometer (Analytical
Luminescence Laboratories, USA). Twenty μl of each sample (cell lysate) were mixed
with 100 μl of luciferase assay reagent (Promega), in 75 mm glass tubes (VWR) and
placed in the instrument (2-s measurements). Results were reported as relative light units
(RLUs).
In-Vitro 99mTc (pertechnetate) uptake. 105 rCDCs were plated in each well of 2 sixwell plates, one day before the experiment: 6 wells were seeded with cells transduced
with the CAG.NIS virus (five days before, MOI of 25) and 6 wells with control,
nontransduced cells. The following morning, 99mTc (pertechnetate) (0.3 μCi/ml-11.1
KBq/ml) was added to the culture media for 30 minutes, in all wells. In half of them (3
containing NIS+ cells and 3 containing control cells) 100 μM of sodium perchlorate (a
specific NIS blocker) was added concurrently with the 99mTc. After 30 min, media
containing the radiotracer was aspirated and the cells were rinsed twice with ice cold PBS
to remove any remaining free 99mTc (pertechnetate). The cells were then trypsinized with
400 µl of 0.25% trypsin and lysed with 500 µl of NaOH (0.33 mol/l) containing 1%
sodium dodecylsulfate. The contents were placed into scintillation vials; 10 ml of
scintillation fluid (Formula 989; Perkin-Elmer, Inc.) was added and counts were recorded
in a gamma-counter (LKB Wallac, Turku, Finland). Two independent experiments were
conducted and each condition was tested in triplicate.
SPECT/CT imaging. The SPECT module is composed of two pixellated NaI(Tl) gamma
camera heads (125 mm × 125 mm crystal size), with 80 × 80 number of pixels. Lowenergy knife-edge pinhole collimators were used with a pinhole aperture of 1 mm
diameter and a focal length of 9 cm; a radius of rotation of 5 cm was used, yielding
voxels with an isotropic dimension of 0.7 mm in reconstructed volume. Each camera
head acquired 128 projections over a 360-degree range, with an acquisition time of 30
seconds for each projection. In order to allow simultaneous dual isotope imaging, data
were acquired in list mode and post-processed by applying two energy windows (“75
keV +10%/−10%” and “140 keV +10%/−10%”) to obtain Tl and Tc projections
separately. 99mTc (pertechnetate) and Tl (thallium) projections were reconstructed using
an ordered-subset expectation-maximization (OSEM) with 8 and 4 updates, respectively.
Reconstructed volumes were then post-filtered using a 6th order Butterworth filter with a
cutoff frequency of 0.3/voxel.
X-ray computed tomography was performed on the same SPECT/CT system
(Online Methods) with an X-ray tube of voltage, 75 kVp; 512 projections were acquired
over a 360-degree range. The projections with 1,184 × 1,120 isotropic pixels (100 μm)
were reconstructed into a CT volume of 5123 isotropic voxels (170 μm). The SPECT and
CT were then registered using rigid body transform, with pre-set parameters specific to
the system.
For quantification, a calibration factor was obtained by imaging a point source in
air; estimation of error resulting from attenuation was obtained by imaging a rat-sized
cylindrical phantom containing a point source, using imaging parameters identical to
those used in in-vivo experiments.
PET imaging. PET images were acquired on a GE Healthcare Vista small animal PET
system. The system has two detector rings, each with 18 detector modules. The detector
modules have LYSO (cerium-doped lutetium-yttrium orthosilicate) and GSO (ceriumdoped gadolinium orthosilicate) crystal layers which form a dual layer phoswich. The
phoswich elements (1.45*1.45*7 mm for LYSO and 1.45*1.45*8 mm for GSO) form a
13 × 13 array on each module. The energy window was set to 250–700 keV, except for
124
I scans where we used a narrower, 400–700 keV window in order to minimize
coincident gamma ray background. Coincidence events were rebinned in the Fourier
space and reconstructed using a 2D OSEM algorithm, with 8 updates for
124
I and 16
updates for
13
NH3 images. The reconstructed PET volume is a 175*175*61 (axial
direction) matrix, with a voxel size of 0.39*0.39*0.78 mm3 (axial direction).
Coregistration of PET and CT images. In order to facilitate coregistration of PET
images with CT, 1 mCi (37 MBq) of free 18F (fluoride) was injected (n = 2) after
completion of the 13NH3 (ammonia) acquisition. After a period of 7–10 minutes, required
for adequate uptake of fluoride by the bones, a 5-min static acquisition was obtained. The
purpose of this scan was to obtain images with distinguished radioactivity uptake in
bones that served as coregistration landmarks. The animal was held in the same position
for all the above scans. After completion of the PET acquisitions, the animal was moved
into the CT scanner (restrained on the same bed) and CT images were obtained as
described above. Coregistration of PET and CT images was performed using rigid body
transformation with manually identified bone as landmarks (Online Fig. 1).
Ex-Vivo SPECT imaging. In order to validate the results obtained by in-vivo imaging
and to confirm the origin of the in-vivo signal, a high resolution ex-vivo SPECT scan was
performed in 5 hearts excised from animals injected with NIS+ cells, after the completion
of the in vivo SPECT imaging. The hearts were rinsed with PBS and washed thoroughly
to remove any remaining blood before this SPECT/CT scan. Imaging parameters were
identical to the ones used in the in vivo acquisitions, with the exception of the radius of
rotation which was reduced to 3 cm, yielding a reconstructed isotropic voxel of 0.5 mm.
Image analysis. All images were analyzed using AMIDE software. A volume of interest
(VOI) was drawn to include the bright spot at the cell injection site, for each animal. The
VOI did not include areas of the surrounding normally perfused myocardium or the LV
cavity. The same VOI was then placed inside the LV cavity (201Tl and 13NH3 were used
to define the endocardial borders) to obtain signal intensities in the blood pool. Contrast
Ratio (CR) % was defined as 100 × [(signal in the cells) − (signal in blood pool)]/signal
in blood pool. Signal intensity/voxel at the injection site was converted to activity/voxel
using the calibration factor obtained by the phantom imaging. Background activity was
measured in an area of the myocardium outside the VOI but within the perfusion deficit
and subtracted from the VOI activity. VOI activity was rescaled to correct for
underestimation due to attenuation by using the estimated error obtained from phantom
studies, thus enabling calculation of the percentage of the injected dose (%ID) taken up
by the NIS+ rCDCs in vivo.
Supplemental Figure 1. Coregistration of CT and PET images. Coregistration was
based on visualization of the skeleton by 18Fluoride PET imaging, a: transverse, b:
coronal, c: sagittal slice orientation, respectively.
Supplemental Figure 2. Comparison of transgene expression levels achieved by a
CMV versus CAG-driven lentivirus. (a) Higher expression levels (~22 times) were
found in cells transduced by the CMV lentivirus (using firefly luciferase as the reporter
gene). (b) Proliferation rates of CMV.NIS and CAG.NIS transduced cells were
comparable.
Supplemental Figure 3. Ex-Vivo SPECT/CT of a heart injected with NIS+ cells.
Arrows point to the rCDC injection site. Red denotes 99mTc uptake. a: transverse, b:
coronal, c: sagittal slice orientation.