Biology EOC
Content Review Packet
Name:
Teacher:
Period:
Page 2
Review resources
Review Resources
Videos:
 Bozeman Science
http://www.bozemanscience.com/biology-main-page/
(Covers all of these topics in 5-10 minute videos. Taught
by a high school teacher, he uses good visuals to help and
goes nice and slow. I would watch these ones first.)
 Crash Course Biology
https://www.youtube.com/playlist?list=PL3EED4C1D684D3
ADF
(Covers all of these topics in 10-15 minute videos in a fun
and engaging way, but also goes into a lot more detail than
we need.)
 Khan Academy
https://www.khanacademy.org/science/biology
(Covers all these topics in 10-20 minute videos with some
good visual representations. Most of them also go into
more detail than we need.)
Articles:



http://www.shmoop.com/biology/
These are well written, detailed articles. I would definitely
use these first.
http://www.biology-online.org/
Click on “tutorials” on the top of the page for helpful articles
. Pretty dry and text-based, but has some good
information.
http://www.sparknotes.com/biology/
Again some general articles
Page 31
Tips for doing well on the EOC
Scenarios. Most of the EOC is centered around a few scenarios.
Recent examples have included moths and salmonberries. You
may know absolutely nothing about the topic besides what they
describe to you. And that is okay! Don’t get tripped up by the
details of the scenario – just think about what the question is
trying to ask you. If the question reads, “Where in the moth cell
does cellular respiration take place?”, don’t worry that you’ve
never seen a moth cell in your life. You know that cellular
respiration takes place in the mitochondria. It doesn’t matter what
type of animal or plant they are talking about. So don’t get
distracted by the scenario! Read the question carefully to get to
what they are truly asking you.
Writing. For being a biology test, the EOC has LOT of writing.
40% of your score comes from the writing-based questions.
This means it is really important to do them, and to do them well!
 Don’t skip the writing questions – answer them!
 Do exactly what the bullet points tell you to do. Make sure
do cover all of the bullet points
 Re-read what you wrote and make sure it answers the
prompt
During the ecology unit we will be covering all of the different
writing prompts that you will see on the EOC so you know exactly
what to do. Just think back to what you have learned, do your
best, and you will be fine! The writing prompts don’t have a single
right answer – there are a whole range of answers that are fine,
as long as you answer all of the bullet points. Even if your answer
feels a bit silly, write it down, its better than nothing!
Do good! Take your time, be thorough and careful, and you will
do well! You can do it!
Page 30
What will the Biology EOC be like?
About half of the biology EOC is based on the content within this
review booklet. The other half is centered around systems,
inquiry, and application.
LS1A Page 3
LS1A: Carbon-containing compounds are the building blocks
of life. Photosynthesis is the process that plant cells use to
combine the energy of sunlight with molecules of carbon
dioxide and water to produce energy-rich compounds that
contain carbon (food) and release oxygen.
Systems
 Feedback is a process in which the output of a system
provides information used to regulate the operation of the
system. Positive feedback increases the disturbance to a
system. Negative feedback reduces the disturbance to a
system.
 Systems thinking can be especially useful in analyzing
complex situations. To be useful, a system needs to be
specified as clearly as possible.
 In complex systems, entirely new and unpredictable
properties may emerge. Consequently, modeling a
complex system in sufficient detail to make reliable
predictions may not be possible.
 Systems can be changing or in equilibrium.
1. The formula for photosynthesis is:
Inquiry
 Basically, the scientific method. In short: ask a question,
design an experiment, draw conclusions, ask more
questions, create a model, communicate clearly, be
honest, know reliability and validity, and think critically.
4. Plants do photosynthesis so they can make:
Application
 In short: know that science, technology, and society are
intertwined. Understand criteria and constraints. Science
is used to solve problems. Perfect solutions do not exist.
Math helps science be better. All people need to be able
to use science to make society better.
2. In words, photosynthesis is:
3. Draw a picture of a plant cell. Use arrows to show the
inputs and the outputs for photosynthesis.
5. What do plants do with the glucose they make?
a.
b.
c.
d.
6. Why do animals need the glucose plants make?
7. Why do animals need the oxygen plants make?
Resource:
http://www.pbs.org/wgbh/nova/nature/photosynthesis.html An
interactive simulation about photosynthesis.
LS1B Page 4
LS1B:The gradual combustion of carbon-containing
compounds within cells, called cellular respiration, provides
the primary energy source of living organisms; the
combustion of carbon by burning fossil fuels provides the
primary energy source for most of modern society.
LS3E Continued
Page 29
LS3E Continued
1. Describe the similarities of the embryos in terms of
biological evolution.
1. The formula for cellular respiration is:
2. In words, cellular respiration is:
3. The inputs for cellular respiration are:
4. The outputs for cellular respiration are:
5. How does glucose have energy?
6. The energy in glucose gets turned into a form of energy
that cells can use:
7. Why do cells need this energy?
8. Animals do cellular respiration because
9. Plants do cellular respiration because
10. When you a fossil fuel (like gas in your car) you do the
following reaction: C3H8 + O2 makes CO2 + H2O + energy.
How is this similar to cellular respiration?
Resource:
http://www.sumanasinc.com/webcontent/animations/content/cellul
arrespiration.html click on “big picture”
2. According to the diagram, which species is most closely
related to the T.rex? How do you know?
3. Which letter (A-C) represents a common ancestor between
frogs and alligators?
4. Which letter (A-C) is a common ancestor for all the species
on the cladogram?
LS3E Continued Page 28
LS3E Continued
Observe the following three DNA sequences found from the
fossils of specimens 24, 46, and 70.
Specimen 24
AATCGCGGTA
Specimen 46
AATGCGGGTA
Specimen 70
AACGTTTCTA
1. Which two specimens are most closely related? How do
you know?
2. How can genes in different species be very similar?
3. Based on the bone anatomy diagrams, which of the
following animals is most closely related to the cat and how
do you know?
LS1C Page 5
LS1C: Cells contain specialized parts for determining
essential functions such as regulation of cellular activities,
energy capture and release, information proteins, waste
disposal, the transfer of information, and movement.
For each part of the cell listed in the table, label it on the pictures
above and describe its function on the table below.
Part of the
Function
cell
Cell
membrane
Cell wall
Nucleus
4. How does examining anatomical similarities between
organisms provide evidence of biological evolution?
Chromosome
Chloroplast
Mitochondrion
5. Why do the organisms in the picture have different shaped
bones? What evolutionary advantage does their shape
give them?
Ribosome
Cytoplasm
Vacuole
Resource: http://www.cellsalive.com/cells/cell_model.htm
LS3E Page 27
LS1D Page 6
LS1D: The cell is surrounded by a membrane that separates
the interior of the cell from the outside world and determines
which substances may enter and which may leave the cell.
Diffusion
1. Diffusion always causes particles to move from a region of
_______________ concentration to region of ______________
concentration.
2. Does diffusion require energy?______________ Does it require a
membrane? _______
Osmosis
3. Osmosis is the ________________ of _______________ across a
____________.
4. In which direction does water move across membranes? It moves
____________ the concentration gradient from a ____________
concentration to a ____________ concentration.
5. Each red blood cell bellow is surrounded by a solution. Below each
picture, label where the concentration of solute is the highest (inside,
outside, same).
_____________
_____________
LS3E: Biological classifications are based on how organisms
are related, reflecting their evolutionary history. Scientists
infer relationships from physiological traits, genetic
information, and the ability of two organisms to produce
fertile offspring.
1. How do scientists infer the evolutionary relationship
between organisms based on their physical
characteristics?
2. How do scientists infer the evolutionary relationship
between organisms based on their genetic information?
3. If two organisms are able to produce fertile offspring, what
does that mean about their evolutionary relationship?
______________
6. Use arrows to show the movement of WATER in each of the cells
4. Based on the picture, which organisms do you think are
most closely related? Why?
5. Based on the picture, which birds do you think are least
closely related? Why?
LS3D Page 26
LS3D: The fossil record and anatomical and molecular
similarities observed among diverse species of living
organisms provide evidence of biological evolution.
1. How does the fossil record above show that birds (modern
chicken on the bottom) evolve from dinosaurs (on the top)?
LS1D Page 7
LS1D: continued.
7. Label the picture of the cell membrane: Include protein,
hydrophobic, hydrophilic, and lipid bilayer
Facilitated Diffusion
8. In facilitated diffusion, which direction do molecules move across
membranes? They move from a __________ concentration to a
_________ concentration.
9. Does facilitated diffusion require energy?____________ Does it
require a membrane ? __________
10. During facilitated diffusion, what do the molecules travel through
in the membrane? _______________
Active Transport
11. In active transport, which direction do molecules move across
membranes? They move from a _______ concentration to a _________
concentration.
12. What is required for active transport to work?
____________________
13. Draw active transport occurring on the diagram below. Include
protein, high concentration, low concentration, and ATP.
2. How would examining the skeleton of a chicken and a
flamingo show that they are evolutionarily related?
3. How would examining the DNA of a penguin and a chicken
show that they are evolutionarily related?
Resource:
http://programs.northlandcollege.edu/biology/biology1111/animations
/passive1.swf
LS1E Page 8
LS1E: The genetic information responsible for inherited
characteristics is encoded in the DNA molecules in
chromosomes. DNA is composed of four subunits(A,T,C,G).
The sequence of a subunit in a gene specifies the amino acid
needed to make a protein. Proteins express inherited traits
(ex. eye color, hair texture) and carry out most cell function.
LS3C Page 25
LS3C: The great diversity of organisms is the result of more
than 3.5 billion years of evolution that has filled available
ecosystem niches on Earth with life forms.
1. DNA is made up of four different nucleotides/bases: _____,
______, _____, and _____.
2. Label the bases on the DNA molecule below.
3. For the strand below, complementary DNA bases below
each one
TACTGTAAAGGCTATATGCCGAAT
1. How does the diagram above show that all species alive
today have diverged from a common ancestor?
4. When we talk about “genetic information”, what part of the
DNA are we talking about?
What do we mean when we talk about “genetic
information”?
5. How does the genetic information coded in the DNA of a
muscle cell in your arm compare to the genetic information
in the DNA of a cell in your brain?
2. What causes species to diverge (become different from
one another)?
3. How can filling an available niche allow a species to
survive?
6. What happens to allow your brain cells to take a different
shape and function compared to your arm cells?
7. What is the relationship between DNA, genes and
proteins?
Resource: http://learn.genetics.utah.edu/content/begin/tour/
4. How can genes in very different organisms be similar to
one another? Where does that similarity come from?
LS1E continued
Page 9
LS3B Page 24
LS3B: Random changes in the genetic makeup of cells and
organisms (mutations) can cause changes in their physical
characteristics or behaviors. If the genetic mutations occur
in eggs or sperm cells, the changes will be inherited by
offspring. While many of these changes will be harmful, a
small minority may allow the offspring to better survive and
reproduce.
1. What is a mutation?
2. How are mutations passed down to offspring?
3. What are some types of changes mutations can make to
the DNA?
4. What can cause mutations?
5. How can a mutation be harmful?
6. How can a mutation have no effect at all on a protein?
LS1E continued
8. How do your genes determine your characteristics?
9. In what part of the cell does DNA get turned into mRNA?
10. What determines the sequence of nucleotides in a mRNA?
11. Turn the DNA sequence of bases below in to an mRNA
sequence of bases.
TACTGTAAAGGCTATATGCCGAAT
12. Where does an mRNA go after it has been made?
13. At the ribosome, mRNA gets translated into
14. A string of amino acids with a certain shape is called a
.
15. What molecule brings amino acids to the ribosome?
16. Translate the following mRNA into amino acids
.
AUGCACCCCGAGAAU
7. How can a mutation be helpful?
8. Are mutations usually harmful or helpful? Explain.
9. A certain species of lizard is normally green and lives in a
damp green place. The environment change, the water
dries up, and the place ends up more brown. How could a
mutation that makes the lizard brown instead of green help
it survive and reproduce?
Resource:
http://www.biotechnologyonline.gov.au/popups/int_translation.html,
http://www.biotechnologyonline.gov.au/popups/int_transcription.html
LS1F Page 10
LS1F All the functions of the cell are based on chemical
reactions. Food molecules are broken down to provide
energy and the chemical constituents needed to synthesize
other molecules. Breakdown and synthesis are made
possible by enzymes.
Some of these enzymes enable the cell to store energy in
special chemicals, such as ATP, that are needed to drive the
many other chemical reactions in a cell.
1.
2.
3.
4.
Proteins are broken down into
Carbohydrates are broken down into
Lipids/fats are broken down into
DNA/RNA are broken down into
5.
6.
7.
8.
Amino acids are put together to make
Simple sugars are put together to make
Fatty acids are put together to make
Nucleotides are put together to make
9. The types of molecules that break down and put together
the molecules in questions 1-8 are called
10. Enzymes are a type of
11. What are some examples of molecules in the body that can
store energy?
12. What type of molecules help transfer energy from food into
energy for cells?
13. Why do cells need energy?
LS3A Page 23
LS3A: Biological evolution is due to: (1) genetic variability of
offspring due to mutations and genetic recombination, (2) the
potential for a species to increase its numbers, (3) a finite
supply of resources, and (4) natural selection by the
environment for those offspring better able to survive and
produce offspring.
1. How do mutations create genetic variability?
2. How do mutations allow some offspring to be better able to
survive and reproduce?
3. Give an example of how a trait might help an animal
survive and reproduce in an environment with a limited
amount of food.
4. For biological evolution to take place, there must be:
a.
b.
c.
d.
5. A housing development was built next to a wet land,
causing run off of polluted water. How could adding this
polluted water to the wet lands drive natural selection of
salamanders living there?
6. Overfishing of kingfish has led to a reduction in the
variation of alleles for kingfish sizes. In the early 1900s,
kingfish had a variety of alleles for size – some to be small,
some to be large. Today, there are no more alleles to be
large, and kingfish only have alleles to be small.
a. What does this mean for the genetic variability of
kingfish offspring today compared to the early
1900s?
b. How could this impact kingfish’s ability to respond to
environmental pressures?
LS2F Page 22
LS2F: The concept of sustainable development supports
adoption of policies that enable people to obtain the
resources they need today without limiting the ability of
future generations to meet their own needs. Sustainable
processes include substituting renewable for non-renewable
resources, recycling, and using fewer resources.
1. Recently Snohomish PUD decided to put up a dam on the
south fork of the Skykomish River. One argument against
this proposal is that it would disrupt important salmon
spawning grounds. Why is this argument scientifically
important?
2. What is an advantage of generating electricity in wind
farms?
LS1G Page 11
LS1G: Cells use the DNA that forms their genes to encode
enzymes and other proteins that allow a cell to grow and
divide to produce more cells, and to respond to the
environment
1. Describe how cells use DNA to make enzymes and other
proteins.
2. If a cell’s environment changes, what can the cell do to to
respond to that change?
3. Why is recycling important?
4. The community is growing and needs more energy
(electricity). What is a way in which the community could
meet its growing demands for electricity, but in a
sustainable way?
3. What are some things that a cell can change about the
proteins and enzymes that it makes?
LS1H Page 12
LS1H: Genes are carried on chromosomes. Animal cells
contain two copies of each chromosome with genetic
information that regulate body structure and functions. Most
cells divide by a process called mitosis, in which the genetic
information is copied so that each new cell contains exact
copies of the original chromosomes.
LS2E Page 21
LS2E: Interrelationships of organisms may generate
ecosystems that are stable for hundreds or thousands of
years.
1. Why does a rain forest have a different biodiversity than a
grassland? Be specific.
1. Describe the relationship between DNA, genes, and
chromosomes using this figure
2. Why does a desert have a different biodiversity than a
grassland? Be specific.
2. How many copies of each chromosome do you have?
3. How do nutrient cycles support stability of the rainforest?
3. Where did each of your copies of your chromosome come
from?
4. What information is contained in chromosomes?
4. How do food relationships support stability of the
grasslands?
5. What is the process by which new cells are made called?
6. Briefly describe how new cells are made.
7. How many cells result in mitosis?
8. What is true about the number of chromosomes in these
cells?
9. What is true about the genetic info in these cells?
5. How does biodiversity contribute to the stability of an
ecosystem?
LS2D Page 20
LS2D: Scientists represent ecosystems in the natural world
using mathematical models.
1. Based on this graph, what will happen to the hare
population over the next 10 years?
How will this be different than what happens to the lynx
population?
LS1I Page 13
LS1I: Egg and sperm cells are formed by a process called
meiosis in which each resulting cell contains only one
representative chromosome from each pair found in the
original cell. Recombination of genetic information during
meiosis scrambles the genetic information, allowing for new
genetic combinations and characteristics in the offspring.
Fertilization restores the original number of chromosome
pairs and reshuffles the genetic information, allowing for
variation among offspring.
1. What is the point of meiosis?
2. What types of cells are made in meiosis?
2. Examine the graph below. What will happen to the
population when it reaches the carrying capacity?
3. How many cells are made in meiosis?
4. What is true about the number of chromosomes in these
cells, compared to the original cell?
5. What is true about the genetic information in each of these
cells?
6. Name and describe two ways in which meiosis makes
every single egg or sperm cell unique.
a.
Carrying capacity
b.
7. Why are siblings, people with the same parents, not
identical to one another?
8. If meiosis makes cells with half the number of
chromosomes, how do offspring end up with the full
number of chromosomes?
9. How does fertilization allow siblings to be different from
one another?
LS1I continued
Page 14
LS1I: continued
10. In humans, a straight hairline (H) is dominant to a widow’s
peak (h). Jerry has a widow’s peak (hh) and his wife
Denise is homozygous dominant (HH).
a. What alleles can Jerry contribute to their offspring?
LS2C Page 19
LS2C: Population growth is limited by the availability of
matter and energy found in resources, the size of the
environment, and the presence of competing and/or
predatory organisms.
1. How does the availability of matter and energy limit the
growth of a population?
b. Complete a punnett square for their offspring below.
2. How does the size of the environment limit the growth of a
population?
c. What is the probability that their child will have a
straight hair line?
d. What is the probability that their child will have a
widow’s peak?
11. In humans, a bent pinky finger (BB) is dominant to a
straight pinky finger (bb). Jerry has a bent pinky finger
(Bb) and his wife Denise has straight pinky fingers (bb).
a. What alleles can Jerry contribute to their offspring?
b. Complete a punnett square for their offspring below.
c. What is the probably that their child will have bent
pinky fingers?
d. What is the probably that their child will have
straight pinky fingers?
e. Is Jerry homozygous or heterozygous?
Resource:
http://www.hobart.k12.in.us/jkousen/Biology/psquare.htm
3. How does the presence of competing organisms limit the
growth of a population?
4. How does the presence of predatory organisms limit the
growth of a population?
5. How can decreasing the size of an environment limit the
population of a species?
6. How can decreasing the availability of matter limit the
population of a species?
7. How can decreasing the number of predators limit the
population of a species?
LS2B Page 18
LS2B: Living organisms have the capacity to produce very
large populations. Population density is the number of
individuals of a particular population living in a given amount
of space.
1. What are conditions necessary for a population to
increase rapidly?
a.
b.
LS1I continued
Page 15
LS1I: continued
12. In some flowers, color is inherited through INCOMPLETE
DOMINANCE, that is, the heterozygote shows both the
dominant and recessive phenotype. So RR = red, WW =
white, and RW = pink.
a. What alleles can a pink flower contribute to its
offspring?
b. Complete a punnett square for crossing two PINK
flowered plants below.
2. What is population density?
3. What are some factors that affect population density?
4. The equation for population density is the number of
individuals in an area: population/area. Calculate the
population density for the questions below. INCLUDE
UNITS.
a. A herd of 12 deer live on my uncle’s 1000 acre
ranch.
b. There are 150 earthworms in 1 cubic meter (m3) of
soil.
c.
c. What is the probability that the offspring plants will
be pink?
d. What is the probabily that the offspring plants will be
white?
13. In chickens, black feathers (BB) are COMINANT to white
feathers (WW), so the heterozygote chicken (BW) has
black and white spots.
a. What alleles can a white chicken contribute to its
offspring?
b. Complete a punnett square for crossing a black
chicken with a chicken with black and white spots
Everett is 48.5 mi2 and 103,000 people live here.
c. What is the probability that the offspring chickens
will have black feathers?
Resource: http://www.buzzle.com/articles/codominance-vsincomplete-dominance.html
LS1I continued
Page 16
LS1I: continued
In pea plants, green seeds (G) are dominant to yellow peas (g),
and round peas (R) are dominant to wrinkled peas(r). A pea plant
with green, round peas (GgRr) is crossed with another pea plant
with green, round peas (GgRr).
GR
Gr
gR
gr
GR
GGRR
GGRr
GgRR
a
Gr
GGRr
GGrr
GgRr
Ggrr
gR
x
GgRr
ggRR
ggRr
gr
GgRr
c
ggRr
b
LS2A Page 17
LS2A: Matter cycles and energy flows through living and
nonliving components in ecosystems. The transfer of matter
and energy is important for maintaining the health and
sustainability of an ecosystem.
1. Add arrows and labels to the picture below to show how
carbon cycles through ecosystems. At right, describe an
energy and a matter transfer or transformation.
1. What alleles can a GgRr pea plant contribute to its
offspring?
2. What should be the genotype in the box labeled x? ____
3. What is the phenotype that goes with the genotype for x?
4. What should be the genotype in the box labeled a? __
5. What is the phenotype that goes with the genotype for a?
2. Use the diagram below to answer the question: what are
four ways nitrogen gets into the soil?
6. What should be the genotype in the box labeled b? ___
7. What is the phenotype that goes with the genotype for b?
8. What should be the genotype in the box labeled c? ___
9. What is the phenotype that goes with the genotype for c?
Resource: http://www.biology.arizona.edu/
mendelian_genetics/problem_sets/dihybrid_cross/03t.html
3. What is an example where matter cycling can affect the
health of an ecosystem?