Outer membrane protein 16 from Brucella
abortus expression in Arabidopsis thaliana
Overview of my Msc thesis project
Prof. Dr. Mirza Suljagić
Student: Jasmin Šutković
Sarajevo , 18th September 2014
Content
•
•
•
•
•
•
Introduction
Objectives
Material and Methods
Short discussion of the current work
Expected outcomes
References
Introduction
Brucellae are facultative intracellular gram-negative bacteria that causes :
-human disease and significant worldwide economic loss due to infection of livestock by
Brucelosis .
- in wild animals it causes late gestation abortion in pregnant females
The Brucella cell wall consists of a peptidoglycan layer strongly associated with the outer
membrane. The molecular characterization of several of these outer membrane proteins
(OMPs) has been reported over the past years.
Outer membrane proteins (OMPs)
• Several Brucella Outer membrane proteins (OMPs) have been characterized in the
past several years. One of these proteins is the 16-kDa OMP, named Omp16.
•
Omp16 is a lipoprotein that it is exposed at the bacterial surface (Tibor et al.1999)
and found in all biovars of B. abortus, B. melitensis, B. suis, B. canis, B. ovis, and B.
neotomae (Pasquevich et al.,2009).
• It is confirmed that Omp16 as a lipoprotein activates monocytes, inducing the
production of proinflammatory cytokines (Ibañezet al., 2013).
Introduction cont...
• In humans, brucelosis causes fever, resembling to a flu-like illness.
DEFENSE MECHANISM
• Although both Ab- and cell-mediated immune responses can influence the
course of infection with Brucella, also IFN-g (cytokine) plays a central role in
acquired resistance against Brucella, by up-regulating macrophage microbial
killing.
• Because brucellosis has serious medical and economic consequences,
prevention of animal infection by vaccination is key.
Current prevention of brucellos
• All commercially available
brucellosis vaccines are based on
live, attenuated strains of Brucella.
• Although effective, these vaccines
have disadvantages:
o they can be infectious for humans;
o they can interfere with diagnosis;
o they may result in abortions when administered to
pregnant animals; and
o the vaccine strain can spread in the region
Currently, no vaccine against human
brucellosis is available
Possible vaccines ….
• Therefore, improved vaccines that
combine safety and efficacy to all
species at risk need to be designed.
• Several trials have been made to
develop a vaccine without these
drawbacks, a vaccine that would be
more effective and safer than those
used at present !
• Subunit vaccines, like recombinant
proteins, are promising vaccine
candidates, because they can be
produced at high yield and purity
and can be manipulated to
maximize desirable activities and
minimize undesirable ones.
However, despite these advantages, Subunit vaccines tend
to be poorly immunogenic in vivo, and require the
adjuvants that indirectly enhance the immune response
against recombinant proteins
Therefore, an oral vaccine could be a promising candidate to control the disease
or to enhance the immune protection provided by currently available vaccines
• It was reported that B. abortus Omp16 confers protection against a challenge
with virulent B. abortus when administered intraperitoneal (i.p.)with
systemic adjuvants (IFA or aluminum hydroxide) or orally with a mucosal
adjuvant (cholera toxin) (Pasquevich, K. et al.,2009)
Karina A. et al. in 2010, showed that a potential subunit vaccine U-OMP16
elicit a protective immune response without the need of external adjuvant.
U-OMP16, expressed in Nicotiana benthamiana, induced a protective
immune response against a challenge with virulent B. abortus when given
to mice without external adjuvants, indicating that Omp16 lipoprotein has
an intrinsic adjuvanticity.
Objectives
• The initial objective of this study was the transformation of Arabidopsis thaliana via
Agrobacterium tumefaciens , to express and then to verify the expression of U-OMP 16
in this plant.
• Due to the time limitation to finish the project completely within this academic year,
transformation of A.thaliana can not be done within this timeframe , but it will be
completed within the following 2-3 months.
• This thesis was supported and granted with the essential chemicals by IUS, as being
the first project of this kind in our labs.
Materials
• Brucella genomic DNA (received from University of Ankara in Turkey,
Department of General Biology, Dr. Adiguzel)
• Arabidopsis thaliana seeds, ecotype Col-O (from Agricultural Biotechnology
Centre, Szent-Gyorgyi, Hungary , Dr.Nyiko Tunde)
• Agrobacterium tumefaciens, strain GV3101 (from Agricultural Biotechnology
Centre, Szent-Gyorgyi, Hungary , Dr.Nyiko Tunde)
• Ecoli DH5α cells (provided by prof. Mirza Suljagic)
• pBI101.1 plasmid (from : Arabidopsis thaliana research center)
Methods and Results
Cultivation and maintenance of
Arabidopsis thaliana seeds stock
• Arabidopsis thaliana, ecotype Columbia (Col) was used as wild type
• Seeds are sterilizes with 70% ethanol for 5 min following an in 10 % (v/v) bleach
containing 0.1% (v/v) Triton X for 15 minutes.
• One month prior transformation, approximately 10 pots (12x6x4 cm) shall be
prepared and for each pot up to 15 seeds.
• The pots are placed for three days in a cold room or +4 fridge to to break the
dormancy phase
• Than, I placed the pots into the Growth Chamber (16h night, 8h light, 22C
120mmol/m2x sec)- and leave it for one month to grow .
• When the plants have just bolted and began to flower they are ready for
transformation , so to increase the transformation efficiency, 3-4 days before
transformation we trim off the main inflorescence shoots as soon as they have
grown to ensure the secondary shoot formation .
Arabidopsis thaliana grown in IUS laboratory growth chamber
Brucella abortus genomic DNA
• Due to the lack of Biosafety II level in the Genetics and Bioengineering labs at
IUS, the genomic DNA from Brucella abortus was isolated and obtained from
the University of Ankara in Turkey, Department of General Biology.
• The B.abortus genomic DNA was isolated from positive tested Eastern Red
cow milk samples, located in the Eastern Anatolia Region of Turkey. These
cows had a history of abortion (Arasoglu et al., 2013).
Working with Agrobacterium tumefaciens , strain GV3101
The A.tumefaciens (GV3101) bacterial cells were received in LB agar plate ( with the
appropriate antibiotics for selection – see table 1). Bacterial cells were picked from the solid
LB medium by scratching the sterile loop across the surface of the cultures.
New cells were grown in LB medium at 30C overnight and stored as glycerol stock for
long storage ,for short storage I prepared LB plates. In addition competent cells were made
using CaCl2 method.
Working with DH5 α E.coli cells
• Empty DH5α cells were grown in LB medium at 37C overnight.
• DH5 α cells harboring the pBI101.1 plasmid were treated very same as the
empty DH5 α cells just with appropriate antibiotics (Kanamycine)
o The vector pBI101.1, was received as a bacterial stab in a 2 ml micro centrifuge tube in LB agar.
o According the study from 1987 (Richards Jefferson) the pBI101.1 plasmid initially was
thought to be of 12.2 kb a
o In the later study, conducted by P.Y Chen et al. in 2003 on the pBI121 vector he proved that
that the plasmid pBI121 has the size of 14.758bp
o Plasmid pBI101.1 is the same as pBI121 but only without the CaMV 35S promoter.
o Using a trial version of SnapGene software I have designed the pBI101 plasmid.
Figure 2: Circular map of vector pBI101.1 designed with SnapGene tool.
- pBI101.1 plasmid extraction from DH5 α cells was done with the
QIAGEN Plasmid plus Midi kit , the final volume was 250 µl.
The isolated plasmid was run on 0.8 % agarose gel and compared to 1kb
marker for its size. Dilutions were prepared, 0.1µl, 0.5µl, 1µl and 2µl
respectively. The expected bands of 13.290bp each is clearly seen of figure
shown below.
-
Agarose gel electrophoresis of pBI101.1 product
- In addition, DNA – plasmid quantification with UV/VIS spectrophotometer
was done to check the plasmid concentration
The measurement was done with Lambda 25 Perkin Elmer UV/VIS spectrophotometer , diluting our sample 100 X
with dH2O. 10µl of isolated plasmid was added to 990 µl dH2O. Formula used to calculate the 260:280
concentrations is the following:
Unknown mg/ml = 50 mg/ml x Measured A260 x dilution factor
The OD reading showed 0.1 A. The dilution factor is 100 .The following concentration was measured:
pB101.1 mg/ml = 50 mg/ml x 0.1 x 100 = 500 µg/ml or 500 ng/µl, resulting in a final concentration of 0.5 µg / µl.
PCR amplification of insert
Table 2: PCR mix
COMPONENTS
No. of
CYCLES
VOLUME
PCR STEPS
TEMPERATURE
DURATION
Taq polymerase buffer(10X)
5 μl
Initial
Denaturation
95°C
2 minutes
MgCl2 (25 mM)
5 μl
Denaturation
94°C
30 seconds
dNTPs (10mM)
1 μl
Annealing
60°C
1 minute
Primer forward (10μΜ)
1 μl
Primer elongation
72°C
1 minute
Primer reverse (10μΜ)
1 μl
Final elongation
72 °C
5 minutes
1x
DNA template (0.5 ng/μl)
1 μl
Hold
4°C
Forever
∞
Taq Polymerase (5 U/μl)
0.5 μl
ddH2O
35.5 μl
Total volume 50 μl
38 cycles
Table 3: Oliginucletide primers used for this study
Primer names
uOMP16 (insert)
Primer Sequence (5 ---˃ 3)
F:
CGAAGCTTATGTGCGTCAAAGAAGAACCTTCCG
R:
CTTCTAGATTAGTGATGGTGATGATGATGCCGTCCGGCCCCGTTGTT
R2: CTTCTAGATTACCGTCCGGCCCCGTTGAGAACGGT
Omp25 (control)
F:
ATGCGCACTCTTAAGTCTC
R:
GCCGAGGATGTTGTCCGT
Note : The uOMP16 R1 primer included also the histidine 6x tag
Omp25 protein is encoded by a nucleotide sequence of 490bp (Arasoğlu et al., 2013)
PCR amplification results of OMP25 and uOMP16
1kb
--
omp25
uOMP16
490bp
432bp
1% agarose gel
Restriction digest of pBI101.1 vector and insert
• During the vector restriction digest we are
incubating our plasmid and insert with a pair of
restriction enzymes, Hind III and XbaI that cut our
DNA material produce DNA molecules with sticky
ends.
• Double digestion is used with SB buffer, where the
activity of HindIII is 100% and 75%-100% of XbaI,
respectively.
Restriction mix:





11µl dH2O
5 µl SB buffer
30 µl of plasmid (pBI101) or insert
2 µl Hind III
2 µl XbaI
Total reaction volume: 50 µl
Left for incubation for minimum 2h at 37C
Ligation
• During the ligation step we have mixed the linearized vector and the inert together
by adding T4 ligase which fuses their ends to form a circular plasmid.
• For the negative control we did not add the insert to the ligation mix.
• For the vector-insert ratio we have compared the digested vector and plasmid on 1%
agarose gel by length and the general thickness of bands. In addition, the ratio of
insert to vector was also determined according the concentration of vector and insert
determined by spectrophotometer quantification of digested plasmid and insert.
• The insert – vector mass ratio was calculated according the following formula:
𝒏𝒈 𝒐𝒇 𝒗𝒆𝒄𝒕𝒐𝒓 𝑿 𝒌𝒃 𝒐𝒇 𝒊𝒏𝒔𝒆𝒓𝒕
𝒊𝒏𝒔𝒆𝒓𝒕
𝑿 𝒎𝒐𝒍𝒂𝒓 𝒓𝒂𝒕𝒊𝒐
𝒌𝒃 𝒐𝒇 𝒗𝒆𝒄𝒕𝒐𝒓
𝒗𝒆𝒄𝒕𝒐𝒓
Table 3:Ligation mix
Minus control
1:3 ratio
1:6 ratio
Volume
Volume
Volume
dH2O
16 µl
13 µl
10 µl
T4 ligase buffer
2 µl
2 µl
2 µl
Vector (900ng/µl)
1 µl
1 µl
1 µl
Insert (800ng/µl)
No
3 µl
6 µl
T4 ligase
1 µl
1 µl
1 µl
Total
20 µl
20 µl
20 µl
Component
Ecoli DH5 α transformation
For the transformation new competent DH5α cells were prepared using ice cold CaCl2 method
Transformation was done using Heat Shock method:
For the transformation of E.coli DH5α cells the ligation product (20 μl) was mixed with a 100μl aliquot of
competent cells and left for 30 minutes for incubation on ice.
After the incubation time the mix is exposed to 42°C in water bath for 1 min and transferred on ice for 2 to 3
min.
400 μL of LB medium (no antibiotics) are added and bacteria are incubated for 1h in a 37°C water bath.
Bacteria are then plated onto agar plate (with kanamycine) and incubated overnight at 37°C (Hanahan et al.,
1983).
Around 200 bacterial colonies
1:3 ligation plate
Around 40 bacterial colonies
1:6 ligation plate
• For verification of transformation plasmid DNA was isolated from several
bacterial colonies.
• Randomly picked 12 bacterial colonies from 1: 3 plate were previously grown
overnight in 3 ml liquid LB medium with appropriate antibiotics at 37C.
• Plasmid DNA was isolated with plasmid miniprep DNA extraction kit from
Invitrogen.
• The isolated plasmid DNA, named as pBI101:uOMP16, was firstly run on
PCR to check for our insert with the primer we have used for our insert
amplification from Brucella genomic DNA
__
PCR amplification of the insert from our plasmid
construct
• In addition the isolated plasmid will be digested with HIND III and XbaI in
total reaction volume of 30µl and left for incubation 2.5h.
• The products will evaluated under UV lamp on 1% agarose gel, where we
expect two bands, one for plasmid (13.922bp) and the other insert (432bp)
Methods left to be completed for this
project – prospective
• Agrobacterium tumefaciens transformation by freeze-thaw methods
• Arabidopsis thaliana transformation by floral dip method
• Expression pattern visualization
Agrobacterium tumefaciens transformation by
freeze-thaw methods
• Freeze thaw-method (Holsters M. et al., 1987) , similar to heat shock method,
using 20mM CaCl2 and dry ice or liquid nitrogen to freeze the cells.
Floral dip
• Transformed Agrobacterium strain GW301 is re-suspended to a freshly made infiltration
media. Infiltration media contains :
10mM MgCl2, 5% sucrose, 0.44mM 6-benzyladenine (BA), 0.3% silwet L-77, 1x Gamborg s vitamin
solution and autoclaved water.
• Dip the plants into the solutions (infiltration media and agrobacterium with our plasmid) –
each pot with our plant is kept minimum for 5 minutes
• Plants are grown in growth chamber for minimum 3 weeks and wait for the seed
germination
• Seeds are collected and sterilized, placed on MS medium plates containing kanamycine
(5000 seeds per MS plate)
• Put the MS plates (with the seeds) to growth chamber and wait for 2 weeks.
• Transgenic plants stay green ,they are bigger and develop true leaves compared to the nontransgenic seedlings, which turn to dark green and eventually die
Arabidopsis thaliana transformation- Floral
dip method
Liu Z., et al., 2010.
Examination of expression
• Staining is done with X-Gluc
(a substrate for GUS ) resulting in a
dark-blue insoluble cleavage
product.
• Fix the tissue with a FAA fixative.
• Visualize with a microscope
attached to a digital camera or store
the samples at 4C for later use.
Liu Z., et al., 2010.
Short discussion for the current work done by today
•
•
In this project initially we planed to express U-OMP 16 in Arabidopsis thaliana leaves and to verify the expression levels by
the beginning of 2014 ∕ 2015 academic year.
Unfortunately I have not been able to complete all the planned activities, some of the reason may be as follows:
 The project idea came into existence in September 2013, the materials (bacterial cells, Arabidopsis thaliana seeds,
agrobacterium tum. cells and the pBI101 plasmid) took more then 6 months to arrive to our university.
 My wish was to do the project fully in IUS laboratory facilities , even though I had to improvise in order to complete some
of the methods. The setup of the laboratories took some time.
 Technical reasons made this project to prolong for almost more then 2 months. For example the received pBI101 plasmid
cells were not viable after two months of storage in -20C. Needed to order again and it took around a month to arrive from
USA.
 Initial primer set for PCR didn’t work , more the 10 PCR with different annealing temperature were done but the insert
could not be amplified. This took me more then a month. Later on my mentor designed new reverse primer (without
histidine 6x taq sequence) and the PCR worked from the first try. To receive the new primer I have waited around 3 weeks.
 Lastly , the Arabidopsis thaliana plants were grown almost 6 months in our growth chamber , 24 ∕ 7. Seeds were collected
and stored at room temperature in paper towels. The plants planed for the transformation suddenly died out 2 weeks ago
and new plant need to be grown for the transformation, in order to be transformed the plants have to grow 6 more weeks.
Short conclusion
• This work can serve as a an important step for the later study, that may include
functional in vitro and in vivo assays. Therefore, the final project results expected
are in vitro activity of U-OMP 16 protein in Arabidopsis thaliana, the stimulation of
DC (Dentritic cells) cells and microphages as it is already proven in the Nicotiana
benthamiana plant.
• These studies will set the fundament in the development of a plant based vaccine, by
expressing U-OMP16 protein in our plant. It is expected, if administrated orally, to
boost immune response, and therefore represent an excellent treatment in the
control of Brucellosis.
Some of the References
• Karina A. et al., 2010.The Protein Moiety of Brucella abortus Outer
Membrane Protein 16 Is a New Bacterial Pathogen-Associated Molecular
Pattern that activates Dendritic Cells In Vivo, Induces a Th1 Immune
Response and Is a Promising Self-Adjuvanting Vaccine against Systemic and
Oral Acquired Brucellosis.J Immunol , 184:5200-5212
• Guillermo H. et al., 2004. Lipoproteins, Not Lipopolysaccharide, Are the Key
Mediators of the Proinflammatory Response Elicited by Heat-Killed Brucella
abortus.J Immunol , 173:4635-4642;
• Sylvestre Marillonnet wet al., 2004.In planta engineering of viral RNA
replicons: Efficient assembly by recombination of DNA modules delivered by
Agrobacterium. PNAS: 101 (18) 6852–6857.