Comparison of Inhibitory Effect Against Streptococcus mutans Growth by Dental
Plaque Bacteria from Early Childhood Caries and Caries-free Children
Nuttorn Opaswanich1,*,#, Waleerat Sukarawan2, Anjalee Vacharaksa3
1
DDS, Master of Science Program, Department of Pediatric Dentistry, Faculty of Dentistry,
Chulalongkorn University, Bangkok, Thailand
2
DDS, PhD, Lecturer, Department of Pediatric Dentistry, Faculty of Dentistry,
Chulalongkorn University, Bangkok, Thailand
3
DDS, PhD, Lecturer, Department of Microbiology, Faculty of Dentistry, Chulalongkorn
University, Bangkok, Thailand
*,#e-mail: pamdent006@gmail.com
Abstract
Bacterial interaction in dental plaque bacteria can influence the oral health status of
individual. Studies have shown that Streptococcus mutans is major species in cultivable
plaque bacteria from children with early childhood caries. On contrary, protective bacteria
such as Streptococcus sanguinis, an early colonizer, is more frequently isolated from children
with no caries. These observations suggest that the change in dental plaque environment may
contribute to the virulent of bacteria and competitive growth in dental biofilm might play a
role in modulating the caries status. The objective of this study was to investigate the
inhibitory effect against S. mutans growth by dental plaque bacteria from caries-free children
compare to early childhood caries children using interspecies interaction assay. The
prevalence of S. mutans and S. sanguinis were also investigated. Participants were 20 cariesfree and 20 early childhood caries children. Dental plaque was collected from each child and
assessed the inhibitory effect against S. mutans by competition assay. Bacterial DNA was
extracted from the latter part of plaque sample and the presence of S. sanguinis and S. mutans
was determined by endpoint PCR. Our results demonstrated that inhibitory effect against S.
mutans growth showed statistically significant difference between caries-free and early
childhood caries subjects (p=0.008), using Mann-Whitney U test. S. sanguinis was presented
in all subjects. Distribution of S. mutans was significant statistical difference between groups
(p=0.003), using Fisher’s exact test. In conclusion, our results revealed that dental plaque
bacteria from caries-free children has greater inhibitory effect against S. mutans growth when
compare to those from early childhood caries children suggesting even though S. sanguinis
were present in every plaque samples regardless of caries status. This study would give more
evident that the inhibitory effects of early colonizers can be modified and may modulate the
outcome of caries incidence in preschool children.
Keywords: early childhood caries, Streptococcus sanguinis, Streptococcus mutans,
interspecies interactions, inhibitory effect
Introduction
Dental plaque contains large amount of microorganisms which live in a complex
community. These microbes form a “biofilm” that have interspecies or intraspecies
interaction with host and environment [1]. Bacterial composition in plaque is maintained in
balance through synergistic, as well as antagonistic interactions of these bacteria. Significant
change in the oral environment can disturb dental biofilm homeostasis. The shift in balance
caused by the overgrowth of pathogenic bacteria and alteration of the species composition
often lead to disease development as a consequence [2]. For instance, oral streptococci are the
species that predominantly inhabit human oral cavities of humans as commensals. However,
these bacteria can become virulent when the oral environment is changed to imbalance and
cause oral diseases such as dental caries [2, 3]. Numerous studies have demonstrated that
Streptococcus mutans is the primary pathogen that causes dental caries [4, 5]. When plaque
environment is more acidic, S. mutans actively compete with other symbiotic colonizer and
prevail in cariogenic dental plaque [4, 6]. Recent studies have shown that S. mutans was
isolated more frequently from children with early childhood caries (ECC) while early
colonizers, such as Streptococcus sanguinis, Streptococcus oralis and Streptococcus
gordonii, were found at higher prevalence from caries-free (CF) children [7]. ECC is a
severe form of dental caries in preschool children which can affect quality of life in many
aspects [8, 9]. Several factors contribute as the etiology of ECC, including high load of
cariogenic microorganisms. S. mutans regularly exceeded 30% of the cultivable plaque flora
from ECC children while they established less than 0.1% of the dental plaque flora from
children with no caries [4, 10]. This observation suggests that the competitive exclusion
between bacterial species might play a role in modulating the caries status. Studies have also
shown that other oral streptococcal species are able to compete or suppress the growth of
caries-causing pathogens by various mechanisms [1, 11, 12]. S. sanguinis is one of the oral
streptococci that early colonize during the initial stage of dental biofilm formation [13].
Moreover, high levels of S. mutans have been shown in correspond with low levels of S.
sanguinis in oral cavity [14]. Recent reports have indicated that S. sanguinis is an oral healthassociated bacteria and has ability to inhibit S. mutans growth by producing hydrogen
peroxide (H2O2) [11]. These results suggested that alteration in oral environment can
influence the viability and virulent of bacteria in oral biofilm [15], hence the interspecies
relationship in non-carious dental plaque might be vary from the carious ones. The inhibitory
effects of pioneer microbes such as S. sanguinis harvested from oral cavity might differ and
reflect in caries experience. Therefore, the purpose of this study was to investigate the
inhibitory effect against S. mutans (strain ATCC 25175) growth by dental plaque bacteria
from CF children compare to those from ECC children using in vitro competition assay on
solid medium. In addition, we compared the distribution of S. sanguinis and S. mutans from
dental plaque samples between two groups using molecular identification method.
Methodology
Participant selection and data collection
The study protocol was approved by the Human Ethics Committee of the Faculty of
Dentistry, Chulalongkorn University (HREC-DCU 2013-010). Subjects were recruited from
patients who came for dental treatment at the Pediatric dental clinic, Faculty of Dentistry,
Chulalongkorn University, by convenient sampling. Consent was obtained from parents of all
subjects. A total of forty healthy children under 6 year of age with primary dentition were
participated in the study. Subjects were equally divided into 2 groups, CF (dmfs=0) and ECC.
ECC was diagnosed according to the criteria defined by the American Academy of Pediatric
Dentistry [16]. Oral examination was performed by two dentists who already calibrated
(kappa=1). Additional bitewing radiographs were taken to evaluate proximal caries in the
case that proximal contacts could not be clinically visualized. The dmfs scores were recorded.
The child’s socio-demographic characteristics, diet habit, and oral health practices were
assessed through guardian interview and recorded into the data record form.
Samples collection
Dental plaque was collected by swiping the tooth surface with a sterile dental explorer
or spoon excavator, from buccal, lingual, and interproximal surfaces in CF subjects. In ECC
subjects, plaque sample was collected from all smooth surfaces which were intact. Plaque
samples from all surfaces in each subject were pooled in 1.5 ml tube contained 1 ml of sterile
phosphate buffered saline (PBS) solution. Each sample was separated in two parts. The first
part was processed in the Microbiology Laboratory, Faculty of Dentistry, Chulalongkorn
University for the growth competition assay within 2 h. The remaining part was stored at
–20°C until the DNA extraction process.
Competition assay on solid medium
To assess competitive growth between bacteria in dental plaque and S. mutans
laboratory strains, a protocol for competition assay was used with modifications [9]. Briefly,
20 µl of dental plaque sample in sterile PBS was firstly dropped onto Mitis Salivarius agar
(MSA) plate and incubated overnight (16-24 h) under aerobic condition with 5% CO2 at
37°C. After that, 20 µl of S. mutans (strain ATCC 25175) grown in brain heart infusion
(BHI) broth for 48 h was later dropped next to the dental plaque colonies to create the close
proximity between colonies. The plate was incubated overnight (16-24 h) under the specified
condition above. Growth inhibition was assessed by the presence of an inhibition zone at the
proximity of the mixed bacterial colonies from dental plaque. Distance of inhibition zone,
which is the area on an agar plate where growth of S. mutans is prevented by antimicrobial
substances produced by microorganisms in dental plaque dropped on the agar surface (as
shown in the Figure 1A), was measured in millimeters using ruler and compared between two
groups. Experiment was performed in triplicate for each plaque sample.
DNA extraction
DNA from dental plaque samples was extracted from bacterial pellet obtained by
centrifugation at 13,000 rcf for 1 minute at room temperature. After weighing the pellet,
bacterial DNA was extracted using PowerBiofilm™ DNA Isolation Kit (MO BIO
Laboratories, Inc., Carlsbad, CA, USA) according to the manufacturer’s instruction.
NanoDrop2000 Spectrophotometer (Thermo SCIENTIFIC, Wilmington, DE, USA) was used
to quantify DNA.
Bacterial-specific PCR analysis
To verify the presence of S. sanguinis and S. mutans in dental plaque, endpoint PCR
with specific primers were performed. The sequences of S. sanguinis- and S. mutans-specific
primers are listed in Table 1. Each PCR mixture (25μl) consisted of 50ng of DNA template,
12.5μl of TopTaq Master Mix (TopTaq DNA Polymerase, dNTPs, and innovative TopTaq
PCR Buffer; Qiagen, Valencia, CA, USA), 0.4μM of forward and reverse primers. The PCR
mixtures were processed with DNA Engine®Peltier Thermal Cycler (Bio-Rad, Hercules, CA,
USA). PCR cycle consisted of a pre-heating step at 94°C for 3 minutes, denaturation at 94°C
for 30 seconds, annealing at 51°C for 30 seconds, followed by elongation at 72°C for 1
minute. The reaction was performed at 35 cycles, with a final extension at 72°C for 10
minutes. Amplicons were verified on 1.5% agarose gels, stained with ethidium bromide. A
100 base pair DNA Ladder (Invitrogen™, Carlsbad, CA, USA) was used as a marker. Image
results were captured with a digital imaging system (Molecular Imager Gel Doc™ Systems,
Biorad Laboratories Inc., CA, USA).
Statistical Analysis
All data were recorded and then analyzed using SPSS software version 17.0
(SPSS,Inc.,Chicago,USA). For the competition assay, distance of inhibition zone was
presented as mean + standard deviation (mean + SD). Then, the results between two groups
(CF and ECC groups) were compared by test for independent samples. Pearson Chi-square
test was used for analysis of the prevalence of each species between two groups. The p
value ≤ 0.05 was considered statistically significant.
Results
Demographic and clinical characteristic
A total of forty participants were recruited in this study. Participants were divided
equally into two groups, CF (n=20) and ECC (n=20). The age of participants range from 2 to
5.75 years old with the average age (±SD) of CF group was 3.64±1.18 years old and the ECC
group was 3.66±0.72 years old. There was no statistical difference in age and gender between
groups, using T-test for independent samples and Chi-square test. The mean dmfs scores of
ECC group was range from 1 to 82 surfaces with the average of 27.30 ± 21.65 surfaces. In
addition, there was no statistical difference in oral hygiene practice and fluoride use between
groups, using Fisher’s exact test. All the demographic data and clinical characteristics
surveyed were shown in Table 2.
Growth competition on solid medium
The inhibitory effect of dental plaque bacteria against S. mutans (ATCC 25175) were
detected in both CF and ECC groups by the competition assay on MSA plates (Figure 1B).
Interestingly, the dental plaque bacteria from CF group showed greater competitive growth
over S. mutans when compared with those from ECC group. The average (±SD) distance of
inhibition zone at the proximity of mixed bacterial colonies from dental plaque and S. mutans
colonies was 2.61±2.09 mm in CF group and 1.04±1.21 mm in ECC group (Figure 1C).
Statistically significant difference was detected in the distance of inhibition zone between two
groups (p=0.008), using Mann-Whitney U test.
Identification of S. sanguinis and S. mutans in dental plaque by PCR
The endpoint PCR was performed to investigate the prevalence of S. sanguinis and S.
mutans in dental plaque from both groups. The PCR revealed that S. sanguinis can be
detected in both CF and ECC groups. Meanwhile, S. mutans was detected in every dental
plaque samples from ECC group but can be detected only 60% in plaque samples from CF
group. Prevalence of S. mutans were statistically different between CF and ECC groups
(p=0.003) by Fisher’s exact test (Table 3).
Discussion and Conclusion
The participants in this study were recruited from the patient in Department of
Pediatric Dentistry, Chulalongkorn University by convenient sampling in order to reduce the
bias of subject selection. According to the demographic data, regarding age and gender,
together with oral hygiene care data; there was no statistical difference between CF and ECC
groups. The homogeneity of these variables allows us to interpret the study outcome more
focus in the relation of caries status between two groups.
Studies have been shown that other oral streptococci species such as S. gordonii and S.
sanguinis have the mechanisms to inhibit the growth of S. mutans [1, 12]. However, most of
the study using the laboratory strains [11, 12] which the environmental setting greatly differ
from the dental plaque biofilm in oral cavity. Given the fact that alteration in oral
environment can influence the viability and virulent of bacteria in oral biofilm [15], the
interspecies relationship might be modify. To date, our study exhibits the first report that
investigates the inhibitory effect of dental plaque bacteria collected from patient against
laboratory strain of S. mutans. Dental plaque bacteria from CF children have greater
inhibitory effect against S. mutans when compare to ECC children as shown by longer
distance of inhibition zone. Different inhibitory effect between CF and ECC groups may be
influenced by two factors. First, the amount of protective bacterial species or ratio of
protective bacteria to total bacteria in dental plaque may be different between two groups.
Although the level of total bacteria was low in caries-free children, but the protective bacteria
might be the major composition of dental plaque. Therefore, the ratio of health-associated
bacteria to total bacteria should be higher when compared to ECC children and reflects in
greater inhibitory capability. Another factor is the virulence properties or functionality of
bacteria in oral biofilm, especially early colonizers, may be different. The cariogenic
environment in dental plaque tremendously helps promote the virulence of acidogenic or
aciduric bacteria such as S.mutans and might reduce the protective activity of others such as
S. sanguinis. Hence, the inhibitory effect of protective bacteria was diminished even they are
present in the detectable level.
Several molecular studies focused on the distribution of oral streptococci composition
in CF and ECC children [17, 18]. Such information could lead to a better understanding of
the roles of different bacterial species associated with caries experience. Our results were in
accordance with other studies that show the detection of S. mutans in children with no caries
[17, 18] . In this study, 60% of our healthy dental plaque from CF group showed the presence
of S. mutans. These results indicated that virulence of S. mutans was controlled by the
presence of protective competitors. Growth inhibition of S. mutans by early colonizers, S.
sanguinis and S. gordonii, in vitro was reported (11, 12) and our study had shown that the
inhibitory effect might active in oral biofilm from patient as well. Most of the studies using
bacterial count or endpoint PCR to investigate the presence of those species produced similar
results, which was more frequently found of S. sanguinis in CF group [18, 19]. However,
S.sanguinis was found in every samples collected from both groups in this study. The
different results possibly due to the small sample size in this study (n=40) compared to others
[17, 18]. Therefore, identification and quantification of other oral streptococci using realtime
PCR with larger sample size may provide new information on the different distribution of
oral streptococci between CF and ECC children. Although the prevalence of S. sanguinis
was not different between CF and ECC groups, the abundance and relative expression of S.
sanguinis to total bacteria may be detectable by realtime PCR.
In this study, S. sanguinis was more frequently isolated than S. mutans in CF group,
which suggested that S. sanguinis can compete with S. mutans in colonization. Since the
cariogenic potential of S. sanguinis is lower than S. mutans, several studies have suggested
that the ratio of S. mutans to S. sanguinis may be used as an indicative of caries incidence
[20]. Further bacterial quantitation will be needed to confirm the reliability of ratio of S.
mutans to S. sanguinis as individual caries indicator.
In conclusion, our study showed that bacteria in dental plaque from CF children have
greater inhibitory effect against S. mutans compared to those from ECC children. S. mutans, a
primary cariogenic pathogen, were detected in all dental plaque from ECC children and in
60% of CF children whereas S. sanguinis, the protective bacteria, were detected in every
plaque samples regardless of caries incidence. The results of this study give more evidence
that the complex interactions in dental plaque biofilm may have an effect on bacteria
cariogenic potential. Furthermore, the inhibitory effects of early colonizers can be modified
depending on the environment and may modulate the outcome of caries status in preschool
children. Finally, PCR is a sensitive, reliable, and rapid molecular method to identify the oral
streptococci and maybe useful in caries prediction.
Table 1. Specific primer used in this study
Primer name
S. sanguinis
MKP-F
gtfP
MKP-R
Sm479F
S. mutans
Sm479R
Nucleotide sequence (5'-3')
GGATAGTGGCTCAGGGCAGCCAGTT
GAACAGTTGCTGGAC TTGCTTGTC
TCGCGAAAAAGATAAACAAACA
GCCCCTTCACAGTTGGTTAG
Amplicon
(bp)
Ref.
313
[21]
479
[22]
Table2.Demographic and clinical characteristics of the study population
CF (n=20)
ECC (n=20)
p value
3.64 ± 1.18
3.66 ± 0.72
0.949
9 (45%)
11 (55%)
11 (55%)
9 (45%)
0.527
Demographic characteristic
Mean age (years) ± SD
Gender : Male
Female
Clinical characteristic
Mean dmfs ± SD
Other characteristics
27.30 ± 21.65
Frequency of tooth brushing
>1 time/day
Fluoridated toothpaste use
19 (95%)
16 (80%)
0.342
20 (100%)
20 (100%)
1.000
Interproximal cleaning device use
7 (35%)
2 (10%)
0.127
Fluoride supplement intake
3 (15%)
1 (5%)
0.605
Table 3. The prevalence of S. mutans and S. sanguinis in CF and ECC groups
Organisms
S. sanguinis
S. mutans
*Fisher’s exact test
CF (n=20)
ECC (n=20)
Frequency
%
Frequency
%
p value
20
12
100
60
20
20
100
100
1.000
0.003*
A)
Figure 1. Growth competition between mixed bacterial colonies from dental plaque and S. mutans: A) Mixed
bacterial colonies from dental plaque was inoculated first and grown overnight, S. mutans was then inoculated
next to the bacterial colonies from dental plaque, and incubated overnight. Inhibition zone was measured as a
distance between the margin of two colonies. The selected margin must be on the axis that crossed the center of
both colonies (a = center of mixed bacterial colonies from dental plaque, b = center of S. mutans colonies, Dash
line = the axis that crossed the center of two colonies, Thick line = the distance of inhibition zone). B) Growth
competition on Mitis Salivarius Agar (MSA) plates. Growth inhibition of S. mutans in CF group was greater
than those in ECC group. C) Distance of inhibition zone, shown as mean±SD, were statistically different
between CF and ECC groups (P =0.008), using Mann-Whitney U test
Figure 2. Detection of two oral streptococci species in plaque samples from CF and ECC subjects. A) The
PCR was amplified using S. sanguinis MKP-specific primers, representing 313-bpamplicons.Lane M; 100
bp DNA marker; lanes P and N are chromosomal DNA from S. sanguinis (ATCC 10556) and negative
control (distilled water), respectively; lanes 1-22 show PCR products from plaque samples from different
children. B)The PCR was amplified usingS. mutans Sm479specific primers, representing 479-bp amplicons.
Lane M; 100 bp DNA marker; lanes P and N are chromosomal DNA from S. mutans(ATCC 25175) and
negative control (distilled water), respectively;lanes 1-17 show PCR products from plaque samples from
different children.
References
1.
2.
3.
4.
5.
6.
7.
Kuramitsu HK, He X, Lux R, Anderson MH, Shi W. Interspecies interactions within oral microbial
communities. Microbiol Mol Biol Rev. 2007;71:653-70.
Takahashi N, Nyvad B. The role of bacteria in the caries process: ecological perspectives. J Dent Res.
2011;90:294-303.
Kleinberg I. A mixed-bacteria ecological approach to understanding the role of the oral bacteria in dental
caries causation: an alternative to Streptococcus mutans and the specific-plaque hypothesis. Crit Rev Oral
Biol Med. 2002;13:108-25.
Loesche WJ. Role of Streptococcus mutans in human dental decay. Microbiol Rev. 1986;50:353-80.
Becker MR, Paster BJ, Leys EJ, Moeschberger ML, Kenyon SG, Galvin JL, et al. Molecular analysis of
bacterial species associated with childhood caries. J Clin Microbiol. 2002;40:1001-9.
Hamada S, Slade HD. Biology, immunology, and cariogenicity of Streptococcus mutans. Microbiol Rev.
1980;44:331-84.
Munson MA, Banerjee A, Watson TF, Wade WG. Molecular analysis of the microflora associated with
dental caries. J Clin Microbiol. 2004;42:3023-9.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
Slade GD, Spencer AJ, Davies MJ, Stewart JF. Influence of exposure to fluoridated water on
socioeconomic inequalities in children's caries experience. Community Dent Oral Epidemiol. 1996;24:89100.
Gussy MG, Waters EG, Walsh O, Kilpatrick NM. Early childhood caries: current evidence for aetiology
and prevention. J Paediatr Child Health. 2006;42:37-43.
Berkowitz RJ, Turner J, Hughes C. Microbial characteristics of the human dental caries associated with
prolonged bottle-feeding. Arch Oral Biol. 1984;29:949-51.
Kreth J, Merritt J, Shi W, Qi F. Competition and coexistence between Streptococcus mutans and
Streptococcus sanguinis in the dental biofilm. J Bacteriol. 2005;187:7193-203.
Kreth J, Zhang Y, Herzberg MC. Streptococcal antagonism in oral biofilms: Streptococcus sanguinis and
Streptococcus gordonii interference with Streptococcus mutans. J Bacteriol. 2008;190:4632-40.
Gurenlian JR. The Role of Dental Plaque Biofilm in Oral Health. Journal of Dental Hygiene. 2007;81.
Loesche WJ, Rowan J, Straffon LH, Loos PJ. Association of Streptococcus mutants with human dental
decay. Infect Immun. 1975;11:1252-60.
Marsh PD. Dental plaque: biological significance of a biofilm and community life-style. J Clin
Periodontol. 2005;32 Suppl 6:7-15.
American Academy of Pediatric Dentistry. Policy on Early Childhood Caries (ECC): Classifications,
Consequences, and Preventive Strategies. Pediatr Dent. 2011;33:47-9.
Martinez-Martinez RE, Fujiwara T, Patino-Marin N, Hoshino T, Wilson M, Loyola-Rodriguez JP.
Comparison of oral streptococci biofilm in caries-free and caries-affected preschool Mexican children.
Acta Odontol Latinoam. 2012;25:27-32.
Mitrakul K, Asvanund Y, Vongsavan K. Prevalence of five biofilm-related oral streptococci species from
plaque. J Clin Pediatr Dent. 2011;36:161-6.
Ge Y, Caufield PW, Fisch GS, Li Y. Streptococcus mutans and Streptococcus sanguinis colonization
correlated with caries experience in children. Caries Res. 2008;42:444-8.
Caufield PW, Dasanayake AP, Li Y, Pan Y, Hsu J, Hardin JM. Natural history of Streptococcus sanguinis
in the oral cavity of infants: evidence for a discrete window of infectivity. Infect Immun. 2000;68:4018-23.
Hoshino T, Kawaguchi M, Shimizu N, Hoshino N, Ooshima T, Fujiwara T. PCR detection and
identification of oral streptococci in saliva samples using gtf genes. Diagn Microbiol Infect Dis.
2004;48:195-9.
Chen Z, Saxena D, Caufield PW, Ge Y, Wang M, Li Y. Development of species-specific primers for
detection of Streptococcus mutans in mixed bacterial samples. FEMS Microbiol Lett. 2007;272:154-62.