Supplementary Information, “Characterization of putative glycosylphosphatidylinositolanchoring motifs for surface display in the methylotrophic yeast Hansenula polymorpha”
Seon Ah Cheon • Jinhee Jung • Jin Ho Choo • Doo-Byoung Oh • Hyun Ah Kang
S. A. Cheon • J. H. Choo • H. A. Kang
Department of Life Science, College of Natural Science, Chung-Ang University, Seoul, 156756, Korea
J. Jung • D.-B. Oh
Biochemicals and Synthetic Biology Research Center, Korea Research Institute of Bioscience
and Biotechnology, 125 Gwahak-ro, Yuseong-gu, Daejeon, 305-806, Korea
Contents
Supplementary Methods:
Plasmids constructions
Supplementary Table 1 H. polymorpha strains and vectors used in this study.
Supplementary Table 2 Primers used in this study.
Supplementary Fig. 1 In silico identification of putative GPI-proteins of H. polymorpha.
Supplementary Fig. 2 Flowchart of the cell wall fractionation procedure to analyze the
locations of GPI-proteins in H. polymorpha.
Supplementary Methods
Plasmids constructions
All vectors constructed in this study are listed in Supplementary Table 1. The 2.2 kb DNA
fragment encoding the HpOch1(1-53aa)-msdS-FLAG fragment was obtained by digestion with
SpeI/ClaI from pDTMOX-HH1MSF (Cheon et al. 2009) and inserted into the corresponding
sites of pDUM2-msdS, which is a modified version of pDUMOX-msdS(HA-HDEL) (Kim et
al. 2006) lacking an unique SalI site, resulting in the vector pDUM2-HHMSF. The 0.6 kb DNA
fragment containing the partial MOX promoter, α-amylase signal sequence from A. niger, and
a c-Myc tag was amplified from pDLMOX-GOD(H) (Kim et al. 2004) using two sequential
rounds of PCR with primer sets MOXaa_9F and MOXaa_8B and MOXaa_9F and
MOXaa_10B, and cloned between the KpnI and XbaI sites of pDUM2-HHMSF, generating the
pDUM2-aaF vector. Then the 1.4 kb msdS fragment generated by digestion with XbaI from
pDUM2-HHMSF was reintroduced into the pDUM2-aaF vector, resulting in the pDUM2aaMSF vector containing the msdS gene fused with the α-amylase signal sequence of A. niger
and a c-Myc tag. To construct a positive control vector for msdS surface display, the DNA
fragment encoding the C-terminal fragment of Tip1p (40 amino acids) (Kim et al. 2002) was
amplified
from
genomic
DNA
of
the
DL1-L
strain
using
PCR
primers
TIP40_11F_SalI/TIP40_12B_SalI (Supplementary Table 2), and cloned into a SalI site of
pDUM2-aaMSF, resulting in pDUM2-aaMSF-Tip40. The DNA fragments encoding the Cterminal fragments (40 amino acids) of ten putative GPI-anchored proteins were amplified
from the genomic DNA of the A16 (leu2) strain derivative of CBS4732 (ATCC34438) using
the PCR primers listed in Supplementary Table 2, and cloned into SalI or SalI/ClaI sites of
pDUM-aaMSF, generating the pDUM2-CCW40, -CRH40, -73/40, -CTS40, -EXG40, -133/40,
-SPS40, -135/40, and -518/40 vectors, respectively.
Supplementary Table 1 H. polymorpha strains and vectors used in this study
Strain name
Genotype
Reference
DL1-LdU
leu2 ura3Δ::lacZ
(Kang et al. 2002)
DL1-g11
leu2 ura3Δ::lacZ och1Δ::lacZ
(Kim et al. 2006)
CBS3742 (A16)
leu2
(Lahtchev 2002)
Plasmid name
Description
Reference
pDUM2-msdS
Removed an unique SalI site from pDUMOXmsdS(HA-HDEL), HARS36, HpURA3
This study
pDUM2-aaF
pMOX- ss*-c-Myc-FLAG
This study
pDUM2-aaMS
pMOX-ss-c-Myc-msdS-FLAG
This study
pDUM2-aaMSF-TIP1
pMOX-ss-c-Myc-msdS-FLAG-TIP1(C40)**
This study
pDUM2-aaMSF-CCW14
pMOX-ss-c-Myc-msdS-FLAG-CCW14(C40)
This study
pDUM2-aaMSF-CRH1
pMOX-ss-c-Myc-msdS-FLAG-CRH1(C40)
This study
pDUM2-aaMSF-73
pMOX-ss-c-Myc-msdS-FLAG-ORF73(C40)
This study
pDUM2-aaMSF-CTS2
pMOX-ss-c-Myc-msdS-FLAG-CTS2(C40)
This study
pDUM2-aaMSF-EXG1
pMOX-ss-c-Myc-msdS-FLAG-EXG1(C40)
This study
pDUM2-aaMSF-133
pMOX-ss-c-Myc-msdS-FLAG-ORF133(C40)
This study
pDUM2-aaMSF-SPS2
pMOX-ss-c-Myc-msdS-FLAG-SPS2(C40)
This study
pDUM2-aaMSF-518
pMOX-ss-c-Myc-msdS-FLAG-ORF518(C40)
This study
pDUM2-aaMSF-135
pMOX-ss-c-Myc-msdS-FLAG-ORF135(C40)
This study
pDLMOX-GOD(H)
pMOX-ss-GOD-6xHis, HpLEU2
(Kim et al. 2004)
* ss, A. niger α-amylase signal sequence
** (C40): C-terminal 40 amino acids
Supplementary Table 2 Primers used in this study
Primer Name
Sequences (5’ to 3’)
MOXaa_9F_KpnI
acggggtaccttgcatcct
MOXaa_8B
ttctgagatgagtttttgttcggccaaagcaggtgccgc
MOXaaCM_10B
tcttctagacagatcctcttctgagatgagtttttgttc
TIP40_11F_SalI
tagtgggtcgacgctggatctagctccgct
TIP40_12B_SalI
catgctgtcgacttacataagcagagctgcaag
CCW1_C40_1F_SalI
tagtgggtcgacgtttcctcttcttctgcagc
CCW1_C40_2B_SalI
catgctgtcgacctaaagaagaccgatcaaga
CRH1_C40_1F_SalI
tagtgggtcgacggcaactcctcgtcgcagtct
CRH1_C40_2B_SalI
catgctgtcgacttagatcaaggcgagtccaaac
ORF73_1F_SalI
agtgggtcgacacggcaagcacggccagc
ORF73_2B_ClaI
tccatcgattctatagtacacaaatcagtcc
CTS2_3F_SalI
agtgggtcgactacccagatgagatggatg
CTS2_4B_ClaI
tccatcgatttacgagatgaataccagaat
EXG1_5F_SalI
agtgggtcgacaaatatgcctctgttctgtct
EXG1_6B_ClaI
tccatcgatttacagtaattctagtcctag
ORF333_7F_SalI
agtgggtcgactcgtcaacggtcagaaacg
ORF333_8B_ClaI
tccatcgattcactcaaacataaagcagtg
SPS2_11F_SalI
agtgggtcgacgacggcgaccacgcaaaac
SPS2_12B_ClaI
tccatcgatttagagctgcatagcaagc
ORF135_13F_SalI
agtgggtcgacccacgtgaagacattccg
ORF135_14B_ClaI
tccatcgattctattgaggagacatgaccatc
ORF518_15F_SalI
agtgggtcgactacgatgacgaaggaacttc
ORF518_16B_ClaI
tccatcgattctagatcagggcagccaa
*Restriction enzyme sites were underlined
Supplementary Fig. 1 In silico identification of putative GPI-proteins of H. polymorpha. For
screening GPI-anchored proteins, the 5,483 annotated ORFs of the H. polymorpha CBS4732
strain (ATCC34438) were analyzed systemically using bioinformatic analysis programs,
including GPI-SOM (Fankhauser and Maser), PredGPI (Pierleoni et al. 2008), big-PI
(Eisenhaber et al. 2004), and fragAnchor (Poisson et al. 2007). Further analysis of putative GPI
anchored proteins was performed using SignalP 4.1 server for signal peptides (Petersen et al.
2011), Psort II (Nakai and Horton 1999) and WoLF PSORT (Horton et al. 2007) for protein
localization, TMHMM (Sonnhammer et al. 1998) for transmembrane domain, NetNGlyc 1.0
server (http://www.cbs.dtu.dk/services/NetNGlyc/) for N-linked glycosylation sites, NetOGlyc
3.1 and 4.0 servers (Julenius et al. 2005; Steentoft et al. 2013) for O-linked glycosylation sites,
and CLC Main benchwork (CLC bio) for analyses of BLASTp, protein alignment, protein
properties, and amino acid frequencies
Supplementary Fig. 2 Flowchart of the cell wall fractionation procedure to analyze the
locations of GPI-proteins in H. polymorpha. The cell wall proteins of H. polymorpha were
isolated as described in Materials and Methods
References
Cheon SA, Choo J, Ubiyvovk VM, Park JN, Kim MW, Oh DB, Kwon O, Sibirny AA, Kim JY,
Kang HA (2009) New selectable host-marker systems for multiple genetic
manipulations based on TRP1, MET2 and ADE2 in the methylotrophic yeast Hansenula
polymorpha. Yeast 26:507-521
Eisenhaber B, Schneider G, Wildpaner M, Eisenhaber F (2004) A sensitive predictor for
potential GPI lipid modification sites in fungal protein sequences and its application to
genome-wide studies for Aspergillus nidulans, Candida albicans, Neurospora crassa,
Saccharomyces cerevisiae and Schizosaccharomyces pombe. J Mol Biol 337:243-253
Fankhauser N, Maser P (2005) Identification of GPI anchor attachment signals by a Kohonen
self-organizing map. Bioinformatics 21:1846-1852
Horton P, Park KJ, Obayashi T, Fujita N, Harada H, Adams-Collier CJ, Nakai K (2007) WoLF
PSORT: protein localization predictor. Nucleic Acids Res 35:W585-587
Julenius K, Molgaard A, Gupta R, Brunak S (2005) Prediction, conservation analysis, and
structural characterization of mammalian mucin-type O-glycosylation sites.
Glycobiology 15:153-164
Kang HA, Sohn JH, Agaphonov MO, Choi ES, M.D. T-A, Rhee SK (2002) Development of
expression systems for the production of recombinant proteins in Hansenula
polymorpha DL-1. In: Gellissen G, editor. Hansenula polymorpha-Biology and
Applications. Weinheim: Wiley-VCH. p 124-146
Kim MW, Kim EJ, Kim JY, Park JS, Oh DB, Shimma Y, Chiba Y, Jigami Y, Rhee SK, Kang
HA (2006) Functional characterization of the Hansenula polymorpha HOC1, OCH1,
and OCR1 genes as members of the yeast OCH1 mannosyltransferase family involved
in protein glycosylation. J Biol Chem 281:6261-6272
Kim MW, Rhee SK, Kim JY, Shimma Y, Chiba Y, Jigami Y, Kang HA (2004) Characterization
of N-linked oligosaccharides assembled on secretory recombinant glucose oxidase and
cell wall mannoproteins from the methylotrophic yeast Hansenula polymorpha.
Glycobiology 14:243-251
Kim SY, Sohn JH, Pyun YR, Choi ES (2002) A cell surface display system using novel GPIanchored proteins in Hansenula polymorpha. Yeast 19:1153-1163
Lahtchev K (2002) Basic genetics of Hanseula polymorpha. In: Gellissen G, editor. Hansenula
polymorpha : biology and applications: Wiley-VCH
Nakai K, Horton P (1999) PSORT: a program for detecting sorting signals in proteins and
predicting their subcellular localization. Trends Biochem Sci 24:34-36
Petersen TN, Brunak S, von Heijne G, Nielsen H (2011) SignalP 4.0: discriminating signal
peptides from transmembrane regions. Nat Methods 8:785-786
Pierleoni A, Martelli PL, Casadio R (2008) PredGPI: a GPI-anchor predictor. BMC
Bioinformatics 9:392
Poisson G, Chauve C, Chen X, Bergeron A (2007) FragAnchor: a large-scale predictor of
glycosylphosphatidylinositol anchors in eukaryote protein sequences by qualitative
scoring. Genomics Proteomics Bioinformatics 5:121-130
Sonnhammer EL, von Heijne G, Krogh A (1998) A hidden Markov model for predicting
transmembrane helices in protein sequences. Proc Int Conf Intell Syst Mol Biol 6:175182
Steentoft C, Vakhrushev SY, Joshi HJ, Kong Y, Vester-Christensen MB, Schjoldager KT,
Lavrsen K, Dabelsteen S, Pedersen NB, Marcos-Silva Let al (2013) Precision mapping
of the human O-GalNAc glycoproteome through SimpleCell technology. EMBO J
32:1478-1488
Download

Supplementary Information, “Characterization of putative