Practice Multiple Choice Questions- #1-20
1.
Which of these is always unicellular?
a) Plantae
b) Fungi
c) Protista
d) Animalia
e) none of these or more than one of these
2.
As a result of the recent flooding around the Bay Area, you would expect to see what evidence of secondary succession?
a) trees fall over after the ground around their roots becomes too water-logged, then float away, leaving exposed soil
b) flooding in fields causes dry-region plants to go dormant and supports growth of water-loving plants
c) mudslides cover a coastal park with 10 feet of mud, rock, and sand, killing all vegetation beneath
d) a and c
e) a, b, and c
3.
What is true of a K-selected species?
a) They reproduce quickly
d) They tend to be small
b) Their population booms and crashes frequently
e) Reproductive cycle is very short
c) Much energy is invested in differentiation and development
4. Poison Oak has glossy leaves of three, just as Poison Effe does. Both are harmful to animals that brush up against them or
ingest their leaves. Poison Effe came after Poison Oak in evolutionary time. These plants are displaying:
a) Cryptic coloration
c) Batesian mimicry
b) Muellerian mimicry
d) Competitive Exclusion
e) Mutualism
5. What is true of an energy pyramid?
a) The organism at the bottom is at the highest trophic level
b) About 90% of energy is lost across each trophic level
c) The amount of energy indicates what is passed out as feces
d) It indicates the diversity of an environment
d) Animals can only be at the top level
Questions 8-16
As a molecular biologist, you are investigating the SVNI06 gene in bacteria. This gene codes an enzyme found in
lysosomes that digests proteins. The sequence for this gene is shown below.
5’ ATGCTAGATCGTTGACACGATCGATCGATCGATCGATATAATATCGATCGATCCTAGCATGCTAGATCGATTCGATCGATCGACT3’ TACGATCTAGCAACTGTGCTAGCTAGCTAGCTAGCTATATTATAGCTAGCTAGGATCGTACGATCTAGCTAAGCTAGCTAGCTGA
GATCGATCGATCGATCGATCTTCGATCGATCGATAGCCTACGACTACGACTACGACTACGACTACAGCATCAGCATCAGCATCAGA 3’
CTAGCTAGCTAGCTAGCTAGAAGCTAGCTAGCTATCGGATGCTGATGCTGATGCTGATGCTGATGTCGTAGTCGTAGACGTAGTCT 5’
6. RNA Polymerase is the enzyme that is required for which process?
a) Transcription
b) Translation
c) RNA Polymerase doesn’t participate in either process
7. You study the mRNA that is produced from the SNVI06 gene. What would you expect the first 6 nucleotides in the
mRNA to be?
a) 5’ CGAUCC 3’
b) 5’ ATGCTA 3’
c) 5’ GCCTAC 3’
d) 5’ TCGTAC 3’
8. Using the genetic code provided, what are the first 5 amino acids in the SNVI06 protein?
a) Met-Leu-Asp-Arg
b) Met-Phe-Val-Thr
c) Asp-Arg-Pro-Pro
d) Met-Glu-Val-Ser
9. You determine that the SVNI06 protein is one that is secreted from the cell. What organelle would the SVNI protein
have to be sent into, so that this secretion/exporting could happen?
a) Nucleus
b) Mitochondria
c) Centrioles
d) Endoplasmic Reticulum
e) Cell Wall
10. Which of the following is NOT used to control genes and protein synthesis?
a) Enhancers
b) Operons
c) Transcription Factors
d) Temperature
11. Translation is the second step of protein synthesis. How does the translation of RNA into protein begin?
a) A G cap is added to the RNA
b) The promoter sequence is recognized
c) A release factor binds to the RNA
d) Transcription Factors bind to the RNA
e) The start codon is recognized by the ribosome
12. Proteins have many levels of structure. A diagram of secondary structure is shown
in the figure to the right. Secondary structure of proteins is characterized by
a) Hydrophobic interations
b) hydrogen bonding
c) disufide bridges
d) covalent bonds between R groups
13. When a protein is denatured due to extreme temperatures, which level of protein structure is NOT affected?
a) primary
b) secondary
c) tertiary
d) quaternary
14. A strand of DNA is composed of 40% cytosine bases. What percentage of adenine bases will there be in this DNA?
a) 10%
b) 40%
c) 65%
d) 90%
Questions 15-18
The following diagram represents the replication fork in DNA replication. One end of one of the DNA
strands has been labeled for you.
15. Enzyme A is:
a) DNA Ligase
b) DNA Polymerase III
c) Helicase
d) Single Stranded Binding Protein
16. Enzyme C is:
a) Helicase
b) DNA Polymerase I
c) p53
d) Gyrase
17. The "E" end of the DNA is
a) 5'
b) 3'
18. Enzyme A is on what strand of the DNA?
a) Leading Strand
b) Lagging Strand
e) Primase