1. Title of the article.
Coexistence of Gilbert’s syndrome with hereditary haemolytic anaemias.
2. Full name, postal address, e-mail, telephone number of the corresponding author.
Professor Beata Burzynska, Institute of Biochemistry and Biophysics, Polish Academy of Sciences,
ul. Pawińskiego 5A, 02-106 Warsaw, Poland; atka@ibb.waw.pl; 048 22 592 12 14
3. Full names, departments, institutions, city and country of all co-authors.
Katarzyna Rawa1, Anna Adamowicz-Salach1, Michał Matysiak1, Anna Trzemecka2, Beata Burzynska2
1
Department of Paediatrics, Haematology and Oncology, Medical University of Warsaw, Warsaw,
Poland
2
Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Warsaw, Poland
4. Up to five keywords or phrases suitable for use in an index.
Gilbert’s syndrome, hereditary haemolytic anaemia, UGT1A1genotyping, unconjugated
hyperbilirubinemia,
5. Word count- excluding title page, abstract, references, figures and tables.
1447
ABSTRACT
Background: Gilbert’s syndrome is an inherited disease characterised by mild unconjugated
hyperbilirubinaemia caused by mutations in UGT1A1 gene which lead to decreased activity of UDPglucuronosyltransferase 1A1. The most frequent genetic defect is a homozygous TA dinucleotide
insertion in the regulatory TATA box in the UGT1A1 gene promoter.
Methods and results: A group of 182 Polish healthy individuals and 256 patients with different types
of hereditary haemolytic anaemias were examined for the A(TA)nTAA motif. PCR reaction was
performed using sense primer labelled by 6-Fam and capillary electrophoresis was carried out in an
ABI 3730 DNA analyzer.
The frequency of the (TA)7/(TA)7 genotype in the control group was estimated at 18.13%, (TA)6/(TA)7
at 45.05% and (TA)6/(TA)6 at 36.26%. There was a statistically significant difference in the
(TA)6/(TA)6 genotype distribution between healthy individuals and patients with glucose-6-phosphate
dehydrogenase deficiency (p=0.041). Additionally, uncommon genotypes: (TA)5/(TA)6, (TA)5/(TA)7
and (TA)7/(TA)8 of the promoter polymorphism were discovered.
Conclusion: Genotyping of the UGT1A1 gene showed distinct distribution of the common
A(TA)nTAA polymorphism relative to other European populations. Because of a greater risk of
hyperbilirubinaemia due to hereditary haemolytic anaemia, the diagnosis of GS in this group of
patients is very important.
Gilbert’s syndrome (GS) is an inherited disorder characterised by mild unconjugated
hyperbilirubinemia in blood. It has been estimated that 3-10% of the general population exhibit GS
[1]. Unconjugated hyperbilirubinemia is caused by mutations in the UGT1A1 gene which encodes
hepatic UDP-glucuronosyltransferase 1A1 (UGT1A1). Mutations lead to decreased activity of UDPglucuronosyltransferase 1A1 and lower bilirubin conjugation with UDP-glucuronic acid [2]. GS is a
mild disorder and there is no requirement for treatment or long-term medical attention. The main
symptom of the disease is increased level of serum unconjugated bilirubin usually diagnosed in routine
laboratory tests.
In Europeans, the most frequent genetic defect in the UGT1A1 gene described to date is a
homozygous TA dinucleotide insertion in the regulatory TATA box - (TA)7/(TA)7 in the gene
promoter [2, 3]. Healthy individuals have six TA repeats - (TA)6/(TA)6. The mutation leads to
decreased activity of UDP-glucuronosyltransferase 1A1 by 30% and lower bilirubin conjugation with
UDP-glucuronic acid and then the accumulation of serum bilirubin [4].
Hereditary haemolytic anaemias, such as hereditary spherocythosis, thalassaemias and
glucose-6-phosphate-dehydrogenase deficiency are a group of disorders in which one of common
symptoms is an increase level of serum bilirubin. The coexistence of Gilbert’s syndrome with
haemolytic anaemia intensify hyperbilirubinemia and thus interfere with a exact diagnosis.
Here, we report the prevalence of GS in patients with different types of haemolytic anaemia
and in healthy individuals. We also discuss the presence of uncommon genotypes detected in Polish
patients and healthy subjects.
MATERIALS AND METHODS
Analysis of the number of repeats in the UGTA1 gene promoter was performed on DNA
samples from patients with confirmed hereditary haemolytic anaemia (65 with hereditary
spherocytosis, 139 with β-thalassemia and 52 with glucose-6-phosphate dehydrogenase deficiency G6PD) from the Department of Paediatrics, Haematology and Oncology in Warsaw. Samples from
182 healthy individuals were collected in the Regional Centre of Blood Donation and Hemotherapy in
Warsaw. Informed consent was obtained from all participants. This study was approved by the Ethical
Committee of the Medical University of Warsaw, Poland.
Genomic DNA was isolated from peripheral blood samples using the MagNA Pure Compact
Nucleic Acid Isolation Kit I (Roche, Germany). The promoter region of the UGT1A1 gene was
amplified by polymerase chain reaction (PCR) with F primer 5’ AAAGTGAACTCCCTGCTACC 3’
and R primer 5’ TGCTCCTGCCAGAGGTT 3’. The primers were designed basing on the GeneBank
UGT1A1 sequence (NG_009254.1). The sense primer was labelled with 6-Fam on the 5’ end and with
Tet on the 3’ end. PCR was performed using FastStart Taq DNA Polymerase with ready-to-use PCR
Grade PCR Mix (Roche, Germany). Cycling conditions comprised 30 cycles of denaturation at 95º for
30 s, annealing at 52º for 30 s, and extension at 72º for 20 s. Following the PCR reaction samples were
analysed in the DNA Sequencing and Oligonucleotide Synthesis Laboratory (Institute of Biochemistry
and Biophysics, PAS). Samples were prepared for capillary electrophoresis by adding 1 µl of 5-times
diluted PCR product to 5.7 µl of formamide and 0.3 µl of a GeneScan ROX 500 DNA ladder (Applied
Biosystems, CA, USA) as an internal standard. The samples were then denatured for 5 min at 95°C
and cooled to 4°C. Electrophoresis was performed in an ABI 3730 DNA Analyzer (Applied
Biosystems, CA, USA) using a POP-7 polymer (Applied Biosystems, CA, USA). After
electrophoresis the runs were analyzed visually using Peak Scanner Software v1.0 (Applied
Biosystems, CA, USA). To confirm the obtained results, selected PCR fragments were sequenced
directly with BigDye Terminators and appropriate primers using an ABI Prism 377 sequencer
(Applied Biosystems, CA, USA). χ2 test was used to estimate allele frequencies in particular groups.
Statistical analysis was done using STATISTICA data analysis software, version 9.1 (StatSoft, Inc.,
2010, www.statsoft.com).
RESULTS
We determined the frequency of promoter polymorphisms of the UGT1A1 gene in 256 patients
with hereditary haemolytic anaemia and 182 controls from the Polish population (Table 1). The
frequency of the (TA)7/(TA)7 genotype in the control group was 18.13%, the (TA)6/(TA)7 genotype
45.05%, and (TA)6/(TA)6 -36.26%. Differences between all groups of hereditary haemolytic anaemias
and healthy individuals were not statistically significant. However, the (TA)7/(TA)7 genotype was
more prevalent in patients with spherocythosis (24.62%) and with G6PD deficiency (23.08%) in
comparison with healthy individuals and thalassaemia patients.
Additionally, we observed a statistically significant difference in the (TA)6/(TA)6 genotype
distribution between healthy individuals and patients with glucose-6-phosphate dehydrogenase
deficiency, where it was found in only 21.15% of patients (p=0.041).
Table 1 Frequency of the UGT1A1 gene promoter variants in healthy individuals and in different groups of
hereditary haemolytic anaemia in Polish population
Patients
Healthy
individuals
Hereditary
spherocytosis
β-thalassaemia
G6PD
Total (%)
*p<0.05
Total
Genotype - number of cases (%)
7/7
5/7
6/6
6/7
5/6
7/8
182
66 (36.26)
82 (45.05)
33 (18.13)
1 (0.55)
0
0
65
24 (36.92)
23 (35.38)
16 (24.62)
2 (3.08)
0
0
139
52
438
57 (41.00)
11 (21.15)*
158 (36.0)
55 (39.57)
29( 55.77)
189 (43.15)
25 (17.99)
12 (23.08)
86 (19.64)
0
0
3 (0.68)
1 (0.72)
0
1 (0.23)
1 (0.72)
0
1 (0.23)
Extremely rare variants ((TA)5/(TA)6, (TA)5/(TA)7, (TA)7/(TA)8) of the promoter repeat were
identified in Polish individuals (Figure 1). The (TA)5/(TA)6 and the (TA)7/(TA)8 genotypes was found
only in the β-thalassaemia group but the (TA)5/(TA)7 genotype was found in the hereditary
spherocytosis group and in the control group. These rare genotypes were not detected in the group of
G6PD-deficient patients.
DISCUSSION
In this study we present the distribution of the most common TATA box genotypes in 438
Polish individuals. No similar data for Poland is available. The average frequency of the (TA)7/(TA)7
genotype, responsible for a decreased the expression of the UGT1A1 gene, was 19.64%. Several
previous studies have reported the prevalence of the (TA)7/(TA)7 variant in European population of 610% [1, 4-8], significantly less than the result obtained in our study (Table 2). In contrast with
European populations high frequency of (TA)7/(TA)7 allele was found in some area in Africa, like
Nigeria [12], Cameroon, Ghana, southern Sudan and in Ethiopia [6]. On the other hand, there was
no systematic, population-based studies on (TA)7 promoter sequence of UGT1A1 gene. Therefore,
the discrepancy between our results and some published data may be due to differences between
populations/ethnic groups or it may depend on the number of patients involved in the study.
Table 2 Frequency of the UGT1A1 gene promoter variants in different European populations. ns - the
A(TA)5TAA and A(TA)8TAA motifs were not studied/data of the A(TA)5TAA and A(TA)8TAA motifs not
showed
Population
Polish
Slovenian [1]
Greek [4]
Swedish [8]
Sardinian [9]
Scottish [10]
Portuguese [11]
Total
182
236
37
248
70
77
75
6/6
66 (36.26)
90 (38.10)
18 (48.65)
112 (45.16)
39 (55.71)
40 (31.00)
40 (53.33)
Genotype - number of cases (%)
6/7
7/7
5/7
82 (45.05)
33 (18.13)
1 (0.55)
113 (47.90)
32 (13.6)
0
12 (32.43)
7 (18.92)
ns
112 (45.6)
24 (9.68)
ns
24(34.29)
7 (10.00)
ns
38 (37.00)
12 (9.00)
ns
29 (38.67)
5 (6.67)
1 (1.33)
5/6
0
0
ns
ns
ns
ns
0
7/8
0
1 (0.40)
ns
ns
ns
ns
0
It has been reported that patients with hereditary spherocythosis or thalassemia minor and coinherited GS have a greater risk of developing gallstones [5, 7]. The knowledge of the possible
coexistence of Gilbert’s syndrome and hereditary haemolytic anaemia would be crucial for an accurate
diagnosis of the reason of an increased level of unconjugated bilirubin. Kaplan et al. [13] and
Galanello et al. [10] have shown that there was no statistically significant difference in the frequency
of (TA)7/(TA)7 among G6PD deficient patients and normal subjects. In our study, the distribution of
the three common genotypes was similar in the control group and in the haemolytic anaemia groups.
However, the occurrence of the normal (TA)6/(TA)6 genotype was statistically significant lower in
G6PD-deficient patients than in healthy individuals and the number of G6PD-deficient patients with
the (TA)7/(TA)7 genotype was higher in this group (statistically insignificant). This finding is
important, because promoter variant has been shown to be responsible for hyperbilirubinemia during
acute hemolytic anemia in G6PD-deficient patients [14].
In the present study we also discovered rarely observed A(TA)nTAA variants in the promoter
region of the UGT1A1 gene. In an African population other variants of the TATA box have been
identified: A(TA)5TAA and A(TA)8TAA [15]. The A(TA)5TAA motif does not affect transcriptional
activity of the UGT1A1 gene, but patients with the A(TA)8TAA motif, similarly to those with the
A(TA)7TAA motif, develop Gilbert’s syndrome [16]. (TA)5/(TA)6 causes a mildly elevated total serum
bilirubin, (TA)5/(TA)7 prolonged neonatal jaundice, but (TA)7/(TA)8 genotype has a non-fasting total
serum bilirubin that is even slightly higher than in most GS patients [10]. In fact, the (TA)7/(TA)7
variant is mostly observed in Caucasian and African populations whereas in Asians the prevalent
mutation is G71R due to a change from G to A in nucleotide 211 in exon 1 of UGT1A1 gene [17].
Recently, several rare variants of the UGT1A1 gene promoter have been reported in
Caucasians: a (TA)7/(TA)8 variant in an Italian girl [18], (TA)6/(TA)8 in a Greek boy [19], (TA)7/(TA)8
in two girls and (TA)5/(TA)7 in one subject in Portugal [11], and two subjects with (TA)7/(TA)8 and
one with (TA)6/(TA)8 variant in Croatia [20]. Our investigation support the suggestion of Iolascon et
al.[18] that the A(TA)8TAA motif in the UGT1A1 gene promoter is probably due to spontaneous
mutation, because (TA)n repeats are particularly unstable and may be lengthened or shortened by a
variety of mechanisms [18].
In conclusion, the genotyping of the UGT1A1 gene was carried out in the Polish population for
the first time and the results showed a distribution of the common A(TA)nTAA variants slightly
different than in other European populations. The present results could be relevant for Northern
Europe as the earlier data were obtained mainly in the Mediterranean area. Additionally, we detected
promoter variants that are very rare in the Caucasians. Moreover, the (TA)6/(TA)7 and (TA)7/(TA)7
genotypes occurred slightly more frequently in patients with G6PD deficiency.
It is also noteworthy that such genotyping should be performed in hereditary haemolytic
anaemia patients, as Gilbert’s syndrome is a risk factor for developing cholelithiasis.
Competing interests: None declared.
REFERENCES
1. Ostanek B, Furlan D, Mavec T, Lukac-Bajalo J. UGT1A1(TA)n promoter polymorphism - A
new case of a (TA)8 allele in Caucasians. Blood Cells, Molecules, and Diseases 2007;38:7882.
2. Radu P, Atsmon J. Gilbert’s Syndrome – Clinical and pharmacological implications. IMAJ
2001;3:593-598.
3. Bosma PJ, Chowdhury JR, Bakker C, Gantla S, De Boer A, Oostra BA, Lindhout D, Tytgat
GNJ, Jansen PLM, Ronald PJ, Elferink O, Chowdhury NR. The genetic basis of reduced
expression of bilirubin UDP-glucuronosyltransferase 1 in Gilbert’s syndrome. The New
England Journal of Medicine 1995;333(18):1171-1175.
4. Kalotychou V, Antonatou K, Tzanatea R, Terpos E, Loukopoulos D, Rombos Y. Analysis of
the A(TA)nTAA configuration in the promoter region of the UGT1 A1 gene in Greek patients
with thalassemia intermedia and sickle cell disease. Blood Cells, Molecules, and Diseases
2003;31:38-42.
5. Borgna-Pignatti C, Rigon F, Merlo L, Chakrok R, Micciolo R, Perseu L, Galanello R.
Thalassemia minor, the Gilbert mutation, and the risk of gallstones. Haematologica
2003;88:1106-1109.
6. Horsfall LJ, Zeitlyn D, Tarekegn A, Bekele E, Thomas MG,5, Bradman N, Swallow DM.
Prevalence of clinically relevant UGT1A allelesand haplotypes in African populations. Annals
of Human Genetics 2011;75:236-246.
7. Rocha S, Costa E, Ferreira F, Cleto E, Barbot J, Rocha-Pereira P, Quintanilha A, Belo L,
Santos-Silva A. Hereditary spherocytosis and the (TA)nTAA polymorphism of UGT1A1 gene
promoter region--a comparison of the bilirubin plasmatic levels in the different clinical forms.
Blood Cells Mol Dis 2010;44(2):117-119.
8. Mercke Odeberg J, Andrade J, Holmberg K, Hoglund P, Malmqvist U, Odeberg J. UGT1A
polymorphisms in a Swedish cohort and a human diversity panel, and the relation to bilirubin
plasma levels in males and females. Eur J Clin Pharmacol 2006;62:829–837.
9. Galanello R, Cipollina MD, Carboni G, Perseu L, Barella S, Corrias A, Cao A.
Hyperbilirubinemia, glucose-6-phosphate dehydrogenase deficiency and Gilbert’s syndrome.
Eur J Pediatr 1999;158:914-916.
10. Burchell B, Hume R. Molecular genetic basis of Gilbert’s syndrome. Journal of
Gastroenterology and Hepatology 1999;14:960-966.
11. Costaa E, Vieirab E, Martinsc M, Saraivad J, Cancelae E, Costaf M, Bauerleg R, Freitash T,
Carvalhoh JR, Santos-Silvai E, Barbotj J, dos Santosb R. Analysis of the UDPglucuronosyltransferase gene in Portuguese patients with a clinical diagnosis of Gilbert and
Crigler–Najjar syndromes. Blood Cells, Molecules, and Diseases 2006;36: 91-97.
12. Kaplan M, Slusher T, Renbaum P, Essiet DF, Pam S, Levy-Lahad E, Hammerman C. (TA)n
UDP-Glucuronosyltransferase 1A1 promoter polymorphism in Nigerian neonates. Pediatric
Research 2008;63:109-111.
13. Kaplan M, Renbaum P, Levy-Lahad E, Hammerman C, Lahad A, Beutler E. Gilbert syndrome
and glucose-6-phosphate dehydrogenase deficiency: A dose-dependent genetic interaction
crucial to neonatal hyperbilirubinemia. Proc. Natl. Acad. Sci. USA 1997;94:12128-12132.
14. Beutler E, Gelbart T, Demina A. Racial variability in the UDP-glucuronosyltransferase 1
(UGT1A1) promoter: A balanced polymorphism for regulation of bilirubin metabolism?
Proceedings of the National Academy of Sciences USA 1998;95:8170-8174.
15. Cappellini MD, Martinez di Montemuros F, Sampietro M, Tavazzi D, Fiorelli G. The
interaction between Gilbert's syndrome and G6PD deficiency influences bilirubin levels. Br J
Haematol 1999;104(4):928-929.
16. Mauro Y, Iwai
M, Mori
A, Sato H, Takeuchi
Y. Polymorphism of
UDP-
Glucuronosyltransferase and drug metabolism. Current Drug Metabolism 2005;6:91-99.
17. Koiwai O, Nishizawa M, Hasada K, Aono S, Adachi Y, Mamlya N, Sato H. Gilbert's
syndrome is caused by a heterozygous missense mutation in the gene for bilirubin UDPglucuronosyltransferase. Hum. Mol. Genet. 1995;4(7):1183-1186.
18. Iolascon A, Faienza MF, Centra M, Storelli S, Zelante L, Savoia A. (TA)8 allele in the
UGT1A1 gene promoter of a Caucasian with Gilbert’s syndrome. Haematologica
1999;84:106-109.
19. Tsezou A, Tzetis M, Kitsiou S, Kavazarakis E, Galla A, Kanavakis E. A Caucasian boy with
Gilbert’s syndrome heterozygous for the (TA)8 allele. Haematologica 2000;85:319-336.
20. Nikolac N, Simundic AM, Topic E, Jurcic Z, Stefanovic M, Dumic J, Goreta SS. Rare TA
repeats in promoter TATA box of the UDP glucuronosyltranferase (UGT1A1) gene in
Croatian subjects. Clinical Chemical Laboratory Medicine 2008;46(2):174-178.
Figure 1.
A chromatogram of the capillary electrophoresis of the UGT1A1 gene promoter. The
red peak (139) represents an internal standard, the 135 peak (blue) represents the
A(TA)5TAA motif, the 137 peak (blue) represents the A(TA)6TAA motif, the 139 peak
(blue) the A(TA)7TAA motif, and 141 peak (blue) the A(TA)8TAA motif.