Am J Physiol Cell Physiol 304: C858–C872, 2013.
First published February 13, 2013; doi:10.1152/ajpcell.00368.2012.
Voltage dependence of the Ca2⫹-activated K⫹ channel KCa3.1 in human
erythroleukemia cells
Colin J. Stoneking, Oshini Shivakumar, David Nicholson Thomas, William H. Colledge,
and Michael J. Mason
Department of Physiology, Development, and Neuroscience, University of Cambridge, Cambridge, United Kingdom
Submitted 19 November 2012; accepted in final form 6 February 2013
Stoneking CJ, Shivakumar O, Nicholson Thomas D,
Colledge WH, Mason MJ. Voltage dependence of the Ca2⫹activated K⫹ channel KCa3.1 in human erythroleukemia cells. Am
J Physiol Cell Physiol 304: C858 –C872, 2013. First published
February 13, 2013; doi:10.1152/ajpcell.00368.2012.—We have
isolated a K⫹-selective, Ca2⫹-dependent whole cell current and single-channel correlate in the human erythroleukemia (HEL) cell line.
The whole cell current was inhibited by the intermediate-conductance
KCa3.1 inhibitors clotrimazole, TRAM-34, and charybdotoxin, unaffected by the small-conductance KCa2 family inhibitor apamin and the
large-conductance KCa1.1 inhibitors paxilline and iberiotoxin, and
augmented by NS309. The single-channel correlate of the whole cell
current was blocked by TRAM-34 and clotrimazole, insensitive to
paxilline, and augmented by NS309 and had a single-channel conductance in physiological K⫹ gradients of ⬃9 pS. RT-PCR revealed
that the KCa3.1 gene, but not the KCa1.1 gene, was expressed in HEL
cells. The KCa3.1 current, isolated in HEL cells under whole cell
patch-clamp conditions, displayed an activated current component
during depolarizing voltage steps from hyperpolarized holding potentials and tail currents upon repolarization, consistent with voltagedependent modulation. This activated current increased with increasing voltage steps above ⫺40 mV and was sensitive to inhibition by
clotrimazole, TRAM-34, and charybdotoxin and insensitive to
apamin, paxilline, and iberiotoxin. In single-channel experiments,
depolarization resulted in an increase in open channel probability (Po)
of KCa3.1, with no increase in channel number. The voltage modulation of Po was an increasing monotonic function of voltage. In the
absence of elevated Ca2⫹, voltage was ineffective at inducing channel
activity in whole cell and single-channel experiments. These data
indicate that KCa3.1 in HEL cells displays a unique form of voltage
dependence modulating Po.
voltage dependence; KCa3.1; open channel probability; potassium
channel
the activity of several plasma
membrane ion channels (4, 39, 45). Of these, Ca2⫹-activated
K⫹ channels are of particular importance, forming a large and
diverse family (reviewed in Refs. 18 and 42). Under physiological conditions, these channels mediate an efflux of K⫹ in
response to increases in cytoplasmic Ca2⫹, which leads to
membrane hyperpolarization. The associated hyperpolarization
and K⫹ efflux have been ascribed important roles. The hyperpolarization accompanying activation of these channels (27)
can have positive and negative effects on the magnitude of
Ca2⫹ transients. On one hand, the hyperpolarization increases
the driving force for store-regulated Ca2⫹ entry in nonexcitable
cells (7, 40). However, activation of these channels can suppress Ca2⫹ entry via voltage-gated Ca2⫹ channels (31), preCALCIUM DIRECTLY MODULATES
Address for reprint requests and other correspondence: M. J. Mason, Dept.
of Physiology, Development, and Neuroscience, Univ. of Cambridge, Downing St., Cambridge, CB2 3EG, UK (e-mail: mjm39@cam.ac.uk).
C858
sumably due to the resulting hyperpolarization. In addition to
the role of these channels in hyperpolarization, K⫹ efflux has
been implicated in some secretory processes (37) and in erythrocyte osmoregulation (20).
Ca2⫹-activated K⫹ channels can be classified into three
distinct classes on the basis of single-channel conductance,
inhibitor and activator sensitivity, and gene identification (1,
43). The small-conductance class contains three members,
KCa2.1, KCa2.2, and KCa2.3, encoded in humans by the
KCNN1, KCNN2, and KCNN3 genes, respectively (hereafter
referred to as the KCa2 family; alternative channel designations: SKCa1, SKCa2, and SKCa3; SK1, SK2, and SK3). The
intermediate-conductance channel family consists of a single
member, KCa3.1, encoded in humans by the KCNN4 gene
(alternative channel designations: IK1, IKCa1, SK4, and Gardos). This channel has a unitary conductance in physiological
K⫹ gradients of 9 –12 pS (10, 14, 22). Importantly, the smalland intermediate-conductance channel families are generally
considered to not be modulated by membrane voltage (1, 43).
This is in marked contrast to the third class of Ca2⫹activated K⫹ channels, the large-conductance channel
KCa1.1 (alternative channel designations: Slo, Slo1, BK, and
maxi-K⫹), encoded by the KCNMA1 gene in humans. This
channel is activated in a synergistic fashion by membrane
depolarization and Ca2⫹ (reviewed in Ref. 36).
The three classes of Ca2⫹-activated K⫹ channels are also
distinguished by their sensitivity to a variety of inhibitory
agents, such as apamin, charybdotoxin, clotrimazole, TRAM34, paxilline, and iberiotoxin (1, 43). The KCa2 family of
channels can be distinguished from KCa3.1 and KCa1.1 channels on the basis of their sensitivity to block by the bee venom
apamin and insensitivity to the scorpion toxin charybdotoxin,
which blocks KCa3.1 and KCa1.1 channels. KCa3.1 is selectively blocked by clotrimazole and TRAM-34, both of which
have no effect on SK and BK channels. Finally, the KCa1.1
channel is selectively inhibited by paxilline and iberiotoxin. By
testing the sensitivity of a Ca2⫹-activated K⫹ current to a
broad spectrum of inhibitory agents, it is possible to determine
which of the three classes of Ca2⫹-activated K⫹ channels
underlies the specific conductance under investigation.
While the KCa2 family and KCa3.1 channel have been reported
to be devoid of voltage modulation (1, 43), at least three reports in
the literature demonstrate a time-dependent activation of the
current at depolarized potentials. This activated component of
KCa3.1 is suggestive of voltage modulation of the channel by a
process independent of the effect of voltage on driving force (7,
14, 16). In one case, this activated component was accompanied
by small tail currents, consistent with the expectation for voltageactivated currents (14). No investigations of the activated current
component of the whole cell response to depolarizing voltage
0363-6143/13 Copyright © 2013 the American Physiological Society
http://www.ajpcell.org
VOLTAGE DEPENDENCE OF KCa3.1
steps have been reported. Experiments performed in our laboratory on the human erythroleukemia (HEL) cell line have isolated
a Ca2⫹-activated K⫹ current with characteristics identical to those
reported for KCa3.1. Interestingly, we have consistently observed
a marked activated current component of the whole cell response
that suggests that this current may be activated by depolarization.
On the basis of these preliminary observations, we have undertaken a more detailed investigation of the influence of membrane
potential on modulation of KCa3.1 in HEL cells.
MATERIALS AND METHODS
Reagents
NaCl and KCl were purchased from Sigma-Aldrich (Gillingham,
Dorset, UK) or Fisher Scientific (Loughborough, Leicestershire, UK).
MgCl2, HEPES, sodium methanesulfonate, potassium methanesulfonate, N-methyl-D-glucamine (NMDG⫹), BAPTA, EGTA, NaOH,
KOH, DMSO, and PMA were purchased from Sigma-Aldrich. CaCl2
was purchased from VWR International (Lutterworth, Leicestershire,
UK) or BDH (Poole, Dorset, UK). MgSO4 was purchased from BDH.
D-Glucose was purchased from Fissons Scientific Apparatus (Loughborough, Leicestershire, UK). Clotrimazole and NS309 were purchased from Sigma-Aldrich and made up in DMSO. E-4031 was
obtained from Merck Bioscience Calbiochem (Nottingham, Nottinghamshire, UK) and made up in distilled water. Paxilline was purchased from Enzo Life Sciences (Exeter, Devon, UK), and TRAM-34
was purchased from R & D Systems (Abingdon, Oxford, UK); both
were made up in DMSO. Charybdotoxin and iberiotoxin were purchased from AnaSpec (San Jose, CA), and apamin was purchased
from Sigma-Aldrich; all toxins were made up in distilled water.
Cell Culture
HEL cells, a human erythroleukemia cell line (24), were originally
obtained from the European Collection of Animal Cell Cultures
(Porton Down, Salisbury, UK). THP-1 cells, a human monocytic
leukemia cell line (41), were obtained from Dr. Andres Floto (Cambridge Institute for Medical Research, Cambridge, UK). HTR-8/
SVneo cells, an extravillous trophoblast-derived human cell line (8),
was originally obtained from Dr. Javier Tello (Medical Research
Council Reproductive Sciences Unit, Edinburgh, UK). HEL and
THP-1 cells were propagated in HCO⫺
3 -buffered RPMI 1640 medium
supplemented with 10% fetal bovine serum, 4 mM L-glutamine, 100
U/ml penicillin, and 50 ␮g/ml streptomycin (all from Sigma-Aldrich
or Invitrogen, Paisley, UK). HTR-8/SVneo cells were propagated in
RPMI 1640 medium, as described above, except 5% fetal bovine
serum and 2 mM L-glutamine were used. HEL and undifferentiated
THP-1 cells were grown in suspension and passaged two to three
times per week. HTR-8/SVneo cells are an adherent cell line passaged
by trypsinization two to three times per week. THP-1 cells were
differentiated by addition of 8 ng/ml PMA to the culture medium.
Differentiation was indicated by cell adherence and spreading to the
culture dish. Differentiated THP-1 cells were harvested for mRNA
purification after 3 days by scraping, while adherent HTR-8/SVneo
cells were removed by trypsinization. For mRNA purification, all cells
were centrifuged and washed in standard NaCl-based extracellular
solution (see Solutions) to remove serum.
Solutions
Whole cell recordings. For whole cell recording, the standard
KCl-based pipette solution contained (mM) 150 KCl, 4.4438 CaCl2,
5.0703 MgCl2, 5 BAPTA, and 10 HEPES, with pH adjusted to 7.2
with KOH (⬃172 mM calculated total K⫹). The values for Ca2⫹ and
Mg2⫹ are the theoretical total concentrations that are added to yield 2
␮M free Ca2⫹ and 5 mM free Mg2⫹, as determined by WEBMAXC
with extended constants (www.stanford.edu/⬃cpatton/maxc.html)
C859
(30). Zero Ca2⫹ and 10 ␮M Ca2⫹ internal solutions were made by
omitting or altering total Ca2⫹ and adjusting total Mg2⫹ to maintain
5 mM free Mg2⫹. Low-Cl⫺ internal solution was made by equimolar
substitution of KCl with K-methanesulfonate and substitution of
MgCl2 with MgSO4.
The standard NaCl-based extracellular solution contained (mM)
145 NaCl, 5 KCl, 1 CaCl2, 1 MgCl2, 10 glucose, and 10 HEPES, with
pH adjusted to 7.35 with NaOH (149 mM calculated total Na⫹).
High-K⫹ solution contained (mM) 150 KCl, 1 CaCl2, 1 MgCl2, 10
glucose, and 10 HEPES, with pH adjusted to 7.35 with KOH (154 mM
calculated total K⫹). Low-Cl⫺ external solution was made by
equimolar substitution of NaCl with Na-methanesulfonate, KCl with
K-methanesulfonate, and MgCl2 with MgSO4. All solution changes in
the experimental chamber were made by gravity-fed superfusion.
Excised inside-out single-channel recordings. For excised insideout single-channel recordings, the pipette solution was identical to the
standard NaCl-based extracellular solution used for whole cell recordings.
The standard KCl-based bath solution contained (mM) 150 KCl,
4.5290 CaCl2, 5.0869 MgCl2, 5 EGTA, and 10 HEPES, with pH
adjusted to 7.2 with KOH (⬃172 mM calculated K⫹). These theoretical values for total Ca2⫹ and Mg2⫹ yield 2 ␮M free Ca2⫹ and 5 mM
free Mg2⫹, as determined by WEBMAXC with extended constants.
Total Ca2⫹ and Mg2⫹ were altered using values obtained from
WEBMAXC to yield solutions of free Ca2⫹ and Mg2⫹ as defined in
the text. K⫹-free bath solution was made by equimolar substitution of
K⫹ for NMDG⫹.
RT-PCR for detection of KCNN4 and KCNMA1 gene expression.
RNA was purified from each cell line using the SV Total RNA Isolation
System (Promega, Madison, WI) according to the manufacturer’s instructions, except the on-column DNase step to reduce genomic DNA was
extended to 1 h. cDNA was synthesized from the total RNA using the
GoScript reverse transcription system (Promega) according to the manufacturer’s instructions, with oligo(dT)15 and random primers used for
the first-strand synthesis. PCR was performed using the following primers designed using online Primer3 software (frodo.wi.mit.edu): KCNN4
[GTGCCTCAGAGCAAAAGTCC (forward) and TGCTGATCGTGCATTTAACC (reverse), 332-bp PCR product from cDNA] and
KCNMA1 [ATATCCACGCGAACCATCTC (forward) and TGGCTTGAGCCATTGTTAATC (reverse), 328-bp PCR product from cDNA].
PCR cycle conditions were as follows: once at 95°C for 5 min followed
by 40 times at different temperatures for different times (95°C for 15 s,
60°C for 30 s, and 72°C for 30 s), and finally once at 72°C for 2 min.
No-cDNA and reverse transcriptase-negative controls were included in
the PCRs. PCR products were analyzed on a 1% agarose gel and
visualized with SafeView (NBS Biologicals, Huntingdon, UK) under UV
light. All PCR products were confirmed by sequencing.
Recording, Data Acquisition, and Analysis
Cells were added to a low-volume Plexiglas chamber mounted on
the stage of an inverted microscope. The bottom of the chamber was
formed by adherence of a glass coverslip with silicone grease. The
chamber was grounded via a Ag/AgCl wire placed directly in the
chamber downstream of the cells. Tight-seal whole cell patch-clamp
recordings in voltage-clamp mode and excised single-channel recordings were carried out using an Axopatch 200A amplifier (Molecular
Devices, Union City, CA). The series resistance compensation feature
of the amplifier was used to achieve 70% series resistance compensation in whole cell recordings. Electrodes were pulled from filamented borosilicate glass (Harvard Apparatus, Kent, UK), and the tips
were fire-polished. Electrodes had resistances of 2– 8 M⍀ when filled
with standard KCl-based internal solution for whole cell recordings
and 10 –14 M⍀ when filled with NaCl-based solution for excised
patch recordings. All experiments were performed at room temperature (20 –24°C).
AJP-Cell Physiol • doi:10.1152/ajpcell.00368.2012 • www.ajpcell.org
C860
VOLTAGE DEPENDENCE OF KCa3.1
Amplifier control and data acquisition were performed using Axograph 4.9 or Axograph X software (Axograph Scientific, Sydney,
Australia) running on a Macintosh computer using a Digidata 1322A
16-bit data acquisition system (Molecular Devices, Union City,
CA). Analysis was performed using Axograph and custom macros
and procedures written within IGOR Pro (Wavemetrics, Lake
Oswego, OR).
In whole cell recordings, 500-ms voltage steps from ⫺103 to
⫹97 mV were applied from a holding potential of ⫺103 or ⫺3
mV. The data were filtered at 1 kHz using the four-pole Bessel
filter of the Axopatch 200A amplifier and acquired at 5 kHz. All
data represent the raw whole cell currents uncorrected for the
presence of background currents. The “step current” was measured
as the mean current over a 1- to 2-ms interval immediately after
dissipation of any uncompensated capacitative transients. The “activated current” was calculated as the difference between the step
current and the steady-state current, measured as an average within the
last 6 ms of the voltage step. Reversal potentials were estimated by
interpolation of the current-voltage (I-V) relationship around zero
current during steps from a holding potential of ⫺103 mV.
Excised single-channel data were filtered at 1 or 2 kHz and
acquired at 10 kHz. When required, channel activity was quantified
using all-points-amplitude histograms produced using the built-in
histogram routine within IGOR Pro with a current bin width of 0.05
pA. The calculated amplitude histograms were fit to the sum of
multiple Gaussian distributions using the multipeak fitting routine
within IGOR Pro. The calculated areas A of the individual Gaussian
peaks of the multipeak fit were taken directly from the output of the
peak fitting routine and used to calculate NPo, were N is the number
of channels and Po is the open channel probability. If it is assumed
that all channels are identical and behave independently, NPo can be
determined from the areas of individual Gaussian peaks using the
following relationship (3) as modified from Selyanko et al. (33) and Li
et al. (21)
N
NPo ⫽
兺 iAi
i⫽0
N
兺 Ai
i⫽0
where Ai is the area of the corresponding Gaussian peak for i open
channels and N is the number of current levels in the patch as
determined by the number of Gaussian peaks corresponding to multiples of the unitary single-channel current.
Unitary single-channel currents were determined by averaging the
current during brief, 5- to 10-ms, openings, during which the channel
was continuously open, and subtracting the average current during
adjacent brief periods when the channel was closed. We avoided open
periods containing brief or partial closures of the channel to ensure that
unitary current estimates were not contaminated by filtering artifacts. The
slope conductance of the channel was determined from the slope of the linear
fit of the I-V relationship between ⫺23 and ⫹17 mV.
To analyze the effect of membrane potential on channel activity,
we used a repetitive step protocol in which the patch was stepped
between ⫺3 mV and the test potential at 5-s intervals. The first second
after each voltage change was discarded to avoid capacitive transients,
and the remaining data were combined into two data sets, one at ⫺3
mV and one at the test potential. These were used to generate two
all-points-amplitude histograms, one at ⫺3 mV and one at the test
potential. On average, 30 – 40 voltage steps were used to generate
these histograms. This protocol avoids any bias due to changes in
basal channel activity during the experiment.
For the whole cell experiments initiated with KCl-based pipette
solutions and NaCl-based bath solutions, a ⫹3-mV junction potential
correction was applied to all voltages presented in RESULTS (28). For
the excised inside-out single-channel data initiated with NaCl-based
pipette solution and a KCl-based bath solution, a ⫺3-mV junction
potential correction was applied (28). The single-channel current data
are presented such that upward deflections represent an outward
current and all voltages are membrane potential; intracellular face of
the patch relative to the extracellular face of the patch. For presentation purposes, single-channel data recordings have been filtered using
a binomial filter within IGOR Pro. Data filtered only at the level of the
Axopatch 200A amplifier were used for all analyses.
Values are means ⫾ SE. Differences were considered statistically
significant at P ⱕ 0.05. The effect of intracellular Ca2⫹, holding
potential, or inhibitors and activators on the steady-state, step, or
activated component of the whole cell I-V relationship was analyzed
using two-way ANOVA for related or unrelated samples as appropriate. Factor 1 consists of 11 levels corresponding to the 11 voltage
steps from ⫺103 to ⫹97 mV (9 levels in the case of the analysis of
the effect of charybdotoxin on the activated current component; see
RESULTS); factor 2 consists of two levels corresponding to the control
and experimental condition under investigation. Our analyses of these
data focused on the determination of significant differences within
factor 2 (i.e., control vs. experimental condition) across the combined
levels of factor 1. In other experiments, significance of differences
between means was determined using Student’s t-test for paired or
unpaired samples, Welch’s t-test for unequal variance, or one- or
two-way ANOVA for related or unrelated samples as appropriate.
Bonferroni’s tests with correction for multiple comparisons were used
for post hoc comparisons when required. For determination of significant differences from normalized data values of 1, confidence intervals corrected for multiple comparisons were used.
RESULTS
To detect a Ca2⫹-activated K⫹ conductance, HEL cells were
whole cell patch-clamped with a KCl-based pipette solution
buffered to 2 ␮M free Ca2⫹ and 5 mM free Mg2⫹ with BAPTA
(⬃172 mM K⫹), and 500-ms voltage steps to different potentials were applied from a holding potential of ⫺103 mV in
20-mV increments. To ensure that the whole cell currents
recorded were not contaminated by TRPM7, which is constitutively activated in HEL cells (26), the pipette solution had a
free Mg2⫹ concentration of 5 mM to inhibit this conductance.
Figure 1A shows representative currents recorded in response
to the indicated voltage steps. All voltages have been corrected
for a ⫹3-mV junction potential (see MATERIALS AND METHODS).
The cell was superfused with normal NaCl solution containing
5 mM K⫹. The mean whole cell steady-state I-V relationship
for the peak current recorded in 49 cells is shown in Fig. 1C.
The steady-state current was measured at the end of the 500-ms
voltage step (arrow in Fig. 1, A and B). The current reversed at
a negative potential close to the K⫹ equilibrium potential,
consistent with K⫹ being the dominant charge carrier. The
Ca2⫹ dependence of the K⫹ current was confirmed by application of identical voltage steps to cells whole cell patched
with a pipette solution devoid of Ca2⫹. Under these conditions,
little current was detected (Fig. 1B). A two-way ANOVA was
performed to confirm the statistical significance of the influence of intracellular Ca2⫹ (see Recording, Data Acquisition,
and Analysis). The mean I-V relationship from seven cells
patched with this 0 Ca2⫹ internal solution showed a significant
reduction in the whole cell current relative to cells patched with
2 ␮M Ca2⫹ solution (P ⱕ 0.05) and a reversal potential near 0
mV, consistent with the absence of a dominant K⫹ conductance (Fig. 1C).
To directly investigate the K⫹ permeability of this Ca2⫹activated conductance, extracellular K⫹ was altered. Cells were
patched with the same 2 ␮M Ca2⫹-containing internal solution
AJP-Cell Physiol • doi:10.1152/ajpcell.00368.2012 • www.ajpcell.org
C861
VOLTAGE DEPENDENCE OF KCa3.1
A
B
800
2 µM Ca2+
600
400
500 ms
200
0
-200
0 Ca2+
600
Current (pA)
Current (pA)
800
400
500 ms
200
0
-200
+97
-103
+97
-103
800 I (pA)
C
1000 I (pA)
D
5 K+
600
154 K+ 500
400
200
-100
2 µM Ca2+
0 Ca2+
-100
-50
-500
*
-50
-200
50
100
Vm (mV)
50
100
Vm (mV)
-1000
0
E
from the data in Fig. 1D is plotted as a function of the logarithm
of extracellular K⫹ concentration in Fig. 1E (n ⫽ 10). These data
show a slope of 52 mV per decade change in extracellular K⫹, a
value in good agreement with that expected for a highly K⫹selective conductance in the presence of small residual background currents or a channel that is not perfectly selective for K⫹
over Na⫹.
It is clear in Fig. 1A that the current response to voltage steps
consists of two components, an initial instantaneous current in
response to the voltage steps (step component) and a secondary
slower-activating component (activated component). The activated component may be indicative of a voltage-dependent
process modulating the Ca2⫹-activated K⫹ conductance. To
investigate the effect of membrane voltage, cells were whole
cell patched with the same solution used in Fig. 1. Figure 2A
shows representative current responses to voltage steps from a
holding potential of ⫺103 mV; the step and activated current
components for the ⫹97-mV step are shown in the inset. In
Fig. 2C, the magnitude of the mean activated current component is plotted as a function of membrane potential for 49 cells.
No activated current component was observed until voltage
was stepped to ⫺43 mV; then a monotonic increase in the
activated current component was observed up to ⫹97 mV,
consistent with voltage modulation of the Ca2⫹-activated K⫹
conductance.
-50
A
-75
2⫹
1.0
1.5 2.0
log [K+]o
2.5
⫹
Fig. 1. Detection of a Ca -activated K current in human erythroleukemia
(HEL) cells. A: a cell was cell patched with a KCl-based pipette internal
solution with 2 ␮M free Ca2⫹ and superfused with standard extracellular
NaCl-based external solution containing 5 mM K⫹, and 500-ms voltage steps
in 20-mV increments from a holding potential of ⫺103 mV were applied.
B: a cell was whole cell patched with a KCl-based pipette internal solution
devoid of added Ca2⫹ and superfused with extracellular solution described in
A, and 500-ms voltage steps in 20-mV increments from a holding potential of
⫺103 mV were applied. C: mean current-voltage (I-V) relationship in cells
dialyzed with 2 ␮M free Ca2⫹ (n ⫽ 49) or 0 Ca2⫹ (n ⫽ 7). Current was
measured at the end of the voltage step, as indicated by arrows in A and B. Vm,
membrane potential. *Significantly different from 2 ␮M free Ca2⫹ (P ⱕ 0.05).
D: effect of extracellular K⫹ on whole cell I-V relationship. Cells were whole
cell patched with a KCl-based pipette internal solution with 2 ␮M, and
voltage-step protocol described in A was administered during superfusion of
each cell with 5 and 154 mM K⫹ solution (n ⫽ 10). Current was measured at
the end of the voltage step, as indicated by arrows in A and B. E: reversal
potential (Erev) in 5 and 154 mM extracellular K⫹ (n ⫽ 10) estimated from data
in D. Dotted line denotes theoretical reversal potential for a 58.5-mV shift per
decade change in extracellular K⫹ concentration ([K⫹]o) with 172 mM
intracellular K⫹. Values are means ⫾ SE; lack of error bars indicates that SE
is within the size of the symbol.
used in the experiments presented in Fig. 1A, and an identical
voltage-step protocol was administered during superfusion with 5
and 154 mM extracellular K⫹-containing solutions. The mean
steady-state whole cell I-V relationships obtained in 10 cells
superfused with 5 and 154 mM extracellular K⫹ are shown in Fig.
1D. Exposure to high-K⫹ solution resulted in a shift in the
reversal potential to values near ⫺3 mV, as expected for a highly
K⫹-selective conductance. The mean reversal potential estimated
Current (pA)
-100
0.5
B
500
500
Activated I
400
Step I
300
200
100
500 ms
0
-100
Current (pA)
Erev
-25
400
300
200
100
500 ms
0
-100
+97
+97
-3
-103
-103
C
300 I (pA)
Activated I
D
600 I (pA)
Step I
*
400
200
100
-103 mV HP
-3 mV HP
-100
-100
-50
50
100
Vm (mV)
-100
-50
50
100
Vm (mV)
-200
Fig. 2. Analysis of step and activated components of whole cell Ca2⫹-activated
K⫹ current response to voltage steps. A: a cell was whole cell patched with a
KCl-based pipette internal solution containing 2 ␮M free Ca2⫹ and superfused
with standard extracellular NaCl-based solution containing 5 mM K⫹, and
500-ms voltage steps in 20-mV increments from a holding potential of ⫺103
mV were applied. Inset: step and activated components of current response for
voltage step to ⫹97 mV. B: cell described in A was subjected to 500-ms
voltage steps as applied in A from a holding potential of ⫺3 mV. C: magnitude
of the activated component of the whole cell current response measured from
voltage steps applied in A (n ⫽ 49). D: magnitude of the step component of the
whole cell current response to voltage steps administered from ⫺103 and ⫺3
mV holding potentials (HP). Effects of both holding potentials were investigated in each cell. *Significantly different from ⫺103 mV (P ⱕ 0.05, n ⫽ 49).
Values are means ⫾ SE; lack of error bars indicates that SE was within the size
of the symbol.
AJP-Cell Physiol • doi:10.1152/ajpcell.00368.2012 • www.ajpcell.org
C862
VOLTAGE DEPENDENCE OF KCa3.1
Further support for the hypothesis that voltage steps lead to
a secondary voltage-dependent increase in K⫹ conductance is
provided by the small inward tail currents detected upon return
to ⫺103-mV holding potential following a depolarized voltage
step (Fig. 2A). No activated current or tail currents were
detected in the absence of elevated cytosolic Ca2⫹ (Fig. 1B),
consistent with the activated current being a component of the
Ca2⫹-activated K⫹ conductance.
Experiments in which voltage steps were applied from a
holding potential of ⫺3 mV are consistent with the hypothesis
that the noninactivating steady-state conductance value is a
monotonic increasing function of the membrane potential.
Figure 2B shows a representative experiment using a holding
potential of ⫺3 mV. Steps to potentials more positive than ⫺3
mV were accompanied by a slow increase in current. In
contrast, steps to potentials more negative than ⫺3 mV but
more positive than the reversal potential were accompanied by
a slow decrease in the current. When voltage steps were
applied from a holding potential of ⫺103 or ⫺3 mV, no
significant inactivation of the activated component over time
(i.e., decrease in current) was observed. The observation that
negative voltage steps applied from a holding potential of ⫺3
mV led to a slow decrease in the current is also consistent with
a lack of inactivation, since it indicates that the voltagedependent augmentation of the conductance at ⫺3 mV remains
even when the cell is held at this potential for prolonged
periods of time. To further investigate whether inactivation
occurred, we analyzed the initial step components of the
current evoked by voltage steps from ⫺103 and ⫺3 mV in
paired experiments in which voltage steps were applied from
both holding potentials in each of 49 cells (Fig. 2D). To
determine whether the holding potential altered the magnitude
of the initial step component, a repeated-measures two-way
ANOVA was performed (see Recording, Data Acquisition, and
Analysis). A significant main effect was found for the holding
potential factor, with the initial step component being significantly greater (P ⱕ 0.05, n ⫽ 49) when voltage steps were
made from a ⫺3-mV holding potential. This indicates that the
conductance was enhanced for the entire time the cell was held
at this potential.
While the KCa2 family and the KCa3.1 channel have been
reported to lack voltage dependence, it is well established that
the large-conductance Ca2⫹-activated K⫹ channel KCa1.1 displays pronounced voltage dependence (for review see Ref. 36).
Coexpression of the large-conductance channel with either of
the voltage-independent channel types could underlie the voltage dependence of the Ca2⫹-activated whole cell current. Such
coexpression has been reported in parotid acinar cells, with
voltage steps displaying a similar secondary current activation
at depolarized potentials (35). To investigate which channels
contribute to the voltage-dependent current, we tested its sensitivity to well-established inhibitors of voltage-independent
and -dependent Ca2⫹-activated K⫹ channels.
To test whether the KCa1.1 channel contributes, we investigated the effect of the KCa1.1-selective inhibitors paxilline and
iberiotoxin. Cells were whole cell patched with the same
KCl-based pipette solution buffered to 2 ␮M free Ca2⫹ used
previously, and the voltage-step protocol shown in Fig. 2A was
administered. Neither 50 nM (n ⫽ 4) nor 100 nM (n ⫽ 4)
iberiotoxin inhibited the activated component of the current
response to voltage steps. Figure 3A shows the effect of the
A
B
400 I (pA)
500 I (pA)
Activated I
Activated I
400
300
300
200
200
100
100
-100
-50
-100
C
400
Paxilline
Control
Iberiotoxin
50
100
Vm (mV)
-100
-50
-100
D
I (pA)
300
50
100
Vm (mV)
I (pA)
Activated I
Activated I
300
200
200
100
100
-100
-50
-100
Control
E-4031
Control
Apamin
50
100
Vm (mV)
-100
-50
50
100
Vm (mV)
-100
Fig. 3. Sensitivity of the activated current component to modulation by
established ion channel inhibitors. Cells were patched with a KCl-based pipette
internal solution containing 2 ␮M free Ca2⫹ and superfused with standard
extracellular NaCl-based solution containing 5 mM K⫹, and voltage-step
protocol shown in Fig. 2A was administered from a holding potential of ⫺103
mV. A: mean activated current component in the absence (control) and
presence of 50 or 100 nM iberiotoxin. Control and iberiotoxin data were
obtained from each cell (P ⱖ 0.05, n ⫽ 8). B: mean activated current
component following 10 min of incubation in 1 ␮M paxilline. C: mean
activated current component in the absence (control) and presence of 200 nM
apamin. Control and apamin data were obtained from each cell (P ⱖ 0.05,
n ⫽ 7). D: mean activated current component in the absence (control) and
presence of E-4031. Control and E-4031 data were obtained from each cell
(P ⱖ 0.05, n ⫽ 8). Values are means ⫾ SE; lack of error bars indicates that
SE is within the size of the symbol.
pooled mean data on the magnitude of the activated component
of the current response (P ⱖ 0.05, n ⫽ 8). The effect of
paxilline, an alternative selective inhibitor of KCa1.1 was also
investigated. Because the putative site of paxilline inhibition
may be intracellular (32), cells were superfused with 1 ␮M
paxilline for 10 min before the whole cell configuration was
obtained. This protocol, while not providing control current
information, was chosen to ensure adequate time for paxilline
to reach its putative intracellular site of inhibition. After 10 min
of paxilline exposure, the whole cell configuration was obtained and the voltage-step protocol was administered. As
clearly shown in Fig. 3B, voltage steps to depolarized potentials still resulted in a marked activated component of the
current, consistent with a lack of inhibition by paxilline of the
voltage-dependent component of the whole cell current (n ⫽
8). We undertook additional experiments where paxilline was
added directly to the patch pipette. Again, the activating
component of the current was robust, consistent with no
significant inhibition of the voltage-dependent component of
the response by paxilline (data not shown). Finally, preliminary
experiments employing acute exposure to paxilline revealed no
modulation of the control whole cell current response (data not
shown). The lack of sensitivity of the voltage-dependent,
AJP-Cell Physiol • doi:10.1152/ajpcell.00368.2012 • www.ajpcell.org
C863
VOLTAGE DEPENDENCE OF KCa3.1
400
Control
300
Current (pA)
Current (pA)
400
200
100
500 ms
0
200
100
500 ms
0
-100
-100
-200
-200
+97
-103
C
1 µM Clotrimazole
300
+97
-103
D
150 I (pA)
Activated I
300 I (pA)
Step I
100
200
Control
Clotrim.
Control
Clotrim.
50
*
-100
-50
-50
50
100
Vm (mV)
*
-100
-50
-100
50
100
Vm (mV)
Fig. 4. Effect of clotrimazole on step and activated components of the whole
cell Ca2⫹-activated K⫹ current. A: control response of a cell whole cellpatched with a KCl-based internal solution containing 2 ␮M free Ca2⫹ and
superfused with standard extracellular NaCl-based solution containing 5 mM
K⫹ (top). Voltage steps were administered from a holding potential of ⫺103
mV (bottom). B: cell described in A subjected to the same voltage-step protocol
in the presence of 1 ␮M clotrimazole. C: mean activated current component
(n ⫽ 6) of the whole cell response to voltage steps in the absence (control) and
presence of clotrimazole (Clotrim). Control and clotrimazole data were obtained from each cell. *Significantly different from control (P ⱕ 0.05).
D: mean step current component (n ⫽ 6) of the whole cell response to voltage
steps in the absence (control) and presence of clotrimazole. Control and
clotrimazole data were obtained from each cell. *Significantly different from
control (P ⱕ 0.05). Values are means ⫾ SE; lack of error bars indicates that
SE is within the size of the symbol.
activated current to iberiotoxin and paxilline argues against a
role for the well-established voltage dependence of KCa1.1 in
the response.
To define the role of the KCa2 family in the voltage-dependent
current, we investigated the effect of the KCa2-selective inhibitor
apamin on the response. Again, cells were whole cell patched with
an identical KCl-based pipette solution buffered to 2 ␮M free
Ca2⫹, and the same voltage-step protocol (see above) was administered from a holding potential of ⫺103 mV. As shown in Fig.
3C, apamin had no effect on the activated current component of
the response (P ⱖ 0.05, n ⫽ 7).
To investigate possible involvement of the intermediateconductance Ca2⫹-activated K⫹ channel KCa3.1, we used clotrimazole, a selective inhibitor of this channel. Again, cells
were whole cell patched with a KCl-based pipette solution
buffered to 2 ␮M free Ca2⫹. Figure 4, A and B, shows the
current response to step changes in membrane potential from a
⫺103-mV holding potential in the same cell in the absence and
presence of 1 ␮M clotrimazole. It is clear from this experiment
that clotrimazole markedly inhibits the activated and step
components of the current response to depolarizing voltage
steps. Figure 4C summarizes the results from six cells and
demonstrates a significant inhibition of the activated current
component of the response (P ⱕ 0.05, n ⫽ 6). Clotrimazole
also abolished the tail currents observed on return to ⫺103 mV
following a depolarizing step (Fig. 4B). Figure 4D summarizes
the significant inhibition of the step component of the current
in the same cells (P ⱕ 0.05, n ⫽ 6) and demonstrates a shift in
the reversal potential to depolarized potentials during inhibition of the current by clotrimazole. This shift in the reversal
potential is consistent with inhibition of a K⫹ current by
clotrimazole. To substantiate the involvement of KCa3.1 in the
voltage dependence, we investigated the sensitivity of the step
and activated components of the whole cell response to the
potent selective KCa3.1 inhibitor TRAM-34. Cells were again
whole cell patched with a KCl-based pipette solution buffered
to 2 ␮M free Ca2⫹. Figure 5, A and B, shows the current
response to step changes in membrane potential from a
⫺103-mV holding potential in the same cell in the absence and
presence of 1 ␮M TRAM-34. Consistent with inhibition by
clotrimazole, TRAM-34 also potently inhibits the activated and
step components of the current response to depolarizing voltage steps. Figure 5C summarizes the results from six cells and
demonstrates a significant inhibition of the activated current
component of the response to TRAM-34 (P ⱕ 0.05, n ⫽ 6).
TRAM-34 also abolished the small tail currents observed on
return to ⫺103 mV following depolarizing voltage steps (Fig.
5B). Figure 5D summarizes the significant inhibition of the
step component of the current in the same cells (P ⱕ 0.05, n ⫽
6) and demonstrates a shift in the reversal potential to depolarized potentials during inhibition of the current by TRAM-
A
B
600
600
Control
Current (pA)
B
Current (pA)
A
400
200
500 ms
0
-200
1 µM TRAM-34
400
200
500 ms
0
-200
+97
-103
+97
-103
C
D
400 I (pA)
Activated I
300 I (pA)
Step I
300
200
200
Control
TRAM-34
100
Control
TRAM-34
*
-100
-50
50
-100
100
-100
-50
-50
50
*
100
Fig. 5. Effect of TRAM-34 on step and activated components of the whole cell
Ca2⫹-activated K⫹ current. A: control response of a cell whole cell patched
with a KCl-based internal solution containing 2 ␮M free Ca2⫹ and superfused
with standard extracellular NaCl-based solution containing 5 mM K⫹. Voltage
steps were administered from a holding potential of ⫺103 mV. B: cell
described in A subjected to the same voltage-step protocol in the presence of
1 ␮M TRAM-34. C: mean activated current component (n ⫽ 6) of the whole
cell response to voltage steps in the absence (control) and presence of
TRAM-34. Control and TRAM-34 data were obtained from each cell. *Significantly different from control (P ⱕ 0.05). D: mean step current component
(n ⫽ 6) of the whole cell response to voltage steps in the absence (control) and
presence of TRAM-34. Control and TRAM-34 data were obtained from each
cell. *Significantly different from control (P ⱕ 0.05). Values are means ⫾ SE;
lack of error bars indicates that SE is within the size of the symbol.
AJP-Cell Physiol • doi:10.1152/ajpcell.00368.2012 • www.ajpcell.org
C864
VOLTAGE DEPENDENCE OF KCa3.1
34. The apparently greater inhibition of the step component
induced by TRAM-34 than clotrimazole may indicate a more
effective block by TRAM-34. While not fully investigated, in
preliminary experiments, TRAM-34 inhibition was only marginally reversible, in contrast to the marked reversibility of
clotrimazole.
As an additional final test to rule out involvement of the
KCa2 family in the voltage dependence and to further substantiate the role of KCa3.1 in the response, we investigated the
effect of charybdotoxin, an established inhibitor of KCa3.1 and
KCa1.1, but not the KCa2 family of channels. Figure 6, A and B,
shows the whole cell response to voltage steps in a cell patched
with a KCl-based internal solution buffered to 2 ␮M free Ca2⫹
in the absence and presence of 200 nM charybdotoxin. The
mean effect of charybdotoxin on the step component of the
current response in five cells is summarized in Fig. 5D.
Charybdotoxin significantly inhibited the step response to
voltage steps (P ⱕ 0.05, n ⫽ 5) and shifted the reversal
potential to more depolarized potentials. The fact that the
percent inhibition induced by charybdotoxin is less than that
induced by TRAM-34 may, like the clotrimazole results, indi-
A
B
400
400
CTX
Current (pA)
Current (pA)
Control
200
0
200
0
500 ms
500 ms
-200
-200
+97
+97
-103
-103
C
D
300 I (pA)
200 I (pA)
Activated I
Step I
150
Control
CTX
200
100
Control
CTX
50
*
-100
-50
-50
50
100
Vm (mV)
*
-100
50
100
Vm (mV)
-100
Fig. 6. Effect of charybdotoxin on step and activated components of the whole
cell Ca2⫹-activated K⫹ current. A: control response of a cell whole cellpatched with a KCl-based internal solution containing 2 ␮M free Ca2⫹ and
superfused with standard extracellular NaCl-based solution containing 5 mM
K⫹. Voltage steps were administered from a holding potential of ⫺103 mV.
B: cell described in A subjected to the same voltage-step protocol in the
presence of 200 nM charybdotoxin (CTX). C: mean activated current component (n ⫽ 6) of the whole cell response to voltage steps in the absence (control)
and presence of charybdotoxin. Control and charybdotoxin data were obtained
from each cell. *Significantly different (P ⱕ 0.05) from control current
response to voltage steps between ⫺103 and ⫹57 mV. D: mean step current
component (n ⫽ 6) of the whole cell response to voltage steps in the absence
(control) and presence of charybdotoxin. Control and charybdotoxin data were
obtained from each cell. *Significant difference (P ⱕ 0.05) from control
current response to voltage steps between ⫺103 and ⫹97 mV. Values are
means ⫾ SE; lack of error bars indicates that SE is within the size of the
symbol.
cate incomplete block by the concentration of toxin used. Our
analysis of the effect of charybdotoxin on the activated current
component of the response was hampered by the well-established voltage dependence of charybdotoxin block (2, 6, 9, 29).
Depolarization results in an increase in the off-rate of toxin
binding, resulting in release of block during prolonged depolarizations, such as those used in our experiments (2, 9, 29).
Such apparent release of block is evident in Fig. 6B, where the
current response to large depolarizations resulted in a timedependent activation of the current indistinguishable from the
activated component of the response under investigation. The
effect of large depolarizations is clear in Fig. 6D, where the mean
activated component at ⫹97 mV starts to approach that in
control conditions. With this in mind, we confined our two-way
ANOVA to depolarizing voltage steps between ⫺103 and ⫹57
mV in the absence and presence of toxin. Within this voltage
range, charybdotoxin significantly inhibited the voltage-dependent activated component of the whole cell current (P ⱕ 0.05,
n ⫽ 5), further supporting the conclusion that the voltage
dependence does not arise from KCa2 family activation. Given
that the KCa1.1 inhibitors paxilline and iberiotoxin do not
inhibit the voltage-dependent response, block by charybdotoxin is consistent with the voltage dependence being associated with activation of KCa3.1.
A requirement for elevated cytosolic free Ca2⫹, block by
clotrimazole, TRAM-34, and charybdotoxin, agents that do not
inhibit the KCa2 family of channels, and insensitivity of the
voltage-dependent activated current component to apamin,
iberiotoxin, and paxilline are consistent with involvement of
the intermediate-conductance Ca2⫹-activated K⫹ channel
KCa3.1. The tail currents at hyperpolarized potentials following
a depolarizing voltage step are, however, reminiscent of
HERG, the human ether-à-go-go-related gene product (38).
The potent inhibitor E-4031 was used to test for involvement of
HERG. Figure 3D shows the activated current response to
voltage steps in cells whole cell patched with a KCl-based
pipette solution buffered to 2 ␮M free Ca2⫹ in the absence and
presence of E-4031. E-4031 had no effect on the activated component of the whole cell current (P ⱖ 0.05, n ⫽ 8). Therefore,
HERG expression cannot account for the voltage dependence
during elevations in intracellular Ca2⫹ in HEL cells.
Finally, in experiments performed in low intracellular and
extracellular Cl⫺ solutions, we observed a voltage dependence
indistinguishable from that in high-Cl⫺ solutions (data not
shown). These data rule out a role for Cl⫺ in the voltagedependent response. Thus the data indicate that KCa3.1 is
involved in the voltage-activated whole cell current.
While the inhibitor sensitivity profile and basic biophysical
characteristics of the activated current of the whole cell response support the conclusion that KCa3.1, and not the voltagedependent KCa1.1, channel is responsible for the voltage dependence, it was necessary to confirm the presence of mRNA
encoding KCa3.1. We undertook RT-PCR experiments to detect direct expression of KCa3.1 and KCa1.1 mRNA. Total
RNA was reverse-transcribed, and the cDNA was amplified
using primers with sequences specific for KCa3.1 (KCNN4
gene) or KCa1.1 (KCNMA1 gene). Figure 7 shows the amplified
products. A prominent band of the correct size and sequence
consistent with KCa3.1 gene expression was found in HEL cells
(lane 1). In contrast, no KCa1.1 gene product was found (lane
11). As a positive control for KCa1.1 detection, we used the
AJP-Cell Physiol • doi:10.1152/ajpcell.00368.2012 • www.ajpcell.org
C865
2
3
KCNN4
4 5 6 7 8
KCNMA1
9 10 11 12 13 14 15 16 17 18 19
600
400
-cDNA
HTR-8/SVneo
HEL
THP-1
THP-1-Diff
THP-1-Diff
HTR-8/SVneo
HEL
THP-1
THP-1-Diff
-RT
HTR-8/SVneo
-cDNA
HEL
THP-1
THP-1-Diff
HTR-8/SVneo
200
-RT
Fig. 7. RT-PCR detection of mRNA arising from expression of the KCa3.1
gene KCNN4 and the KCa1.1 gene KCNMA1. Lanes 1–9 correspond to PCRs
with primers specific for KCNN4: lanes 1– 4 show detection of PCR product in
HEL, THP-1, THP-1 differentiated (Diff), and HTR-8/SVneo cells, lane 9 is a
control PCR run without cDNA (⫺cDNA), and lanes 5– 8 are PCRs run in the
absence of reverse transcriptase (⫺RT). Lanes 11–19 correspond to PCRs with
primers specific for KCNMA1: lanes 11–14 show detection of PCR product in
HEL, THP-1, THP-1 differentiated, and HTR-8/SVneo cells; lane 19 is a
control PCR run without cDNA; and lanes 15–18 are PCRs run in the absence
of reverse transcriptase. Molecular sizes (left) are taken from the standards run
in lane 10 (200 –1,000 bp in 100-bp increments).
monocytic cell line THP-1 and the human trophoblast cell line
HTR-8/SVneo. THP-1 cells express a Ca2⫹-activated K⫹ current with characteristics of KCa3.1 (16). In contrast, PMAinduced differentiation of THP-1 cells to macrophage-like cells
induced expression of a KCa1.1 current in addition to currents
associated with activation of KCa3.1 (5). Lane 2 shows a band
consistent with KCa3.1 expression in THP-1 cells. Lane 3
shows expression of KCa3.1 in differentiated THP-1 cells,
while lane 4 shows expression of KCa3.1 in the human trophoblast cell line HTR-8/SVneo. In native THP-1 cells, we detected only a very slight expression of the KCa1.1 gene (lane
12). However, a strong band consistent with robust expression
of this gene is seen following differentiation with phorbol ester
for 3 days in culture (lane 13). Such findings are in close
agreement with the functional expression of KCa1.1 currents in
differentiated, but not native, THP-1 cells (5, 16). As a final
control for the efficacy of our KCa1.1 primer pair, we found a
marked level of KCa1.1 cDNA expression in HTR-8/SVneo
cells (lane 14). PCRs in the absence of cDNA (lanes 9 and 19)
and in the presence of cDNA and corresponding primer pairs,
but in the absence of reverse transcriptase (lanes 5– 8 and lanes
15–18), yielded no products. The lack of KCa1.1 cDNA in HEL
cells further supports the conclusion that the voltage-activated
current cannot be ascribed to activity of this channel, consistent
with the pharmacological sensitivity of the voltage-activated
current and its requirement for elevated cytosolic Ca2⫹ levels.
However, detection of KCa3.1-specific cDNA in HEL cells
supports the conclusion that expression of this channel underlies the voltage-dependent response, consistent with our pharmacological profile.
The whole cell current is given by the product of the singlechannel current (i), the number of channels that are available to
open (N), and the open channel probability (Po). Therefore, the
increase in current that gives rise to the activated component
could be due to an increase in Po or N. To investigate the role
of altered channel availability and altered Po in the voltagedependent component of the whole cell current, single-channel
experiments were performed using the excised inside-out
patch-clamp configuration. Experiments were first undertaken
to characterize the single-channel correlate of KCa3.1 in HEL
cells. The pipette internal solution was standard NaCl solution,
identical to that used as the extracellular solution in whole cell
recordings, while the bath (intracellular) solution was a KClbased solution with free Ca2⫹ concentrations set to defined
levels with EGTA. This solution contained 5 mM free Mg2⫹ to
inhibit TRPM7 activity, as used in the whole cell experiments.
As a result of the symmetrical Cl⫺ conditions used in our
experiments, ⫺3 mV was chosen as the basic holding potential
for determination of channel activity to ensure that the recordings were not contaminated by Cl⫺ channel activity. Figure 8A
shows a section of data recorded at a holding potential of ⫺3
mV. Given the ionic composition of the pipette, KCa3.1 activity
is expected at this potential. Outward currents arising from
multiple single-channel openings were observed. The Ca2⫹ sensitivity of the channel activity was confirmed by superfusion of
the patch with 50 nM free Ca2⫹, leading to loss of channel
activity. Reexposure to 2 ␮M free Ca2⫹ resulted in reactivation of
channel activity. Figure 8B shows the channel activity at higher
temporal resolution at arrows 1 and 2 in Fig. 8A. In Fig. 8C,
all-points-amplitude histograms constructed from 30-s stretches of
A
50 nM Ca2+
2 pA
4
3
2
1
c
20 s
B
1
2
1 pA
2
1s
1
c
2
1
C
Total Count x103
1
HEL
BP
1000
800
THP-1
VOLTAGE DEPENDENCE OF KCa3.1
1
i=0
20
2 µM Ca2+
i=1
NPo = 0.68
15
50
40
i=0
2
50 nM Ca2+
NPo = 0
30
10
20
5
i=2
i=3
10
0
0
Current (pA)
2⫹
Current (pA)
Fig. 8. Ca -activated single channels in excised inside-out patches. A: section
of a recording at ⫺3-mV holding potential from an excised inside-out patch.
Pipette internal solution was standard NaCl-based solution containing 5 mM
K⫹; bath solution was KCl-based solution with 2 ␮M free Ca2⫹ and 5 mM free
Mg2⫹. Where indicated, patch was superfused with a KCl-based solution with
50 nM free Ca2⫹. Closed state (c) and current levels corresponding to the
indicated number of open channels (1– 4) are shown at left. B: current
recording at higher resolution in 2 ␮M or 50 nM free Ca2⫹ (recordings 1 and
2, respectively). Data correspond to arrows 1 and 2 in A. C: all-pointsamplitude histograms in 2 ␮M and 50 nM free Ca2⫹ were generated from 30-s
sections of the data presented in A and fit to the sum of Gaussian distributions.
NPo (where N is number of channels and Po is open channel probability) was
calculated as described in Recording, Data Acquisition, and Analysis.
AJP-Cell Physiol • doi:10.1152/ajpcell.00368.2012 • www.ajpcell.org
C866
VOLTAGE DEPENDENCE OF KCa3.1
B
1.5 I (pA)
3 pA
c
Vm (mV)
-83
1.0
2
c
-43
0.5
0.5 s
n=6 or 7
2
c
-3 -100
3
2
1
c
+37
4
3
2
1
c
+77
-50
-0.5
50
100
Vm (mV)
Fig. 9. Single-channel I-V relationship of the Ca2⫹-dependent channel.
A: excised inside-out patch was superfused with a KCl-based solution containing 2 ␮M free Ca2⫹. After confirmation of the Ca2⫹ dependence of
single-channel activity by superfusion with 50 nM free Ca2⫹, patch was
stepped to different potentials. Closed state (c) and current levels corresponding to the indicated number of open channels (1– 4) are shown at left. B: mean
I-V relationship of the channel (n ⫽ 6 or 7 for each data point). Dotted line is
a visual linear fit of data between ⫺23 and ⫺63 mV that extrapolates to a
highly negative reversal potential. Data from potentials more negative than
⫺63 mV are not displayed because of inability to resolve the single-channel
current near the reversal potential.
the record in 2 ␮M and 50 nM free Ca2⫹ are shown with the sum
of multiple Gaussian peaks fit to the data. In 2 ␮M free Ca2⫹, four
peaks are resolvable, indicative of at least three channels in the
patch. In 50 nM Ca2⫹, no open channel peaks are evident,
consistent with the Ca2⫹ dependence of the channel. The NPo
value for the stretch of data recorded in the presence of 2 ␮M free
Ca2⫹ as estimated from the multiple Gaussian fit (see Recording,
Data Acquisition, and Analysis) was 0.68, with NPo ⫽ 0 in 50 nM
Ca2⫹, since no channel openings were detected.
To determine the I-V relationship of the channel, membrane
patches were stepped to voltages between ⫺83 and ⫹97 mV.
A representative experiment is shown in Fig. 9A. Singlechannel currents were measured from ⬎5-ms channel openings
to ensure that the low-pass filter imposed on the recording did
not influence the measurements. Figure 9B shows the mean I-V
relationship estimated from data derived from seven patches.
Extrapolation of the linear portion of the I-V relationship
between ⫺63 and ⫺23 mV yields a highly negative reversal
potential, consistent with a highly selective K⫹ channel. Consistent with this finding, replacement of bath K⫹ with nonpermeant NMDG⫹ abolished channel activity (data not shown).
The mean slope conductance determined from the slope of a
linear fit to the data between ⫺23 and ⫹17 mV was 8.7 ⫾ 0.6
pS (n ⫽ 7), a value similar to that reported for KCa3.1 under
conditions of physiological K⫹ gradients (10, 14, 22). At
highly depolarized potentials, the single-channel current was
depressed, consistent with voltage-dependent channel block by
an undefined ion or compound. Such a finding is consistent
with the flattening of the I-V relationship in whole cell experiments, such as those presented in Fig. 1. Voltage-dependent
block of KCa3.1 and KCa2 channels by intracellular Mg2⫹ and
Ca2⫹ has been reported (19) and may be responsible for this
depression. In all subsequent experiments, the magnitude of the
single-channel current at ⫺3 mV (0.94 ⫾ 0.02 pA), the
sensitivity of the channel to Ca2⫹, and a negative reversal
potential were used to identify the channel.
Single-channel activity in 2 ␮M free Ca2⫹ was inhibited by
application of 1 ␮M clotrimazole, consistent with the whole
cell results presented in Fig. 4. Figure 10A shows the inhibitory
influence of clotrimazole on the Ca2⫹-dependent channel activity and demonstrates the reversibility of the inhibition.
Figure 10B shows the single-channel activity at higher resolution before, during, and after clotrimazole application. Figure
10C shows the all-points-amplitude histogram produced from
40-s intervals of the record shown in Fig. 10A in the absence
and presence of clotrimazole. In the absence of clotrimazole,
NPo ⫽ 0.57. Application of 1 ␮M clotrimazole suppressed NPo
by a factor of ⬎10 to 0.049, with washout resulting in reversal
of channel block. A significant reduction in NPo was observed
in four of four experiments (P ⱕ 0.05). Analysis of the unitary
current in the absence and presence of 1 ␮M clotrimazole
revealed no significant difference in unitary current at ⫺3 mV
(P ⱖ 0.05, n ⫽ 5).
The effect of TRAM-34 on single-channel activity was also
investigated. Representative single-channel activity in 2 ␮M
free Ca2⫹ is shown in Fig. 11. Superfusion with solution con-
A
2 pA
1 µM Clotrimazole
25 s
3
2
1
c
1
2
3
1 pA
B
2
1
c
1
C
Total Count x103
A
30
2
Control
i=0
Clotrimazole
60
NPo = 0.57
20
i=1
3
Wash Off
40
i=0
NPo = 0.049
0
i=2
i=3
i=0
NPo = 0.42
40
20
10
1s
i=1
20
i=2
i=1
0
Current (pA)
0
Current (pA)
Current (pA)
Fig. 10. Inhibition of Ca2⫹-dependent K⫹ channel activity by clotrimazole.
A: section of a recording at ⫺3-mV holding potential from an excised inside-out
patch. Pipette internal solution was standard NaCl-based solution containing 5 mM
K⫹; bath solution was KCl-based solution containing 2 ␮M free Ca2⫹ and 5 mM
free Mg2⫹. Where indicated, patch was superfused with 1 ␮M clotrimazole.
Closed state (c) and current levels corresponding to the indicated number of open
channels (1–3) are shown at left. B: current recording at higher resolution before
(1), during (2), and after (3) clotrimazole application. Data correspond to arrows
1, 2, and 3 in A. C: all-points-amplitude histograms before (control), during
(clotrimazole), and after (wash off) clotrimazole were generated from 40-s sections
of data in A and fit to the sum of Gaussian distributions. NPo was calculated as
described in Recording, Data Acquisition, and Analysis.
AJP-Cell Physiol • doi:10.1152/ajpcell.00368.2012 • www.ajpcell.org
C867
VOLTAGE DEPENDENCE OF KCa3.1
A
2
1 pA
1
50 s
c
2
1
B
2
1 pA
1
2s
c
1
2
Total Count x103
C
200
i=0
Control
NPo = 0.26
150
0
i=0
TRAM-34
NPo = 0
150
100
50
250
200
100
i=1
i=2
50
0
Current (pA)
Current (pA)
Fig. 11. Inhibition of Ca2⫹-dependent K⫹ channel activity by TRAM-34.
A: section of a recording at ⫺3-mV holding potential from an excised
inside-out patch. Pipette internal solution was standard NaCl-based solution
containing 5 mM K⫹; bath solution was KCl-based solution containing 2 ␮M
free Ca2⫹ and 5 mM free Mg2⫹. Where indicated, patch was superfused with
1 ␮M TRAM-34. Closed state (c) and current levels corresponding to the
indicated number of open channels (1 and 2) are shown at left. B: current
recording at higher resolution before (1) and during (2) TRAM-34 application.
Data correspond to arrows 1 and 2 in A. C: all-points-amplitude histograms
before (control) and during (TRAM-34) TRAM-34 application were generated
from 120-s sections of data in A and fit to the sum of Gaussian distributions.
NPo was calculated as described in Recording, Data Acquisition, and Analysis.
taining 1 ␮M TRAM-34 resulted in complete inhibition of
channel activity. The larger positive deflections during
TRAM-34 application are resets of the head stage while recording in capacitive mode. Figure 11B shows the channel
activity at higher resolution in the absence and presence of
TRAM-34. Figure 11C shows the all-points-amplitude histogram produced from 120-s intervals of the record in Fig. 11A
in the absence and presence of TRAM-34. In the absence of
inhibitor, NPo ⫽ 0.26. Application of TRAM-34 suppressed all
channel activity, resulting in NPo ⫽ 0. NPo was reduced to 0 in
six of six patches (P ⱕ 0.05). Consistent with our finding in
whole cell experiments, TRAM-34 inhibition was not reversible. As a result of the complete inhibition of channel activity,
it was not possible to determine the effect of TRAM-34 on
unitary current.
To further differentiate between KCa1.1 and KCa3.1, NS309,
a potent activator of KCa3.1 and the KCa2 channel family, but
not the KCa1.1 channel (13, 34), was applied. Application of 1
␮M NS309 resulted in a significant increase in single-channel
activity of the Ca2⫹-dependent channel (Fig. 12A). Figure 12B
shows the channel activity before and during NS309 application on an expanded time scale at arrows 1 and 2 in Fig. 12A.
The effect of NS309 was slowly reversible (Fig. 12A). The
all-points-amplitude histogram before NS309 addition had a
calculated NPo value of 1.52 and displayed five clear peaks
indicative of at least four active channels. Addition of the
activator resulted in a marked increase in NPo to 5.3 associated
with additional peaks and the lack of a closed-state peak. It was
not possible to quantify the mean increase in channel activity
associated with NS309 addition, since, in two of the three
patches exposed to NS309, individual peaks in the all-pointsamplitude histogram were not resolvable because of a large
increase in channel activity resembling a macro current. This
inability to consistently resolve single-channel events precluded the ability to reliably determine the effect of NS309 on
unitary current. Modulation of channel activity by NS309 casts
further doubt on the KCa1.1 channel as the source of the
single-channel activity. In addition, in three of three patches,
channel activity was unaffected by addition of the KCa1.1
channel inhibitor paxilline (data not shown).
The Ca2⫹ sensitivity of the single-channel activity, negative
reversal potential, and direct demonstration that K⫹ is the
dominant charge-carrying ion by ion substitution indicate that
the single-channel activity isolated in the present experiments
is due to a Ca2⫹-activated K⫹ channel. The estimated singlechannel conductance, lack of sensitivity to paxilline, and modulation by NS309 clearly rule out the KCa1.1 channel in the
single-channel response. Furthermore, application of depolarizing voltage steps in 50 nM Ca2⫹ was never observed to result
in channel activity, consistent with lack of expression of
KCa1.1 channels (data not shown). The sensitivity to clotrim-
4 pA
1 µM NS309
A
50 s
7
5
3
1
c
1
B
4
3
2
1
c
2
7
5
1
3
2
1
c
2 pA
1s
C
Total Count x103
1 µM TRAM-34
12
i=1
6
Control
NPo = 1.52
i=2
i=4
4
8
i=3
i=0
4
i=2
2
i=3
i=1
i=4
i=5
NS309
NPo = 5.30
i=6
i=7
0
0
0
2
4
6
Current (pA)
8
0
2
4
6
Current (pA)
8
Fig. 12. Activation of Ca2⫹-dependent K⫹ single-channel activity by NS309.
A: section of a recording at ⫺3-mV holding potential from an excised
inside-out patch. Pipette internal solution was standard NaCl-based solution
containing 5 mM K⫹; bath solution was KCl-based solution containing 2 ␮M
free Ca2⫹ and 5 mM free Mg2⫹. Where indicated, patch was superfused with
1 ␮M NS309. Closed state (c) and current levels corresponding to the indicated
number of open channels (1–7) are shown at left. B: current recording at higher
resolution before (1) and during (2) NS309 application. Data correspond to
arrows 1 and 2 in A. C: all-points-amplitude histograms before (left) and
during (right) NS309 application were generated from 25-s sections of data in
A and fit to the sum of Gaussian distributions. NPo was calculated as described
in Recording, Data Acquisition, and Analysis.
AJP-Cell Physiol • doi:10.1152/ajpcell.00368.2012 • www.ajpcell.org
VOLTAGE DEPENDENCE OF KCa3.1
A
#
2.0
#
1.8
5 mM Mg2+
1.6
*
1 mM Mg2+
&
*
1.4
*
1.2
*
*
1.0
*
10
20
30
Po
at -3 mV
40
50
60
Vm (mV)
B
Relative Po at +57 mV
#
1.8
*
1.6
1.4
*
1.2
2
µM
0
M Ca 2
g2 +
+
0
5
µM
M Ca 2
g2
+ +
1.0
0.
azole and TRAM-34 is consistent with a lack of involvement of
the small-conductance KCa2 channel family in the singlechannel events. Furthermore, the lack of effect of apamin on
the whole cell currents indicates that KCa2 channel family
activity is not significant in HEL cells. The single-channel
conductance, inhibition by clotrimazole and TRAM-34, lack of
sensitivity to paxilline, and activation by NS309 are consistent
with the channel isolated in the present experiments being
KCa3.1.
Experiments were undertaken to define the influence of
depolarization on channel availability (N) and Po of the KCa3.1
channel. NPo was calculated from all-points-amplitude histograms at ⫺3 mV and at the test potential. We used a repetitive
step protocol in which the patch was stepped between these
two potentials at 5-s intervals (see Recording, Data Acquisition, and Analysis). To determine the role of voltage in modulation of N, NPo was calculated for voltage steps from ⫺3 mV
to ⫹17, ⫹37, and ⫹57 mV in 10 patches superfused with 2
␮M free Ca2⫹ and 1 mM free Mg2⫹. Six of 10 patches had low
enough channel number (N) for N to be accurately estimated at
⫺3 mV and the three test potentials. This estimate of N was
simply given by the maximum number of superimposed channel openings observed in the recording (12). In all six patches,
N did not change during voltage steps to all potentials. N in the
remaining four patches could not be reliably estimated because
of the high channel number (12). Given that we observed no
change in N in the large subset of patches where channel
number was reliably measurable, we conclude that depolarization within our test range does not result in recruitment of
further channels to an active state from which they can open.
To analyze the effects of voltage on Po while excluding variability between patches due to varying values of N and varying
baseline levels of channel activity, we used the ratio of NPo at the
test potential to NPo at ⫺3 mV. Given that N does not change with
changes in membrane voltage, this is equivalent to a relative
change in Po induced by the voltage step. Channel activity in
excised inside-out patches exposed to 2 ␮M free Ca2⫹ and 1 mM
Mg2⫹ was first confirmed as being due to KCa3.1 before investigation of the effect of membrane potential on Po. Figure 13A
shows the relative change in Po at ⫹17, ⫹37, and ⫹57 mV
determined in 10 patches in which NPo was calculated for all
potentials. Relative Po increased in a graded fashion between ⫺3
and ⫹57 mV. The relative change in Po was significantly ⬎1 at
all potentials (P ⱕ 0.05, n ⫽ 5), meaning that all voltage steps
cause Po to increase significantly, with the step to ⫹57 mV
increasing Po on average by 28%.
Since our whole cell experiments were performed with 5
mM free Mg2⫹ in the pipette internal solution, we repeated the
experiments with this level of free Mg2⫹. Figure 13A also
shows the relative change in Po at ⫹17, ⫹37, and ⫹57 mV
determined in five patches in which NPo was calculated for all
potentials. Once again, the relative Po increased in a graded
fashion between ⫺3 and ⫹57 mV, with the relative change in
Po being significantly ⬎1 at all potentials (P ⱕ 0.05, n ⫽ 5).
A two-way ANOVA performed on the 1 and 5 mM Mg2⫹ data
sets indicates a significant main effect of the value of the
voltage step (P ⱕ 0.05). Post hoc analysis indicates a significant difference between ⫹17 and ⫹57 mV and between ⫹37
and ⫹57 mV voltage steps (P ⱕ 0.05). Therefore, the relative
increase in Po is an increasing function of the magnitude of the
voltage step.
Relative Po
C868
Fig. 13. Effect of membrane potential, free Mg2⫹, and free Ca2⫹ on relative Po.
A: excised inside-out patches were superfused with a bath solution containing
2 ␮M free Ca2⫹ and 1 or 5 mM free Mg2⫹. Alternating voltage-step protocol
was administered from ⫺3 mV to ⫹17, ⫹37, and ⫹57 mV in the presence of
1 and 5 mM free Mg2⫹. Five patches were exposed to all 3 test potentials in
5 mM free Mg2⫹ solution; 10 patches were exposed to all 3 potentials in 1 mM
free Mg2⫹. Accumulative all-points-amplitude histograms were generated for
each patch, and multiple Gaussian distributions were fit for calculation of NPo
at each test voltage in 1 and 5 mM free Mg2⫹. Data were normalized to NPo
value at ⫺3 mV for each voltage pair, yielding relative increases in Po that are
plotted in A. *Significantly different from 1, i.e., significant relative change in
Po (P ⱕ 0.05). #Significant difference in Po between ⫹17 and ⫹57 mV and
between ⫹37 and ⫹57 mV (P ⱕ 0.05). &Significant difference in change in
Po as a function of voltage between 1 and 5 mM Mg2⫹. B: excised inside-out
patches were exposed to 0.5 and 2 ␮M free Ca2⫹ (n ⫽ 5) in the absence of
Mg2⫹, and voltage-step protocol was administered using a voltage step to ⫹57
mV from ⫺3 mV. NPo at ⫺3 and ⫹57 mV was calculated from accumulative
all-points-amplitude histograms. NPo at ⫹57 mV was normalized to NPo at ⫺3
mV, yielding a relative change in Po. *Significantly different from 1, i.e.,
significant relative change in Po (P ⱕ 0.05). #Significant difference in relative
Po between 0.5 and 2 ␮M free Ca2⫹ (P ⱕ 0.05). Values are means ⫾ SE.
ANOVA also indicates a significant main effect of Mg2⫹,
indicating that the relative increase in voltage modulation of Po
was significantly less in 1 mM Mg2⫹ than 5 mM Mg2⫹ (P ⱕ
0.05). Such a finding may be indicative of a role for Mg2⫹ in
the voltage dependence of Po. To investigate this hypothesis,
we measured NPo at ⫺3 and ⫹57 mV in patches exposed to 2
AJP-Cell Physiol • doi:10.1152/ajpcell.00368.2012 • www.ajpcell.org
C869
VOLTAGE DEPENDENCE OF KCa3.1
A
B
2.5
Control
2.0
5.0
10 µM NS309
4.0
Current (nA)
Current (nA)
␮M free Ca2⫹ in the absence of Mg2⫹. In the absence of Mg2⫹,
depolarization to ⫹57 mV significantly increased the relative
Po to 1.23 ⫾ 0.02 (P ⱕ 0.05, n ⫽ 5). This increase, while
modestly less than that observed in the presence of 1 mM
Mg2⫹ (1.28 ⫾ 0.06, n ⫽ 10, plotted in Fig. 10A), was not
significantly different from that value (P ⱖ 0.05). Importantly,
significant voltage modulation of Po was observed even when
Mg2⫹ was removed. Thus, Mg2⫹ is not an absolute requirement for voltage-dependent modulation of Po in HEL cells.
One could reasonably expect the relative increase in Po
induced by depolarization to be a function of the basal channel
activity. For example, if the rate of channel opening is increased by depolarization, then the relative increase in Po
caused by a voltage step will be greater if baseline channel
activity is lower. Correspondingly, maximal channel activity
would not be expected to be augmented by depolarization.
Given this hypothesis, an alternative explanation for the effect
of 1 vs. 5 mM Mg2⫹ on voltage modulation of Po arises from
the finding that Mg2⫹ has been shown to modulate Po of
KCa3.1 in erythrocytes (11). In erythrocytes, increasing Mg2⫹
resulted in a decrease in Po for any given submaximal Ca2⫹
concentration. We have found a similar influence of Mg2⫹ on
KCa3.1 activity in HEL cells (data not shown). This means that
the effect of Mg2⫹ on the voltage modulation of Po in Fig. 13A
could be an indirect result of its effect on basal channel
activity. To investigate this hypothesis, using the same patch,
we compared the change in NPo at ⫹57 mV in patches exposed
to 2 ␮M free Ca2⫹-0 Mg2⫹ with the change measured in the
presence of 0.5 ␮M free Ca2⫹-0 Mg2⫹. Lowering free Ca2⫹
significantly reduced the calculated NPo value at ⫺3 mV from
0.73 ⫾ 0.2 to 0.12 ⫾ 0.02 (P ⱕ 0.05, n ⫽ 5). Under these
conditions, voltage steps to ⫹57 mV increased the relative Po
to 1.53 ⫾ 0.09, a significant increase over that observed with
2 ␮M free Ca2⫹ (1.23 ⫾ 0.02, P ⱕ 0.05). These data are
summarized in Fig. 13B. While both relative changes in Po are
different from 1 (i.e., there was a significant relative increase in
Po due to the voltage step at both free Ca2⫹ levels), these
results are consistent with the hypothesis that the influence of
depolarization on relative Po is a function of basal channel
activity. In the whole cell configuration, we would predict that
the activated component of the current response to depolarizing
voltage steps would become less as the magnitude of the whole
cell current is increased (i.e., Po is increased). To test this
prediction, we exploited the ability of NS309 to increase
channel activity by increasing the Ca2⫹ sensitivity of the
channel (13). Cells were whole cell patched with a KCl-based
internal solution with 10 ␮M free Ca2⫹ and 5 mM free Mg2⫹
buffered with 5 mM BAPTA. As can be seen in Fig. 14A,
depolarization-induced activation of the current was still observed at this free Ca2⫹ level in the presence of 5 mM Mg2⫹.
In contrast, after superfusion with NS309, which induced a
marked increase in whole cell current, voltage modulation of
the current was markedly reduced (Fig. 14B). The mean effect
of NS309 in eight cells is summarized in Fig. 14, C and D. In
the presence of NS309, the step current was significantly
increased over control, consistent with an increase in the
proposed Ca2⫹ sensitivity of the channel (P ⱕ 0.05; Fig. 14D).
In contrast, the magnitude of the activated component of the
current was significantly smaller (P ⱕ 0.05), i.e., only 38% of
the control response at ⫹97 mV (Fig. 14C). The data in Fig.
14C document a significant reduction in the absolute magni-
1.5
1.0
0.5
500 ms
0
-0.5
3.0
2.0
1.0
500 ms
0
-1.0
+97
-103
+97
-103
C
D
800 I (pA)
4000 I (pA)
Step I
Activated I
3000
600
Control
NS309 400
Control
NS309
*
200
*
1000
-100
-100
-50
-200
E
40
50
100
Vm (mV)
-50
-1000
50
100
Vm (mV)
Activated I
(% of Steady-State)
Control
NS309
20
*
-60
-20
20
60
100
Vm (mV)
Fig. 14. Effect of NS309 on step and activated component of the whole cell
Ca2⫹-activated K⫹ current. A: control response of a cell whole cell patched
with a KCl-based internal solution containing 10 ␮M free Ca2⫹ and 5 mM
Mg2⫹. Cell was superfused with standard NaCl-based solution containing 5
mM K⫹. Voltage steps were administered from a holding potential of ⫺103
mV. B: cell shown in A was subjected to the same voltage-step protocol in the
presence of 10 ␮M NS309. C: mean activated current component (n ⫽ 8) of
the whole cell response to voltage steps in the absence (control) and presence
of NS309. Control and NS309 data were obtained from each cell. *Significantly different from control (P ⱕ 0.05). D: mean step current component
(n ⫽ 8) of the whole cell response to voltage steps in the absence (control) and
presence of NS309. Control and NS309 data were obtained from each cell.
E: mean activated current in the absence (control) and presence of NS309
presented as a percentage of the steady-state current measured at the end of the
500-ms voltage step. Activated current as a percentage of steady-state current
was calculated from data set in C and D (n ⫽ 8). *Significantly different from
control (P ⱕ 0.05). Values are means ⫾ SE; lack of error bars indicates that
SE is within the size of the symbol.
tude of the activated current component of the response to
depolarizing voltage steps. The data in Fig. 14, A and B, also
suggest that the contribution of the activated current component to the peak steady-state current (i.e., the current recorded
at the end of the 500-ms voltage step) becomes less as the
magnitude of the whole cell current increases. In Fig. 14E, the
activated current in these eight cells is presented as a percentage of the steady-state current for voltage steps between ⫺43
and ⫹97 mV. These data indicate that the activated current as
AJP-Cell Physiol • doi:10.1152/ajpcell.00368.2012 • www.ajpcell.org
C870
VOLTAGE DEPENDENCE OF KCa3.1
a percentage of the maximal steady-state current value is
significantly reduced (P ⱕ 0.05) as channel activity increases
as a result of application of NS309. While the absolute current
was reduced by 62% at ⫹97 mV during NS309-induced
channel activation, the activated current component as a percentage of maximal steady-state current was reduced by 75%.
Therefore, the activating current makes less contribution to the
steady-state current as the whole cell current increases toward
its maximum. These data further support the conclusion that
the effect of Mg2⫹ on the voltage modulation of relative Po in
Fig. 13A can be accounted for by the ability of Mg2⫹ to alter
the Po of the channel and, thus, the level of basal channel
activity.
DISCUSSION
In the present experiments, in HEL cells, we isolated a
highly K⫹-selective, Ca2⫹-dependent whole cell current and
single-channel correlate that displays voltage dependence.
Voltage dependence manifested itself as a secondary activated
current component of the whole cell response to depolarizing
voltage steps. This activated current was superimposed on an
instantaneous step current. The whole cell current was augmented by addition of NS309, a selective activator of KCa3.1
and the KCa2 family of channels, but not the large-conductance
KCa1.1 channel (13, 34). The step and activated components of
the whole cell current were blocked by the KCa3.1 inhibitors
clotrimazole, TRAM-34, and charybdotoxin. Additionally, the
activated current was insensitive to the selective KCa2 family
inhibitor apamin and the KCa1.1 inhibitors paxilline and iberiotoxin, as is the step current (data not shown). The singlechannel correlate was also inhibited by clotrimazole and
TRAM-34 and insensitive to paxilline, while channel activity
was augmented by NS309. The single-channel conductance
was 8.7 pS in physiological K⫹ gradients, a value very similar
to that reported by other groups for KCa3.1 in human T
lymphocytes and cloned KCa3.1 channels (10, 14, 22). Additionally, we found no evidence for expression of the voltagedependent KCa1.1 channel in any of our single-channel experiments. Finally, we detected mRNA for KCa3.1, but not the
KCa1.1 channel, consistent with expression of KCa3.1, but not
KCa1.1, in HEL cells. These findings are consistent with the
whole cell current and isolated single-channel activity arising
from the expression of KCa3.1.
Of the three classes of Ca2⫹-activated K⫹ channels, the
KCa2 family of channels and KCa3.1 have been reported to lack
voltage dependence; only the large-conductance KCa1.1 channel activity was modulated by membrane depolarization (reviewed in Refs. 36 and 43). In contrast to this well-held view,
we have presented evidence supporting modulation of KCa3.1
channel activity by membrane depolarization. The voltagedependent component of the whole cell current activated in a
time-dependent fashion at potentials more positive than ⫺43
mV, as judged by our step protocol. Detection of tail currents
on return to hyperpolarized potentials following a depolarizing
voltage step further supports voltage dependence of the current. The activated component of the whole cell current detected during depolarizing voltage steps could also be interpreted as a time-dependent activation component of the current
response. However, time-dependent activation is difficult to
reconcile for a Ca2⫹-activated conductance in the sustained
presence of elevated intracellular Ca2⫹. Under these conditions, a step change in potential would be expected to result in
a step change in whole cell current.
Interestingly, the voltage-dependent activated current component showed no evidence of inactivation, a characteristic
distinct from the classical voltage-activated K⫹ conductances
in cells such as megakaryocytes (15). Modulation of KCa3.1
activity by membrane depolarization was also significantly
different from voltage modulation of the KCa1.1 channel. In
contrast to voltage modulation of the large-conductance channel, depolarization was unable to activate KCa3.1 channel
activity in the absence of elevated levels of cytosolic Ca2⫹.
Thus, depolarization alone is not sufficient to activate KCa3.1
channel activity, at least in the voltage range investigated in the
present experiments. In addition, the voltage activation relationship of the channel is not altered by free Ca2⫹ levels, as
judged by a similar voltage dependence of the whole cell
current in 2 and 10 ␮M free Ca2⫹ (Figs. 2 and 14). Additional
experiments undertaken with 1 ␮M free Ca2⫹ revealed an
identical voltage relationship (data not shown), thus extending
the free Ca2⫹ range from 1 to 10 ␮M, with no indication of
modulation of the voltage dependence of the activated current
component. This is in direct contrast to the modulation of the
voltage dependence of KCa1.1 by changes in free Ca2⫹ within
this concentration range (44).
The voltage dependence of the whole cell current may, in
theory, arise from an increase in the number of available channels
(N) or an increase in Po. In our single-channel experiments, no
increase in N was observed during steps in membrane potential
from ⫺3 to ⫹57 mV. Rather, depolarization within this voltage
range was accompanied by a graded increase in Po, which could
account for the activated component of the whole cell current
during depolarizing voltage steps. As would be expected of a
voltage-dependent mechanism, this increase in Po was a function
of the magnitude of the depolarization, with voltage steps of
different magnitudes resulting in significantly different increases
in relative Po (Fig. 13A).
While we found no increase in N during depolarization, we
cannot rule out an effect of depolarization on channel availability during voltage steps to more depolarized potentials. Our
analysis of the effect of membrane voltage on Po was dependent on the generation of all-points-amplitude histograms with
clearly resolvable peaks. Histograms derived from voltage
steps to potentials more depolarized than ⫹57 mV were frequently contaminated by baseline fluctuations associated with
an increase in background current and/or the generation of
poorly resolvable single-channel events. As a result, we were
forced to confine our single-channel studies to a limited voltage
range. The relative increase in Po calculated from our singlechannel experiments documents a rather small influence of
voltage on this parameter compared with that observed in
classical voltage-dependent channels. In addition to limiting
our depolarizing voltage steps to a narrow range of voltages,
we used a holding potential of ⫺3 mV, a value within the
voltage-dependent range of channel modulation as determined
in our whole cell studies. Holding at a potential outside the
voltage activating range (i.e., more negative than ⫺43 mV)
would be expected to increase our measured relative increases
in Po. Our selection of ⫺3 mV was predicated on the need to
have clearly resolvable channel events out of the level of
background noise of our recording system. Irrespective of our
AJP-Cell Physiol • doi:10.1152/ajpcell.00368.2012 • www.ajpcell.org
VOLTAGE DEPENDENCE OF KCa3.1
inability to report maximal changes in Po, it is important to
highlight that we observed a clear, graded increase in Po
associated with depolarization over the voltage range investigated in our single-channel experiments. This is a finding not
previously ascribed to KCa3.1 channel function.
It is interesting that the increase in Po that underlies the
activated component of the whole cell current does not give rise to
a greater steady-state current at large depolarizing potentials. In
fact, the I-V relationship shows inward rectification, with the
steady-state current actually saturating at depolarized potentials
and, in some cases, actually falling at depolarized potentials (Figs.
1 and 9) (16, 23). This apparent paradox is explained by the
finding that KCa3.1 is blocked in a voltage-dependent manner by
intracellular Mg2⫹ and Ca2⫹ (19). Therefore, the magnitude of the
steady-state current at depolarized potentials is the sum of the two
opposing effects of depolarization.
A key question that arises from our findings is as follows: Why
has voltage dependence of KCa3.1 not been reported in other cell
types? A simple explanation is that the effect of depolarization on
Po is confined to HEL cells or possibly cells of leukemic origin.
While this is an intriguing proposal, evidence in the literature
would suggest that the effect is more widespread. As noted in the
introduction, we are aware of three reports in the literature
demonstrating an activated component of KCa3.1 during depolarizing voltage steps. In one case, the activated component of the
current was deemed to be inconsistently present, and the authors
concluded that no systematic voltage- or time-dependent activation of the current existed (16). In another report documenting
cloning of KCa3.1 (14), there was comment on an activated
component of the current during large depolarizations, but no
further investigations were undertaken. Interestingly, small tail
currents were obvious in the records, consistent with a voltage
dependence of the channel and our results in HEL cells. Finally,
Gao et al. (7) presented records of a KCa3.1-like current in human
macrophages differentiated from peripheral monocytes that show
a marked activated current component in response to depolarizing
voltage steps. The authors did not discuss this component of the
current.
One possible mechanism for the voltage modulation arises
from the finding that Mg2⫹ reduces the Po of KCa3.1 (11), a
finding that we have confirmed in HEL cells (data not shown).
If this mechanism were affected by the membrane potential, it
could explain the voltage modulation of Po. Mg2⫹ has also
been shown to mediate voltage-dependent block of KCa3.1 in
murine endothelial cells (19); so, in general, the interactions of
Mg2⫹ with the channel can be modulated by the membrane
potential. To investigate an underlying role for Mg2⫹ in the
voltage modulation of Po of KCa3.1 in HEL cells, we performed experiments in the absence of intracellular Mg2⫹. As
shown in Fig. 13B, in the absence of Mg2⫹, relative Po at ⫹57
mV was significantly increased over that at ⫺3 mV. Additionally, large activated current components of the whole cell
response to voltage steps, indistinguishable from those observed in the presence of 5 mM Mg2⫹, were observed in the
absence of Mg2⫹ in the pipette (data not shown). Taken
together, these data indicate that Mg2⫹ is not required for
voltage modulation of KCa3.1 in HEL cells.
An alternative explanation is that the rates of one or more of
the kinetic transitions of the channel are directly modulated by
voltage. This would be the case if they involved conformational changes that were sensitive to membrane potential. In
C871
general, any of the kinetic transitions could involve the movement of charged moieties of the channel and, hence, could be
voltage-modulated. As discussed above, voltage modulation of
KCa3.1 is only observed in the presence of elevated intracellular Ca2⫹, distinguishing its voltage modulation from that
observed in classical voltage-sensing ion channels. A proposed
mechanism that encompasses this result involves modulation
of Ca2⫹ binding or voltage-modulated changes in the Ca2⫹
affinity of the binding site. Data presented in Fig. 13A highlight
the graded increase in Po with depolarization in the presence of
a constant free Ca2⫹ level. If voltage modulates the affinity of
the binding site or the effective free Ca2⫹ level in the vicinity
of the binding site, an increase in Po is predicted. We are
unable to distinguish the validity of any of the proposed
mechanisms for voltage modulation of KCa3.1 in HEL cells.
Further experimentation is required to address this important
question. However, the present experiments highlight the previously unappreciated voltage dependence of the whole cell
current while defining a critical role for modulation of Po in the
response.
The physiological relevance of the voltage dependence of
KCa3.1 is dependent on the resting potential of the cell prior to
elevations in intracellular Ca2⫹ concentration and activation of
KCa3.1. Using the data presented in Fig. 2D, we can calculate the
influence of resting potential on the anticipated KCa3.1 conductance. The slope of the linear component of the I-V relationship
between ⫺103 and ⫹37 mV was calculated at holding potentials
of ⫺103 and ⫺3 mV. Holding at ⫺3 mV resulted in a 39%
increase in slope conductance over that measured from a holding
potential of ⫺103 mV. This has important implications for cells
with depolarized resting membrane potentials. For example,
megakaryocytes from patients with myelogenous leukemia and
leukemic cell lines used as models for megakaryocyte and platelet
function, such as the HEL cell line, lack expression of conventional voltage-activated K⫹ channels (15). This results in a depolarized resting membrane potential (15), which is predicted to
augment the hyperpolarizing ability of KCa3.1 during suboptimal
elevations in intracellular Ca2⫹ concentration. This enhancement
of KCa3.1-induced hyperpolarization is, in turn, expected to increase the influx of Ca2⫹ across the plasma membrane during
store-operated Ca2⫹ entry, for example. Gao et al. (7) showed that
KCa3.1-induced hyperpolarization increases the influx of Ca2⫹
across the plasma membrane. In fact, activation of KCa3.1 in HEL
cells has been reported to augment Ca2⫹ influx (23).
We previously highlighted the role of depolarization-induced stimulation of metabotropic receptors in influencing the
temporal pattern of Ca2⫹ and membrane potential oscillations
in rat megakaryocytes (25). We have noted the involvement of
depolarization in stimulating ADP-induced Ca2⫹ release from
intracellular stores and the subsequent hyperpolarization induced by activation of KCa3.1 (25). Given the present findings,
a role for depolarization in modulation of KCa3.1 must also be
considered in this model.
AUTHOR CONTRIBUTIONS
C.J.S. and M.J.M. are responsible for conception and design of the research;
C.J.S., O.S., D.N.T., W.H.C., and M.J.M. performed the experiments; C.J.S.,
O.S., D.N.T., W.H.C., and M.J.M. analyzed the data; C.J.S., O.S., D.N.T.,
W.H.C., and M.J.M. interpreted the results of the experiments; C.J.S., O.S.,
D.N.T., and M.J.M. prepared the figures; C.J.S. and M.J.M. drafted the
manuscript; C.J.S. and M.J.M. edited and revised the manuscript; C.J.S., O.S.,
D.N.T., W.H.C., and M.J.M. approved the final version of the manuscript.
AJP-Cell Physiol • doi:10.1152/ajpcell.00368.2012 • www.ajpcell.org
C872
VOLTAGE DEPENDENCE OF KCa3.1
DISCLOSURES
No conflicts of interest, financial or otherwise, are declared by the authors.
REFERENCES
1. Aldrich R, Chandy KG, Grissmer S, Gutman GA, Wei AD, Wulff H.
Calcium-Activated Potassium Channels, Introductory Chapter (Online). International Union of Basic and Clinical Pharmacology database. http://www.
iuphar-db. org/DATABASE/FamilyIntroductionForward?familyId⫽69 [1
Nov. 2013].
2. Anderson CS, MacKinnon R, Smith C, Miller C. Charybdotoxin block
of single Ca2⫹-activated K⫹ channels. J Gen Physiol 91: 317–333, 1988.
3. Aoki K, Kosakai K, Yoshino M. Monoaminergic modulation of the
Na⫹-activated K⫹ channel in Kenyon cells isolated from the mushroom
body of the cricket (Gryllus bimaculatus) brain. J Neurophysiol 100:
1211–1222, 2008.
4. Del Carlo B, Pellegrini M, Pellegrino M. Calmodulin antagonists do not
inhibit IKCa channels of human erythrocytes. Biochim Biophys Acta 1558:
133–141, 2002.
5. DeCoursey TE, Kim SY, Silver MR, Quandt FN. Ion channel expression in PMA-differentiated human THP-1 macrophages. J Membr Biol
152: 141–157, 1996.
6. Frey BW, Carl A, Publicover NG. Charybdotoxin block of Ca2⫹activated K⫹ channels in colonic muscle depends on membrane potential
dynamics. Am J Physiol Cell Physiol 274: C673–C680, 1998.
7. Gao Y, Hanley PJ, Rinné S, Zuzarte M, Daut J. Calcium-activated K⫹
channel (KCa3.1) activity during Ca2⫹ store depletion and store-operated
Ca2⫹ entry in human macrophages. Cell Calcium 48: 19 –27, 2010.
8. Graham CH, Hawley TS, Hawley RG, MacDougall JR, Kerbel RS,
Khoo N, Lala PK. Establishment and characterization of first trimester
human trophoblast cells with extended lifespan. Exp Cell Res 206: 204 –
211, 1993.
9. Goldstein SAN, Miller C. Mechanisms of charybdotoxin block of a
voltage-gated K⫹ channel. Biophys J 65: 1613–1619, 1993.
10. Grissmer S, Nguyen A, Cahalan M. Calcium-activated potassium channels in resting and activated human T lymphocytes. Expression levels,
calcium dependence, ion selectivity, and pharmacology. J Gen Physiol
102: 601–630, 1993.
11. Grygorczyk R, Schwarz W. Ca2⫹-activated K⫹ permeability in human
erythrocytes: modulation of single-channel events. Eur Biophys J 12:
57–65, 1985.
12. Horn R. Estimating the number of channels in patch recordings. Biophys
J 60: 433–439, 1991.
13. Hougaard CH, Eriksen BL, Jørgensen S, Johansen TH, Dyhring T,
Madsen LS, Strøbaek D, Christophersen P. Selective positive modulation of the SK3 and SK2 subtypes of small conductance Ca2⫹-activated
K⫹ channels. Br J Pharmacol 151: 655–665, 2007.
14. Joiner WJ, Wang LY, Tang MD, Kaczmarek L. hSK4, a member of a
novel subfamily of calcium-activated potassium channels. Proc Natl Acad
Sci USA 94: 11013–11018, 1997.
15. Kapural L, Feinstein MB, O’Rourke F, Fein A. Suppression of the
delayed rectifier type of voltage gated K⫹ outward current in megakaryocytes from patients with myelogenous leukemias. Blood 86: 1043–1055,
1995.
16. Kim SY, Silver MR, DeCoursey TE. Ion channels in human THP-1
monocytes. J Membr Biol 152: 117–130, 1996.
17. Köhler M, Hirschberg B, Bond CT, Kinzie JM, Marrion NV, Maylie
J, Adelman JP. Small-conductance, calcium-activated potassium channels from mammalian brain. Science 273: 1709 –1714, 1996.
18. Latorre R, Oberhauser A, Labarca P, Alvarez O. Varieties of calciumactivated potassium channels. Annu Rev Physiol 51: 385–399, 1989.
19. Ledoux J, Boven AD, Nelson MT. Ca2⫹-activated K⫹ channels in
murine endothelial cells: block by intracellular calcium and magnesium. J
Gen Physiol 131: 125–135, 2008.
20. Lew V, Tiffert TT, Etzion Z, Perdomo D, Daw N, Macdonald L,
Bookchin RM. Distribution of dehydration rates generated by maximal
Gardos-channel activation in normal and sickle red blood cells. Blood 105:
361–367, 2005.
21. Li Y, Gamper N, Shapiro MS. Single-channel analysis of KCNQ K⫹
channels reveals the mechanism of augmentation by cysteine-modifying
reagents. J Neurosci 24: 5079 –5090, 2004.
22. Logsdon NJ, Kang J, Togo JA, Christian EP, Aiyar J. A novel gene,
hKCa4, encodes the calcium-activated potassium channel in human T
lymphocytes. J Biol Chem 272: 32723–32726, 1997.
23. Lu X, Fein A, Feinstein MB, O’Rourke FA. Antisense knock out of the
inositol 1,3,4,5-tetrakisphosphate receptor GAP1IP4BP in the human erythroleukemia cell line leads to the appearance of intermediate conductance
KCa channels that hyperpolarize the membrane and enhance calcium
influx. J Gen Physiol 113: 81–95, 1999.
24. Martin P, Papayannopoulou T. HEL cells: a new human erythroleukemia cell line with spontaneous and induced globin expression. Science
216: 1233–1235, 1982.
25. Mason MJ, Hussain JF, Mahaut-Smith MP. A novel role for membrane
potential in the modulation of intracellular Ca2⫹ oscillations in rat megakaryocytes. J Physiol 524: 437–448, 2000.
26. Mason MJ, Schaffner C, Floto PA, Teo QA. Constitutive expression of
a Mg2⫹ inhibited K⫹ current and a TRPM7-like current in human
erythroleukemia cells. Am J Physiol Cell Physiol 302: C853–C867, 2012.
27. Meech RW, Strumwasser F. Intracellular calcium injection activates
potassium conductance in Aplysia nerve cells (Abstract). Fed Proc 29:
834, 1970.
28. Neher E. Correction for liquid junction potentials in patch clamp experiments. Methods Enzymol 207: 123–131, 1992.
29. Park CS, Miller C. Mapping function to structure in a channel-blocking
peptide: electrostatic mutants of charybdotoxin. Biochemistry 31: 7749 –
7755, 1992.
30. Patton C, Thompson S, Epel D. Some precautions in using chelators to
buffer metals in biological solutions. Cell Calcium 35: 427–431, 2004.
31. Robitaille R, Charlton M. Presynaptic calcium signals and transmitter
release are modulated by calcium-activated potassium channels. J Neurosci 12: 297–305, 1992.
32. Sanchez M, McManus OB. Paxilline inhibition of the ␣-subunit of the
high conductance calcium-activated potassium channel. Neuropharmacology 35: 963–968, 1996.
33. Selyanko AA, Hadley JK, Brown DA. Properties of single M-type
KCNQ2/KCNQ3 potassium channels expressed in mammalian cells. J
Physiol 534: 15–24, 2001.
34. Strøbaek D, Teuber L, Jørgensen TD, Ahring PK, Kjaer K, Hansen
RS, Oleson SP, Christopherson P, Skaaning-Jenson B. Activation of
human IK and SK Ca2⫹-activated K⫹ channels by NS309 (6,7-dichloro1H-indole-2,3-dione 3-oxime). Biochim Biophys Acta 1665: 1–5, 2004.
35. Thompson J, Begenisich T. Membrane-delimited inhibition of maxi-K
channel activity by the intermediate conductance Ca2⫹-activated K channel. J Gen Physiol 127: 159 –169, 2006.
36. Toro L, Wallner M, Meera P, Tanaka Y. Maxi-KCa, a unique member
of the voltage-gated K channel superfamily. News Physiol Sci 13: 112–
117, 1998.
37. Trautmann A, Marty A. Activation of Ca-dependent K channels by
carbamoylcholine in rat lacrimal glands. Proc Natl Acad Sci USA 81:
611–615, 1984.
38. Trudeau MC, Warmke JW, Ganetzky B, Robertson GA. HERG, a
human inward rectifier in the voltage-gated potassium channel family.
Science 269: 92–95, 1995.
39. Schreiber M, Salkoff L. A novel calcium-sensing domain in the BK
channel. Biophys J 73: 1355–1363, 1997.
40. Tsien RY, Pozzan T, Rink TJ. T-cell mitogens cause early changes in
cytoplasmic free Ca2⫹ and membrane potential in lymphocytes. Nature
295: 68 –71, 1982.
41. Tsuchiy S, Yamabe M, Yamaguchi Y, Kobayashi Y, Konno T, Tada
K. Establishment and characterization of a human acute monocytic leukemia cell line (THP-1). Int J Cancer 26: 171–176, 1980.
42. Vergara C, Latorre R, Marrion N, Adelman J. Calcium-activated
potassium channels. Curr Opin Neurobiol 8: 321–329, 1998.
43. Wei AD, Gutman GA, Aldrich R, Chandy KG, Grissmer S, Wulff H.
International Union of Pharmacology. LII. Nomenclature and molecular
relationships of calcium-activated potassium channels. Pharmcol Rev 57:
463–472, 2005.
44. Yan J, Aldrich RW. LRRC26 auxillary protein allows BK channel
activation at resting voltage without calcium. Nature 466: 513–516, 2010.
45. Zuhlke RD, Pitt GS, Deisseroth K, Tsien RW, Reuter H. Calmodulin
supports both inactivation and facilitation of L-type calcium channels.
Nature 399: 159 –161, 1999.
AJP-Cell Physiol • doi:10.1152/ajpcell.00368.2012 • www.ajpcell.org