Method S2. RT-PCR
Total RNA was isolated using a combined TRIzol and silica spin column protocol.
Approximately 100 mg frozen plant tissue was mixed with 1 ml of TRIzol (Invitrogen) and
incubated for 5 min at room temperature. Subsequently, samples were mixed vigorously with
200 µl of chloroform and centrifuged at 12,000 g for 10 min at 4 C. The aqueous phase was
collected and used for RNA isolation with the Qiagen RNeasy column according to the
manufacturer’s instructions. On-column DNase digestion was carried out using RNase-Free
DNase set (Qiagen). 1 µg of total RNA was used for cDNA synthesis with SuperScript III
Reverse Transcriptase (Invitrogen), following the manufacturer’s recommendations. For semiquantitative RT-PCR, a 1 μl aliquot of the 20 μl cDNA reaction mixture was used as a template.
Transcript levels of CYB (At1g57620) were analyzed after 35 cycles, using primers Forward (F):
5’ CTGTACCTCACACCGGATCA 3’ and Reverse (R): 5’ TGGTGTAACACGGTGCCATA
3’.
Transcript levels of GLL23 were analyzed after 30 cycles, using primers F: 5’
GAACGAATTGGCTAGAACAG 3’ and R: 5’ GCAACCATAAGCATCATGTG 3. Actin 8 was
used as a reference gene (primers F: 5’ GAGACATCGTTTCCATGACG 3’; R: 5’
TTTCAAACCTGCTCCTCCTT 3’). Real-time qRT-PCR was performed in a Bio-Rad iQ5
thermal cycler. For the PCR amplification with GLL23- and ACT8-specific primers (sequences
as above), iQ SYBR Green Supermix (BioRad) was used according to the manufacturer’s
instructions in a final volume of 20 μl. The fold change in gene expression was calculated using
the CP equation of Pfaffl (2001).
References to Method S2
Pfaffl, M.W. (2001) A new mathematical model for relative quantification in real-time RT-PCR.
Nucleic Acids Res. 29, e45.
1
Download

tpj12408-sup-0012-MethodS2