Table S1: Age and HTT CAG repeat lengths of subjects participating in the study.
The cohort used for each experiment is listed separately.
N
age
(mean +/- SD)
CAG
(mean +/- SD)
Control
27
45.4 +/- 11.7
-
Pre-manifest HD
17
42.15 +/- 9.9
42.8 +/- 2.1
Early HD
22
49.0 +/- 11.7
43.5 +/- 2.8
Moderate HD
14
59.4 +/- 7.3
43.0 +/- 1.3
Control
9
45.1 +/- 11.9
-
Pre-manifest HD
6
47.8 +/- 6.6
42.7 +/- 1.0
Early HD
10
46.7 +/- 7.3
44.2 +/- 2.8
Moderate HD
5
53.2 +/- 10.1
44.8 +/- 3.8
Control
11
42.0 +/- 12.4
-
HD
17
49.5 +/- 7.1
43.0 +/- 1.6
Control
9
48.0 +/- 9.9
-
HD
8
51.3 +/- 10.6
43.4 +/- 1.6
Proximity Ligation Assays
(Fig 5B)
Control
7
45.0 +/- 19.6
-
HD
12
50.2 +/- 14.5
43.1 +/- 2.8
p65 translocation
(Fig 5D)
Control
8
49.0 +/- 7.4
-
HD
7
51.4 +/- 7.7
42.4 +/- 1.7
PCR arrays
(Table 1 and Figure S5)
Control
10
45.8 +/- 9.3
-
Early HD
10
48.7 +/- 8.5
43.1 +/- 2.2
PCR validation +
HTT knock down
effects on transcription
(Figure 6 and S6)
Control
10
48.2 +/- 13.7
-
Early HD
10
52.3 +/- 11.1
43.1 +/- 2.2
Control
7
45.0 +/- 12.2
-
Pre-manifest HD
6
43.5 +/- 9.0
42.5 +/- 2.0
Early HD
6
48.3 +/- 10.1
44.2 +/- 3.1
Moderate HD
7
54.5 +/- 16.0
43.2 +/- 2.8
Experiment
Monocyte
cytokine
profiling
(Figure 1A)
Macrophage
cytokine
profiling
(Figure 1B)
HTT lowering validation
(Figure 2)
HTT knock down cell
cytokine profiling
(Figure 3)
TLR4 qPCR
(Figure S3)
Subject group
1
Figure S1: Correlations between cytokine levels produced by Huntington’s disease
myeloid cells in vitro and HTT CAG repeat length. (A) There is a significant association
between HTT CAG repeat length and production of TNF, but not other cytokines by
Huntington’s disease monocytes. (B) No associations were observed between CAG repeat
length and production of cytokines by Huntington’s disease macrophages.
2
Figure S2: siRNA delivery via glucan-encapsulated particles (GeRPs) does not affect
cell viability. Control macrophages were treated with GeRPs containing different amounts of
either scrambled or anti-HTT siRNA for 24 h. LDH assays showed no differences in cell
viability following these treatments.
3
Figure S3: Sorting efficiency of U937 cells transfected with HTT exon 1. U937 cells were
lentivirally transduced with HTT exon 1 carrying 29, 71 or 129 CAG repeats. All viral
vectors also encoded GFP, which was used to fluorescence-activated cell sort (FACS)
transfected cells. FACS sorting was highly efficient, as shown by comparing (A) pre-sorted
cell populations and (B) the 99% pure HTT expressing post-sorted U937 cells.
4
Figure S4: TLR4 expression does not differ between Huntington’s disease and control
monocytes. CD14+ monocytes were isolated from both Huntington’s disease patients and
controls. RNA was extracted from these unstimulated cells and used for gene expression
analysis via qPCR. Data are shown as relative gene expression +/- SEM, analysed by oneway ANOVA.
5
Figure S5: mHTT interacts directly with the NFB pathway, which is dysregulated in
Huntington’s disease. (A) Mutant HTT interacts directly with IKK, as shown by coimmunoprecipitation. HTT was precipitated from PBMC whole cell lysates using either
MAB2166 or 2B7 anti-HTT antibodies, before immunoblotting for HTT and IKK. An
example blot of samples from one control and one Huntington’s disease subject is shown,
with relevant bands marked. Experiment was repeated with similar results four times. (B)
Similar to the prolonged degradation of IB in Huntington’s disease monocytes, the cells also
demonstrate increased phosphorylation of the protein over time. (C) LPS-induced degradation
of IB is prolonged in Huntington’s disease, demonstrated by decreased IB levels in patient
monocytes one hour post-LPS stimulation compared with control cells. Levels of IB return
to those at baseline or above by four hours post-stimulation. (B+C) Shown are example blots
of samples from one control and one Huntington’s disease subject, repeated at least two times
with similar results.
6
Figure S6: Expression of several key molecules within the NFB pathway is altered in
Huntington’s disease. Monocytes under basal unstimulated conditions were analysed by
qPCR using pre-validated primers from SABioscience (n=10 biological repeats, for control
and early Huntington’s disease patients) (B) Changes in expression levels were analysed
using Cytoscape, allowing construction of a pathway map to visualize gene expression
changes within the TLR4/LPS signalling cascade. Nodes stand for the different genes, red
and green colour indicating up- or down-regulation in Huntington’s disease compared to
control cells, respectively. Connecting lines visualize connections between genes (red:
experimental data; green: array data; lilac: STRING data; blue: combined data).
7
Figure S7: Gene expression changes identified using PCR signalling arrays are
validated with qPCR. CD14+ monocytes were isolated by magnetic cell sorting. After 3
days in culture, RNA was isolated from the unstimulated cells and used for gene expression
analysis via qPCR. This showed the same up-regulation in Huntington’s disease versus
control cells as the original array. Data are shown as relative gene expression +/- SEM,
analysed using an unpaired Student t test *p>0.05; **p>0.01.
8
Supplementary experimental procedures
Classification of human samples
Blood samples were obtained from control subjects and genetically-diagnosed Huntington’s
disease patients. Pre-manifest Huntington’s disease mutation carriers were identified
according to the absence of diagnostic motor abnormalities on the Unified Huntington’s
Disease Rating Scale (Huntington Study Group, 1996), whilst patients with motor
abnormalities were classed as having early or moderate-stage disease using the total
functional capacity (TFC) scale (13-7, early; 6-3, moderate) (Shoulson, 1981). Subjects with
inflammatory or infective conditions were excluded. Subjects’ demographic are provided in
Table S1.
Isolation of human monocytes and macrophages
Cells were isolated from whole blood, as previously described (Björkqvist et al., 2008). 50 ml
whole blood was collected in heparin (CP Pharmaceuticals) and leukocytes were isolated by
density gradient centrifugation. Monocytes were sorted via magnetic cell separation columns
using anti-CD14 microbeads (Miltenyi Biotec).
Mutant HTT expression in U937 cells
A2UCOE
Huntington’s
disease
exon
1
vectors
used
in
this
study
were:
p'HRsincpptUCOEeGFP+linker+WPRE; p'HRsincpptUCOE+htt exon 1 IRES eGFP 29CAG;
p'HRsincpptUCOE+htt exon 1 IRES eGFP 71CAG and p'HRsincpptUCOE +htt exon 1 IRES
eGFP 129CAG. These were generated by modifying the A2UCOE vector (Zhang et al.,
2007) as follows: a polylinker containing PmeI-SnaBI-BstBI sites was ligated into the NdeI
site, at the same time destroying the NdeI site at the 3’ end of the polylinker; a woodchuck
post translational regulatory element was ligated into the BstBI site; exon 1 human HTTIRES-eGFP was ligated into the SalI-NdeI sites. Virus production using a pMD.G2 envelope
9
and pCMVdR8.74 packaging plasmid was performed by preparing a PEI/DNA solution in
serum free DMEM media, which was incubated with HEK293T cells for 4 h before fresh
DMEM media (containing 10% FCS and antibiotics) was added. Viral supernatants were
collected and concentrated by filtration through a 0.22 m syringe filter and centrifugation
(4000xg for 24 h) after 48 h. To achieve a single DNA insertion per cell, viral transduction
rate was titrated to 10-20% before FACS of the transduced cells according to GFP
expression, which is co-transfected with all A2UCOE plasmids.
Production of glucan encapsulated siRNA containing particles
Glucan particles were prepared as described previously (Soto and Ostroff, 2008). Briefly,
Saccharomyces cerevisiae (100 g of SAF-Mannan; SAF Agri) was suspended in 1 litre 0.5 M
NaOH and heated to 80°C for 1 h. The insoluble material containing the yeast cell walls was
collected by centrifugation at 5000xg for 20 min. This insoluble material was then suspended
in 1 litre 0.5 M NaOH, and incubated at 80°C for 1 h. The insoluble residue was again
collected by centrifugation (5000xg for 20 min) and washed three times with 1 litre of water,
three times with 200 ml propan-2-ol and three times with 200 ml acetone. The resulting slurry
was placed in a glass tray and dried at room temperature (20°C) to produce 12.7 g of a fine,
slightly off-white powder. Fluorescent glucan particles were prepared as described previously
(Aouadi et al., 2009). Briefly, glucan particles (1 g) were washed with sodium carbonate
buffer (0.1 M sodium carbonate, pH 9.2) and resuspended in 100 ml sodium carbonate buffer.
5-(4,6-Dichlorotriazinyl) aminofluorescein (Invitrogen; 1 mg/ml in ethanol) was added to the
buffered glucan particle suspension (10% v/v) and mixed at room temperature in the dark
overnight. Tris buffer (2 mM Tris/HCl, pH 6.8) was added, incubated for 15 min and glucan
particles were washed with sterile pyrogen-free water until the supernatant was clear. The
glucan particles were then flash-frozen, freeze-dried in the dark and stored at room
temperature in the dark. To load siRNA into 107 glucan particles, siRNA (10 l 7 mM
10
siRNA; anti- HTT from Dharmacon (Guide strand: 5’- pUUCAUCAGCUUUUCCAG
GGUC-3’; Passenger strand: 5’ –CCCUGGAAAAGCUGAUGACGG -3’) (DiFiglia et al.,
2007) and scrambled from Dharmacon (Guide strand: 5'-pUUUCGAAGUACUCAGCG
UGAG-3'; Passenger strand: 5'-CACGCUGAGUACUUCGAACUU-3')) was mixed with
sterile, pyrogen-free saline (Sigma, 40 l), HEPES buffer (Invitrogen, 30 l 0.1M, pH 7.5 in
saline) and glucan particles (10 l 109 particles/ml in saline), and incubated for 2 h at room
temperature in the dark. The siRNA was trapped by complex formation inside the glucan
particles by adding 10 l EndoPorter (GeneTools, diluted 1:1 with saline) and incubated for
15 minutes at room temperature as described by Tesz, et. al. (Tesz et al., 2011). Loaded
GeRPs were flash frozen on dry ice in single use aliquots and stored at -80°C. Loading
reactions were scaled up or down proportionately to produce the desired number of GeRPs.
TR-FRET quantification of HTT
TR-FRET immunoassay quantification of total HTT and soluble mutant HTT was performed
as previously described (Baldo et al., 2012). 5 l tissue homogenate samples were transferred
to low-volume wells of white 384-microtiter plates (Greiner Bio-One). A total of 1 l
detection buffer (50 mM NaH2PO4, 400 mM NaF, 0.1% BSA, and 0.05% Tween + antibody
mix) was added, with the final antibody amount per well for soluble mHTT and total HTT
detection being 1 ng 2B7-Tb + 10 ng MW1-d2 or 1 ng 2B7-Tb + 10 ng 2166- Alexa Fluor
488, respectively. TR-FRET readout was performed with an EnVision Reader (PerkinElmer).
After the excitation of the donor fluorophore Tb at 320 nm and a time delay of 100 ms, the
resulting Tb and d2 or Alexa Fluor 488 emission signals were read at 620 nm and 665 or 520
nm, respectively. Total protein levels of cell lysates were quantified BCA Protein Assay Kit
(Pierce) according to manual. Huntingtin protein levels are shown as percentage of the signal
intensities over lysis buffer background signal after normalization to total protein levels (ΔF).
11
qPCR
For standard qPCR, RNA was isolated from cell pellets using the QIAGEN RNeasy Mini Kit
before cDNA transcription using the SuperScript II Reverse Transcriptase (Invitrogen), both
according to manufacturer’s instructions. For each reaction, SYBR Green Master Mix
(Applied Biosystems) was mixed with 5 ng cDNA and 300 pM forward and reverse primer
(HTT_f: AGTGATTGTTGCTATGGAGCGG HTT_r: GCTGCTGGTTGGACAGAAACTC;
IRAK1_f: CTACCTGCCCGAGGAGTACA IRAK1_r: GTGCTTCTCAAAGCCACTCC;
CD40_f; CACCTCGCTATGGTTCGTCT; CD40_r: CTGGTGGTGGCAGTGTGTCTCTC;
JUN_f: TTTCGGGAGTGTCC AGAGAG; JUN_r: GAGAAGCCTAAGACGCAGGA;
TLR4_f: CTCCTGCGTGA GACCAGAAA; TLR4_r: GGTTGAGAAGGGGAGGTTGT) in
a total volume of 25ul. PCR cycling conditions were: 95°C for 10min followed by 40 cycles
of 95°C for 15sec and 60°C at 1min. All PCR plates were run on a 7500Fast real-time PCR
system (Applied Biosystems) using 7500 software. The Ct value for each gene was subtracted
by the mean of the Ct value for the house keeping genes (B2M, bActin and GAPDH for
standard qPCR; and B2M, bActin, GAPDH, RPL13a and HPRT1 for SABioscience plates).
The relative gene expression (delta-delta CT) was then calculated, setting the average of the
𝐶𝑡 𝑔𝑒𝑛𝑒 𝑜𝑓 𝑖𝑛𝑡𝑒𝑟𝑒𝑠𝑡
)
𝐴𝑣𝑒𝑟𝑎𝑔𝑒 𝑜𝑓 𝑐𝑜𝑛𝑡𝑟𝑜𝑙 𝐶𝑡
−(
control condition as standard, using the following formula: 2
Bioinformatics
A gene network was constructed using STRING, a database and web resource composed of
known and predicted protein-protein interactions of both physical, functional and
bibliometric nature collected from a large number of biological resources (Jensen et al.,
2009). Cytoscape, an open source software for integrating interaction networks with highthroughput expression data (Shannon et al., 2003), was utilised to highlight and analyse the
differential expression in monocytes isolated from Huntington’s disease and control subjects.
12
Western Blot
Cell pellets were lysed in RIPA buffer (25 mM Tris-HCl (pH 7.6), 150 mM NaCl, 1% NP-40,
1% sodium deoxycholate, 0.1% SDS and 1xcomplete protease inhibitor cocktail (Roche)) and
protein content was measured using a BCA protein assay (Pierce). 10 g protein was mixed
with 5x Laemmli buffer, before denaturing at 95°C for 10 min. Lysates were run on 4-20%
Tris-glycine gels (Invitrogen) and blotted on PVDF membrane, which were blocked with 5%
skimmed milk in Tris-buffered saline, pH 7.0, containing 0.1% Tween20 (TBS-T) for 2 h.
Blocked membranes were incubated with an anti-IB (Santa Cruz; 1:500) or anti-pIB (Cell
Signalling; 1:1000) antibody in 5% skimmed milk in TBS-T overnight. After washing several
times with TBS-T, membranes were incubated for 1 h with secondary anti-rabbit alkaline
phosphatase antibodies (Sigma-Aldrich; 1:10,000). Signal was visualized using CDP-Star
substrate (Applied Biosystems) on Kodak BioMax MR-1 film. Membranes were stripped
using ReBlot Plus Strong solution (Millipore) 1:10 diluted for 10min, before reprobing with
anti-GAPDH antibody (Sigma- Aldrich, 1:3000) and secondary anti rabbit –alkaline
phosphate antibody as loading control.
Co-immunoprecipitation of HTT and IKK
HTT immunoprecipitation was performed as described (Landles et al., 2010), with the
following adaptations. PBMCs, collected by density centrifugation of 50 ml whole blood,
were lysed in 500 μl ice-cold lysis buffer (50 mM HEPES (pH 7.0), 150 mM NaCl, 10 mM
EDTA, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 0.1% BSA, 10 mM DTT, 1 mM
PMSF, 1x complete protease inhibitor cocktail (Roche)). Lysates were pre-cleared prior to
immunoprecipitation by incubation with 50 μl (1:1 slurry) pre-washed G-Sepharose-agarose
beads (Invitrogen) for 6 h at 4 °C. Immuno-precipitations were carried out overnight using
1.5 mg pre-cleared supernatant, 30 μl protein G-Sepharose-agarose (1:1 slurry) and 2 μg
antibody (MAB2166 (Millipore) and 2B7 (generously provided by A. Weiss at Novartis)) in
13
1 ml final volume. Beads were pelleted by centrifugation at 13,000 ×g for 30 sec, washed 4×
with lysis buffer, resuspended in 16 μl of 2× Laemmli buffer and denatured at 75 °C for 5
min. Immunoprecipitates were split into two samples, separated on two 8% SDS-PAGE,
before blotting onto PVDF membranes for immunodetection of HTT (MAB2166; Millipore;
1:1000) or IKK (Santa Cruz; 1:1000).
14
Supplementary references
Aouadi M, Tesz GJ, Nicoloro SM, Wang M, Chouinard M, Soto E, et al. Orally delivered
siRNA targeting macrophage Map4k4 suppresses systemic inflammation. Nature.
2009;458(7242):1180-4.
Baldo B, Paganetti P, Grueninger S, Marcellin D, Kaltenbach LS, Lo DC, et al. TR-FRETbased duplex immunoassay reveals an inverse correlation of soluble and aggregated mutant
huntingtin in huntington's disease. Chem Biol. 2012;19(2):264-75.
Björkqvist M, Wild EJ, Thiele J, Silvestroni A, Andre R, Lahiri N, et al. A novel pathogenic
pathway of immune activation detectable before clinical onset in Huntington's disease. J Exp
Med. 2008;205(8):1869-77.
DiFiglia M, Sena-Esteves M, Chase K, Sapp E, Pfister E, Sass M, et al. Therapeutic silencing
of mutant huntingtin with siRNA attenuates striatal and cortical neuropathology and
behavioral deficits. Proc Natl Acad Sci U S A. 2007;104(43):17204-9.
Huntington Study Group. Unified Huntington's Disease Rating Scale: reliability and
consistency. Huntington Study Group. Mov Disord. 1996;11(2):136-42.
Jensen LJ, Kuhn M, Stark M, Chaffron S, Creevey C, Muller J, et al. STRING 8--a global
view on proteins and their functional interactions in 630 organisms. Nucleic Acids Res.
2009;37(Database issue):D412-6.
Landles C, Sathasivam K, Weiss A, Woodman B, Moffitt H, Finkbeiner S, et al. Proteolysis
of mutant huntingtin produces an exon 1 fragment that accumulates as an aggregated protein
in neuronal nuclei in Huntington disease. J Biol Chem. 2010;285(12):8808-23.
Shannon P, Markiel A, Ozier O, Baliga NS, Wang JT, Ramage D, et al. Cytoscape: a
software environment for integrated models of biomolecular interaction networks. Genome
Res. 2003;13(11):2498-504.
Shoulson I. Huntington disease: functional capacities in patients treated with neuroleptic and
antidepressant drugs. Neurology. 1981;31(10):1333-5.
Soto ER, Ostroff GR. Characterization of multilayered nanoparticles encapsulated in yeast
cell wall particles for DNA delivery. Bioconjug Chem. 2008;19(4):840-8.
15
Tesz GJ, Aouadi M, Prot M, Nicoloro SM, Boutet E, Amano SU, et al. Glucan particles for
selective delivery of siRNA to phagocytic cells in mice. Biochem J. 2011;436(2):351-62.
Zhang F, Thornhill SI, Howe SJ, Ulaganathan M, Schambach A, Sinclair J, et al. Lentiviral
vectors containing an enhancer-less ubiquitously acting chromatin opening element (UCOE)
provide highly reproducible and stable transgene expression in hematopoietic cells. Blood.
2007;110(5):1448-57.
16