Database Searching
BLAST and FastA
Database Homology Searching
• Use algorithms to increase efficiency and
provide a mathematical basis for searching
which can be translated into statistical
significance
• Assumes that sequence, structure and
function are interrelated.
• BLAST (Basic Local Alignment Tool) and
FastA (Fast Alignment)
• These are heuristic methods approximating
Smith Waterman
What is a Heuristic Method?
• Many problems in Artificial
Intelligence are optimization
problems.
• An approximation (or heuristic)
search method does not mean that
the search algorithm will find a wrong
solution.
• If a solution is found, that solution is
guaranteed to be valid, but it may not
be optimal.
BLAST
• The BLAST algorithm was written
balancing speed and increased sensitivity
for distant sequence relationships.
• Instead of relying on global alignments
(commonly seen in multiple sequence
alignment programs) BLAST emphasizes
regions of local alignment to detect
relationships among sequences which share
only isolated regions of similarity.
BLAST
• Blast creates a list of all short
sequences (words) that have a certain
“threshold” score when compared
with the query sequence.
• These are 16-256 nucleotides or 3
amino acids in a row.
• Then the database is searched for
occurrences of these words.
• Find this in BLAST algorithm
Parameters
BLAST
Speed is achieved by:
– Pre-indexing the database before the
search
– Parallel processing
• Uses a hash table that contains
neighborhood words rather than just
random words.
Neighborhood words
• The program declares a hit if the word
taken from the query sequence has a score
>= T when a scoring matrix is used.
• This allows the word size (W (this is similar
to ktup value)) to be kept high (for speed)
without sacrificing sensitivity.
• If T is increased by the user the number
of background hits is reduced and the
program will run faster
Comparison Matrices
In general, the BLOSUM series is thought to be superior to
the PAM series for detecting evolutionarily distant
sequences to the because they are derived from areas of
conserved sequences.
It is important to vary the parameters when performing a
sequence comparison. Similarity scores for truly related
sequences are usually not sensitive to changes in scoring
matrix and gap penalty.
Thus, if your “hits list” holds up after changing these
parameters you can be more sure that you are detecting
similar sequences.
High Scoring Pairs
BLAST
• Matching words are extended into
ungapped local alignments between
query sequence and the database
sequence.
• Extensions are scored until the
alignment score drops below a
threshold.
• The maximal-scoring segment pairs
(MSPs) are combined where possible
into local alignments.
Statistical Significance of
Sequence Comparisons
• Assess the statistical significance of
a particular global alignment by
generating many random sequence
pairs of the appropriate length and
composition, and calculating the
optimal alignment score for each.
BLAST Statistics
• A local alignment without gaps consists
simply of a pair of equal length segments,
one from each of the two sequences being
compared.
• A modification of the Smith-Waterman or
Sellers algorithms finds segment pairs
whose scores can not be improved by
extension or trimming.
• These are called high-scoring segment
pairs or HSPs.
Local Alignment Statistics
• Fortunately statistics for the scores
of local alignments, unlike those of
global alignments, are well
understood.
• This is particularly true for local
alignments lacking gaps, which we will
consider first.
• Such alignments were precisely those
sought by the original BLAST
database search programs.
Two BLASTs
• WU-Blast and NCBI Blast.
• Both have some versions in the public
domain, but there are private versions of
WU Blast.
• TIGR, Berkeley Drosophila Genome and
Stanford’s yeast genome use WU-Blast
• WU-Blast may be better for searching
genomic sequences- different gap scoring
and repeat policies.
Scoring Matrix
• The most critical parameter in sequence
comparison is definitely the choice of a scoring
matrix.
• Scoring matrices reflect the knowledge about
the objects which constitute the sequences.
• The algorithm regard sequences merely as a
list of symbols.
• The meaning of the symbols for the application
and their properties with regard to mutual
similarity is merely represented by the
content of the scoring matrices.
A Good Scoring Matrix Site
• http://www.techfak.unibielefeld.de/bcd/Curric/PrwAli/node
D.html#wm2
Log-Odds-Matrix
• Frequently scores are calculated as
log-odds-ratios which are based on
the comparison of frequencies in
sequences having the property to be
studied and random frequencies.
BLOSUM 62 is the default matrix
in BLAST 2.0.
• You can select a different matrix for
your Blast search.
• Though it is tailored for comparisons
of moderately distant proteins, it
performs well in detecting closer
relationships.
• A search for distant relatives may be
more sensitive with a different
matrix.
BLOSUM 62
• The BLOSUM 62 matrix shown here is a 20 x
20 matrix of which a section is shown here in
which every possible identity and
substitution is assigned a score based on the
observed frequencies of such occurrences in
alignments of related proteins.
• Identities are assigned the most positive
scores.
• Frequently observed substitutions also
receive positive scores and seldom observed
substitutions are given negative scores.
BLAST
• BLAST is more than a tool to view
sequences aligned with each other or
to calculate percent homology, but a
program to locate regions of sequence
similarity with a view to comparing
structure and function.
BLASTP
• Compares an amino acid query
sequence against a protein sequence
database.
BLASTN
• Compares a nucleotide query sequence
against a nucleotide sequence
database.
BLASTX
• Compares a nucleotide query sequence
translated in all reading frames
against a protein sequence database.
• You could use this option to find
potential translation products of an
unknown nucleotide sequence.
TBLASTX
• Compares the six-frame translations
of a nucleotide query sequence
against the six-frame translations of
a nucleotide sequence database.
• The tblastx program cannot be used
with the nr database on the BLAST
Web page because it is
computationally intensive.
TBLASTN
• Compares a protein query sequence
against a nucleotide sequence
database dynamically translated in all
reading frames.
• We can try this search with this
sequence: Hadrurin
GILDTIKSIASKVWNSKTVQDLKRKG
INWVANKLGVSPQAA
PHI-BLAST
• Pattern Hit Initiated Blast
• PHI-Blast uses protein motifs to
increase the chance of finding
biologically significant matches.
PSI-BLAST
• Position Specific Iterative Blast
• PSI-Blast uses an iterative alignment
procedure to develop position specific
scoring matrices which increases its
capability to detect weak pattern
matches.
FastA Format
• A sequence in FASTA format begins
with a single-line description,
followed by lines of sequence data.
• The description line is distinguished
from the sequence data by a greaterthan (">") symbol in the first column.
• It is recommended that all lines of
text be shorter than 80 characters in
length.
Evaluating Blast Results
• A Blast search can produce dozens or
hundreds of candidate alignments.
• Out of these alignments, which are
really specific?
• Raw Scores, Bit Scores and E-values
are used as statistics.
Raw Scores
• Raw scores are the sum of scores of the
MSPs that make up the alignment.
• Because of differences between scoring
matrices, they are not always directly
comparable.
• The raw score S for an alignment is
calculated by summing the scores for each
aligned position and the scores for gaps.
• In this figure, a DNA alignment is shown.
In amino acid alignments, the score for an
identity or a substitution is given by the
specified substitution matrix
Bit Scores
• Bit scores are raw scores converted
from the log base of the scoring
matrix that creates the alignment to
log base 2.
• This rescaling allows scores to be
compared between the alignments.
E-values
• E-values (Expect values) provide
information about the likelihood that
a given sequence alignment is
significant.
• The smaller the E-value, the less
likely the alignment was by chance.
• At some point, you are just
generating random junky data- unless
you have other information like a
structural comparison.
FASTA
• Another method for local sequence
alignment.
• Maintained by Dr. William Pearson at
the University of Virginia.
• http://www.infobiogen.fr/doc/Fasta/
docfasta.html
FASTA (Pearson and Lipman 1988)
• This is a combination of word search and
Smith-Waterman algorithm
• The query sequence is divided into small
words of certain size.
• The initial comparison of the query
sequence to the database is performed
using these “words”.
• If these “words” are located on the same
diagonal in an array the region surrounding
the diagonals are analyzed further.
• Search time is only proportional to size of
database not (database*query sequence)
FASTA Algorithm
• FASTA ktups are shorter than
BLAST words.
• 1-2 for proteins and 4-6 for nucleic
acids.
• Lower ktups give a more slower, more
sensitive search.
• Higher ktups give a faster search
with fewer false positives.
The FASTA program is the uses Hash tables.
These tables speed the process of word search.
Query Sequence
= TCTCTC
123456 (position number)
Database Sequence = TTCTCTC
1234567 (position number)
You choose to use word size = 4 for your
table (total number of words in your table is
44 = 256)
?
Sequence (total
of 256)
TCTC
CTCT
TTCT
Position w/in query
1,3
2
Position w/in DB
2,4
3
1
Offset (Q minus DB)
-1 or -3 or 1
-1
FASTA Steps
Different offset values
1
2
Identical offset
values in a
contiguous sequence
Diagonals are extended
Local regions of
identity are found
3
Eliminate short diagonals
below a cutoff score
Rescore the local regions
using PAM or Blos. matrix
4
Create a gapped alignment in
a narrow segment and then
perform S-W alignment
Summary of FASTA steps
1. Analyzes database for identical matches that are
contiguous (between 5 and 10 amino acids in length
(same offset values)).
2. Longest diagonals are scored again using the PAM
matrix (or other matrix). The best scores are saved
as “init1” scores.
3. Short diagonals are removed.
4. Long diagonals that are neighbors are joined. The
score for this joined region is “initn”. This score may
be lower due to a penalty for a gap.
5. A S-W dynamic programming alignment is performed
around the joined sequences to give an “opt” score.
Thus, the time-consuming S-W step is performed only
on top scoring sequences
The ktup value
•The ktup (for k-tuples) value stands for the length of
the word
used to search for identity.
•For proteins a ktup value of 3 would give a hash table of
203
elements (8000 entries).
•The higher the ktup value the less likely you will get a
match unless it is identical (remember the dot plots).
•The lower the ktup value the more background you will
have The following rules typically apply when using FASTA:
•The higher the ktup value the faster analysis (fewer
diagonals).
Gap Penalties
• If too high a gap penalty is used
relative to the range of scores in the
substitution matrix, then gaps will
never appear in the alignment.
• Conversely, if the gap penalty is too
low compared to the matrix scores,
then gaps will appear everywhere in
the alignment in order to align as
many of the same characters as
possible.
ktup analysis____________________
1 proteins- distantly related
2 proteins- somewhat related (default)
3 DNA-default
FASTA Versions
FASTA-nucleotide or protein sequence searching
FASTx/-compares a translated DNA query sequence
FASTy to a protein sequence database (forward
or backward translation of the query)
tFASTx/-compares protein query sequence to
tFASTy DNA sequence database that has been
translated into three forward and three
reverse reading frames
FASTA Statistical Significance
A way of measuring the significance of a score considers
the mean of the random score distribution.
The difference between the similarity score for your
single alignment and the mean of the random score
distribution is normalized by the standard deviation of
that random score distribution.
This is the Z-score.
Higher Z-scores are better because the further the real
score is from this mean (in standard deviation units) the
more significant it is.
FASTA Statistical Significance
Z score for a single alignment=
(similarity score - mean score from database)
standard deviation from database
Stand. Dev. =

2
(
scores)
 scores2 Total#ofSequences
Total#ofSequences
Mean similarity scores
of complete database
Mean similarity scores
of related records
FASTA Statistics (cont.)
Using the distribution of the z-scores in the database,
the FastA program can estimate the number of sequences
that would be expected to produce, purely by chance, a zscore greater than or equal to the z-score obtained in the
search.
This is reported as the E() or expect value.
This value is the number of sequences you would expect to
find with this score by searching a database of random
sequences.
Thus, when z the E()
Evaluating the Results of
FASTA
Best
SCORES
Init1: 2847 Initn: 2847 Opt: 2847
z-score: 2609.2 E(): 1.4e-138
Smith-Waterman score: 2847; 100.0% identity in 413 overlap
Good
SCORES
Init1: 719 Initn: 748 Opt: 793
z-score: 734.0 E(): 3.8e-34
Smith-Waterman score: 796; 41.3% identity in 378 overlap
Mediocre
SCORES
Init1: 249 Initn: 304 Opt: 260
z-score: 243.2 E(): 8.3e-07
Smith-Waterman score: 270; 35.0% identity in 183 overlap
Which Program should one use?
• Most researchers use methods for
determining local similarities:
– Smith-Waterman (gold standard)
– FASTA Do not find every possible alignment
of query with database sequence. These
– BLAST
are used because they run faster than
}
S-W
When to use the correct program
Problem
Program
Explanation
Identify
Unknown
Protein
BLASTP;
FASTA3
General protein
comparison. Use ktup=2
for speed; ktup=1 for
sensitive search.
Smith-Waterman
Slower than FASTA3
and BLAST but provides
maximum sensitivity
TFASTX3;TFASTY3;
TBLASTN
Use if homolog cannot
be found in protein
databases; Approx. 33%
slower
Psi-BLAST
Finds distantly related
sequences. It replaces
the query sequence with
a position-specific score
matrix after an initial
BLASTP search. Then it
uses this matrix to find
distantly related
sequences
When to use the correct program (cont. 1)
Problem
Program
Explanation
Identify
new
orthologs in closely
related species
TFASTX3;TFASTY3
TBLASTN:TBLASTX
Use PAM matrix <=20 or
BLOSUM90 to avoid detecting
distant relationships. Search
EST sequences w/in the same
species.
Identify
EST
Sequence
FASTX3;FASTY3;
BLASTX;TBLASTX
Always attempt to translate
your sequence into protein
prior to searching.
Identify
DNA
Sequence
FASTA;BLASTN
Nucleotide sequence
comparision
TBLASTX-nucleotide query-translated nucleotide DB
BLASTX-nucleotide query-protein DB
Choosing the database
• Remember that the E value increases
linearly with database size.
• When searching for distant relationships
always use the smallest database likely to
contain the homolog of interest.
• Thought problem: If the E-value one
obtains for a search is 12 in Swiss-PROT
and the E-value one obtains for same
search is 74 in PIR how large is PIR
compared to Swiss-PROT?
74/12 = ~6
Filtering Repetitive Sequences
• Over 50% of genomic DNA is repetitive
• This is due to:
–
–
–
–
–
retrotransposons
ALU region
microsatellites
centromeric sequences, telomeric sequences
5’ Untranslated Region of ESTs
Example of ESTs with simple low complexity regions:
T27311
GGGTGCAGGAATTCGGCACGAGTCTCTCTCTCTCTCTCTCTCTCTCTC
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC
Filtering Repetitive Sequences
(cont. 1)
Programs like BLAST have the option of
filtering out low complex regions.
• Repetitive sequences increase the
chance of a match during a database
search