USING RESTRICTION ENZYMES TO IDENTIFY SIMILAR
SPECIES
How many species do you see?
___________
___________
There are a lot of organisms that look very similar to one another but are different
species. However, there are also individuals that look very different but are the
same species.
So how can we tell two similar species apart without being an expert in every
organism’s morphology?
We will learn a genetic technique to differentiate between 2 different species
using DNA. For example, the following two species of fish are very closely
related and difficult to differentiate morphologically.
Write down some observations that you make about the difference between
these two species
Exercise I: An example restriction enzyme digest using foam noodles.
Imagine that we have identified two organisms morphologically, pink and blue.
We then extracted DNA and amplified a specific gene (represented by a foam
noodle). This gene will then be “digested” or exposed to the enzyme BamHI for a
period of time. Each group of 3 students will have a gene from an individual (6
total in the class), will identify restriction sites on their gene (foam noodle), and
make the cuts using a plastic knife.
Write in the blank the forward (3’-5’) and reverse (5’-3’) sequence of nucleotides
for the restriction site for the SmaI enzyme.
5’- C C C G G G -3’
3’- G G G C C C -5’
Each member of your group will have a specific job. One person will be the
nucleotide counter, who will identify the specific sequence of the enzyme
restriction site and will count the number of nucleotides for each segment.
Another person will need to physically cut the noodle using a plastic knife once
either the teacher or the GK12 fellow have approved your restriction sites.
And the recorder will write down the morphological identification of their individual
(pink or blue) and the size and number of their fragments.
Select a member of your group to do each job and write their names below.
_________________________ : nucleotide counter
_________________________ : noodle cutter
_________________________ : data recorder
How many SmaI restriction sites were on your gene? _______
How many fragments of DNA were left after the gene was digested? ______
How many base pairs are in each fragment?
1. _____
2. _____
Once the gene is digest please clean up scrap foam from you bench.
Exercise II: Separating restriction fragments using gel
Your gene should have separated into 3 fragments. If it didn’t, ask me to help you
find the other restriction site(s). Each student will take one of the 3 fragments
produced by your restriction enzyme digest and as a group move to the front of
the classroom. There will be 6 groups, each going into a different “well.”
In this hypothetical scenario, the room will be filled with an imaginary gel matrix.
The gel matrix will mean the larger/longer pieces of DNA bump into more of the
gel molecules, making them run slower through the gel matrix.
If your piece of DNA is larger than 40 base pairs you’ll only be allowed to take a
step every 4 seconds. If your DNA fragment is between 39-30 base pairs you
can take a step every 3 seconds. If your DNA fragment is less than 29-20 base
pairs you can take a step every 2 seconds. If your DNA fragment is less than 19
base pairs you can take a step every 1 seconds. Wait tell I turn on the machine
(I will say “go”) after a few seconds we will stop to see the banding pattern on the
gel.
Remember, because of the phosphate in the DNA the molecule is negatively
charged so we will apply a positive charge to attract the DNA molecules on the
opposite side of the classroom and a negative charge behind the DNA (the chalk
board) to repel the DNA molecules.
Restriction enzymes or restriction endonucleases are proteins produced by
bacteria to prevent or restrict invasion by foreign DNA. They act as DNA
scissors, cutting the foreign DNA into pieces so that it cannot function. Restriction
enzymes recognize and “cut” DNA strands at specific sequences called
restriction sites. Each different restriction enzyme has its own site that is a very
specific sequence of nucleotides.
Example restriction sites and cutting patterns for specific enzymes:
EcoRI
5'- G A A T T C -3'
3'- C T T A A G -5'
BamHI
5'- G G A T C C -3'
3'- C C T A G G -5'
AluI
5'- A G C T -3'
3'- T C G A -5'
Under appropriate conditions (salt concentration, pH, and temperature), a
restriction enzyme will cleave a piece of DNA into a series of fragments. The
number and sizes of the fragments depend on the number and location of
restriction sites for that enzyme in the given DNA.
Evolution is the change in allele frequencies in a population over time.
Remember that an allele is an alternate form of a gene, meaning that one gene
can have variations in sequence patterns called alleles. And, between two
species these sequences can vary dramatically. So, there may be variations in
the locations of restriction sites between two species. This variation in restriction
site location could potentially lead to size variations in fragments after exposure
to a restriction enzyme that we can use to identify different species.
Now I want each group to restart this procedure by using toothpicks and tape to
put the DNA molecules back together. Then look at the other restriction sites
provided in the explanation to see if another enzyme will restrict this gene in both
species.
Write all enzymes that can digest your DNA molecule below.
__________________________________________________________
__________________________________________________________
Compare your list of enzymes with your classmates for the next 5 minutes and
see if there are any proteins that will restrict this gene in both species. If there
are other enzymes that will restrict this gene in both species, lets run another gel
(using the same rules as before) to see if it can be useful in determining species
identifications.
Did all the morphological identifications match the DNA identifications using
SmaI? If not how did they differ and how can you tell that the identifications are
wrong?
No, there was a pink that showed a genetic identity of a blue.
Were there other enzymes that cut your fragment? List your morphological
identification, genetic identification, and the enzymes that restricted your gene.
Pink: EcoRI, AluI
Blue: BamHI, AluI
If there were a second enzyme that could digest both species would it work for
species identification? Please explain why or why not.
AluI, no, both species had the same fragment sizes and thus banding
patterns
AluI BamHI EcoRI SmaI
Blue 50, 25, 25 2 medium fragments, 1 small fragments
GGAACCGCCCGGGCAACTTAAGCAGCTCACGGGATCCTTGTATTGGATCC
Pink 10, 20, 70 2 small fragments, 1 large fragment
GGATCCGCACGGGCAACTTAAGCAGCTCCCGGGATCCTTGTATTGGATAC