MOLECULAR DIAGNOSTICS AND DNA TAXONOMY
Identification of Neotropical felid faeces using RCP-PCR
S . RO Q U ES ,* B. ADR ADOS, * C . C HAVE Z,† C . K E LLE R,‡ W . E . M AGN US S ON,‡ F . P ALOMARES *
an d J. A. GODOY*
*Department of Conservation Biology, Estación Biologica de Doñana, CSIC, Calle America Vespuccio s/n, 41092 Sevilla, Spain,
†Laboratorio Ecologia y Conservación de Fauna Silvestre, Instituto de Ecologı́a, UNAM, 04510 Mexico D.F., Mexico, ‡Department
of Ecology, INPA, Manaus 69000, Brazil
Abstract
Faeces similarity among sympatric felid species has generally hampered their use in distributional, demographic and dietary studies. Here, we present a new and simple approach based on a set of species-specific primers, for the unambiguous
identification of faeces from sympatric neotropical felids (i.e. puma, jaguar, jaguarundi and ocelot ⁄ margay). This method,
referred to as rapid classificatory protocol-PCR (RCP-PCR), consists of a single-tube multiplex PCR yielding species-specific banding patterns on agarose gel. The method was optimized with samples of known origin (14 blood and 15 fresh faeces) and validated in faecal samples of unknown origin (n = 138), for some of which (n = 40) we also obtained species
identification based on mtDNA sequencing. This approach proved reliable and provides high identification success rates
from faeces. Its simplicity and cost effectiveness should facilitate its application for routine surveys of presence and abundance of these species.
Keywords: Felidae, noninvasive, species identification, mitochondrial
Many carnivores are elusive, which has traditionally
hampered their study and prompted the use of indirect
signs such as tracks or faeces to monitor their presence,
activity and behaviour (Schwartz et al. 2007; Long et al.
2008). Despite its great information potential, using faeces has been limited by the difficulty in distinguishing
between faeces of related sympatric species (Kohn &
Wayne 1997; Davison et al. 2002; Waits & Paetkau 2005).
Several molecular techniques have been developed for
the genetic identification of elusive carnivores from faeces and other noninvasive samples (Dalen et al. 2004;
Waits & Paetkau 2005; Livia et al. 2007). Direct sequencing of informative PCR products followed by phylogenetic analysis has remained a common approach (Bartlett
& Davidson 1992; Farrell et al. 2000; Miotto et al. 2007;
Haag et al. 2009), while other indirect methods rely on
the detection of species-specific DNA sequence patterns,
either through single-strand conformation polymorphism analysis (SSCP), polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) (Foran
et al. 1997; Paxinos et al.1997; Pilgrim et al. 1998; Hansen
& Jacobsen 1999; Mills et al. 2000; Cossı́os & Angers
2006), or multiplex diagnostic PCR systems (Palomares
et al. 2002; Bhagavatula & Singh 2006; Sugimoto et al.
Correspondence: Severine Roques, Fax: +34 954 621 125;
E-mail: severineroques@hotmail.com
2006; Fernandes et al. 2008; Nonaka et al. 2009,). However, some of these methods are costly and laborious,
which limits their use in large-scale studies, or require
specialized equipment and expertise. Additionally, they
may produce false positives (by the presence of the same
banding patterns coming from a different species), or
false negatives as a result of undetected intraspecific
polymorphism that might compromise their reliability
outside the areas for which they were developed.
Here, we present a new and simple approach based
on a set of species-specific primers for the unambiguous
identification of several sympatric neotropical felid species (jaguar, Panthera onca; puma, Puma concolor; jaguarundi, Herpailurus yagouaroundi and ocelot, Felis pardalis
or margay, Felis wiedii). This method, referred to as rapid
classificatory protocol–PCR (RCP-PCR; Dalen et al. 2004),
consists of a multiplex diagnostic amplification system,
designed based
on NADH5 mitochondrial DNA
(mtDNA) sequences, that yields species-specific banding
patterns on agarose gels. The method was optimized
using faecal samples of captive individuals and validated
with field samples that were concurrently identified
using mtDNA sequencing.
For the optimization of sequencing and RCP-PCRbased protocols, a total of 15 fresh faecal samples and 14
blood samples, belonging to the five felid species (18
jaguars, five pumas, two ocelots, two margays and two
Common
(All)
Jaguar
(Po)
ND5-FEL-130F
166 bps
ND5 -Po-149F
147 bps
Puma
Jaguarundi
Ocelot
Margay
ND5 -FEL-274R
ND5 -Pc/Hy-183F
113 bps
ND5 -FEL-274R
ND5 -Pc/Hy-183F
113 bps
ND5 -FEL-274R
(Pc)
(Hy)
ND5 -Hy-58F
238 bps
(Fp)
(Fw)
ND5 -FEL-167F
129 bps
ND5 -FEL-274R
ND5 -FEL-167F
129 bps
ND5 -FEL-274R
ND5 -FEL-274R
Fig. 1 Illustration of the RCP-PCR assay for the identification of the five felid species: jaguar (Po), puma (Pc), jaguarundi (Hy), ocelot
(Fp) and margay (Fw). The use of both F (ND5-FEL-130F) and R (ND5-FEL-F-274R) common primers which will amplify all species,
along with the four species-specific primers will provide a characteristic banding PCR pattern specific of one or two of the species. For
example, ND5-Pc ⁄ Hy-183F will amplify in presence of both puma and jaguarundi DNA, but these two species can be distinguished
based on the jaguarundi-specific amplification of a 238 bp fragment primed by ND5-Hy-58F. The resulting patterns will be different in
each species, except for ocelot and margay.
Table 1 Primers designed in this study. Primer names include a code that indicates their species specificity as follows: FEL, all five
target species; Po, Panthera onca; Hy, Herpailurus yaguarundi; Pc, Puma Concolor; Fp, Felis pardalis; Fw, Felis wiedii. Numbers indicate the
position of their 3¢ end within the targeted sequence. CN, final primer concentration in PCR
Primers
Sequence (5–3)
CN (in lM)
PCR product
ND5-FEL-274R
ND5-FEL-130F
ND5-Po-149F
ND5-Hy-58F
ND5-Pc ⁄ Hy-183F
ND5-Fp ⁄ Fw-167F
YGTAGCACTTTKYGTCACATGA
CCTTYACYATCAGCATAAT
TCCGGCTATAGTATTTATTTCTTCC
TCATTATAACCGGCACCCAACTG
GCAGTCATCTCAAACTGACACTG
TYTCCCAGGACAAGAAGCAGTA
0.25
0.30
0.25
0.25
0.25
0.20
166 BPS
147 BPS
238 BPS
113 BPS
129 BPS
jaguarundis), were collected in zoos of Brazil (Manaus)
and Europe (Sevilla, Madrid, Tenerife) or were wild
captured in Mexico (Quintana Roo). For four zoo jaguars,
matched blood and faecal samples were available. We
validated our methods on a total of 138 faeces collected
during field surveys between 2004 and 2009 in Brazil (40
from Adolfo Ducke Forest Reserve, Manaus, DUC) and
Mexico (32 from Ejido Caobas, Quintana Roo, CAO, and
66 from El Zapotal Ecological Reserve, Yucatan, ZAP).
DUC faecal samples were also analysed by DNA sequencing. Except DUC samples that were directly conserved
in silica pellets, the rest of the faecal samples were collected in sterilized plastic vials with approximately 30 ml
of absolute alcohol, subsequently transferred to 100-ml
plastic jars containing silica pellets (Wasser et al. 1997)
and stored at room temperature until DNA extraction.
DNA isolation from blood samples followed standard
phenol–chloroform extraction protocols (Sambrook et al.
1989). DNA was extracted from faecal samples using protocols based on the GuSCN ⁄ silica method (Boom et al.
1990; Hö ss & Paabo 1993; Frantz et al. 2003). To avoid
contamination of faecal samples, all steps were performed in a separate laboratory, free of PCR product and
especially designated for the manipulation of noninvasive material. Extraction controls were added to monitor
for contamination every 15 samples.
Available sequences of the NADH Dehydrogenase
subunit 5 (NADH5) region of the mtDNA for the five
felid species targeted were obtained from the GENBANK
database and
aligned. Primers NAD5c2-F (5¢-YTAY
GCCTTYACYATCAGCA) and NAD5c2-R (5¢-AAGTGC
TACRGGGAYRAAGA) were
designed for the PCR
amplification of a 160 bps variable segment from
degraded DNA. The fresh faecal samples (of known species identity) and the DUC-field faecal extracts were
amplified using the newly designed primers. Products
© 2010 Blackwell Publishing Ltd
were cleaned by ultrafiltration through Centricon-100
(Millipore Corp.) and sequenced in both forward and
reverse directions using the BigDye v 3.1 Terminator
Cycle Sequencing Kit (Applied Biosystems) and an automated DNA sequencer (ABI-3130xl; Applied Bisoystems,
Inc.). Sequences were edited, assembled and aligned
using the program Sequencher 3.1.1 (Gene Codes
Corporation) (Genbank accession numbers HM068603HM068610). Neighbour-joining trees were constructed
from p-distance matrices using the MEGA.3 program
(Kumar et al. 2004) and used to assign unknown faecal
samples to their species of origin.
For the RCP-PCR-based protocol, species-specific
primers were designed based on the alignment of
NADH5 sequences obtained in this study plus those
retrieved from GenBank, which covered a broad range of
geographical origins. Thus we took into account both
inter- and intraspecific nucleotide differences, which
minimized the probability that
intraspecific polymorphisms within the targeted sequences generate false
negatives. For the puma, sequenced individuals encompassed the whole distribution area (Culver et al. 2000),
while sequences covered large sympatric areas from
Mexico to south Brazil for the remaining species (this
study, Johnson & O’Brien 1997) Additionally, sequences
available in GenBank from several of the most common
felid preys, or their taxonomically closest species
(caiman, Caiman crocodilus, 14190593; the tufted deer,
Elaphodus cephalophus, 111380720; the
white-lipped
peccary, Pecari tajacu, 223972345; the coati, Nasua nasua,
110226402 and the tapir, Tapirus terrestris, 37496461),
were aligned with the felid ones to evaluate the possibility of amplification of contaminant prey DNA. General
primers ND5-FEL-130F and
ND5-FEL-F-274R were
designed to anneal to all felids, whereas additional
forward primers (ND5-Pc ⁄ Hy-183F,
ND5-Po-149F,
ND5-Hy-58F, Fp ⁄ Fw-167F) were designed to be speciesspecific by selecting their 3¢ ends to match speciesspecific sequence patterns and to anneal at different
distances from the reverse general primer (Fig. 1;
Table 1). The use of all primers in a single-tube PCR
results in amplified fragments ranging in size between
113 bps and 238 bps depending on the species, short
enough to allow a high probability of amplification from
degraded DNA (Fig. 1). Primer annealing positions, concentrations and PCR conditions were selected to favour
the amplification of the species-specific PCR fragment
over the general one and over potential nonspecific products, so that the absence of amplification will indicate
DNA degradation, inhibition or that the sample belongs
to a nontargeted species. It was not possible to design
species-specific primers to differentiate between ocelots
and margays because of their high genetic similarity in
the short sequence segment selected (see Fig. 1).
The final species-diagnostic assay is based on a sixprimer single-tube 20-lL PCR consisting of 6 ll DNA
extract, 0.2 mM of each nucleotide, 2.5 mM MgCl2,
0.8 mg ⁄ ml BSA, between 0.2 and 0.3 lM of each primer
(Table 1), 1· PCR buffer and 0.75 units of Taq polymerase
(Bioline). The cycling parameters for the PCR reaction
(a)
(b)
Fig. 2 Amplification results from RCP-PCR on samples of different felid species. a. Blood (n = 7) and fresh faeces (n = 16)
from captive or captured individuals. b. Faecal samples (N = 60)
collected in the Ecological Zapotal Reserve (Yucatan, Mexico). P,
Puma; Jr, Jaguar; Ji, Jaguarundi; O, Ocelot or Margay; Oc, Ocelot;
Mg, Margay; NI, Non-identified sample, L, 100 bp DNA ladder.
+ indicates blood samples used as positive controls.
were 94 °C denaturation for 2 min, followed by 40 cycles
of 94 °C denaturation for 30 s, 57 °C annealing for 30 s,
and 72 °C extension for 30 s, and ending with a single
10-min final extension at 72 °C.
Our RCP-PCR protocol was standardized using blood
and fresh faecal DNA samples extracted from captive
individuals, and its suitability to identify species was
tested on the 138 faeces collected in the field and compared to the mtDNA sequencing in the 40 DUC faecal
extracts. PCR and extraction controls were included in
each reaction set to monitor contamination. Although
primers were specifically designed to avoid prey amplification, blood samples of two prey species (peccary, Pecari
tajacu, and coati, Nasua nasua) were also included in the
analysis to check whether they may yield false positives.
The amplified DNA fragments were visualized in a 2%
agarose gel.
RCP-PCR unambiguously and reliably identified
blood and fresh faecal samples from captive jaguars,
pumas, jaguarundis and ocelots ⁄ margays (Fig. 2a). The
latter two species could not be distinguished by this
assay or by direct sequencing because of the absence of
reciprocal monophyly for the targeted fragment, including shared polymorphisms across species. Other mitochondrial DNA regions or the use of other types of
polymorphic markers, such as autosomal microsatellites,
should be explored.
The success rate of faeces identification for the 40
field samples from DUC was 82.5% for DNA sequencing (N = 40) and 85% for the RCP-PCR method
(Table 2). The species assigned by the RCP-PCR assay
matched the species assigned by sequencing in all 28
DUC faeces that could be identified by both methods.
Furthermore, six of the seven samples that could not be
identified by sequencing gave interpretable patterns
with RCP-PCR. Success rate for this latter method in the
other two study areas was 89.2 and 90.3% (Table 2).
Failed identifications were mostly because of the low
DNA quantity and ⁄ or quality resulting in amplification
failures (both methods affected), weak or ambiguous
sequences (DNA sequencing), and ambiguous banding
patterns (i.e. unexpected product sizes for the RCP-PCR
method) (see Fig. 2b). Observed success rates are higher
than those previously reported for sequencing methods
in the same species (60–66% success; Farrell et al. 2000;
Haag et al. 2009; ) but are similar to those obtained for
other indirect PCR-based techniques that targeted short
PCR products (generally less than 280 bp, Palomares
et al. 2002; Dalen et al. 2004; Sugimoto et al. 2006; Fernandes et al. 2008).
The amplification patterns of the most common prey
species (coati and peccary) were easily distinguished
from the expected felid patterns (results not shown).
Another possible confounding effect could arise if intraguild predation, which is common in felids (Palomares &
Caro 1999), occurs among the target felid species. However, it would still be easy to know the involved species,
as the amplified fragments would result in a mixed banding pattern, and it would be reasonable to assume that
the faeces belong to the larger species (Palomares & Caro
1999). Another problem associated with noninvasive
samples would be the nonamplification arising from
undetected intraspecific polymorphism (i.e. false negative). Although we cannot totally discard this possibility,
this seems unlikely given the limited diversity found in
the NADH5 among the five felids (Johnson & O’Brien
1997, this study), and the high identification success rate
observed for faeces sampled across broad geographic
ranges.
In comparison to sequencing and PCR-RFLP methods
(Foran et al. 1997; Cossı́os & Angers 2006; Bidlack et al.
2007), our RCP-PCR approach is cheaper and involves
fewer steps (namely DNA isolation, a single tube multiplex PCR amplification and an agarose gel electrophoresis), thus minimizing the chances of contamination,
reducing costs and facilitating the screening of large
numbers of samples. The application of this method
provides an easy, reliable, fast and relatively cheap
way to monitor demographic parameters and distribution of these neotropical felids. Furthermore, species
identification is a necessary step for additional downstream analyses (e.g. diet, hormones), including the genotyping of polymorphic loci, such as microsatellites, for
individual identification and for the estimate of dispersal,
population sizes, relatedness and population genetic
parameters, which is key for the conservation, monitoring and management of such elusive and often endangered species (Waits & Paetkau 2005).
Table 2 Results (identification, success rate) of RCP-PCR amplification in field-collected faecal samples. NI means nonidentified sample.
Ocel ⁄ Marg means that the sample belongs to either ocelot or margay
Sampling site
Mexico
Ejido Caobas (CAO)
E Zapotal Ecological Reserve (ZAP)
Brasil
Adolfo Ducke Forest Reserve (DUC)
N Faeces
NI
Jaguar
Puma
Jaguarundi
Ocel ⁄ Marg
Success rate (%)
31
65
3
3
14
39
12
15
0
0
2
4
90.3
89.2
40
6
14
19
0
1
85
© 2010 Blackwell Publishing Ltd
Acknowledgements
The research was carried out under the project BIOCON 05 100 ⁄ 06 of the Fundació n BBVA and the Brazil ⁄ Spain joint project
CNPq # 690085 ⁄ 02-8 ⁄ CSIC # 2004BR0009. Sampling in Brazil
was carried out under licenses # 131 ⁄ 2005 CGFAU ⁄ LIC, 13883-1
SISBIO and 15664-1 SISBIO of the Instituto Brasileiro do Meio
Ambiente – IBAMA. Faecal and blood samples of known captive
individuals from the Amazon region were obtained through
Cap. J. M. Ferreira and Cap. Carlos Palhari of the veterinary division of the Centro de Instrução de Guerra na Selva – CIGS, and
MSc. Carlos Abrahão and Biol. Diogo Lagroteria of the Nú cleo
de Fauna Silvestre – NUFAS ⁄ IBAMA in Manaus, Amazonas,
Brazil. Other samples of captive individuals in Spain were provided by Zoo of Las Pajanosas (Sevilla), Wildvets S.L.P. (Jerez de
la Frontera), Loro Parque Foundation (Tenerife), Arca de Noe
Association (Alicante), Zoo Aquarium (Madrid) and Zoo of Cordoba. Faecal samples were exported from Brazil to Spain for
genetic analysis under IBAMA ⁄ CGEN Autorização de Acesso
licence # 063 ⁄ 05 and IBAMA ⁄ CITES export licences # 0123242BR
and 08BR002056 ⁄ DF. We are grateful to J.S. Lópes and J. Tavares
for the collection of most field samples in Brazil. Several friends
collaborated with the fieldwork in Brazil and Mexico, as well as
the local reserve staff of El Zapotal Ecolofical Reserve (Mexico).
L. Soriano and A. Piriz provided multiple technical advices.
A. Garcı́a, E. Marmesat and B. Gutié rrez also participated in the
analysis of samples. The Spanish Ministry of Education and
Sciences supported a stay of S. Roques in Mexico.
References
Bartlett SE, Davidson WS (1992) FINS (forensically informative nucleotide
sequencing): a procedure for identifying the animal origin of biological
specimens. BioTechniques, 12, 408–411.
Bhagavatula J, Singh L (2006) Genotyping faecal samples of Bengal tiger
(Panthera tigris tigris) for population estimation: a pilot study. BMC
Genetics, 7, 48.
Bidlack AL, Reed SE, Per J, Palsbøll PJ, Getz WM (2007) Characterization
of a western North American carnivore community using PCR–RFLP
of cytochrome b obtained from fecal samples. Conservation Genetics, 8,
1511–1513.
Boom R, Sol CJA, Salimans MMM, Jansen CL, Wertheim-van Dillen PME,
Van der Noordaa J (1990) Rapid and simple method for purification of
nucleic acids. Journal of Clinical Microbiology, 28, 495–503.
Cossı́os D, Angers B (2006) Identification of Andean felid faeces using
PCR-RFLP. Mastozoologı́a Neotropical, 13, 239–244.
Culver M, Johnson WE, Pecon-Slattery J, O’Brien SJ (2000) Genomic
ancestry of the American puma (Puma concolor). Journal of Heredity, 91,
186–197.
Dalen L, Gö therströ m A, Angerbjö rn A (2004) Identifying species from
pieces of faeces. Conservation Genetics, 5, 109–111.
Davison A, Birks JDS, Brooks RC et al. (2002) On the origin of faeces: morphological versus molecular methods for surveying rare carnivores
from their scats. Journal of Zoology, 257, 141–143.
Farrell LE, Romant J, Sunquist ME (2000) Dietary separation of sympatric
carnivores identified by molecular analysis of scats. Molecular Ecology,
9, 1583–1590.
Fernandes CA, Ginja C, Pereira I, Bruford MW, Santos Reis M (2008)
Species-specific mitochondrial DNA markers for identification of
noninvasive samples from sympatric carnivores in the Iberian Peninsula. Conservation Genetics, 9, 681–690.
Foran DR, Crooks KR, Minta SC (1997) Species identification from scat: an
unambiguous genetic method. Wildlife Society Bulletin, 25, 835–839.
Frantz AC, Pope LC, Carpenter P et al. (2003) Reliable microsatellite genotyping of the Eurasian badger (Meles meles) using faecal DNA. Molecular Ecology, 12, 1649–1661.
Haag T, Santos AS, Angelo CD et al. (2009) Development and testing o
fan optimized method for DNA-based identification of jaguar (Panthera
onca) and puma (Puma concolor) faecal samples for use in ecological
and genetic studies. Genetica, 136, 505–512.
Hansen MM, Jacobsen YL (1999) Identification of mustelid species: otter
(Lutra lutra), American mink (Mustela vison) and polecat (Mustela putorius), by analysis of DNA from faecal samples. Journal of Zoology, 247,
177–181.
Hö ss M, Paabo S (1993) DNA extraction from Pleistocene bones by a
silica-based purification method. Nucleic Acids Research, 21, 3913–
3914.
Johnson WE, O’Brien SJ (1997) Phylogenetic reconstruction of the Felidae
using 16S rRNA and NADH-5 mitochondrial genes. Journal of Molecular
Evolution, 44, 98–116.
Kohn MH, Wayne RK (1997) Facts from faeces revisited. Trends of Ecology
and Evolution, 12, 223–227.
Kumar S, Tamura K, Nei M (2004) ‘MEGA3: integrated software for
Molecular Evolutionary Genetics. Analysis and sequence alignment’.
Bioinformatics, 5, 150–163.
Livia L, Francesca V, Antonella P et al. (2007) A PCR-RFLP method on faecal samples to distinguish Martes martes, Martes foina, Mustela putorius and Vulpes vulpes. Conservation Genetics, 8, 757–759.
Long RA, mackay P, Zielinski WJ, Ray JC (2008) Non Invasive Survey Methods for Carnivores. Island Press, Washington.
Mills LS, Pilgrom KL, Schwartz MK, Mckelvey YK (2000) Identifying lynx
and other North American felids on mtDNA analysis. Conservation
Genetics, 1, 285–288.
Miotto RA, Rodrigues FP, Ciocheti G, Galetti PM Jr (2007) Determination of the minimum population size of pumas (Puma concolor)
through faecal DNA analysis in two protected Cerrado areas in the
Brazilian southeast. Biotropica, 39, 647–654.
Nonaka N, Sano T, Inoue T et al. (2009) Multiplex PCR system for identifying the carnivore origins of faeces for an epidemiological study on
Echinococcus multilocularis in Hokkaido, Japan. Parasitology Research,
106, 75–83. DOI: 10.1007/s00436-009-1629-0.
Palomares F, Caro TM (1999) Interspecific killing among mammalian carnivores. American Naturalist., 153, 492–508.
Palomares F, Godoy JA, Piriz A, O’Brien SJ, Johnson WE (2002) Faecal
genetic analysis to determine the presence and distribution of elusive
carnivores: design and feasibility for the Iberian lynx. Molecular
Ecology, 11, 2171–2182.
Paxinos EC, McIntosh KR, Fleischer R (1997) A non-invasive method for
distinguishing among canid species: amplification and enzyme restriction of DNA from dung. Molecular Ecology, 6, 483–486.
Pilgrim KL, Boyd DK, Forbes SH (1998) Testing for wolf-coyote hybridization in the Rocky Mountains using mitochondrial DNA. Journal of
Wildlife Management, 62, 683–686.
Sambrook J, Fritschi EF, Maniatis T (1989) Molecular Cloning: A Laboratory
Manual. Cold Spring Harbor Laboratory Press, New York.
Schwartz MK, Luikart G, Waples RS (2007) Genetic monitoring as a promising tool for conservation and management. Trends in Ecology and Evolution, 22, 25–33.
Sugimoto T, Nagata J, Aramilev VV, Belozor A, Higashi S, McCullough
DR (2006) Species and sex identification from faecal samples of sympatric carnivores, Amur leopard and Siberian tiger, in the Russian Far
East. Conservation Genetics, 7, 1572–9737.
Waits LP, Paetkau D (2005) New non-invasive genetic sampling tools
for wildlife biologists: a review of applications and recommendations
for accurate data collection. Journal of Wildlife Management, 69, 1419–
1433.
Wasser SK, Houston CS, Koehiler GM, Cadd GG, Fain SR (1997) Techniques for applications of faecal DNA methods to field studies of Ursids. Molecular Ecology, 6, 1091–1097.