EL-SEWER
FEMS Microbiology Letters 144 (1996) 81-87
Molecular and genetic analysis of multiple changes in the levels of
production of virulence factors in a subcultured variant of
Streptococcus mutans
Yamashita,
Yuichi Tsukioka, Yoshio Nakano, Yukie Shibata,
Toshihiko Koga *
Department of Preventive Dentistry, Kyushu University Faculty of Dentistry, 3-l-l
Maidashi, Higashi-ku. Fukuoka 812-82, Japan
Received 27 June 1996; revised 9 August 1996; accepted 13 August 1996
Abstract
We previously isolated a variant strain, XclOOL, which shows decreased production of a surface protein antigen with a
molecular mass of 190 kDa (PAc), after repeated subculturing of Streptococcus mutans strain Xc [Koga, T. et al. (1989) J. Gen.
Microbial. 135, 3199-32021. In the present study, the levels of expression of the gtfB, gtfC, gtfa and ftf genes coding for
polysaccharide-synthesizing
enzymes in strain XclOOL were compared with those in strain Xc. Western blot analysis revealed
multiple differences in the levels of production of these enzymes between these two strains. The amounts of the gtfB and gtfC
gene products responsible for water-insoluble glucan synthesis in strain XclOOL were lower than those in strain Xc, whereas the
amounts of the gtj2I and&-gene products responsible for water-soluble glucan synthesis and fructan synthesis, respectively, in
strain XclOOL were higher than those in strain Xc. Northern blot analysis revealed that the amounts of the four enzymes and
PAc produced by strain XclOOL reflected the relative amounts of mRNAs from the genes. The chloramphenicol
acetyltransferase gene was fused with each of these live genes, and the transcriptional activity of each gene in strain
XclOOL was quantitatively compared with that in strain Xc. The chloramphenicol acetyltransferase assay also indicated that
the phenotypic differences between strain Xc and strain XclOOL were due to differences in the transcriptional activities of the
virulence genes. No differences in the nucleotide sequences of the promoter regions of the gtfB, gtfC, gtfD, ft?f and pat genes
were found between strain Xc and strain XclOOL. It is possible that a factor(s) affecting the levels of transcription of the
multiple virulence genes exists in S. mutans.
Keywords:
Streptococcus mutans; Virulence factor; Surface protein antigen; Glucosyltransferase; Fructosyltransferase
1. Introduction
Streptococcus mutans has been strongly implicated
* Corresponding author. Tel.: +81 (92) 641-1151; Fax:
+81 (92) 641-3206; E-mail: toshidha@mbox.nc.kyushu-u.ac.jp
as a causative
agent of human dental caries [l]. S.
mutans produces several virulence factors such as
giucosyltransferases
[2], fructosyltransferase
[2] and
a cell-surface
protein
antigen with a molecular
mass of 190 kDa, which has been variously designated
antigen
B, I/II, IF, MSL-1,
Pl, SR and PAc
0378-1097/96/$12.00
Copyright 0 1996 Federation of European Microbiological Societies. Published by Elsevier Science B.V.
PII SO378-1097(96)00342-4
Downloaded from http://femsle.oxfordjournals.org/ by guest on March 6, 2016
Yoshihisa
82
Y. Ycrmushito CI a/. I FEMS Microbiology Letters 144 (19961 XIly7
2. Materials and methods
2.1. Bacterial strains and culture conditions
Strains of S. mutans and Escherichia coli were
maintained
and grown routinely as previously described [8].
2.2. Antisera
Rabbit anti-PAc serum was prepared as previously
described [9]. Rabbit anti-glucosyltransferase-I
serum
and anti-glucosyltransferase-S
serum were kindly
provided by K. Fukushima, Nihon University, Matsudo Dental School, Matsudo, Japan. Rabbit antifructosyltransferase
serum was obtained from M. Inoue and S. Sato, Kagoshima University, Faculty of
Dentistry, Kagoshima, Japan.
2.3. DNA manipulations
DNA isolation, endonuclease restriction, ligation,
DNA sequencing and transformation
of S. mutans
and E. coli were carried out as previously described
[8]. Southern blot analysis was performed with di-
goxigenin (DIG)-labeled probes using a nonradioactive DIG DNA LaBeling And Detection kit (DIGELISA) (Boehringer GmbH) according to the instructions of the supplier.
2.4. Western blot analysis of’ virulence jkctors
Strains Xc and XclOOL were grown anaerobically
to stationary phase in brain heart infusion (BHI;
Difco Laboratories) broth, and 0.2 ml of the culture
broth was diluted with 2 ml of fresh BHI broth. The
culture was incubated anaerobically at 37°C until an
optical density at 550 nm (ODssa) of 1.0 was attained. Samples (0.6 ml) of these cultures were precipitated with two volumes of acetone, and dried at
room temperature
for 15 min. The dried samples
were analyzed by Western blotting using appropriate
rabbit anti-virulence
factor sera as previously described [9].
2.5. Northern blot analysis
Aliquots of overnight cultures of strains Xc and
XclOOL (0.2 ml each) were inoculated into 12 ml of
BHI broth prewarmed to 37°C. After these cultures
were incubated at 37°C for 2 h, glycine was added to
a final concentration
of 1%. The growth was continued until an ODss0 of about 0.4 was attained. After
the cells were harvested by centrifugation,
total
RNA was extracted according to the method of Shiroza and Kuramitsu [lo]. The extracted RNA was
purified with ISOGEN-LS
(Nippon
Gene Inc.).
Four DIG-labeled
PCR probes (probe P for pat,
probe I for gtfB and gtfC, probe S for gtfD and
probe F for fttf> were prepared to determine the
amounts of mRNA transcripts specific for the five
virulence factors. The 1.l-kb SpeI-Sac1 fragment of
pat, the 1.6-kb BamHI fragment of gtfB, the 1.4-kb
BstPI-PstI fragment of gtfD and the 1.3-kb StyI-ClaI
fragment of ftA which were ligated into the multiple
cloning sites of pBluescript, were used as templates
for PCR amplification of probe P, probe I, probe S
and probe F, respectively. -2lM13
and M13PRl
primers were used as primers. Target mRNA was
identified with the appropriate
DIG-labeled
probe
using a nonradioactive
DIG-ELISA
according to
the instructions of the supplier.
Downloaded from http://femsle.oxfordjournals.org/ by guest on March 6, 2016
[3]. Hydrophobic
interaction between PAc and acquired pellicles is considered to be important
for
the initial attachment of S. mutuns to tooth surfaces
[3]. Synthesis of water-insoluble
glucan, catalyzed by
glucosyltransferase-I
and glucosyltransferase-SI,
is
necessary for the accumulation
of S. mutans cells
on tooth surfaces [1,2]. Water-soluble
glucan and
fructan, the synthesis of which is catalyzed by glucosyltransferase-S
and fructosyltransferase,
respectively, serve as storage reservoirs for carbon, and
contribute to the pathogenesis of S. mutans [446].
We previously isolated a variant strain, XclOOL,
which shows decreased production of PAc after repeated subculturing
of S. mutuns strain Xc which
was freshly isolated from human dental plaque [7].
In the present study, we found multiple differences in
the levels of expression of the genes coding for polysaccharide-synthesizing
enzymes between these two
strains. In this report, we describe the molecular
and genetic analysis of the phenotypic changes in
the variant strain.
Y Yamashita et al. I FEMS Microbiology Letters 144 (1996) 81-87
83
Table 1
S. murans strains used in this study
Relevant characteristics
Reference or source
xc
Wild-type strain (parent strain of XclOOL)
Subcultured variant of strain Xc showing decreased level of PAc pro duction
Em’; strain Xc carrying the cat gene fused with the pat gene
EmT; strain XclOOL carrying the cat gene fused with the pat gene
Em’; strain Xc carrying the cat gene fused with the gtfB gene
Em’; strain XclOOL carrying the cat gene fused with the glfB gene
Em’; strain Xc carrying the car gene fused with the grfC gene
Em’; strain XclOOL carrying the car gene fused with the grjC gene
Em’; strain Xc carrying the cat gene fused with the gtfD gene
Em’; strain XclOOL carrying the car gene fused with the gtfD gene
EmI ; strain Xc carrying the cat gene fused with the fif gene
Em’; strain XclOOL carrying the car gene fused with the ftf gene
[71
[71
This
This
This
This
This
This
This
This
This
This
XclooL
xc11
XclOOLl1
xc12
Xc1OOL12
xc13
xc1ooL13
xc14
XclOOL14
xc15
XclOOL15
2.6. Construction of chloramphenicol acetyltransferase f CA T) and virulence factors fusion strains
The l.O-kb BamHI fragment containing a promoterless cat gene isolated from pMH109 [l l] was ligated to the l.O-kb fragment containing the erythromycin resistance
gene from pAMP1
[ 121. The
resultant 2.0-kb cat cartridge had the erythromycin
resistance gene downstream of the cat gene and the
both genes were in the same orientation.
The plasmid composed of the 1.I-kb SpeI-Sac1 fragment
from the pat gene, the cat cartridge, and pUC replicon was constructed. The cat cartridge was located
immediately downstream from the 1.1 -kb SpeI-Sac1
fragment in the same orientation. The intact plasmid
was introduced into the pat gene of strains Xc and
XclOOL, and the resultant strains were designated
strains Xc11 and XclOOLll (Table 1). A series of
derivatives of strains Xc and XclOOL carrying the
cat gene fused with the gtfB, gtfC, gtfD and ftf genes
were constructed by allelic exchange with the 1.6-kb
BamHI fragment of gtfB gene, the 1.4-kb BstPI-PstI
fragment of gtfD and the 2.2-kb BanII-ClaI fragment
of ftf interrupted
by the cat cartridge in the same
orientation (Table 1). Since there is a high sequence
identity between the gtfB gene and the gtfC gene, it
is possible that both types of transformants
acquiring the cat cartridge fused with gtfB and gtfC are
isolated by homologous
recombination
with the
1.6-kb BamHI fragment of gtfB gene interrupted
study
study
study
study
study
study
study
study
study
study
by the cat cartridge. The construction
of transformants with fusion between the cat and virulence factor
genes from strains Xc and XclOOL was confirmed by
Southern blot analyses of EcoRI digests of chromosomal DNA from the obtained transformants.
These
transformants
were used for monitoring of the level
of expression of each virulence factor gene.
2.7. CAT assay
CAT-specific activity in cell lysates of S. mutans
strains carrying the cat gene fused with the virulence
genes was measured by the method of Kiska and
Macrina [13]. One unit of CAT activity was defined
as the amount of enzyme which catalyzed the acetylation of 1 pmol of chloramphenicol
per min at
37°C. The value of CAT activity in cell lysates of
strain Xc was defined as a background adsorption.
This background value was subtracted from the value of CAT activity in cell lysates of the S. mutans
strains carrying a fusion between cat and the virulence factor genes. Protein was quantified by the BioRad protein assay reagent with bovine serum albumin as a standard.
2.8. Primer extension analysis
The transcriptional
start site of the pat gene was
determined by primer extension with biotinylated oligonucleotide primers, PAC2 (5’-GTCCTGCTACA-
Downloaded from http://femsle.oxfordjournals.org/ by guest on March 6, 2016
Bacterial strain
Y. Yumashitu et (11.I FEMS Microbiology Letters 144 (1996) XI-37
84
GAGACTGCTGCTA-3’)
and PAC3 (5’-CTGCTGCTACTGTTCCTAGAACAG-3’),
according to the
method of Kato et al. [14].
2.9. Nucleotide sequences of promoter regions of’ the
virulence factor genes
3. Results and discussion
3. I. Expression levels of various virulence genes in
strains Xc and XclOOL
Western blot analyses revealed that the amounts
of PAc, glucosyltransferase-I
and glucosyltransferase-SI produced by strain XclOOL were lower than
the amounts of those produced by strain Xc (Fig.
lA,B), whereas the amounts of glucosyltransferaseS and fructosyltransferase
produced
by strain
XclOOL were higher than the amounts of these two
proteins produced by strain Xc (Fig. lC,D). The
amounts
of these virulence factors produced by
strain Xc were almost the same as the amounts of
these factors produced by strains MT8148, T8 and
UA130 (Fig. IA-D). Total RNA preparations from
strains Xc and XclOOL were subjected to Northern
blot analysis. The differences in the levels of production of the virulence factors between strain Xc and
Table 2
Primers used for PCR amplification of the DNA fragments containing the promoter
Gene
Primer
Sequence
regions of the gtfB, gtfC, gtfD and
frf genes
Size
Sequence
of the
determined
fragment
(bp)
tbo)
@fB
gcfc
g[fD
fif
@B-F
5’-TGTAAAACGACGGCCAGTTCACTTAAAGATCTACAG-3’
gtfB-R
5’.CAGGAAACAGCTATGACCGCCACCCGAAAGTGATGTT-3’
gtfC-F
S-TGTAAAACGACGGCCAGTAGAACGAGTTCGGATTAA-3’
gtfC-R
5’-CAGGAAACAGCTATGACCACTTCCTGAAAGAGAGGTC-3’
gtfDF
5’.TGTAAAACGACGGCCAGTCAGGTTTATGGCGG-3’
@D-R
S’CAGGAAACAGCTATGACCAGAAGCGACAGCAAC-3’
ftf-F
5’-TGTAAAACGACGGCCAGTGGACAGACTCTGAAA-3’
ftf-R
5’CAGGAAACAGCTATGACCAGTCAGGATAGCAGTC3’
The sequences of -2lM13
and Ml 3RP1 primers are underlined
619
445
355
195
439
320
460
286
Downloaded from http://femsle.oxfordjournals.org/ by guest on March 6, 2016
The I S-kb HindIII-Spel
fragments containing the
1.4-kb upstream region of the pat gene were obtained from chromosomal
DNA of strains Xc and
XclOOL using a marker rescue method [15]. The 236bp nucleotide sequences between the initiation codon
of the pat gene and the termination
codon of the
preceding open reading frame were determined for
each strain using the Taq DyeDeoxy@’ Terminator
Cycle Sequencing kit (Applied Biosystems) with the
rescued fragment and synthetic primers, pat-F (5’GAATGCTGATGGACATCAATGG-3’)
for the
forward orientation and pat-R (5’-CTAGAACAGCACCACACAGTGT-3’)
for the reverse orientation. The fragments containing
the promoter sequences of other virulence factor genes of strains
Xc and XclOOL were amplified by PCR using chromosomal DNA of strain Xc or XclOOL and each set
of primers that possess the -21 Ml3 or M13RPl primer sequence at the 5’-terminus (Table 2). The nucleotide sequences of the region between the initiation codon of the gtfB, gtfC or ftf gene and the
termination
codon of its preceding open reading
frame, and the 343-bp nucleotide sequence upstream
of the initiation codon of the gtfD gene were determined for strains Xc and XclOOL using the Taq Dye
Primer Cycle Sequencing Core kit (Applied Biosysterns) with the respective amplified PCR fragments
and fluorescence-labeled
-2lM13
or M13RPI primer (Applied Biosystems).
Y Yamashita et al. IFEMS
Microbiology
kDa
A
12
3
4
5
219124- ; -_
kb
12
12
12
12
1.4 5.3 w@
1.0-
B-~tf~&~stz_.ei_
12
12
12
12
Fig. 2. Comparison
of expression levels of virulence genes in
strain Xc with those in strain XclOOL. Panel A shows Northern
blot patterns of total mRNA (3 pg) from strains Xc (lane 1) and
XclOOL (lane 2). Hybridization
was carried out with the DIG-labeled PCR probes: probe P for the pat gene, probe I for the
gtfB and gtfC genes, probe S for the gtfD gene and probe F for
the ftf gene. Panel B shows total mRNA transferred to membranes prior to hybridization.
Molecular mass standards (in kb)
are noted on the left.
between strain Xc and strain XclOOL might result
from differences in the transcriptional
activity of
each virulence gene.
C
219.
3.2. Comparison of the nucleotide sequences of the
promoter regions of virulence genes
124-
Fig. 1. Western blot analyses of virulence factors produced by
various strains of S. mutans. Panels A-D represent the results
obtained using rabbit anti-PAc, anti-glucosyltransferase-I,
antiglucosyltransferase-S
and anti-fructosyltransferase
sera, respectively. Lanes 1-5 are for S. mutam strains Xc, XcloOL, MT8148,
UA130 and T8, respectively. Molecular mass standards (in kDa)
are noted on the left.
It is possible that multiple changes in the levels of
expression of the virulence genes in strain XclOOL
might be due to mutations in the promoter regions
of the virulence genes. To test this possibility, we
compared the nucleotide sequences of the promoter
regions of the genes of strain XclOOL with those of
strain Xc. The transcription
start sites of the four
polysaccharide-synthesis
enzyme genes and the -10
and -35 sequences for each transcript were deduced
as recently reported by Smorawinska and Kuramitsu
[ 161. They concluded that each virulence gene has its
Downloaded from http://femsle.oxfordjournals.org/ by guest on March 6, 2016
strain XclOOL, which were detected by Western blot
analysis (Fig. l), reflected the differences in the
amounts of mRNA specific for each virulence factor
gene (Fig. 2). There was no difference between the
growth rates of strains Xc and Xc 1OOL (data not
shown), suggesting that a mutation(s)
in strain
XclOOL had no effect on general physiological characteristics such as the growth rate.
No reports comparing the levels of expression of
virulence genes in S. mutans have yet been published.
Therefore the transcriptional
activity of the virulence
genes in strains Xc and XclOOL were quantitatively
estimated from the level of CAT-specific activity in a
series of transformants
carrying the cat gene fused
with the virulence genes. The transcriptional
activities of the virulence genes varied in strain Xc. The
levels of expression of the pat, gffD and ff genes in
strain Xc were almost the same, but they were significantly lower than those of the gtfB and gtfC
genes
(Fig. 3). Moreover, these results indicated
that the phenotypic differences in virulence factors
85
Letters 144 (1996) 8137
Y Yumashitu et ul. IFEMS
86
Microbiology
81-87
200
the entire sequences of the promoter regions of the
five virulence genes, suggesting that the phenotypic
differences of S. mutans strain Xc and strain XclOOL
were not caused by mutation(s)
of promoter sequences of virulence genes and their flanking regions.
Further work is needed to identify factor(s) affecting
the levels of transcription
of the multiple virulence
genes in S. mutans.
100
Acknowledgments
g 400
S
k
k
#J 300
3
S
5
Letters 144 (1996)
:s
1
0
pat
gtP
sF
g@
Pf
Fig. 3. Expression of various virulence genes in strains Xc and
XclOOL. The ievels of CAT-specific activity in fusion derivatives
from strains Xc and XclOOL, which carry the cur gene fused
with the pat, gffB, gtfC, gffD or fj”gene, were used to quantitate
the levels of transcription of each the genes in both strains. Each
value represents the mean with the standard deviation of three
independent experiments.
This work was supported in part by a Grant-inAid for Scientific Research (B) 07557134 from the
Ministry of Education, Science, Sports and Culture
of Japan and by the Mochida Memorial Foundation
for Medical and Pharmaceutical Research. We thank
Howard K. Kuramitsu for providing the clones carrying the gtfD and ftf genes.
References
own promoter in the region immediately upstream of
each structural gene [16]. The promoter region of the
pat gene was identified in the present study. By
Northern
blot analysis, PAc-specific mRNA was
found to be around 5.0 kb in size which corresponds
to the size of the pm gene, suggesting that the promoter of the pm gene is located in the region immediately upstream of the pat gene. For identification
of the transcriptional
start site of the pat gene, primer extension analysis of mRNA prepared from
strain Xc was carried out. The results of the present
study indicate that transcription
is initiated at a single G 49 bp upstream of the initiation codon of the
pat gene (data not shown). From this finding, typical
E. co/i-like promoter sequences, a -35 promoter sequence, TTGACA, and a -10 promoter sequence,
TACAAT, were deduced.
The nucleotide sequences of the promoter regions
of the four virulence genes (gtfB, gtfC, gtfD and ftj)
of strains Xc and XclOOL were determined using
synthetic primers (Table 2). Those of the pat gene
of both strains were determined using rescued fragments and synthetic primers, pat-F and pat-R. No
base change was observed between strains Xc and
XclOOL, not only in the promoter sequences but in
[I] Loesche, W.J. (1986) Role of Streptococcus mutans in human
dental decay. Microbial. Rev. 50, 353-380.
[2] Hamada, S. and Slade, H.D. (1980) Biology, immunology,
and cariogenicity of Streptococcus mutans. Microbial. Rev.
44. 331-384.
[3] Koga, T., Yamashita. Y., Nakano, Y., Kawasaki, M., Oho,
T., Yu, H., Nakai, M. and Okahashi, N. (1995) Surface proteins of Streptococcus mutans. In: Genetics of Streptococci,
Enterococci and Lactococci (Ferretti, J.J., Gilmore, MS.,
Klaenhammer, T.R. and Brown, F., Eds.), Dev. Biol. Stand.
Base1 85, 363-369.
[4] Schroeder, V.A., Michalek, S.M. and Macrina, F.L. (1989)
Biochemical characterization
and evaluation of virulence of
a fructosyltransferase-deficient
mutant of Streptococcus mufuns V403. Infect. Immun. 57, 3560-3569.
[5] Munro, C., Michalek, SM. and Macrina, F.L. (1991) Cariogenicity of Streptococcus
mutansV403 glucosyltransferase and
fructosyltransferase
mutants constructed by allelic exchange.
Infect. Immun. 59. 2316-2323.
[6] Yamashita, Y., Bowen, W.H., Burne, R.A. and Kuramitsu.
H.K. (1993) Role of the Streptococcus mutans gtf‘ genes in
caries induction in the specific-pathogen-free
rat model. Infect.
Immun. 61, 3811-3817.
[7] Koga, T., Asakawa, H., Okahashi, N. and Takahashi,
I.
(1989) Effect of subculturing on expression of a cell-surface
protein antigen by Streptococcus mutans. J. Gen. Microbial.
135, 319993207.
[8] Yamashita, Y., Takehara, T. and Kuramitsu,
H.K. (1993)
Molecular characterization
of a Streptococcus mutms mutant
Downloaded from http://femsle.oxfordjournals.org/ by guest on March 6, 2016
2
u
Y Yamashita et al. I FEMS Microbiology
[9]
[IO]
[ll]
[12]
altered in environmental
stress responses. J. Bacterial. 175,
6220-6228.
Ohta, H., Kato, H., Okahashi, N., Takahashi, I., Hamada, S.
and Koga, T. (1989) Characterization
of a cell-surface protein
antigen of hydrophilic
Streptococcus mutans strain GS-5.
J. Gen. Microbial. 135, 981-988.
Shiroza, T. and Kuramitsu,
H.K. (1993) Construction
of a
model secretion system for oral streptococci. Infect. Immun.
61, 374553155.
Hudson, M.C. and Stewart, G.C. (1986) Differential utilization of Staphylococcus aurew promoter sequences by Escherichia coli and Bacillus subtilis. Gene 48, 93-100.
Brehm, J., Salmond, G. and Minton, N. (1987) Sequence of
the adenine methylase gene of the Streptococcus faecalis plasmid pAMB1. Nucleic Acids Res. 15, 3177.
Letters 144 (1996) 8137
87
[13] Kiska, D.L., and Macrina, F.L. (1994) Genetic regulation of
fiuctosyltransferase
in Streptococcus mutans. Infect. Immun.
62, 1241-1251.
[14] Kato, C., Smorawinska,
M., Sato, T. and Horikoshi,
K.
(1995) Cloning and expression in Escherichiu coli of a pressure-regulated promoter region from a barophilic bacterium,
strain DB6705. J. Mar. Biotechnol. 2, 125-129.
[15] Niaudet, B., Gaze, A. and Ehrlich, SD. (1982) Insertional
mutagenesis in Bacilius sub&s: mechanism and use in gene
cloning. Gene 19, 277-284.
[16] Smorawinska, M. and Kuramitsu, H.K. (1995) Primer extension analysis of Streptococcus mutans promoter structures.
Oral Microbial. Immunol. 10, 188-192.
Downloaded from http://femsle.oxfordjournals.org/ by guest on March 6, 2016