DNA STUDY GUIDE KEY
1.Explain the research of the following scientists:
 Griffith: injected mice with bacteria. The
bacteria caused the transformation that
allowed the mice to die of pneumonia. The
DNA was transformed. Know the picture from
the notes.
 Avery: discovered DNA and genes. DNA is
the transforming factor.
 Hershey and Chase: they wanted to see what
causes a virus. Results-DNA in the virus
causes the infection.
1.Explain the research of the following scientists:
 Franklin and Wilkins: Rosalind Franklin used
x-rays to take pictures of the DNA structure.
DNA has an X shape.
 Watson and Crick: credited for the structure
of DNA. Discovered that DNA have a double
helix structure. Stole Rosalind’s information.
 Chargaff: Discovered a pattern between the
four bases. Guanine = Cytosine and Adenine =
Thymine. (AT Grover Cleveland)
What is the role DNA?
 The role of DNA is to hold genetic material.
What is a nucleotide and what are the three
parts to it?
 A nucleotide is the single unit or monomer of
a nucleic acid. The three parts are sugar,
phosphate group and a nitrogenous base.
What two nitrogenous bases are purine?
Pyrimidines?
 Purines = Adenine and Guanine
 Pyrimidines = Cytosine and Thymine
List the steps to DNA replication.
 Helicase unzips DNA – the two strands
become templates
 DNA polymerase adds new base pairs to
bond with complementary strands
 The DNA bases bonds together and they
have two semi-conservative strands.
What do the following enzymes do during
DNA replication?
 Helicase - unzips DNA
 DNA polymerase – bonds to a promoter and
adds new bases to the template strand.
What are the three differences between RNA and DNA?
 RNA has ribose and DNA has deoxyribose
 RNA is single stranded and DNA has two
 RNA uses Uracil and DNA uses Thymine
What are the three types of RNA used during protein
synthesis and explain their function? mRNA, tRNA,
rRNA
 mRNA = messenger RNA; makes a copy of the
template from DNA (recipe)
 tRNA = transfer RNA; transfers amino acids to the
ribosome
 rRNA = ribosomal RNA; factory of the protein
synthesis, makes up the ribosome.
What is a codon and where is it found?
 A codon is a three letter sequence found in mRNA.
What is an anti-codon and where is it found?
An anti-codon is the opposite of a codon found
on a tRNA molecule.
What is transcription? Where does it take
place?
Transcription = takes place in the nucleus and is
the process of DNA coding for RNA.
What needs to be added to the mRNA strand
before it can leave the nucleus and go to a
ribosome in the cytoplasm?
mRNA strand needs a cap and tail to leave the
nucleus.
What is translation? Where does it take
place in the cell?
 Translation is the process of RNA coding
for a protein that takes place on a ribosome
in the cytoplasm.
Write the mRNA strand for this DNA
strand:
TACGGCATGAACGTAGCTAGCACT.
 The mRNA strand is
AUGCCGUACUUGCAUCGAUCGUGA
What are the amino acids that correspond
to the mRNA strand you just made?
 Codons = AUG-CCG-UAC-UUG-CAUCGA-UCG-UGA
 Amino acids = Met-Pro-Tyr-Leu-His-ArgSer-STOP