SUPPORTING INFORMATION
Method S1. Construction of transgenic Arabidopsis lines
Construction of transgenic Arabidopsis lines relied on the GATEWAY system (Invitrogen).
Cloning cassettes from the pQE30-based expression constructs described above were
amplified with primers
5’- GGGGACAAGTTTGTACAAAAAAGCAGGCTCTATGAGAGGATCGCATCACC-3’
and 5’- GGGACCACTTTGTACAAGAAAGCTGGGTACAGGAGTCCAAGCTCA-3’,
which introduced recombination sites attP1 and attP2, allowing for recombination into the
pDONR221 vector (Invitrogen, Carlsbad, CA, USA) via Gateway Clonase II BP. The
fidelity of the entry clones was checked by sequencing using standard M13 forward and
reverse primers. The destination clone was created by recombination of linearized
pDONR221 plasmid into pGWB2 or pGWB6 (Tsuyoshi Nakagawa, Research Institute of
Molecular Genetics, Shimane University, Matsue 690, Japan) with the use of Gateway
Clonase II LR. Destination vectors placed the UGTs under the control of CaMV 35S
promoter and provided kanamycin resistance. While pGWB2 vector was designed to
produce the His-tagged construct, pGWB6 also provided a C-terminal GFP protein tag. The
destination vectors were transformed into Agrobacterium tumefaciens GV3101 and used to
transform heterozygous ugt74b1-2 plants, allowing isolation of each overexpression insertion
event in both wild-type and the ugt74b1-2 backgrounds. Plants were transformed by the
floral dip method (Clough and Bent, 1998). Seeds collected from primary transformants
were re-screened in the T2 generation to identify lines harboring single insertions, and
progeny of individual T2 plants were screened on both kanamycin and Basta to determine
the genotype (homozygous or heterozygous) of the T2 parent with respect to the
overexpression construct (KanR) and the ugt74b1-2 insertion (Bar).
1
Method S2. Plant growth conditions
Soil grown plants were planted in Pro-Mix ‘BX’ (Premier Horticulture, Red Hill, PA, USA)
at 22°C and 70% relative humidity under illumination with fluorescent and incandescent light
(16 h per day) at a photon fluence rate of approximately 120 mol m-2 sec-1. Plants were
watered 2-3 times per week and fertilized with macronutrients (7.5 mM N, 1.7 mM P, 3 mM
K, 3 mM Ca, and 1.2 mM Mg). For plant growth in sterile conditions, seeds were surfacesterilized for 10 min in 1.5% (w/v) sodium hypochlorite and placed on solid medium
containing 8 g l-1 phytagar, 30 g l-1 sucrose, 2.15 g l-1 (0.5 ×) Murashige-Skoog (MS) salts,
pH 5.6, and 1 × MS vitamin mix (Sigma, St. Louis, MO, USA). After 2-3 days of
stratification at 4oC, plants were grown at 24oC at a photon fluence rate of approximately 160
mol m-2 sec-1 for 18 h (long days) or 8 h (short days) per day. For selection of transgenic
plants, the agar medium was supplemented with 25 μg ml-1 kanamycin (Sigma), or with 5.25
g ml-1 sulfadiazine (Sigma), or seedlings grown in soil were sprayed with 1% (v/v) Basta
herbicide (Finale, Farnam Companies, Phonix, AZ, USA).
Method S3. Analysis of endogenous hormone contents
Fresh plant material (10-80 mg) was homogenized with 5 ml methanol and 50 ng each of
(D4)ACC (1-aminocyclopropane-1-carboxylic acid), (2H5)JA (jasmonic acid), (2H5)OPDA
(12-oxo-phytodienoic acid), (-)JA-(2H3)Leu (jasmonate-isoleucine), (D6)ABA (abscisic acid),
(13C6)IAA (indolyl-3-acetic acid) and [13C6, 15N1]IBA (indolyl-3-butyric acid) were added as
internal standards. Extract preparation, derivatization and GC-MS analysis (Polaris Q,
Thermo-Finnigan, Bremen, Germany) were performed as previously described (Grubb et al.,
2004; Miersch et al., 2008; Sreenivasulu at al., 2010).
2
Method S4. Phylogenetic analysis of the UGT74 clade
A search for proteins related to the UGT74 clade employed blastp searches at the NCBI
website (http://blast.ncbi.nlm.nih.gov/Blast.cgi) with default parameters, except the organism
field was restricted to green plants (taxid:33090). The following proteins were used as query
sequences: UGT74B1, UGT74C1, UGT74D1, UGT74E1, UGT74F1 and UGT75C1. The
latter was included because a previous phylogenetic analysis of Arabidopsis Family 1 UGTs
indicated that it is closely related to, but outside of, the UGT74 clade (Li et al., 2001). An “E
value” of 1 x 10-78 was chosen as the cutoff; this was the least stringent value for which every
query recovered at least one sequence each from the genomes of Zea mays, Oryza sativa and
Sorghum bicolor. The recovered gene lists were combined, duplicates discarded and a total
of 269 records retrieved. One sequence we believe to be misannotated (UGT74E1) was
corrected in both A. thaliana and A. lyrata. An initial tree was constructed, and the position
of UGT75C1 was used to make a final determination of which sequences to include in further
analyses. Finally, UGT74 homologs from Carica papaya were retrieved from PLAZA
(http://bioinformatics.psb.ugent.be/plaza_v1/; Proost et al., 2009) and added to the alignment.
For construction of the final tree, all identified protein sequences were aligned (Table
S7) using the L-INS-i option in MAFFT (Katoh et al., 2005) and edited manually. The
JTT+G model was selected as the best fitting amino acid substitution model according to the
Bayesian Information Criterion in ProtTest (Darriba et al., 2011). To reconstruct the
phylogeny we used MrBayes 3.1 (Ronquist and Huelsenbeck, 2003) as implemented at the
CIPRES portal (Miller et al. 2010) and initiated two runs of eight Markov-chain Monte Carlo
(MCMC) chains of 106 generations each from a random starting tree, sampling every 100
generations (additional settings: Rates = gamma, Ngammacat = 4, Aamodelpr = JTT, Temp =
0.01). A suitable burn-in was chosen based on Tracer outputs (v. 1.5;
http://tree.bio.ed.ac.uk/software/tracer/) and convergence was assessed by standard deviation
3
of split frequencies (< 0.08) and with AWTY (Nylander et al., 2008) by comparing the
estimated posterior distributions of branch support from the two independent MCMC runs.
The phylogenetic tree was rooted between the monocot and the eudicot sequences and
visualized with the MEGA Tree Explorer (Tamura et al., 2011).
Method S5. Comparison of relative UGT74 gene expression
Methods for qRT-PCR experiments are described Experimental Procedures. Microarray gene
expression analysis was conducted by the UC Berkeley Functional Genomics Laboratory
Affymetrix Genechip Core Facility, utilizing the Affymetrix ATH1-121501 gene chip.
mRNA was prepared from 2-week-old vegetative rosettes of wild-type (Col-0) plants
according to their recommended protocol (http://qb3.berkeley.edu/qb3/fgl/microarray.cfm).
Plants were frown asceptically according to our standard protocol for measuring
glucosinolates (see Experimental Procedures). Data were downloaded for the “vegetative
rosette” samples of the “Developmental Map” dataset at http://bar.utoronto.ca/efp/cgibin/efpWeb.cgi. This dataset was originally published by Schmid et al. (2005). Absolute
expression values are shown.
Supporting References
Clough, S.J. and Bent A.F. (1998) Floral dip: a simplified method for Agrobacteriummediated transformation of Arabidopsis thaliana. Plan J., 6, 735-743.
Darriba, D., Taboada, G.L., Doallo, R. and Posada, D. (2011) ProtTest 3: fast selection of
best-fit models of protein evolution. Bioinformatics, 27, 1164-1165.
Grubb, C.D., Zipp, B.J., Ludwig-Müller, J., Masuno, M.N., Molinski, T.F. and Abel, S.
(2004) Arabidopsis glucosyltransferase UGT74B1 functions in glucosinolate
biosynthesis and auxin homeostasis. Plant J., 40, 893-908.
Katoh, K., Kuma, K., Toh, H. and Miyata, T. (2005) MAFFT version 5: improvement in
accuracy of multiple sequence alignment. Nucleic Acids Res., 33, 511-518.
Li, Y., Baldauf, S., Lim, E.K. and Bowles, D.J. (2001) Phylogenetic analysis of the UDPglycosyltransferase multigene family of Arabidopsis thaliana. J. Biol. Chem., 276,
4338-4343.
4
Miersch, O., Neumerkel, J., Dippe, M., Stenzel, I. And Wasternack, C. (2008)
Hydroxylated jasmonates are commonly occurring metabolites of jasmonic acid and
contribute to a partial switch-off in jasmonate signaling. New Phytol., 177, 114-127.
Miller, M., Pfeiffer, W. and Schwartz, T. (2010) Creating the CIPRES Science Gateway
for inference of large phylogenetic trees. In Gateway Computing Environments
Workshop (GCE), pp. 1-8.
Nylander, J.A., Wilgenbusch, J.C., Warren, D.L. and Swofford, D.L. (2008) AWTY (are
we there yet?): a system for graphical exploration of MCMC convergence in Bayesian
phylogenetics. Bioinformatics, 24, 581-583.
Proost, S., Van Bel, M., Sterck, L., Billiau, K., Van Parys, T., Van de Peer, Y. and
Vanepoele, K. (2009) PLAZA: a comparative genomics resource to study gene and
genome evolution in plants. Plant Cell, 12, 3718-3731.
Quiel, J.A. and Bender, J. (2003) Glucose conjugation of anthranilate by the Arabidopsis
UGT74F2 glucosyltransferase is required for tryptophan mutant blue fluorescence. J.
Biol. Chem., 278, 6275-6281.
Ronquist, F. and Huelsenbeck, J.P. (2003) MrBayes 3: Bayesian phylogenetic inference
under mixed models. Bioinformatics, 19, 1572-1574.
Schmid, M., Davison, T. S., Henz, S. R., Pape, U. J., Demar, M., Vingron, M., Scholkopf,
B., Weigel, D., and Lohmann, J. U. (2005) A gene expression map of Arabidopsis
thaliana development. Nat Genet 37, 501-506
Sreenivasulu, N., Radchuk, V., Alawasy, A., Borisjuk, L., Weier, D., Staroske, N.,
Fuchs, J., Miersch, O., Strickert, M. Usadel, B., Wobus, U., Grimm, B., Weber,
H. And Weschke, W. De-regulation of absisic acid contents causes abnormal
endosperm development in the barley mutant seg8. Plant J., 64, 589-603.
Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M. and Kumar, S. (2011)
MEGA5: molecular evolutionary genetics analysis using maximum likelihood,
evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol., 28, 27312739.
5