Welcome
To
Biology
Mrs. Wilson
Room X-1
Ext. 5405
mwilson@dusd.net
September 6, 2006
Questionnaire
September 7, 2006
Classroom Expectations
September 8, 2006
Safety Rules
Homework: safety test – Monday
September 11, 2006
Safety Test
Handout: Root words
Homework: Study week 1
September 12, 2006
Begin Cornell Notebook
Homework: Finish notebook, make a cover for you notebook using 4 colors
n number each page: odd #’s on left page
September 14, 2006
Root Quiz #1
Textbooks
Cornell note-taking
STAR Chapter 2-1 [8]
Homework: STAR 2-2, 2-3[14]
Friday, September 15, 2006
Due: STAR 2-2, 2-3[14]
Handouts: bathroom passes
Grade notebook assignments (highlight)
Discuss Atoms & Bonds
Homework: STAR 3-1 [4]
Monday, September 18, 2006
Due: STAR 3-1 [4]
Bonds
Homework: Water coloring sheet STAR [5]
Tuesday, September 19, 2006
Due: Water coloring sheet STAR [5]
Discussion of water
Homework: Properties of water coloring sheet [6] and properties of water
analogy (left side)
Thursday, September 21, 2006
Due: Properties of water coloring sheet [6] and properties of water analogy
(left side)
pH notes
pH Lab
Homework: STAR 3-2, 3-3 [16]
Friday, September 22, 2006
Due: STAR 3-2, 3-3 [16]
Root Quiz #2
Notes- Biologically Important Molecules [15]
Homework: Identifying Chemical Compounds
Monday, September 25, 2006
Due: Identifying Chemical Compounds
Finish notes
Homework: questions from notes
Tuesday, September 26, 2006
Due: Questions from notes
Molecule Lab
Homework: KWL and 10 vocabulary cards
Thursday, September 28, 2006
Due: KWL and 10 vocabulary cards
Root Quiz #3
Food Lab
Homework: Molecules of Life worksheet
Friday, September 29, 2006
Due: Current Event, Molecules of Life worksheet
Complete Molecule activity
Homework: Chapter 2, Chapter review 1- 25
Monday, October 2, 2006
Due: Chapter 2 Chapter Review 1-25
Review for test Thursday
Homework: Chapter 3 Chapter review 1-25
Tuesday, October 3, 2006
Due: Chapter 3 Chapter review 1-25
Practice Quiz
Word Game – use notes, KWL, and voc. Cards
Homework: Review for test on Thursday, homework packet and notebook
due
Thursday, October 5, 2006
Due: homework packet and notebook due
Review for test
Test
Homework: STAR 1-4 [3] and pg. 1088 (draw and label microscope (left
side) pg. 1089 [6] right side 6 questions on handling a microscope plus how
to make a wet mount in your own words.
Friday, October 6, 2006
Due: STAR 1-4 [3] and pg. 1088 (draw and label microscope (left side) pg.
1089 [6] right side 6 questions on handling a microscope plus how to make a
wet mount in your own words.
Reflection, parent input - Monday
Grade notebooks
Introduction to the cell book project
Homework: STAR 4-1, 4-2 [22] due Tuesday
Tuesday, October 10, 2006
Due: STAR 4-1, 4-2 [22] due Tuesday
Root Quiz #4
Discussion of Virus and bacteria
Homework: Comparison of Virus, Bacteria, and Eukaryote
Thursday, October 12, 2006
Due: Comparison of Virus, Bacteria, and Eukaryote
Finish notes – Virus and Bacteria
Poster of Virus
Homework: virus and bacteria questions
Friday, October 13, 2006
Due: storyboard, virus and bacteria
questions
Video- Eukaryotic cell
Complete poster
Homework: Animal cell coloring sheet [5]
Monday, October 16, 2006
Due: Animal coloring sheet [5]
Review cell size
Notes – Eukaryotic Cell
Homework: Plant cell coloring sheet [5]
Tuesday, October 17, 2006
Due: Plant cell coloring sheet
Finish cell notes
Homework: Cell membrane coloring
sheet [4]
Thursday, October 19, 2006
Due: Cell membrane coloring sheet
Lab – Cell size Lab
Homework: Chapter 4 Review
Friday, October 20, 2006
Due: Chapter 4 Review
Root Quiz #5
Homework: Cell book
Monday, October 23, 2006
Due: Cell book
Microscope review
Homework: microscope sheet
Tuesday, October 24, 2006
Due: microscope sheet
Begin cell Lab
Homework: KWL, vocabulary cards
Thursday, October 26, 2006
Due: KWL, vocabulary cards
Root Quiz #6
Cell Lab
Homework: cell crossword
Friday, October 27, 2006
Due: cell crossword
Cell Video
Cell work sheets
Homework: Review for quiz, finish work
sheets
Monday, October 30, 2006
Test – Cell (50 points)
Homework: STAR 5-1 [8]
Tuesday, October 31, 2006
Due: STAR 5-1 [8], Current Event
Discussion of movement through the
membrane
Homework: STAR 5-2 [5], Reflection
(Chapter 4)
Thursday, November 2, 2006
Due: STAR 5-2 [5], reflection
Potato Lab
Homework: Movement of Water sheet
Friday, November 3, 2006
Due: Movement of Water sheet
Graphing and data tables
Homework: Graphs, Binder due Monday
Monday, November 6, 2006
Due: Graphs
Review for test
Homework: Chapter 5 Review 1-23 and
Critical Thinking 1-4
Tuesday, November 07, 2006
Due: Chapter 5 Review 1-23 and Critical
Thinking 1-4
Review
Test – Chapter 5
Homework: Chapter 6 [13], redo
Osmosis lab
Thursday, November 9, 2006
Due: Redo of Osmosis Lab, Chapter 6
[13]
Intro to the Leaf
Leaf Mini Lab
Homework: Leaf Coloring sheet, STAR
notes [5]
Monday, November 13, 2006
Due: Leaf coloring sheet, STAR [5]
Grade notebooks
Homework: Photosynthesis Reading 6-1,
6-2
Tuesday, November 14, 2005
Due: Photosynthesis Reading 6-1, 6-2
Finish photosynthesis notes
Homework: Photochemical reactions coloring sheet and STAR [6]
Thursday, November 16, 2006
Due: Photochemical reactions coloring sheet and STAR [6]
CD activity
Homework: Absorption of Chlorophyll
Friday, November 17, 2006
Due: Absorption of Chlorophyll
Root Quiz #7
Finish CD
Homework: Capturing Energy in Light
Monday, November 20, 2006
Due: Capturing Energy in Light
How to write a Lab report
Homework: Introduction to Osmosis Lab
(Tuesday),Chapter 6 review 1-21
Critical Thinking 2,5,7 due: Monday
27th
Tuesday,
Write Lab report
Homework: Lab report and Chapter
review 1-21 Critical Thinking 2,5,7
Have a Good holiday
Monday, November 27, 2006
Due: Chapter review 1-21 Critical
Thinking 2,5,7
Review
Homework: Photosynthesis test
Tuesday, November, 28, 2006
Due: Photosynthesis test
Root Quiz #8
Review
Video- Photosynthesis
Homework: photosynthesis cartoon (left
side), current event
Thursday, November 30, 2006
Due: photosynthesis cartoon (left side),
current event
Video – Energy In
Make a poster (assigned by the teacher)
of either Light dependent or independent
reaction)
Homework: Review for the test, work on
lab report for Mon.
Friday, December 1, 2006
Due: Photosynthesis packet
Photosynthesis test
Homework: STAR 7-1 [6] & 7-2 [6]
Monday, December 4, 2006
Due: STAR 7-1 [6] & 7-2 [6], Lab report
rough draft
Peer review of lab report
Homework: Reading sheet 7-1
Tuesday, December 5, 2006
Due: Reading Sheet 7-1,
Introduction to respiration
Homework: Glycolysis cs. [5]
Thursday, December 7, 2006
Due: Glycolysis cs. [5]
Interactive tutor
Homework: Fate of Pyruvate cs. [5]
Friday, December 8, 2006
Due: Fate of Pyruvate cs. [5]
Finish Interactive tutor
Mention Extra credit for Thursday
Homework: Lab report
Monday, December 11, 2006
Due: Lab report
Introduce Endangered Species Project
Homework: Chapter 7 Review 1-23
Tuesday, December 12, 2006
Due: Chapter 7 Review 1-23
Video – Energy Out
Homework: Reading Sheet 7-2,
reflection and notebook
Thursday, December 14, 2006
Due: Extra Credit, Reading Sheet 7-2,
reflection and notebook
Review
Lab – Photosynthesis/respiration
Homework: Study for test
Friday, December 15, 2006
Test on Chapter 7 – Respiration
Happy Holiday
Thursday, Jan. 4, 2007
“There’s a Hair in my Dirt”
Random Sampling Lab
Homework: STAR Chapter 19 [20]
Friday, Jan. 5, 2007
Due: Chapter 19 [20]
Root Quiz #9
Introduction to Ecology
Population Notes
Homework: STAR Chapter 20 [19]
Monday, January 8, 2007
Due: STAR Chapter 20 [19]
Notes - populations
Homework: STAR Chapter 21 [20] due
Thursday
Tuesday, Jan. 9, 2007
Root Quiz #10
Population Video
Notes Finish populations
Homework: STAR Chapter 21 [20]
Thursday, Jan. 11, 2007
Due: STAR Chapter 21[20]
Population Lab
Homework: Chapter 22, sect. 1&2 [12]
Friday, January 12, 2007
Due: Chapter 22, sect. 1&2 [12]
Ecosystems video
Biological Interactions & Communities
Homework: Food Web [7] and color,
Binders
Tuesday, January 16, 2007
Due: Food Web [7] and color, Binders
Root Quiz #11
Biological Interactions & Communities
Homework: STAR 22 3&4 [15], finish
symbionic relationship activity
Thursday, January 18, 2007
Due: STAR 22 3&4 [15]
Predator/Prey Lab
Homework: Predator/prey Relationships,
Current Event
Friday, January 19, 2007
Due: Predator/prey Relationships,
Current Event
Energy Transfer notes
Homework: Analyzing Ecological
Relationships
Monday, January 22, 2007
Root quiz #12
Biomes
Homework: Review for the test
Tuesday, January 23, 2007
Ecology Test
Cornell notebooks due
Homework: Study for Root Final #1-12
Thursday, January 25, 2007
Collect packets - Ecology
Root Word Final #1-12
Grade notebooks
Video – Human Impact
Homework: Complete Endangered
Species Project – email any power point
projects to me, Subject: your name and
period
Friday, January 26, 2007
Endangered Species Project
Presentations begin
Monday, January 29, 2007
Endangered Species Project completed
BRING PASSES TO FINAL
IF YOU DROP OR CHANGE THIS
CLASS AT THE SEMESTER, BRING
YOUR TEXTBOOK ON THE DAY OF
THE FINAL
Biology
Semester 2
Monday, February 05, 2007
Check in
Handout: Calendars and Human
Anatomy Project
Reflection – First semester
Homework: choose a topic for the
Anatomy project
Tuesday, February 06, 2007
Sign up for project topic
Work on Anatomy project
Homework: Work on project
Wednesday, February 07, 2007
Write the paper in the classroom (bring
disc)
Homework: Bring materials needed to
make your poster for your project
Thursday, February 08, 2007
Root Quiz #13
Complete poster in class
Homework: Be prepared to give
presentation on Tues. Email any power
point presentations by Monday to my
email. Don’t forget the subject is your
name and period.
Tuesday, February 13, 2007
Due: Human Anatomy project
Begin giving presentations
Homework: STAR 10-1 [5] review
questions from presentations
Thursday, February 15, 2007
Due: STAR 10-1 [5] review questions
from presentations
Continue presentations
Homework: STAR 10-2 [5] review
questions from presentations
Friday, February 16, 2007
Due: STAR 10-2 [5] review questions
from presentations
Presentations
Homework: review questions as posted
Tuesday, February 20, 2007
Due: review questions from
presentations
Review for test
Homework: notes and review questions
due, study for test
Thursday, February 22, 2007
Due: notes and review questions
Finish presentations
Homework: Review questions
Friday, February 23, 2007
Due: review questions
Review for the test
Homework: review for test, Cornell
notes
Monday, February 26, 2006
Due: Cornell notebook, packet
Test on Human Anatomy
Homework: STAR 10-3 [ 6], Current
Event
Tuesday, February 28, 2007
Due: STAR 10-3 [ 6], Current Event
Introduction to DNA
DNA and its structure,
Homework: Complete DNA and its
structure
Thursday, March 1, 2007
Due: DNA and its structure,
DNA and RNA
COL- Blueprint of Life
Homework: Andromeda Strain, Nucleic
Acids and Protein Synthesis
Friday, March 2, 2007
Due: Andromeda Strain, Nucleic Acids
and Protein Synthesis
Root Quiz #14
Introduce Recipe for Protein project
Review – Homework
Homework: Protein Synthesis
TACATAGGCAGATTAGTACGC
Monday, March 5, 2007
Due: Protein Synthesis
COL – Building Block of Life
Go over DNA and Its Structure
Homework: Crossword,
(Role of RNA due Thursday)
TAC TTT ACG GCC TCG ATC ATT
Tuesday, March 6, 2007
Due: Crossword
Work on poster
Homework: Chapter 10 review 1-22,
Critical Thinking 2,3,6, Role of RNA
Thursday, March 8, 2007
Due: Role of RNA, Chapter 10 review 122, Critical Thinking 2,3,6
Finish poster
Go over Chapter review
Homework: Reflection and Review for
test
Friday, March 9, 2007
Due: Homework packet, notebook
Test – Chapter 10
Homework: STAR 8-1, 8-2 [10]
Monday, March 12, 2007
Due: STAR 8-1, 8-2 [10]
Introduction to Mitosis
Mitosis Flip book: Due March 19
Homework: Mitosis Coloring Sheet [6]
Tuesday, March 13, 2007
Due: Mitosis Coloring Sheet [6]
Root Quiz #15
Mitosis Cut and Paste
Homework: Cross-a-Clue
Thursday, March 15, 2007
Due: Cross-a-Clue
Mitosis Lab
Homework: Mitosis Flip Book, STAR 83 [5]
Friday, March 16, 2007
Due: STAR 8-3 [5]
Finish Lab
Homework: Mitosis Flip Book, Be
prepared for a mitosis quiz on Monday
Monday, March 19, 2007
Due: Mitosis Flip Book
Mitosis Review
Mitosis Quiz
Intro to Meiosis
Homework: Meiosis coloring sheet [7]
Tuesday, March 20, 2007
Due: Meiosis coloring sheet [7]
Notes: Meiosis
Chromosomes
Homework: Chapter 8 Review 1-23
Thursday, March 22, 2007
Due: Chapter 8 Review 1-23
Chromosome activity
Generations – Video
Meiosis Cut and Paste
Homework: review for test, Cell Cycle,
reflection
Friday, March 23, 2007
Due: cell division packet
Review
Test – Chapter 8 – Cell division
Homework: STAR 9-1 [9]
Monday, March 26, 2007
Due: STAR 9-1 [9]
Root Quiz #16
Introduction to Genetics (Mendel)
Homework: STAR 9-2 [12], Binder
Tuesday, March 27, 2007
Due: STAR 9-2 [12] Binder
Finish notes
Chromosome – genetics simulation
Homework: Problems #1 & Incomplete
dominance
Thursday, March 29, 2007
Due: Problems #1 & Incomplete
Dominance
Probability Lab
Homework: Punnett Squares for crosses,
Cat Problems, Current Event
Friday, March 30, 2007
Due: Punnett Squares for crosses, Cat
Problems, Current Event
Go over problems
Homework: Genetics Problems #2 &
Word Game
Monday, April 2, 2007
Due: Genetics Problems #2 & Word
Game
Root Quiz #17
Review Problems
Introduce Dihybrid Cross
Homework: Dihybrid Cross
Tuesday, April 3, 2007
Due: Dihybrid Cross
Review problems
Exploring Human Traits
Homework: STAR 12-1 [8], Finish
Exploring Human Traits
Thursday, April 5, 2007
Due: Genetics Problems
Faces Activity
Homework: face
Friday, April 6, 2007
Due: face
Video- Cancer Warriors
Homework: Enjoy Spring Break
Monday, April 16, 2007
Human inheritance – pedigrees
Homework: STAR 12-2 [8]
Tuesday, April 17, 2007
Due: STAR 12-2 [8]
Root Quiz #18
Introduction to Pedigree Activity
Homework: Chapter 9 Review 1-25
Thursday, April 19, 2007
Due: Chapter 9 Review 1-25
Pedigree Activity
Homework: Chapter 12 review 1-25 &
CT 1-6
Friday, April 20, 2007
Due: Chapter 12 review 1-25 & CT 1-6
Review
Finish Pedigree
Homework: 15 vocabulary cards from
Chapter 9 and 12, Extra CreditTrihybrid cross
Monday, April 23, 2007
Due: Vocabulary cards
Review for test
Patterns of Inheritance
Sex linked problems
Homework: Reflection and review for
test
Tuesday, April 24, 2007
Due: reflection
Test – Genetics
Homework: STAR14-1, 14-2 [10]
Thursday, April 26, 2007
Due: STAR14-1, 14-2 [10]
Root Quiz #19
Introduction to Evolution
Geologic Time Line
Homework: STAR 14-3 [6]
Friday, April 27, 2007
Due: STAR 14-3 [6]
Is Evolution Just a Theory?
Interpreting an Ancient Puzzle
Grade notebooks
Homework: STAR 15-1[4], 15-2[10],
Current Event
Monday, April 30, 2007
Due: STAR 15-1[4], 15-2[10], Current
Event
Root Quiz #20
Who was Charles Darwin?
Homework: STAR 16- 1&2 [16]
Tuesday, May 1, 2007
Due: STAR 16- 1&2 [16]
Video – Snowball
Evolution notes
Homework: Finches of the Galapagos
Thursday, May 3, 2007
Due: Finches of the Galapagos
Geology
My Fossil activity
Homework: STAR 16-3 ]6]
Friday, May 4, 2007
Due: STAR 16-3 [6]
Notes Evolution
How do we know that evolution
happens?
Homework: Molecular Clock
Monday, May 7, 2007
Due: Molecular Clock
Review homework
How does evolution really work?
Homework: STAR 17-1[7]
Tuesday, May 8, 2007
Due: 17-1 [7]
Transformations
Homework: STAR 17- 2, 17-3 [10]
Thursday, May 10, 2007
Due: STAR 17- 2, 17-3 [10]
Allele Frequencies and Sickle Cell
Anemia Lab
Homework: Cross-A-Clue
Friday, May 11, 2007
Due: Cross-A-Clue
Root Quiz #21
Practice STAR test
Homework: Chapter 14 review 1-25
Tuesday, May 15, 2007
Due: Chapter 14 review 1-25
Root Quiz #22
Go over STAR test
Homework: STAR 15-3 [7]
Wednesday, May 16, 2007
Due: STAR 15-3 [7]
Go over Chapter review
Reader- Ringside Seat on Evolution
Homework: Chapter 15 review 1-25
Friday, May 18, 2007
Due: Chapter 15 review 1-25
Go over Chapter review
COL- Microevolution
Homework: Word Scramble,
Chapter 16 review 1-25
Monday, May 21, 2007
Due: Word Scramble, Chapter 16 review
1-25
Notes – Evolution
Did Humans Evolve?
KWL
Homework: Chapter 14 and 15
vocabulary cards [15]
Tuesday, May 22, 2007
Due; Chapter 14 and 15 vocabulary cards
[15]
Root Quiz #23
Notes- Human Evolution
Video - Hand Made Human
Homework: Observing Primate Structure
Thursday, May 24, 2007
Due: Observing Primate Structure
Peppered Moth Lab
Homework: Interpreting Information
about Primates, Binder
Friday, May 25, 2007
Due: Interpreting Information about
Primates, Binder due
Comparing Primates, From Gorillas to
Humans
Homework: finish Comparing Primates,
From Gorillas to Humans
Tuesday, May 29, 2007
Due: Comparing Primates, From Gorillas
to Humans
Root Quiz #24
COL – Macroevolution
Homework: Chapter 17 Review 1-25
Current Event
Thursday, May 31, 2007
Due: Chapter 17 Review 1-25, Current
Event
Origami Paper Bird
Homework: Vocabulary cards Chapter
16 [10]
Friday, June 1, 2007
Due: Vocabulary cards Chapter 16
Finish lab
Start reading on Hobbit
Homework: Vocabulary cards Chapter
17 [10]
Monday, June 4, 2007
Due: Vocabulary cards Chapter 17 [10]
Read Hobbit
Homework: Review for Root final on
Thursday
Tuesday, June 5, 2007
Why does Evolution Matter Now?
Finish Hobbit
Review for root final #13-25
Homework: study
Thursday, June 7, 2007
Root Word Final
Homework: review for Evolution test
Friday, June 8, 2007
What Happened to the Neanderthals?
Homework: reflection
Monday, June 11, 2007
Due: reflection
Grade notebooks, review
Homework: review for test
Tuesday, June 12, 2007
Due: notebooks
Evolution test
Thursday, June 13, 2007
Move into new building
Friday, June 14, 2007
Move into new building or Chimps R Us
Monday, June 18, 2007
Start “Journey of Man”
Finals
Finish “Journey of Man”
Farewell!!