What is PCR?
-PCR is a technique that takes specific sequence of DNA of small
amount and amplifies it to be used for further testing.• In vitro technique
-Amplify= making numerous copies of a segment of DNA
- DNA Replication vs. PCR:
PCR is a laboratory version of DNA Replication in cells( in vivo)
-PCR was invented in the 1984 by Kary Mullis as a way to make
numerous copies of DNA fragments in the laboratory.
- The method depends on repeated thermal cycling.
Application of PCR:
1- Diagnosis and detection of genetic and infectious
diseases..
2- Widely used in criminal investigations and
parental test.
3- determine evolutionary development of
organisms.
PCR Thermocycler
Basic requirements for PCR
reaction
• 1) DNA sequence of target region must be known.
2) Primers - typically 20-30 bases in size. These can be readily
produced by commercial companies. Can also be prepared using a
DNA synthesizer.
3) Heat-stable DNA polymerase - e.g. Taq polymerase (an enzyme
originally isolated from the bacterium Thermus aquaticus, which live
in hot water and can tolerate high temperatures.
4) DNA thermal cycler - machine which can be programmed to carry
out heating and cooling of samples over a number of cycles.
The three main steps of PCR
•
The basis of PCR is temperature changes and the effect that these
temperature changes have on the DNA.
• In a PCR reaction, the following series of steps is repeated 20-40 times
(note: 25 cycles usually takes about 2 hours and amplifies the DNA
fragment of interest 100,000 fold)
Step 1: Denature DNA
At 95C, the DNA is denatured (i.e. the two strands are separated)
Step 2: Primers Anneal
At 40C- 65C, the primers anneal (or bind to) their complementary
sequences on the single strands of DNA
Step 3: DNA polymerase Extends the DNA chain
At 72C, DNA Polymerase extends the DNA chain by adding nucleotides to
the 3’ ends of the primers.
Denaturation of DNA
Hydrogen bonds that holds the double strand
break and double-stranded DNA separate to single
stranded DNA, all enzymatic reactions stop.
This occurs at 95 ºC
Step 2 Annealing or Primers Binding
Primers bind to the complimentary sequence on the
target DNA. Primers are chosen such that one is
complimentary to the one strand at one end of the
target sequence and that the other is complimentary
to the other strand at the other end of the target
sequence. (at 40˚C- 60 ˚C )
Step 3 Extension or Primer Extension
extension
extension
DNA polymerase catalyzes the extension of the
strand in the 5-3 direction, starting at the
primers, attaching the appropriate nucleotide
(A-T, C-G) (at 70˚C - 75˚C )
Animations
• http://www.dnalc.org/ddnalc/resources/pcr.
html
Question
Calculate the annealing stage in PCR technique :
primer 1 : 5' GATGAGTTCGTGTCCGTACAACT 3'
primer 2 : 5' GGTTATCGAAATCAGCCACAGCGCC 3'
Rules :
Time temperature for primer 1 = 2(A+T) + 4(G+C)
Time temperature for primer 2 = 2(A+T) + 4(G+C)
Primer1+primer 2 / 2 = _____ - 5 c = ______
Time temperature for primer 1 = 2(5+7) + 4(6+5) = 68
Time temperature for primer 2 = 2(7+4) + 4(6+7)= 74
68+74 / 2 = ___71__ - 5 c = __66 C____
Calculate the number of DNA that during in (15 ) cycles by using PCR
technique :
Rule:
2 Number of cycle
215 = 32768 copies