Online Appendix for the following JACC article
TITLE: Human Cardiac Progenitor Cells Engineered With Pim-I Kinase Enhance
Myocardial Repair
AUTHORS: Sadia Mohsin, PHD, Mohsin Khan, PHD, Haruhiro Toko, MD, PHD, Brandi
Bailey, PHD, Christopher T. Cottage, MS, Kathleen Wallach, BS, Divya Nag, Andrew
Lee, BS, Sailay Siddiqi, MD, Feng Lan, PHD, Kimberlee M. Fischer, PHD, Natalie Gude,
PHD, Pearl Quijada, MS, Daniele Avitabile, PhD, Silvia Truffa, BS, Brett Collins, BS,
Walter Dembitsky, MD, Joseph C. Wu, MD, PHD, Mark A. Sussman, PHD
APPENDIX
Table S1
Primary and Secondary Antibodies
Application
Antibody
Dilution
Amplify
Company
ICC
GFP
1:200
No
Molecular Probes
ICC
MEF2C
1:200
No
Aviva Systems Biology
ICC
GATA6
1:200
No
Santa Cruz
ICC
VWF
1:200
No
Invitrogen
IHC
α-sarcomeric actin
1:100
No
Sigma
IHC
GFP
1:300
Yes
Rockland
IHC
vWF
1:100
No
Invitrogen
IHC
SM22
1:100
No
ABCAM
IHC
c-kit
1:50
Yes
ABCAM
FACS
c-kit
1:100
No
Biolegend
FACS
CD45
1:100
No
Biolegend
FACS
CD31
1:100
No
Biolegend
FACS
CD34
1:100
No
Biolegend
FACS
Glycophorin
1:100
No
Biolegend
FACS
GFP
1:200
No
Rockand
Western blot
GFP
1:500
No
Invitrogen
Western blot
Pim-1 (C20,E16)
1:500
No
Santa Cruz
Western blot
B tubulin
1:1000
No
Santa Cruz
Western blot
P21
1:100
No
ABCAM
Western blot
Phospho p21
1:100
No
Santa Cruz
Table S2
Primers for quantitative RT-PCR
Primer Name
Forward/Reverse
Sequence
vWF
Forward
GGATTTGCATGGATGAGGATGGGA
vWF
Reverse
TTGACCCGATGACTCTTCAGCAAG
Mef2c
Forward
AGATCTCCTGTTGACAGCTTGA
Mef2c
Reverse
GTGGAATTCGTTCCGGTGAT
GATA6
Forward
CCAGGAAACGAAAACCTAAGAACA
GATA6
Reverse
TTGGAGTCATGGGAATGGAATT
Table S3
P values for EF and FS for echocardiography 20 weeks after transplantation
Table S4
P values for MRI and Echocardiography data 8 weeks after transplantation
SUPPLEMENTAL METHODS
Generation of Lentiviral vectors and transduction of hCPCs
hCPCe and hCPCeP are transduced with lentivirus for eGFP and Pim-1 and eGFP.
Lentivirus were made as described earlier (1) and lentiviral constructs are described in
online supplementary fig 1C. Lentivirus for Fluc-RFP(-HSVttk) (Fig 6 A) is collected
from the supernatant of transfected 293FT cells and concentrated as previously described
(1). hCPCe –Luc and hCPCeP-Luc were transduced at a MOI of 10.
Human Cardiac Stem Cell Isolation
hCPCS are isolated from heart tissue obtained from patients undergoing surgery for Left
Ventricular Assist Device (LVAD) implantation. The study protocol is IRB exempt by
NIH guidelines for human subjects research exemptions (45 CFR 46.101) defined as:
"Research involving the collection or study of existing data, documents, records,
pathological specimens, or diagnostic specimens, if these sources are publicly available
or if the information is recorded by the investigator in such a manner that the subjects
cannot be identified, directly, or though identifiers linked to the subjects." The only
information collected with the tissue sample is the age and sex of the patient. The human
cardiac progenitor cells (hCPCs) in our study are obtained from a male patient at 68 years
of age. Normally, tissue samples are procured from the left ventricular wall core plug
removed to insert the LVAD pump that would otherwise be discarded. Tissue is minced
in small pieces and digested in collagenase at 150U mg/ml (Worthington Bio Corp,
Lakewood, NJ) for 2 hours at 37°C. The cells are then passed through 100µm and 50µm
filters (BD biosciences CA), centrifuged at 1200rpm for 5 min, with resuspension of the
pellet in hCPCs media consisting of Hams F12 (Fisher), 10% FBS, 1% PSG, 5mU/ml
human erythropoietin (Sigma), 10ng/ml basic FGF (Peprotech). Following overnight
incubation at 37°C the cells are collected and passed through 100µm and 50µm filters
and centrifuged at 1200rpm for 5 min. The pellet is incubated with c-kit labeled beads
(miltenyi biotec, CA) and sorting is performed according to manufacturer’s protocol. The
cells are subsequently seeded and expanded clonally. hCPCs were successfully isolated
from 29 LVAD samples out of 41 total samples for a success rate of 70%.
Transduction and differentiation of hCPC
Six hCPCs isolates from distinct patient samples are infected with bicistronic lentivirus
expressing eGFP alone (Lv-eGFP) or in combination with Pim-1 (Lv-eGFP+Pim-1;
Supplement Fig 1C). For lentiviral infection, hCPC are plated in 6-well dish (50,000
cells/ well), serially transduced with lentivirus (multiplicity of infection (MOI) of 20
followed by MOI of 10 two days after first infection) to obtain hCPC expressing
enhanced green fluorescent protein (eGFP) together with Pim-1 (hCPCeP) or eGFP alone
(hCPCe). Engineered hCPCs are expanded and analyzed using flow cytometry to validate
high percentage eGFP expression. All six cell lines successfully transduced to over
express Pim-1 and GFP and the cell line having the highest Pim-1 expression was chosen
for use in this study. Additional studies incorporate modification of hCPCs with a firefly
luciferase (Luc) reporter construct to generate hCPCe Luc or hCPCeP Luc for
bioluminescence Imaging (BLI) as described in online supplementary methods. For
differentiation hCPCs are treated with dexamethasone 10-8 mol/L for 7 days as previously
described (1)
Karyotype Analysis
Karyotype analyses of hCPCs are performed at the Cytogenetics Laboratory, Department
of Pathology, Stanford Hospital and Clinics. Cells are treated with 0.1 mg/mL colcemid
for induction of mitotic arrest with subsequent harvest by trypsin dispersal, hypotonic
shock, and fixation with 3:1 methanol: acetic acid. For each cell line, 20 metaphase
spreads are analyzed using standard G-banding method.
MTT, CyQuant, Trypan Blue Exclusion and Trap Assay
MTT and CyQuant assay of hCPCs, hCPCe and hCPCeP involves plating 2000 cells/
well in quadruplicate in a 96-well plate and incubation with MTT reagent (Sigma, St
Louis, Mo) or CyQuant reagent (Invitrogen) as described by our group (1).
Pharmacologic inhibition of Pim-1 kinase by quercetagetin (10µmol/L; Calbiochem, San
Diego, Ca) is performed as previously reported (1). Telomerase activity is assessed by
TRAP assay using quantitative PCR according to the manufacturer’s protocol (TRAPeze
RT; Chemicon S7710).
Real time RT- PCR
Total RNA is isolated from hCPCe and hCPCeP before and after dexamethasone
treatment by using Quick-RNA MiniPrep (Zymo Research). cDNA is prepared using
iScript cDNA Synthesis Kit (Bio Rad). Real time PCR is performed on samples in
triplicate using iQ SYBER Green (Bio Rad) according to manufacturer’s protocol. The
primer sequences used for experiments are listed in Table S2.
Protein Isolation and Western blot Analysis
hCPCe and hCPCeP are plated in 6-well dishes (50,000 cells/ well). The samples were
harvested in 50µl of sample buffer, boiled and sonicated. Protein lysates are run on 412% NuPage Novex Bis Tris gel (Invitrogen), transferred on polyvinylidene fluoride
(PVDF) membrane, blocked in 8% skim milk in Tris-buffered saline Tween-20 (TBST)
solution for 1 hour at room temperature and then incubated with primary antibodies
overnight at 4°C (Table S1). Membrane is incubated with secondary antibodies for 1 hour
at room temperature after several washes with TBST solution. Fluorescence signal is
detected and quantified using Typhoon 9400 fluorescent scanner together with Image
Quant 5.0 software (Amersham Biosciences).
Myocardial Infarction, Echocardiography, Hemodynamics
Surgery is performed on SCID mice including sham=15, vehicle=20, hCPCe=20 and
hCPCeP=20 that are anesthetized by isoflurane inhalation, intubated and ventilated.
Thoracotomy reveals the left anterior descending (LAD) artery for ligation. Cells are
injected into 5 separate sites (100,000 cells) at the border zone area after infarction.
Infarction size is standardized by echocardiography using Vevo 770 imaging system
(Visualsonics, ON, Canada) using a parasternal short axis view by M mode recorded 7
days after surgery. Lack of anterior wall motion with at least 40% decrease in ejection
fraction and fractional shortening is the minimal inclusion criteria for experimental
groups. Echocardiographic assessment for ejection fraction at 1 week after infarction is
33.9% by the Stanford group (Wu) versus 15% for the San Diego group (Sussman).
These measurements suggest initial infarction injury is not comparable between the two
sets of experiments, although within each separate study the loss of contractile function is
consistent throughout the time course of the study. Closed chest hemodynamic
assessment is performed on mice anesthetized with 3% Chloral hydrate, 300mg/Kg prior
to insertion of micro-tip pressure transducer (FT111B, Scisense) into the right carotid
artery and advanced into left ventricle. The catheter is connected to A/D converter
(FV892A, Scisence) for data acquisition.
Echocardiographic measurement of cardiac function
Animals receiving LAD artery ligation are scanned on days 2, 28, and 56 using a
Siemens-Acuson Sequoia C512 system equipped with a multi frequency (8–14 MHz)
15L8 transducer. Fractional shortening (FS) is acquired using standard M-mode image
acquisitions of left ventricular short axis images as previously described (2).
BLI of cell survival and localization
Severe Combined Immunodeficiency Disease (SCID) mice (8 weeks of age; Charles
Rivers, MA) are anesthetized by inhaled isoflurane (2%), intubated, and ventilated. A left
thoracotomy is performed, followed by ligation of the left anterior descending (LAD)
artery for 30 minutes after which 1x106 hCPCe Luc or hCPCeP Luc are injected
intramyocardially into 3 sites near the peri-infarct zone in a total volume of 20 µl as
previously described (2).
Survival and engraftment of hCPC in vivo is assessed by BLI performed on animals
receiving 375 mg/kg body weight d-luciferin reporter probe on days 2, 4, 7, 14, 21, 28,
35, 42, 49, and 56 using an IVIS Spectrum (Xenogen, Alameda, CA). Living Image 4.0
(Caliper Life Sciences, Hopkinton, MA) software is used to quantify signal intensity in
units of photons/sec/cm2/sr as previously described (2).
Magnetic resonance imaging (MRI)
MRI is performed using a Signa 3.0T Excite HD scanner (GE Healthcare Systems,
Milwaukee, WI; http://www.gehealthcare.com/euen/mri/index.html) with a Mayo Clinic
T/R MRI coil (Mayo Clinic Medical Devices, Rochester, MN). Briefly, mice are
anesthetized with 2% isoflurane and placed in the supine position for imaging. A small
animal electrocardiogram and respiratory gating system (Small Animal Instruments,
Stony Brook, New York) are used to acquire images as previously described (3).
Following localization, gradient recalled echo (GRE) and fast spoiled GRE (FSPGR)
sequences are used to acquire sequential short-axis slices from apex to base of the mouse
heart every 1.5 mm. For each sequence, 20 cine frames encompassing 1 cardiac cycle are
obtained with the following sequence parameters: TR = 10 ms, TE = 4.6 ms, number of
excitations (NEX) = 2, field of view (FOV) = 60 × 60 mm, matrix = 256 × 256, flip angle
(FA) = 30°, and slice thickness 1.5 mm. A contouring program, OsiriX (OsiriX
Foundation, Geneva, Switzerland) is used to trace the endocardial border of the LV
myocardium for each slice of the heart over the entire cardiac cycle to determine ejection
fraction (EF), end-diastolic (EDV) and end-systolic volumes (ESV).
Histology and Staining
Hearts are retroperfused through the abdominal aorta with heparin (Sigma) followed by
relaxation buffer to arrest in diastole followed by fixation in formalin for 24 hours. Hearts
are processed, embedded in paraffin, and 5µm sections are cut. Slides are deparaffinized
in xylene for 5min for three changes, followed by 3 changes in 100% ethanol for 3
minutes each, 95% ethanol 2 changes for 3 minutes, 70% ethanol for 3 minutes and in deionized water 3 changes for 3 minutes. After deparafinization, the sections are boiled
10mmol/L citrate buffer (pH 6.0) followed by quenching with 3%H2O2/1XTN for 20 min
(if required) otherwise proceed to blocking with Tris-NaCl-Blocking buffer (TNB; Perkin
Elmer catalog FP1020) for 30 minutes. Primary antibodies are applied overnight at 4°C
in TNB buffer. The next day secondary antibodies are applied for 2 hour at room
temperature after washing with TN buffer. When amplification is required, slides are
incubated with streptavidin horseradish peroxidase-conjugated antibody for 30 minutes at
room temperature and signal is developed using tyramide substrate diluted 1:50 v/v in
amplification diluent (Perkin-Elmer) for 10 minutes. Slides are washed in 1XTN for 5
minutes 3 changes before staining for DNA. The slides are mounted in Vectashield
mounting medium (Vector Labs) and scanned using Leica TCS SP2 confocal laserscanning microscope. A List of Primary and secondary antibodies used for
immunostaining is provided in Table S1.
Telomere Length Measurements
Telomere length is analyzed by quantitative in situ hybridization (Q-FISH) and confocal
microscopy. PNA probe was purchased from DAKO (K5325) and measurements were
done according to manufacturer’s protocol. Briefly, slides were deparaffinized and
rehydrated, followed by antigen retrieval using 10mM Citrate buffer pH 6.0. Slides were
subsequently washed with PBS and treated for 9 minutes with Proteinase K (Dako,
S3020). Following another PBS wash slides were dehydrated with a series of cold
ethanol then allowed to dry. PNA probe was placed on the section and denatured at 80C
for 10 minutes and hybridized at 37C overnight. Slides were washed two times in Wash
Buffer at 65C and counterstained with Sytox blue. Telomere signal was acquired in each
nucleus using Leica software and divided by Sytox blue signal to account for differences
in nuclear size.
Telomerase Activity
Telomerase activity is assessed by quantitative PCR according to manufacturer protocol
(TRAPeze RT, Chemicon S7710). Briefly, hCPCs are harvested in CHAPS buffer and
centrifuged at 4°C. 1 μg of lysate is obtained then incubated in a solution containing
reverse transcriptase reaction mix and Taq polymerase at 30°C for 30 minutes. Control
cells provided by the manufacturer are used as positive control and serial dilutions of
control template TSR8 provided by the manufacturer is employed for quantitation.
CHAPS buffer in the absence of protein lysates and heat-inactivated lysates are used as
negative control. PCR cycling conditions and data analysis are performed according to
manufacturer protocol.
In Situ Hybridization
Human Alu repeats are identified using in situ hybridization on paraffin embedded
experimental hearts and human left ventricular assist device plugs as a positive control.
Deparaffinization and antigen retrieval is performed as described previously. Following
antigen retrieval and subsequent PBS washes slides are treated with Digest All 3 Pepsin
(00-3009, Invitrogen) at 37C for 5 minutes. Slides are then washed and dehydrated and
allowed to completely dry. Biogenex Alu probe is added to the slide and placed at 80C
for 10 minutes to facilitate denaturation. The slides are then incubated at 37C overnight.
The following day the slides are washed three times with 50% formamide/ 2X SSC at
37C, then 3 times with 2X SSC. Endogenous peroxidase activity is quenched with 3%
peroxide for 20 minutes, and then slides are treated with anti-fluorescein HRP (Roche)
for 30 minutes at room temperature. Following a PBS wash, slides are treated with
Tyramide FITC (Perkin Elmer, NEL 701001KT) according to manufacturer protocol,
washed and counterstained with Topro-3.
Animal Studies
Institutional Animal Care and Use Committee approved all animal studies.
Statistics
All data are expressed as mean +/- SEM. Student’s t-test is used when comparing two
groups, one-way or two- way repeated measures. ANOVA with post Bonferroni test is
used to compare more than two groups. Kolmogorov Smirnov test is used for TRAP
assay. P value less than 0.05 is considered as statistically significant. Statistical Analysis
is performed using Graph Pad Prism v 5.0 software.
References:
1. Fischer KM, Cottage CT, Wu W, et al. Enhancement of myocardial
regeneration through genetic engineering of cardiac progenitor cells
expressing Pim-1 kinase. Circulation 2009;120:2077– 87.
2. Cao F, Wagner RA, Wilson KD, et al. Transcriptional and functional
profiling of human embryonic stem cell-derived cardiomyocytes. PLoS
One 2008;3:e3474.
3. Yue P, Arai T, Terashima M, et al. Magnetic resonance imaging of
progressive cardiomyopathic changes in the db/db mouse. Am J
Physiol Heart Circ Physiol 2007;292:H2106–18.
Supplementary Figure 1
Human CPCs overexpressing Pim-1 A) Human CPCs in culture, B) characterization of
human CPCs by FACS analysis, C) Schematic diagram of lentiviral vectors for eGFP and
eGFP Pim-1, D) percentage of GFP in hCPCe and hCPCeP, E) immunoblot analysis of
human CPCs for overexpression of Pim-1 and GFP lentiviral transduction, F) karyotype
analysis of hCPCe and hCPCeP.
Supplementary Figure 2
Colocalization of human mitochondrial marker and Alu with GFP staining:
Immunohistochemistry for human mitochondrial marker (white), GFP (green), Desmin
(red) and nuclei (blue) respectively for A) vehicle B) remote zone, C) infarct zone of
hCPCeP injected mice 12 weeks after transplantation. Scale bar = 50μm. FISH analysis
for Alu (green), sarcomeric actin (red) and nuclei (blue) for D) human heart sample E-F)
infarct zone of mice transplanted with hCPCeP after 12 weeks G) Human heart sample no
probe (control) H-I ) Infarct zone of mice with hCPCeP 20 week after transplantation.
Scale Bars: A-C = 50μm, D, G-I = 40μm and E-F = 10μm.
Supplementary Figure 3
Pim-1 expression remains increased in hCPCeP at 12 weeks post- transplantation:
Confocal microscopy images show immunolabeling for Pim-1 in hCPCe (A) or hCPCeP
(B). Pim-1 (white), GFP (green), α-sarcomeric actin (red) and nuclei (blue). Scale bar =
40μm