Am J Physiol Cell Physiol 304: C858–C872, 2013. First published February 13, 2013; doi:10.1152/ajpcell.00368.2012. Voltage dependence of the Ca2⫹-activated K⫹ channel KCa3.1 in human erythroleukemia cells Colin J. Stoneking, Oshini Shivakumar, David Nicholson Thomas, William H. Colledge, and Michael J. Mason Department of Physiology, Development, and Neuroscience, University of Cambridge, Cambridge, United Kingdom Submitted 19 November 2012; accepted in final form 6 February 2013 Stoneking CJ, Shivakumar O, Nicholson Thomas D, Colledge WH, Mason MJ. Voltage dependence of the Ca2⫹activated K⫹ channel KCa3.1 in human erythroleukemia cells. Am J Physiol Cell Physiol 304: C858 –C872, 2013. First published February 13, 2013; doi:10.1152/ajpcell.00368.2012.—We have isolated a K⫹-selective, Ca2⫹-dependent whole cell current and single-channel correlate in the human erythroleukemia (HEL) cell line. The whole cell current was inhibited by the intermediate-conductance KCa3.1 inhibitors clotrimazole, TRAM-34, and charybdotoxin, unaffected by the small-conductance KCa2 family inhibitor apamin and the large-conductance KCa1.1 inhibitors paxilline and iberiotoxin, and augmented by NS309. The single-channel correlate of the whole cell current was blocked by TRAM-34 and clotrimazole, insensitive to paxilline, and augmented by NS309 and had a single-channel conductance in physiological K⫹ gradients of ⬃9 pS. RT-PCR revealed that the KCa3.1 gene, but not the KCa1.1 gene, was expressed in HEL cells. The KCa3.1 current, isolated in HEL cells under whole cell patch-clamp conditions, displayed an activated current component during depolarizing voltage steps from hyperpolarized holding potentials and tail currents upon repolarization, consistent with voltagedependent modulation. This activated current increased with increasing voltage steps above ⫺40 mV and was sensitive to inhibition by clotrimazole, TRAM-34, and charybdotoxin and insensitive to apamin, paxilline, and iberiotoxin. In single-channel experiments, depolarization resulted in an increase in open channel probability (Po) of KCa3.1, with no increase in channel number. The voltage modulation of Po was an increasing monotonic function of voltage. In the absence of elevated Ca2⫹, voltage was ineffective at inducing channel activity in whole cell and single-channel experiments. These data indicate that KCa3.1 in HEL cells displays a unique form of voltage dependence modulating Po. voltage dependence; KCa3.1; open channel probability; potassium channel the activity of several plasma membrane ion channels (4, 39, 45). Of these, Ca2⫹-activated K⫹ channels are of particular importance, forming a large and diverse family (reviewed in Refs. 18 and 42). Under physiological conditions, these channels mediate an efflux of K⫹ in response to increases in cytoplasmic Ca2⫹, which leads to membrane hyperpolarization. The associated hyperpolarization and K⫹ efflux have been ascribed important roles. The hyperpolarization accompanying activation of these channels (27) can have positive and negative effects on the magnitude of Ca2⫹ transients. On one hand, the hyperpolarization increases the driving force for store-regulated Ca2⫹ entry in nonexcitable cells (7, 40). However, activation of these channels can suppress Ca2⫹ entry via voltage-gated Ca2⫹ channels (31), preCALCIUM DIRECTLY MODULATES Address for reprint requests and other correspondence: M. J. Mason, Dept. of Physiology, Development, and Neuroscience, Univ. of Cambridge, Downing St., Cambridge, CB2 3EG, UK (e-mail: mjm39@cam.ac.uk). C858 sumably due to the resulting hyperpolarization. In addition to the role of these channels in hyperpolarization, K⫹ efflux has been implicated in some secretory processes (37) and in erythrocyte osmoregulation (20). Ca2⫹-activated K⫹ channels can be classified into three distinct classes on the basis of single-channel conductance, inhibitor and activator sensitivity, and gene identification (1, 43). The small-conductance class contains three members, KCa2.1, KCa2.2, and KCa2.3, encoded in humans by the KCNN1, KCNN2, and KCNN3 genes, respectively (hereafter referred to as the KCa2 family; alternative channel designations: SKCa1, SKCa2, and SKCa3; SK1, SK2, and SK3). The intermediate-conductance channel family consists of a single member, KCa3.1, encoded in humans by the KCNN4 gene (alternative channel designations: IK1, IKCa1, SK4, and Gardos). This channel has a unitary conductance in physiological K⫹ gradients of 9 –12 pS (10, 14, 22). Importantly, the smalland intermediate-conductance channel families are generally considered to not be modulated by membrane voltage (1, 43). This is in marked contrast to the third class of Ca2⫹activated K⫹ channels, the large-conductance channel KCa1.1 (alternative channel designations: Slo, Slo1, BK, and maxi-K⫹), encoded by the KCNMA1 gene in humans. This channel is activated in a synergistic fashion by membrane depolarization and Ca2⫹ (reviewed in Ref. 36). The three classes of Ca2⫹-activated K⫹ channels are also distinguished by their sensitivity to a variety of inhibitory agents, such as apamin, charybdotoxin, clotrimazole, TRAM34, paxilline, and iberiotoxin (1, 43). The KCa2 family of channels can be distinguished from KCa3.1 and KCa1.1 channels on the basis of their sensitivity to block by the bee venom apamin and insensitivity to the scorpion toxin charybdotoxin, which blocks KCa3.1 and KCa1.1 channels. KCa3.1 is selectively blocked by clotrimazole and TRAM-34, both of which have no effect on SK and BK channels. Finally, the KCa1.1 channel is selectively inhibited by paxilline and iberiotoxin. By testing the sensitivity of a Ca2⫹-activated K⫹ current to a broad spectrum of inhibitory agents, it is possible to determine which of the three classes of Ca2⫹-activated K⫹ channels underlies the specific conductance under investigation. While the KCa2 family and KCa3.1 channel have been reported to be devoid of voltage modulation (1, 43), at least three reports in the literature demonstrate a time-dependent activation of the current at depolarized potentials. This activated component of KCa3.1 is suggestive of voltage modulation of the channel by a process independent of the effect of voltage on driving force (7, 14, 16). In one case, this activated component was accompanied by small tail currents, consistent with the expectation for voltageactivated currents (14). No investigations of the activated current component of the whole cell response to depolarizing voltage 0363-6143/13 Copyright © 2013 the American Physiological Society http://www.ajpcell.org VOLTAGE DEPENDENCE OF KCa3.1 steps have been reported. Experiments performed in our laboratory on the human erythroleukemia (HEL) cell line have isolated a Ca2⫹-activated K⫹ current with characteristics identical to those reported for KCa3.1. Interestingly, we have consistently observed a marked activated current component of the whole cell response that suggests that this current may be activated by depolarization. On the basis of these preliminary observations, we have undertaken a more detailed investigation of the influence of membrane potential on modulation of KCa3.1 in HEL cells. MATERIALS AND METHODS Reagents NaCl and KCl were purchased from Sigma-Aldrich (Gillingham, Dorset, UK) or Fisher Scientific (Loughborough, Leicestershire, UK). MgCl2, HEPES, sodium methanesulfonate, potassium methanesulfonate, N-methyl-D-glucamine (NMDG⫹), BAPTA, EGTA, NaOH, KOH, DMSO, and PMA were purchased from Sigma-Aldrich. CaCl2 was purchased from VWR International (Lutterworth, Leicestershire, UK) or BDH (Poole, Dorset, UK). MgSO4 was purchased from BDH. D-Glucose was purchased from Fissons Scientific Apparatus (Loughborough, Leicestershire, UK). Clotrimazole and NS309 were purchased from Sigma-Aldrich and made up in DMSO. E-4031 was obtained from Merck Bioscience Calbiochem (Nottingham, Nottinghamshire, UK) and made up in distilled water. Paxilline was purchased from Enzo Life Sciences (Exeter, Devon, UK), and TRAM-34 was purchased from R & D Systems (Abingdon, Oxford, UK); both were made up in DMSO. Charybdotoxin and iberiotoxin were purchased from AnaSpec (San Jose, CA), and apamin was purchased from Sigma-Aldrich; all toxins were made up in distilled water. Cell Culture HEL cells, a human erythroleukemia cell line (24), were originally obtained from the European Collection of Animal Cell Cultures (Porton Down, Salisbury, UK). THP-1 cells, a human monocytic leukemia cell line (41), were obtained from Dr. Andres Floto (Cambridge Institute for Medical Research, Cambridge, UK). HTR-8/ SVneo cells, an extravillous trophoblast-derived human cell line (8), was originally obtained from Dr. Javier Tello (Medical Research Council Reproductive Sciences Unit, Edinburgh, UK). HEL and THP-1 cells were propagated in HCO⫺ 3 -buffered RPMI 1640 medium supplemented with 10% fetal bovine serum, 4 mM L-glutamine, 100 U/ml penicillin, and 50 g/ml streptomycin (all from Sigma-Aldrich or Invitrogen, Paisley, UK). HTR-8/SVneo cells were propagated in RPMI 1640 medium, as described above, except 5% fetal bovine serum and 2 mM L-glutamine were used. HEL and undifferentiated THP-1 cells were grown in suspension and passaged two to three times per week. HTR-8/SVneo cells are an adherent cell line passaged by trypsinization two to three times per week. THP-1 cells were differentiated by addition of 8 ng/ml PMA to the culture medium. Differentiation was indicated by cell adherence and spreading to the culture dish. Differentiated THP-1 cells were harvested for mRNA purification after 3 days by scraping, while adherent HTR-8/SVneo cells were removed by trypsinization. For mRNA purification, all cells were centrifuged and washed in standard NaCl-based extracellular solution (see Solutions) to remove serum. Solutions Whole cell recordings. For whole cell recording, the standard KCl-based pipette solution contained (mM) 150 KCl, 4.4438 CaCl2, 5.0703 MgCl2, 5 BAPTA, and 10 HEPES, with pH adjusted to 7.2 with KOH (⬃172 mM calculated total K⫹). The values for Ca2⫹ and Mg2⫹ are the theoretical total concentrations that are added to yield 2 M free Ca2⫹ and 5 mM free Mg2⫹, as determined by WEBMAXC with extended constants (www.stanford.edu/⬃cpatton/maxc.html) C859 (30). Zero Ca2⫹ and 10 M Ca2⫹ internal solutions were made by omitting or altering total Ca2⫹ and adjusting total Mg2⫹ to maintain 5 mM free Mg2⫹. Low-Cl⫺ internal solution was made by equimolar substitution of KCl with K-methanesulfonate and substitution of MgCl2 with MgSO4. The standard NaCl-based extracellular solution contained (mM) 145 NaCl, 5 KCl, 1 CaCl2, 1 MgCl2, 10 glucose, and 10 HEPES, with pH adjusted to 7.35 with NaOH (149 mM calculated total Na⫹). High-K⫹ solution contained (mM) 150 KCl, 1 CaCl2, 1 MgCl2, 10 glucose, and 10 HEPES, with pH adjusted to 7.35 with KOH (154 mM calculated total K⫹). Low-Cl⫺ external solution was made by equimolar substitution of NaCl with Na-methanesulfonate, KCl with K-methanesulfonate, and MgCl2 with MgSO4. All solution changes in the experimental chamber were made by gravity-fed superfusion. Excised inside-out single-channel recordings. For excised insideout single-channel recordings, the pipette solution was identical to the standard NaCl-based extracellular solution used for whole cell recordings. The standard KCl-based bath solution contained (mM) 150 KCl, 4.5290 CaCl2, 5.0869 MgCl2, 5 EGTA, and 10 HEPES, with pH adjusted to 7.2 with KOH (⬃172 mM calculated K⫹). These theoretical values for total Ca2⫹ and Mg2⫹ yield 2 M free Ca2⫹ and 5 mM free Mg2⫹, as determined by WEBMAXC with extended constants. Total Ca2⫹ and Mg2⫹ were altered using values obtained from WEBMAXC to yield solutions of free Ca2⫹ and Mg2⫹ as defined in the text. K⫹-free bath solution was made by equimolar substitution of K⫹ for NMDG⫹. RT-PCR for detection of KCNN4 and KCNMA1 gene expression. RNA was purified from each cell line using the SV Total RNA Isolation System (Promega, Madison, WI) according to the manufacturer’s instructions, except the on-column DNase step to reduce genomic DNA was extended to 1 h. cDNA was synthesized from the total RNA using the GoScript reverse transcription system (Promega) according to the manufacturer’s instructions, with oligo(dT)15 and random primers used for the first-strand synthesis. PCR was performed using the following primers designed using online Primer3 software (frodo.wi.mit.edu): KCNN4 [GTGCCTCAGAGCAAAAGTCC (forward) and TGCTGATCGTGCATTTAACC (reverse), 332-bp PCR product from cDNA] and KCNMA1 [ATATCCACGCGAACCATCTC (forward) and TGGCTTGAGCCATTGTTAATC (reverse), 328-bp PCR product from cDNA]. PCR cycle conditions were as follows: once at 95°C for 5 min followed by 40 times at different temperatures for different times (95°C for 15 s, 60°C for 30 s, and 72°C for 30 s), and finally once at 72°C for 2 min. No-cDNA and reverse transcriptase-negative controls were included in the PCRs. PCR products were analyzed on a 1% agarose gel and visualized with SafeView (NBS Biologicals, Huntingdon, UK) under UV light. All PCR products were confirmed by sequencing. Recording, Data Acquisition, and Analysis Cells were added to a low-volume Plexiglas chamber mounted on the stage of an inverted microscope. The bottom of the chamber was formed by adherence of a glass coverslip with silicone grease. The chamber was grounded via a Ag/AgCl wire placed directly in the chamber downstream of the cells. Tight-seal whole cell patch-clamp recordings in voltage-clamp mode and excised single-channel recordings were carried out using an Axopatch 200A amplifier (Molecular Devices, Union City, CA). The series resistance compensation feature of the amplifier was used to achieve 70% series resistance compensation in whole cell recordings. Electrodes were pulled from filamented borosilicate glass (Harvard Apparatus, Kent, UK), and the tips were fire-polished. Electrodes had resistances of 2– 8 M⍀ when filled with standard KCl-based internal solution for whole cell recordings and 10 –14 M⍀ when filled with NaCl-based solution for excised patch recordings. All experiments were performed at room temperature (20 –24°C). AJP-Cell Physiol • doi:10.1152/ajpcell.00368.2012 • www.ajpcell.org C860 VOLTAGE DEPENDENCE OF KCa3.1 Amplifier control and data acquisition were performed using Axograph 4.9 or Axograph X software (Axograph Scientific, Sydney, Australia) running on a Macintosh computer using a Digidata 1322A 16-bit data acquisition system (Molecular Devices, Union City, CA). Analysis was performed using Axograph and custom macros and procedures written within IGOR Pro (Wavemetrics, Lake Oswego, OR). In whole cell recordings, 500-ms voltage steps from ⫺103 to ⫹97 mV were applied from a holding potential of ⫺103 or ⫺3 mV. The data were filtered at 1 kHz using the four-pole Bessel filter of the Axopatch 200A amplifier and acquired at 5 kHz. All data represent the raw whole cell currents uncorrected for the presence of background currents. The “step current” was measured as the mean current over a 1- to 2-ms interval immediately after dissipation of any uncompensated capacitative transients. The “activated current” was calculated as the difference between the step current and the steady-state current, measured as an average within the last 6 ms of the voltage step. Reversal potentials were estimated by interpolation of the current-voltage (I-V) relationship around zero current during steps from a holding potential of ⫺103 mV. Excised single-channel data were filtered at 1 or 2 kHz and acquired at 10 kHz. When required, channel activity was quantified using all-points-amplitude histograms produced using the built-in histogram routine within IGOR Pro with a current bin width of 0.05 pA. The calculated amplitude histograms were fit to the sum of multiple Gaussian distributions using the multipeak fitting routine within IGOR Pro. The calculated areas A of the individual Gaussian peaks of the multipeak fit were taken directly from the output of the peak fitting routine and used to calculate NPo, were N is the number of channels and Po is the open channel probability. If it is assumed that all channels are identical and behave independently, NPo can be determined from the areas of individual Gaussian peaks using the following relationship (3) as modified from Selyanko et al. (33) and Li et al. (21) N NPo ⫽ 兺 iAi i⫽0 N 兺 Ai i⫽0 where Ai is the area of the corresponding Gaussian peak for i open channels and N is the number of current levels in the patch as determined by the number of Gaussian peaks corresponding to multiples of the unitary single-channel current. Unitary single-channel currents were determined by averaging the current during brief, 5- to 10-ms, openings, during which the channel was continuously open, and subtracting the average current during adjacent brief periods when the channel was closed. We avoided open periods containing brief or partial closures of the channel to ensure that unitary current estimates were not contaminated by filtering artifacts. The slope conductance of the channel was determined from the slope of the linear fit of the I-V relationship between ⫺23 and ⫹17 mV. To analyze the effect of membrane potential on channel activity, we used a repetitive step protocol in which the patch was stepped between ⫺3 mV and the test potential at 5-s intervals. The first second after each voltage change was discarded to avoid capacitive transients, and the remaining data were combined into two data sets, one at ⫺3 mV and one at the test potential. These were used to generate two all-points-amplitude histograms, one at ⫺3 mV and one at the test potential. On average, 30 – 40 voltage steps were used to generate these histograms. This protocol avoids any bias due to changes in basal channel activity during the experiment. For the whole cell experiments initiated with KCl-based pipette solutions and NaCl-based bath solutions, a ⫹3-mV junction potential correction was applied to all voltages presented in RESULTS (28). For the excised inside-out single-channel data initiated with NaCl-based pipette solution and a KCl-based bath solution, a ⫺3-mV junction potential correction was applied (28). The single-channel current data are presented such that upward deflections represent an outward current and all voltages are membrane potential; intracellular face of the patch relative to the extracellular face of the patch. For presentation purposes, single-channel data recordings have been filtered using a binomial filter within IGOR Pro. Data filtered only at the level of the Axopatch 200A amplifier were used for all analyses. Values are means ⫾ SE. Differences were considered statistically significant at P ⱕ 0.05. The effect of intracellular Ca2⫹, holding potential, or inhibitors and activators on the steady-state, step, or activated component of the whole cell I-V relationship was analyzed using two-way ANOVA for related or unrelated samples as appropriate. Factor 1 consists of 11 levels corresponding to the 11 voltage steps from ⫺103 to ⫹97 mV (9 levels in the case of the analysis of the effect of charybdotoxin on the activated current component; see RESULTS); factor 2 consists of two levels corresponding to the control and experimental condition under investigation. Our analyses of these data focused on the determination of significant differences within factor 2 (i.e., control vs. experimental condition) across the combined levels of factor 1. In other experiments, significance of differences between means was determined using Student’s t-test for paired or unpaired samples, Welch’s t-test for unequal variance, or one- or two-way ANOVA for related or unrelated samples as appropriate. Bonferroni’s tests with correction for multiple comparisons were used for post hoc comparisons when required. For determination of significant differences from normalized data values of 1, confidence intervals corrected for multiple comparisons were used. RESULTS To detect a Ca2⫹-activated K⫹ conductance, HEL cells were whole cell patch-clamped with a KCl-based pipette solution buffered to 2 M free Ca2⫹ and 5 mM free Mg2⫹ with BAPTA (⬃172 mM K⫹), and 500-ms voltage steps to different potentials were applied from a holding potential of ⫺103 mV in 20-mV increments. To ensure that the whole cell currents recorded were not contaminated by TRPM7, which is constitutively activated in HEL cells (26), the pipette solution had a free Mg2⫹ concentration of 5 mM to inhibit this conductance. Figure 1A shows representative currents recorded in response to the indicated voltage steps. All voltages have been corrected for a ⫹3-mV junction potential (see MATERIALS AND METHODS). The cell was superfused with normal NaCl solution containing 5 mM K⫹. The mean whole cell steady-state I-V relationship for the peak current recorded in 49 cells is shown in Fig. 1C. The steady-state current was measured at the end of the 500-ms voltage step (arrow in Fig. 1, A and B). The current reversed at a negative potential close to the K⫹ equilibrium potential, consistent with K⫹ being the dominant charge carrier. The Ca2⫹ dependence of the K⫹ current was confirmed by application of identical voltage steps to cells whole cell patched with a pipette solution devoid of Ca2⫹. Under these conditions, little current was detected (Fig. 1B). A two-way ANOVA was performed to confirm the statistical significance of the influence of intracellular Ca2⫹ (see Recording, Data Acquisition, and Analysis). The mean I-V relationship from seven cells patched with this 0 Ca2⫹ internal solution showed a significant reduction in the whole cell current relative to cells patched with 2 M Ca2⫹ solution (P ⱕ 0.05) and a reversal potential near 0 mV, consistent with the absence of a dominant K⫹ conductance (Fig. 1C). To directly investigate the K⫹ permeability of this Ca2⫹activated conductance, extracellular K⫹ was altered. Cells were patched with the same 2 M Ca2⫹-containing internal solution AJP-Cell Physiol • doi:10.1152/ajpcell.00368.2012 • www.ajpcell.org C861 VOLTAGE DEPENDENCE OF KCa3.1 A B 800 2 µM Ca2+ 600 400 500 ms 200 0 -200 0 Ca2+ 600 Current (pA) Current (pA) 800 400 500 ms 200 0 -200 +97 -103 +97 -103 800 I (pA) C 1000 I (pA) D 5 K+ 600 154 K+ 500 400 200 -100 2 µM Ca2+ 0 Ca2+ -100 -50 -500 * -50 -200 50 100 Vm (mV) 50 100 Vm (mV) -1000 0 E from the data in Fig. 1D is plotted as a function of the logarithm of extracellular K⫹ concentration in Fig. 1E (n ⫽ 10). These data show a slope of 52 mV per decade change in extracellular K⫹, a value in good agreement with that expected for a highly K⫹selective conductance in the presence of small residual background currents or a channel that is not perfectly selective for K⫹ over Na⫹. It is clear in Fig. 1A that the current response to voltage steps consists of two components, an initial instantaneous current in response to the voltage steps (step component) and a secondary slower-activating component (activated component). The activated component may be indicative of a voltage-dependent process modulating the Ca2⫹-activated K⫹ conductance. To investigate the effect of membrane voltage, cells were whole cell patched with the same solution used in Fig. 1. Figure 2A shows representative current responses to voltage steps from a holding potential of ⫺103 mV; the step and activated current components for the ⫹97-mV step are shown in the inset. In Fig. 2C, the magnitude of the mean activated current component is plotted as a function of membrane potential for 49 cells. No activated current component was observed until voltage was stepped to ⫺43 mV; then a monotonic increase in the activated current component was observed up to ⫹97 mV, consistent with voltage modulation of the Ca2⫹-activated K⫹ conductance. -50 A -75 2⫹ 1.0 1.5 2.0 log [K+]o 2.5 ⫹ Fig. 1. Detection of a Ca -activated K current in human erythroleukemia (HEL) cells. A: a cell was cell patched with a KCl-based pipette internal solution with 2 M free Ca2⫹ and superfused with standard extracellular NaCl-based external solution containing 5 mM K⫹, and 500-ms voltage steps in 20-mV increments from a holding potential of ⫺103 mV were applied. B: a cell was whole cell patched with a KCl-based pipette internal solution devoid of added Ca2⫹ and superfused with extracellular solution described in A, and 500-ms voltage steps in 20-mV increments from a holding potential of ⫺103 mV were applied. C: mean current-voltage (I-V) relationship in cells dialyzed with 2 M free Ca2⫹ (n ⫽ 49) or 0 Ca2⫹ (n ⫽ 7). Current was measured at the end of the voltage step, as indicated by arrows in A and B. Vm, membrane potential. *Significantly different from 2 M free Ca2⫹ (P ⱕ 0.05). D: effect of extracellular K⫹ on whole cell I-V relationship. Cells were whole cell patched with a KCl-based pipette internal solution with 2 M, and voltage-step protocol described in A was administered during superfusion of each cell with 5 and 154 mM K⫹ solution (n ⫽ 10). Current was measured at the end of the voltage step, as indicated by arrows in A and B. E: reversal potential (Erev) in 5 and 154 mM extracellular K⫹ (n ⫽ 10) estimated from data in D. Dotted line denotes theoretical reversal potential for a 58.5-mV shift per decade change in extracellular K⫹ concentration ([K⫹]o) with 172 mM intracellular K⫹. Values are means ⫾ SE; lack of error bars indicates that SE is within the size of the symbol. used in the experiments presented in Fig. 1A, and an identical voltage-step protocol was administered during superfusion with 5 and 154 mM extracellular K⫹-containing solutions. The mean steady-state whole cell I-V relationships obtained in 10 cells superfused with 5 and 154 mM extracellular K⫹ are shown in Fig. 1D. Exposure to high-K⫹ solution resulted in a shift in the reversal potential to values near ⫺3 mV, as expected for a highly K⫹-selective conductance. The mean reversal potential estimated Current (pA) -100 0.5 B 500 500 Activated I 400 Step I 300 200 100 500 ms 0 -100 Current (pA) Erev -25 400 300 200 100 500 ms 0 -100 +97 +97 -3 -103 -103 C 300 I (pA) Activated I D 600 I (pA) Step I * 400 200 100 -103 mV HP -3 mV HP -100 -100 -50 50 100 Vm (mV) -100 -50 50 100 Vm (mV) -200 Fig. 2. Analysis of step and activated components of whole cell Ca2⫹-activated K⫹ current response to voltage steps. A: a cell was whole cell patched with a KCl-based pipette internal solution containing 2 M free Ca2⫹ and superfused with standard extracellular NaCl-based solution containing 5 mM K⫹, and 500-ms voltage steps in 20-mV increments from a holding potential of ⫺103 mV were applied. Inset: step and activated components of current response for voltage step to ⫹97 mV. B: cell described in A was subjected to 500-ms voltage steps as applied in A from a holding potential of ⫺3 mV. C: magnitude of the activated component of the whole cell current response measured from voltage steps applied in A (n ⫽ 49). D: magnitude of the step component of the whole cell current response to voltage steps administered from ⫺103 and ⫺3 mV holding potentials (HP). Effects of both holding potentials were investigated in each cell. *Significantly different from ⫺103 mV (P ⱕ 0.05, n ⫽ 49). Values are means ⫾ SE; lack of error bars indicates that SE was within the size of the symbol. AJP-Cell Physiol • doi:10.1152/ajpcell.00368.2012 • www.ajpcell.org C862 VOLTAGE DEPENDENCE OF KCa3.1 Further support for the hypothesis that voltage steps lead to a secondary voltage-dependent increase in K⫹ conductance is provided by the small inward tail currents detected upon return to ⫺103-mV holding potential following a depolarized voltage step (Fig. 2A). No activated current or tail currents were detected in the absence of elevated cytosolic Ca2⫹ (Fig. 1B), consistent with the activated current being a component of the Ca2⫹-activated K⫹ conductance. Experiments in which voltage steps were applied from a holding potential of ⫺3 mV are consistent with the hypothesis that the noninactivating steady-state conductance value is a monotonic increasing function of the membrane potential. Figure 2B shows a representative experiment using a holding potential of ⫺3 mV. Steps to potentials more positive than ⫺3 mV were accompanied by a slow increase in current. In contrast, steps to potentials more negative than ⫺3 mV but more positive than the reversal potential were accompanied by a slow decrease in the current. When voltage steps were applied from a holding potential of ⫺103 or ⫺3 mV, no significant inactivation of the activated component over time (i.e., decrease in current) was observed. The observation that negative voltage steps applied from a holding potential of ⫺3 mV led to a slow decrease in the current is also consistent with a lack of inactivation, since it indicates that the voltagedependent augmentation of the conductance at ⫺3 mV remains even when the cell is held at this potential for prolonged periods of time. To further investigate whether inactivation occurred, we analyzed the initial step components of the current evoked by voltage steps from ⫺103 and ⫺3 mV in paired experiments in which voltage steps were applied from both holding potentials in each of 49 cells (Fig. 2D). To determine whether the holding potential altered the magnitude of the initial step component, a repeated-measures two-way ANOVA was performed (see Recording, Data Acquisition, and Analysis). A significant main effect was found for the holding potential factor, with the initial step component being significantly greater (P ⱕ 0.05, n ⫽ 49) when voltage steps were made from a ⫺3-mV holding potential. This indicates that the conductance was enhanced for the entire time the cell was held at this potential. While the KCa2 family and the KCa3.1 channel have been reported to lack voltage dependence, it is well established that the large-conductance Ca2⫹-activated K⫹ channel KCa1.1 displays pronounced voltage dependence (for review see Ref. 36). Coexpression of the large-conductance channel with either of the voltage-independent channel types could underlie the voltage dependence of the Ca2⫹-activated whole cell current. Such coexpression has been reported in parotid acinar cells, with voltage steps displaying a similar secondary current activation at depolarized potentials (35). To investigate which channels contribute to the voltage-dependent current, we tested its sensitivity to well-established inhibitors of voltage-independent and -dependent Ca2⫹-activated K⫹ channels. To test whether the KCa1.1 channel contributes, we investigated the effect of the KCa1.1-selective inhibitors paxilline and iberiotoxin. Cells were whole cell patched with the same KCl-based pipette solution buffered to 2 M free Ca2⫹ used previously, and the voltage-step protocol shown in Fig. 2A was administered. Neither 50 nM (n ⫽ 4) nor 100 nM (n ⫽ 4) iberiotoxin inhibited the activated component of the current response to voltage steps. Figure 3A shows the effect of the A B 400 I (pA) 500 I (pA) Activated I Activated I 400 300 300 200 200 100 100 -100 -50 -100 C 400 Paxilline Control Iberiotoxin 50 100 Vm (mV) -100 -50 -100 D I (pA) 300 50 100 Vm (mV) I (pA) Activated I Activated I 300 200 200 100 100 -100 -50 -100 Control E-4031 Control Apamin 50 100 Vm (mV) -100 -50 50 100 Vm (mV) -100 Fig. 3. Sensitivity of the activated current component to modulation by established ion channel inhibitors. Cells were patched with a KCl-based pipette internal solution containing 2 M free Ca2⫹ and superfused with standard extracellular NaCl-based solution containing 5 mM K⫹, and voltage-step protocol shown in Fig. 2A was administered from a holding potential of ⫺103 mV. A: mean activated current component in the absence (control) and presence of 50 or 100 nM iberiotoxin. Control and iberiotoxin data were obtained from each cell (P ⱖ 0.05, n ⫽ 8). B: mean activated current component following 10 min of incubation in 1 M paxilline. C: mean activated current component in the absence (control) and presence of 200 nM apamin. Control and apamin data were obtained from each cell (P ⱖ 0.05, n ⫽ 7). D: mean activated current component in the absence (control) and presence of E-4031. Control and E-4031 data were obtained from each cell (P ⱖ 0.05, n ⫽ 8). Values are means ⫾ SE; lack of error bars indicates that SE is within the size of the symbol. pooled mean data on the magnitude of the activated component of the current response (P ⱖ 0.05, n ⫽ 8). The effect of paxilline, an alternative selective inhibitor of KCa1.1 was also investigated. Because the putative site of paxilline inhibition may be intracellular (32), cells were superfused with 1 M paxilline for 10 min before the whole cell configuration was obtained. This protocol, while not providing control current information, was chosen to ensure adequate time for paxilline to reach its putative intracellular site of inhibition. After 10 min of paxilline exposure, the whole cell configuration was obtained and the voltage-step protocol was administered. As clearly shown in Fig. 3B, voltage steps to depolarized potentials still resulted in a marked activated component of the current, consistent with a lack of inhibition by paxilline of the voltage-dependent component of the whole cell current (n ⫽ 8). We undertook additional experiments where paxilline was added directly to the patch pipette. Again, the activating component of the current was robust, consistent with no significant inhibition of the voltage-dependent component of the response by paxilline (data not shown). Finally, preliminary experiments employing acute exposure to paxilline revealed no modulation of the control whole cell current response (data not shown). The lack of sensitivity of the voltage-dependent, AJP-Cell Physiol • doi:10.1152/ajpcell.00368.2012 • www.ajpcell.org C863 VOLTAGE DEPENDENCE OF KCa3.1 400 Control 300 Current (pA) Current (pA) 400 200 100 500 ms 0 200 100 500 ms 0 -100 -100 -200 -200 +97 -103 C 1 µM Clotrimazole 300 +97 -103 D 150 I (pA) Activated I 300 I (pA) Step I 100 200 Control Clotrim. Control Clotrim. 50 * -100 -50 -50 50 100 Vm (mV) * -100 -50 -100 50 100 Vm (mV) Fig. 4. Effect of clotrimazole on step and activated components of the whole cell Ca2⫹-activated K⫹ current. A: control response of a cell whole cellpatched with a KCl-based internal solution containing 2 M free Ca2⫹ and superfused with standard extracellular NaCl-based solution containing 5 mM K⫹ (top). Voltage steps were administered from a holding potential of ⫺103 mV (bottom). B: cell described in A subjected to the same voltage-step protocol in the presence of 1 M clotrimazole. C: mean activated current component (n ⫽ 6) of the whole cell response to voltage steps in the absence (control) and presence of clotrimazole (Clotrim). Control and clotrimazole data were obtained from each cell. *Significantly different from control (P ⱕ 0.05). D: mean step current component (n ⫽ 6) of the whole cell response to voltage steps in the absence (control) and presence of clotrimazole. Control and clotrimazole data were obtained from each cell. *Significantly different from control (P ⱕ 0.05). Values are means ⫾ SE; lack of error bars indicates that SE is within the size of the symbol. activated current to iberiotoxin and paxilline argues against a role for the well-established voltage dependence of KCa1.1 in the response. To define the role of the KCa2 family in the voltage-dependent current, we investigated the effect of the KCa2-selective inhibitor apamin on the response. Again, cells were whole cell patched with an identical KCl-based pipette solution buffered to 2 M free Ca2⫹, and the same voltage-step protocol (see above) was administered from a holding potential of ⫺103 mV. As shown in Fig. 3C, apamin had no effect on the activated current component of the response (P ⱖ 0.05, n ⫽ 7). To investigate possible involvement of the intermediateconductance Ca2⫹-activated K⫹ channel KCa3.1, we used clotrimazole, a selective inhibitor of this channel. Again, cells were whole cell patched with a KCl-based pipette solution buffered to 2 M free Ca2⫹. Figure 4, A and B, shows the current response to step changes in membrane potential from a ⫺103-mV holding potential in the same cell in the absence and presence of 1 M clotrimazole. It is clear from this experiment that clotrimazole markedly inhibits the activated and step components of the current response to depolarizing voltage steps. Figure 4C summarizes the results from six cells and demonstrates a significant inhibition of the activated current component of the response (P ⱕ 0.05, n ⫽ 6). Clotrimazole also abolished the tail currents observed on return to ⫺103 mV following a depolarizing step (Fig. 4B). Figure 4D summarizes the significant inhibition of the step component of the current in the same cells (P ⱕ 0.05, n ⫽ 6) and demonstrates a shift in the reversal potential to depolarized potentials during inhibition of the current by clotrimazole. This shift in the reversal potential is consistent with inhibition of a K⫹ current by clotrimazole. To substantiate the involvement of KCa3.1 in the voltage dependence, we investigated the sensitivity of the step and activated components of the whole cell response to the potent selective KCa3.1 inhibitor TRAM-34. Cells were again whole cell patched with a KCl-based pipette solution buffered to 2 M free Ca2⫹. Figure 5, A and B, shows the current response to step changes in membrane potential from a ⫺103-mV holding potential in the same cell in the absence and presence of 1 M TRAM-34. Consistent with inhibition by clotrimazole, TRAM-34 also potently inhibits the activated and step components of the current response to depolarizing voltage steps. Figure 5C summarizes the results from six cells and demonstrates a significant inhibition of the activated current component of the response to TRAM-34 (P ⱕ 0.05, n ⫽ 6). TRAM-34 also abolished the small tail currents observed on return to ⫺103 mV following depolarizing voltage steps (Fig. 5B). Figure 5D summarizes the significant inhibition of the step component of the current in the same cells (P ⱕ 0.05, n ⫽ 6) and demonstrates a shift in the reversal potential to depolarized potentials during inhibition of the current by TRAM- A B 600 600 Control Current (pA) B Current (pA) A 400 200 500 ms 0 -200 1 µM TRAM-34 400 200 500 ms 0 -200 +97 -103 +97 -103 C D 400 I (pA) Activated I 300 I (pA) Step I 300 200 200 Control TRAM-34 100 Control TRAM-34 * -100 -50 50 -100 100 -100 -50 -50 50 * 100 Fig. 5. Effect of TRAM-34 on step and activated components of the whole cell Ca2⫹-activated K⫹ current. A: control response of a cell whole cell patched with a KCl-based internal solution containing 2 M free Ca2⫹ and superfused with standard extracellular NaCl-based solution containing 5 mM K⫹. Voltage steps were administered from a holding potential of ⫺103 mV. B: cell described in A subjected to the same voltage-step protocol in the presence of 1 M TRAM-34. C: mean activated current component (n ⫽ 6) of the whole cell response to voltage steps in the absence (control) and presence of TRAM-34. Control and TRAM-34 data were obtained from each cell. *Significantly different from control (P ⱕ 0.05). D: mean step current component (n ⫽ 6) of the whole cell response to voltage steps in the absence (control) and presence of TRAM-34. Control and TRAM-34 data were obtained from each cell. *Significantly different from control (P ⱕ 0.05). Values are means ⫾ SE; lack of error bars indicates that SE is within the size of the symbol. AJP-Cell Physiol • doi:10.1152/ajpcell.00368.2012 • www.ajpcell.org C864 VOLTAGE DEPENDENCE OF KCa3.1 34. The apparently greater inhibition of the step component induced by TRAM-34 than clotrimazole may indicate a more effective block by TRAM-34. While not fully investigated, in preliminary experiments, TRAM-34 inhibition was only marginally reversible, in contrast to the marked reversibility of clotrimazole. As an additional final test to rule out involvement of the KCa2 family in the voltage dependence and to further substantiate the role of KCa3.1 in the response, we investigated the effect of charybdotoxin, an established inhibitor of KCa3.1 and KCa1.1, but not the KCa2 family of channels. Figure 6, A and B, shows the whole cell response to voltage steps in a cell patched with a KCl-based internal solution buffered to 2 M free Ca2⫹ in the absence and presence of 200 nM charybdotoxin. The mean effect of charybdotoxin on the step component of the current response in five cells is summarized in Fig. 5D. Charybdotoxin significantly inhibited the step response to voltage steps (P ⱕ 0.05, n ⫽ 5) and shifted the reversal potential to more depolarized potentials. The fact that the percent inhibition induced by charybdotoxin is less than that induced by TRAM-34 may, like the clotrimazole results, indi- A B 400 400 CTX Current (pA) Current (pA) Control 200 0 200 0 500 ms 500 ms -200 -200 +97 +97 -103 -103 C D 300 I (pA) 200 I (pA) Activated I Step I 150 Control CTX 200 100 Control CTX 50 * -100 -50 -50 50 100 Vm (mV) * -100 50 100 Vm (mV) -100 Fig. 6. Effect of charybdotoxin on step and activated components of the whole cell Ca2⫹-activated K⫹ current. A: control response of a cell whole cellpatched with a KCl-based internal solution containing 2 M free Ca2⫹ and superfused with standard extracellular NaCl-based solution containing 5 mM K⫹. Voltage steps were administered from a holding potential of ⫺103 mV. B: cell described in A subjected to the same voltage-step protocol in the presence of 200 nM charybdotoxin (CTX). C: mean activated current component (n ⫽ 6) of the whole cell response to voltage steps in the absence (control) and presence of charybdotoxin. Control and charybdotoxin data were obtained from each cell. *Significantly different (P ⱕ 0.05) from control current response to voltage steps between ⫺103 and ⫹57 mV. D: mean step current component (n ⫽ 6) of the whole cell response to voltage steps in the absence (control) and presence of charybdotoxin. Control and charybdotoxin data were obtained from each cell. *Significant difference (P ⱕ 0.05) from control current response to voltage steps between ⫺103 and ⫹97 mV. Values are means ⫾ SE; lack of error bars indicates that SE is within the size of the symbol. cate incomplete block by the concentration of toxin used. Our analysis of the effect of charybdotoxin on the activated current component of the response was hampered by the well-established voltage dependence of charybdotoxin block (2, 6, 9, 29). Depolarization results in an increase in the off-rate of toxin binding, resulting in release of block during prolonged depolarizations, such as those used in our experiments (2, 9, 29). Such apparent release of block is evident in Fig. 6B, where the current response to large depolarizations resulted in a timedependent activation of the current indistinguishable from the activated component of the response under investigation. The effect of large depolarizations is clear in Fig. 6D, where the mean activated component at ⫹97 mV starts to approach that in control conditions. With this in mind, we confined our two-way ANOVA to depolarizing voltage steps between ⫺103 and ⫹57 mV in the absence and presence of toxin. Within this voltage range, charybdotoxin significantly inhibited the voltage-dependent activated component of the whole cell current (P ⱕ 0.05, n ⫽ 5), further supporting the conclusion that the voltage dependence does not arise from KCa2 family activation. Given that the KCa1.1 inhibitors paxilline and iberiotoxin do not inhibit the voltage-dependent response, block by charybdotoxin is consistent with the voltage dependence being associated with activation of KCa3.1. A requirement for elevated cytosolic free Ca2⫹, block by clotrimazole, TRAM-34, and charybdotoxin, agents that do not inhibit the KCa2 family of channels, and insensitivity of the voltage-dependent activated current component to apamin, iberiotoxin, and paxilline are consistent with involvement of the intermediate-conductance Ca2⫹-activated K⫹ channel KCa3.1. The tail currents at hyperpolarized potentials following a depolarizing voltage step are, however, reminiscent of HERG, the human ether-à-go-go-related gene product (38). The potent inhibitor E-4031 was used to test for involvement of HERG. Figure 3D shows the activated current response to voltage steps in cells whole cell patched with a KCl-based pipette solution buffered to 2 M free Ca2⫹ in the absence and presence of E-4031. E-4031 had no effect on the activated component of the whole cell current (P ⱖ 0.05, n ⫽ 8). Therefore, HERG expression cannot account for the voltage dependence during elevations in intracellular Ca2⫹ in HEL cells. Finally, in experiments performed in low intracellular and extracellular Cl⫺ solutions, we observed a voltage dependence indistinguishable from that in high-Cl⫺ solutions (data not shown). These data rule out a role for Cl⫺ in the voltagedependent response. Thus the data indicate that KCa3.1 is involved in the voltage-activated whole cell current. While the inhibitor sensitivity profile and basic biophysical characteristics of the activated current of the whole cell response support the conclusion that KCa3.1, and not the voltagedependent KCa1.1, channel is responsible for the voltage dependence, it was necessary to confirm the presence of mRNA encoding KCa3.1. We undertook RT-PCR experiments to detect direct expression of KCa3.1 and KCa1.1 mRNA. Total RNA was reverse-transcribed, and the cDNA was amplified using primers with sequences specific for KCa3.1 (KCNN4 gene) or KCa1.1 (KCNMA1 gene). Figure 7 shows the amplified products. A prominent band of the correct size and sequence consistent with KCa3.1 gene expression was found in HEL cells (lane 1). In contrast, no KCa1.1 gene product was found (lane 11). As a positive control for KCa1.1 detection, we used the AJP-Cell Physiol • doi:10.1152/ajpcell.00368.2012 • www.ajpcell.org C865 2 3 KCNN4 4 5 6 7 8 KCNMA1 9 10 11 12 13 14 15 16 17 18 19 600 400 -cDNA HTR-8/SVneo HEL THP-1 THP-1-Diff THP-1-Diff HTR-8/SVneo HEL THP-1 THP-1-Diff -RT HTR-8/SVneo -cDNA HEL THP-1 THP-1-Diff HTR-8/SVneo 200 -RT Fig. 7. RT-PCR detection of mRNA arising from expression of the KCa3.1 gene KCNN4 and the KCa1.1 gene KCNMA1. Lanes 1–9 correspond to PCRs with primers specific for KCNN4: lanes 1– 4 show detection of PCR product in HEL, THP-1, THP-1 differentiated (Diff), and HTR-8/SVneo cells, lane 9 is a control PCR run without cDNA (⫺cDNA), and lanes 5– 8 are PCRs run in the absence of reverse transcriptase (⫺RT). Lanes 11–19 correspond to PCRs with primers specific for KCNMA1: lanes 11–14 show detection of PCR product in HEL, THP-1, THP-1 differentiated, and HTR-8/SVneo cells; lane 19 is a control PCR run without cDNA; and lanes 15–18 are PCRs run in the absence of reverse transcriptase. Molecular sizes (left) are taken from the standards run in lane 10 (200 –1,000 bp in 100-bp increments). monocytic cell line THP-1 and the human trophoblast cell line HTR-8/SVneo. THP-1 cells express a Ca2⫹-activated K⫹ current with characteristics of KCa3.1 (16). In contrast, PMAinduced differentiation of THP-1 cells to macrophage-like cells induced expression of a KCa1.1 current in addition to currents associated with activation of KCa3.1 (5). Lane 2 shows a band consistent with KCa3.1 expression in THP-1 cells. Lane 3 shows expression of KCa3.1 in differentiated THP-1 cells, while lane 4 shows expression of KCa3.1 in the human trophoblast cell line HTR-8/SVneo. In native THP-1 cells, we detected only a very slight expression of the KCa1.1 gene (lane 12). However, a strong band consistent with robust expression of this gene is seen following differentiation with phorbol ester for 3 days in culture (lane 13). Such findings are in close agreement with the functional expression of KCa1.1 currents in differentiated, but not native, THP-1 cells (5, 16). As a final control for the efficacy of our KCa1.1 primer pair, we found a marked level of KCa1.1 cDNA expression in HTR-8/SVneo cells (lane 14). PCRs in the absence of cDNA (lanes 9 and 19) and in the presence of cDNA and corresponding primer pairs, but in the absence of reverse transcriptase (lanes 5– 8 and lanes 15–18), yielded no products. The lack of KCa1.1 cDNA in HEL cells further supports the conclusion that the voltage-activated current cannot be ascribed to activity of this channel, consistent with the pharmacological sensitivity of the voltage-activated current and its requirement for elevated cytosolic Ca2⫹ levels. However, detection of KCa3.1-specific cDNA in HEL cells supports the conclusion that expression of this channel underlies the voltage-dependent response, consistent with our pharmacological profile. The whole cell current is given by the product of the singlechannel current (i), the number of channels that are available to open (N), and the open channel probability (Po). Therefore, the increase in current that gives rise to the activated component could be due to an increase in Po or N. To investigate the role of altered channel availability and altered Po in the voltagedependent component of the whole cell current, single-channel experiments were performed using the excised inside-out patch-clamp configuration. Experiments were first undertaken to characterize the single-channel correlate of KCa3.1 in HEL cells. The pipette internal solution was standard NaCl solution, identical to that used as the extracellular solution in whole cell recordings, while the bath (intracellular) solution was a KClbased solution with free Ca2⫹ concentrations set to defined levels with EGTA. This solution contained 5 mM free Mg2⫹ to inhibit TRPM7 activity, as used in the whole cell experiments. As a result of the symmetrical Cl⫺ conditions used in our experiments, ⫺3 mV was chosen as the basic holding potential for determination of channel activity to ensure that the recordings were not contaminated by Cl⫺ channel activity. Figure 8A shows a section of data recorded at a holding potential of ⫺3 mV. Given the ionic composition of the pipette, KCa3.1 activity is expected at this potential. Outward currents arising from multiple single-channel openings were observed. The Ca2⫹ sensitivity of the channel activity was confirmed by superfusion of the patch with 50 nM free Ca2⫹, leading to loss of channel activity. Reexposure to 2 M free Ca2⫹ resulted in reactivation of channel activity. Figure 8B shows the channel activity at higher temporal resolution at arrows 1 and 2 in Fig. 8A. In Fig. 8C, all-points-amplitude histograms constructed from 30-s stretches of A 50 nM Ca2+ 2 pA 4 3 2 1 c 20 s B 1 2 1 pA 2 1s 1 c 2 1 C Total Count x103 1 HEL BP 1000 800 THP-1 VOLTAGE DEPENDENCE OF KCa3.1 1 i=0 20 2 µM Ca2+ i=1 NPo = 0.68 15 50 40 i=0 2 50 nM Ca2+ NPo = 0 30 10 20 5 i=2 i=3 10 0 0 Current (pA) 2⫹ Current (pA) Fig. 8. Ca -activated single channels in excised inside-out patches. A: section of a recording at ⫺3-mV holding potential from an excised inside-out patch. Pipette internal solution was standard NaCl-based solution containing 5 mM K⫹; bath solution was KCl-based solution with 2 M free Ca2⫹ and 5 mM free Mg2⫹. Where indicated, patch was superfused with a KCl-based solution with 50 nM free Ca2⫹. Closed state (c) and current levels corresponding to the indicated number of open channels (1– 4) are shown at left. B: current recording at higher resolution in 2 M or 50 nM free Ca2⫹ (recordings 1 and 2, respectively). Data correspond to arrows 1 and 2 in A. C: all-pointsamplitude histograms in 2 M and 50 nM free Ca2⫹ were generated from 30-s sections of the data presented in A and fit to the sum of Gaussian distributions. NPo (where N is number of channels and Po is open channel probability) was calculated as described in Recording, Data Acquisition, and Analysis. AJP-Cell Physiol • doi:10.1152/ajpcell.00368.2012 • www.ajpcell.org C866 VOLTAGE DEPENDENCE OF KCa3.1 B 1.5 I (pA) 3 pA c Vm (mV) -83 1.0 2 c -43 0.5 0.5 s n=6 or 7 2 c -3 -100 3 2 1 c +37 4 3 2 1 c +77 -50 -0.5 50 100 Vm (mV) Fig. 9. Single-channel I-V relationship of the Ca2⫹-dependent channel. A: excised inside-out patch was superfused with a KCl-based solution containing 2 M free Ca2⫹. After confirmation of the Ca2⫹ dependence of single-channel activity by superfusion with 50 nM free Ca2⫹, patch was stepped to different potentials. Closed state (c) and current levels corresponding to the indicated number of open channels (1– 4) are shown at left. B: mean I-V relationship of the channel (n ⫽ 6 or 7 for each data point). Dotted line is a visual linear fit of data between ⫺23 and ⫺63 mV that extrapolates to a highly negative reversal potential. Data from potentials more negative than ⫺63 mV are not displayed because of inability to resolve the single-channel current near the reversal potential. the record in 2 M and 50 nM free Ca2⫹ are shown with the sum of multiple Gaussian peaks fit to the data. In 2 M free Ca2⫹, four peaks are resolvable, indicative of at least three channels in the patch. In 50 nM Ca2⫹, no open channel peaks are evident, consistent with the Ca2⫹ dependence of the channel. The NPo value for the stretch of data recorded in the presence of 2 M free Ca2⫹ as estimated from the multiple Gaussian fit (see Recording, Data Acquisition, and Analysis) was 0.68, with NPo ⫽ 0 in 50 nM Ca2⫹, since no channel openings were detected. To determine the I-V relationship of the channel, membrane patches were stepped to voltages between ⫺83 and ⫹97 mV. A representative experiment is shown in Fig. 9A. Singlechannel currents were measured from ⬎5-ms channel openings to ensure that the low-pass filter imposed on the recording did not influence the measurements. Figure 9B shows the mean I-V relationship estimated from data derived from seven patches. Extrapolation of the linear portion of the I-V relationship between ⫺63 and ⫺23 mV yields a highly negative reversal potential, consistent with a highly selective K⫹ channel. Consistent with this finding, replacement of bath K⫹ with nonpermeant NMDG⫹ abolished channel activity (data not shown). The mean slope conductance determined from the slope of a linear fit to the data between ⫺23 and ⫹17 mV was 8.7 ⫾ 0.6 pS (n ⫽ 7), a value similar to that reported for KCa3.1 under conditions of physiological K⫹ gradients (10, 14, 22). At highly depolarized potentials, the single-channel current was depressed, consistent with voltage-dependent channel block by an undefined ion or compound. Such a finding is consistent with the flattening of the I-V relationship in whole cell experiments, such as those presented in Fig. 1. Voltage-dependent block of KCa3.1 and KCa2 channels by intracellular Mg2⫹ and Ca2⫹ has been reported (19) and may be responsible for this depression. In all subsequent experiments, the magnitude of the single-channel current at ⫺3 mV (0.94 ⫾ 0.02 pA), the sensitivity of the channel to Ca2⫹, and a negative reversal potential were used to identify the channel. Single-channel activity in 2 M free Ca2⫹ was inhibited by application of 1 M clotrimazole, consistent with the whole cell results presented in Fig. 4. Figure 10A shows the inhibitory influence of clotrimazole on the Ca2⫹-dependent channel activity and demonstrates the reversibility of the inhibition. Figure 10B shows the single-channel activity at higher resolution before, during, and after clotrimazole application. Figure 10C shows the all-points-amplitude histogram produced from 40-s intervals of the record shown in Fig. 10A in the absence and presence of clotrimazole. In the absence of clotrimazole, NPo ⫽ 0.57. Application of 1 M clotrimazole suppressed NPo by a factor of ⬎10 to 0.049, with washout resulting in reversal of channel block. A significant reduction in NPo was observed in four of four experiments (P ⱕ 0.05). Analysis of the unitary current in the absence and presence of 1 M clotrimazole revealed no significant difference in unitary current at ⫺3 mV (P ⱖ 0.05, n ⫽ 5). The effect of TRAM-34 on single-channel activity was also investigated. Representative single-channel activity in 2 M free Ca2⫹ is shown in Fig. 11. Superfusion with solution con- A 2 pA 1 µM Clotrimazole 25 s 3 2 1 c 1 2 3 1 pA B 2 1 c 1 C Total Count x103 A 30 2 Control i=0 Clotrimazole 60 NPo = 0.57 20 i=1 3 Wash Off 40 i=0 NPo = 0.049 0 i=2 i=3 i=0 NPo = 0.42 40 20 10 1s i=1 20 i=2 i=1 0 Current (pA) 0 Current (pA) Current (pA) Fig. 10. Inhibition of Ca2⫹-dependent K⫹ channel activity by clotrimazole. A: section of a recording at ⫺3-mV holding potential from an excised inside-out patch. Pipette internal solution was standard NaCl-based solution containing 5 mM K⫹; bath solution was KCl-based solution containing 2 M free Ca2⫹ and 5 mM free Mg2⫹. Where indicated, patch was superfused with 1 M clotrimazole. Closed state (c) and current levels corresponding to the indicated number of open channels (1–3) are shown at left. B: current recording at higher resolution before (1), during (2), and after (3) clotrimazole application. Data correspond to arrows 1, 2, and 3 in A. C: all-points-amplitude histograms before (control), during (clotrimazole), and after (wash off) clotrimazole were generated from 40-s sections of data in A and fit to the sum of Gaussian distributions. NPo was calculated as described in Recording, Data Acquisition, and Analysis. AJP-Cell Physiol • doi:10.1152/ajpcell.00368.2012 • www.ajpcell.org C867 VOLTAGE DEPENDENCE OF KCa3.1 A 2 1 pA 1 50 s c 2 1 B 2 1 pA 1 2s c 1 2 Total Count x103 C 200 i=0 Control NPo = 0.26 150 0 i=0 TRAM-34 NPo = 0 150 100 50 250 200 100 i=1 i=2 50 0 Current (pA) Current (pA) Fig. 11. Inhibition of Ca2⫹-dependent K⫹ channel activity by TRAM-34. A: section of a recording at ⫺3-mV holding potential from an excised inside-out patch. Pipette internal solution was standard NaCl-based solution containing 5 mM K⫹; bath solution was KCl-based solution containing 2 M free Ca2⫹ and 5 mM free Mg2⫹. Where indicated, patch was superfused with 1 M TRAM-34. Closed state (c) and current levels corresponding to the indicated number of open channels (1 and 2) are shown at left. B: current recording at higher resolution before (1) and during (2) TRAM-34 application. Data correspond to arrows 1 and 2 in A. C: all-points-amplitude histograms before (control) and during (TRAM-34) TRAM-34 application were generated from 120-s sections of data in A and fit to the sum of Gaussian distributions. NPo was calculated as described in Recording, Data Acquisition, and Analysis. taining 1 M TRAM-34 resulted in complete inhibition of channel activity. The larger positive deflections during TRAM-34 application are resets of the head stage while recording in capacitive mode. Figure 11B shows the channel activity at higher resolution in the absence and presence of TRAM-34. Figure 11C shows the all-points-amplitude histogram produced from 120-s intervals of the record in Fig. 11A in the absence and presence of TRAM-34. In the absence of inhibitor, NPo ⫽ 0.26. Application of TRAM-34 suppressed all channel activity, resulting in NPo ⫽ 0. NPo was reduced to 0 in six of six patches (P ⱕ 0.05). Consistent with our finding in whole cell experiments, TRAM-34 inhibition was not reversible. As a result of the complete inhibition of channel activity, it was not possible to determine the effect of TRAM-34 on unitary current. To further differentiate between KCa1.1 and KCa3.1, NS309, a potent activator of KCa3.1 and the KCa2 channel family, but not the KCa1.1 channel (13, 34), was applied. Application of 1 M NS309 resulted in a significant increase in single-channel activity of the Ca2⫹-dependent channel (Fig. 12A). Figure 12B shows the channel activity before and during NS309 application on an expanded time scale at arrows 1 and 2 in Fig. 12A. The effect of NS309 was slowly reversible (Fig. 12A). The all-points-amplitude histogram before NS309 addition had a calculated NPo value of 1.52 and displayed five clear peaks indicative of at least four active channels. Addition of the activator resulted in a marked increase in NPo to 5.3 associated with additional peaks and the lack of a closed-state peak. It was not possible to quantify the mean increase in channel activity associated with NS309 addition, since, in two of the three patches exposed to NS309, individual peaks in the all-pointsamplitude histogram were not resolvable because of a large increase in channel activity resembling a macro current. This inability to consistently resolve single-channel events precluded the ability to reliably determine the effect of NS309 on unitary current. Modulation of channel activity by NS309 casts further doubt on the KCa1.1 channel as the source of the single-channel activity. In addition, in three of three patches, channel activity was unaffected by addition of the KCa1.1 channel inhibitor paxilline (data not shown). The Ca2⫹ sensitivity of the single-channel activity, negative reversal potential, and direct demonstration that K⫹ is the dominant charge-carrying ion by ion substitution indicate that the single-channel activity isolated in the present experiments is due to a Ca2⫹-activated K⫹ channel. The estimated singlechannel conductance, lack of sensitivity to paxilline, and modulation by NS309 clearly rule out the KCa1.1 channel in the single-channel response. Furthermore, application of depolarizing voltage steps in 50 nM Ca2⫹ was never observed to result in channel activity, consistent with lack of expression of KCa1.1 channels (data not shown). The sensitivity to clotrim- 4 pA 1 µM NS309 A 50 s 7 5 3 1 c 1 B 4 3 2 1 c 2 7 5 1 3 2 1 c 2 pA 1s C Total Count x103 1 µM TRAM-34 12 i=1 6 Control NPo = 1.52 i=2 i=4 4 8 i=3 i=0 4 i=2 2 i=3 i=1 i=4 i=5 NS309 NPo = 5.30 i=6 i=7 0 0 0 2 4 6 Current (pA) 8 0 2 4 6 Current (pA) 8 Fig. 12. Activation of Ca2⫹-dependent K⫹ single-channel activity by NS309. A: section of a recording at ⫺3-mV holding potential from an excised inside-out patch. Pipette internal solution was standard NaCl-based solution containing 5 mM K⫹; bath solution was KCl-based solution containing 2 M free Ca2⫹ and 5 mM free Mg2⫹. Where indicated, patch was superfused with 1 M NS309. Closed state (c) and current levels corresponding to the indicated number of open channels (1–7) are shown at left. B: current recording at higher resolution before (1) and during (2) NS309 application. Data correspond to arrows 1 and 2 in A. C: all-points-amplitude histograms before (left) and during (right) NS309 application were generated from 25-s sections of data in A and fit to the sum of Gaussian distributions. NPo was calculated as described in Recording, Data Acquisition, and Analysis. AJP-Cell Physiol • doi:10.1152/ajpcell.00368.2012 • www.ajpcell.org VOLTAGE DEPENDENCE OF KCa3.1 A # 2.0 # 1.8 5 mM Mg2+ 1.6 * 1 mM Mg2+ & * 1.4 * 1.2 * * 1.0 * 10 20 30 Po at -3 mV 40 50 60 Vm (mV) B Relative Po at +57 mV # 1.8 * 1.6 1.4 * 1.2 2 µM 0 M Ca 2 g2 + + 0 5 µM M Ca 2 g2 + + 1.0 0. azole and TRAM-34 is consistent with a lack of involvement of the small-conductance KCa2 channel family in the singlechannel events. Furthermore, the lack of effect of apamin on the whole cell currents indicates that KCa2 channel family activity is not significant in HEL cells. The single-channel conductance, inhibition by clotrimazole and TRAM-34, lack of sensitivity to paxilline, and activation by NS309 are consistent with the channel isolated in the present experiments being KCa3.1. Experiments were undertaken to define the influence of depolarization on channel availability (N) and Po of the KCa3.1 channel. NPo was calculated from all-points-amplitude histograms at ⫺3 mV and at the test potential. We used a repetitive step protocol in which the patch was stepped between these two potentials at 5-s intervals (see Recording, Data Acquisition, and Analysis). To determine the role of voltage in modulation of N, NPo was calculated for voltage steps from ⫺3 mV to ⫹17, ⫹37, and ⫹57 mV in 10 patches superfused with 2 M free Ca2⫹ and 1 mM free Mg2⫹. Six of 10 patches had low enough channel number (N) for N to be accurately estimated at ⫺3 mV and the three test potentials. This estimate of N was simply given by the maximum number of superimposed channel openings observed in the recording (12). In all six patches, N did not change during voltage steps to all potentials. N in the remaining four patches could not be reliably estimated because of the high channel number (12). Given that we observed no change in N in the large subset of patches where channel number was reliably measurable, we conclude that depolarization within our test range does not result in recruitment of further channels to an active state from which they can open. To analyze the effects of voltage on Po while excluding variability between patches due to varying values of N and varying baseline levels of channel activity, we used the ratio of NPo at the test potential to NPo at ⫺3 mV. Given that N does not change with changes in membrane voltage, this is equivalent to a relative change in Po induced by the voltage step. Channel activity in excised inside-out patches exposed to 2 M free Ca2⫹ and 1 mM Mg2⫹ was first confirmed as being due to KCa3.1 before investigation of the effect of membrane potential on Po. Figure 13A shows the relative change in Po at ⫹17, ⫹37, and ⫹57 mV determined in 10 patches in which NPo was calculated for all potentials. Relative Po increased in a graded fashion between ⫺3 and ⫹57 mV. The relative change in Po was significantly ⬎1 at all potentials (P ⱕ 0.05, n ⫽ 5), meaning that all voltage steps cause Po to increase significantly, with the step to ⫹57 mV increasing Po on average by 28%. Since our whole cell experiments were performed with 5 mM free Mg2⫹ in the pipette internal solution, we repeated the experiments with this level of free Mg2⫹. Figure 13A also shows the relative change in Po at ⫹17, ⫹37, and ⫹57 mV determined in five patches in which NPo was calculated for all potentials. Once again, the relative Po increased in a graded fashion between ⫺3 and ⫹57 mV, with the relative change in Po being significantly ⬎1 at all potentials (P ⱕ 0.05, n ⫽ 5). A two-way ANOVA performed on the 1 and 5 mM Mg2⫹ data sets indicates a significant main effect of the value of the voltage step (P ⱕ 0.05). Post hoc analysis indicates a significant difference between ⫹17 and ⫹57 mV and between ⫹37 and ⫹57 mV voltage steps (P ⱕ 0.05). Therefore, the relative increase in Po is an increasing function of the magnitude of the voltage step. Relative Po C868 Fig. 13. Effect of membrane potential, free Mg2⫹, and free Ca2⫹ on relative Po. A: excised inside-out patches were superfused with a bath solution containing 2 M free Ca2⫹ and 1 or 5 mM free Mg2⫹. Alternating voltage-step protocol was administered from ⫺3 mV to ⫹17, ⫹37, and ⫹57 mV in the presence of 1 and 5 mM free Mg2⫹. Five patches were exposed to all 3 test potentials in 5 mM free Mg2⫹ solution; 10 patches were exposed to all 3 potentials in 1 mM free Mg2⫹. Accumulative all-points-amplitude histograms were generated for each patch, and multiple Gaussian distributions were fit for calculation of NPo at each test voltage in 1 and 5 mM free Mg2⫹. Data were normalized to NPo value at ⫺3 mV for each voltage pair, yielding relative increases in Po that are plotted in A. *Significantly different from 1, i.e., significant relative change in Po (P ⱕ 0.05). #Significant difference in Po between ⫹17 and ⫹57 mV and between ⫹37 and ⫹57 mV (P ⱕ 0.05). &Significant difference in change in Po as a function of voltage between 1 and 5 mM Mg2⫹. B: excised inside-out patches were exposed to 0.5 and 2 M free Ca2⫹ (n ⫽ 5) in the absence of Mg2⫹, and voltage-step protocol was administered using a voltage step to ⫹57 mV from ⫺3 mV. NPo at ⫺3 and ⫹57 mV was calculated from accumulative all-points-amplitude histograms. NPo at ⫹57 mV was normalized to NPo at ⫺3 mV, yielding a relative change in Po. *Significantly different from 1, i.e., significant relative change in Po (P ⱕ 0.05). #Significant difference in relative Po between 0.5 and 2 M free Ca2⫹ (P ⱕ 0.05). Values are means ⫾ SE. ANOVA also indicates a significant main effect of Mg2⫹, indicating that the relative increase in voltage modulation of Po was significantly less in 1 mM Mg2⫹ than 5 mM Mg2⫹ (P ⱕ 0.05). Such a finding may be indicative of a role for Mg2⫹ in the voltage dependence of Po. To investigate this hypothesis, we measured NPo at ⫺3 and ⫹57 mV in patches exposed to 2 AJP-Cell Physiol • doi:10.1152/ajpcell.00368.2012 • www.ajpcell.org C869 VOLTAGE DEPENDENCE OF KCa3.1 A B 2.5 Control 2.0 5.0 10 µM NS309 4.0 Current (nA) Current (nA) M free Ca2⫹ in the absence of Mg2⫹. In the absence of Mg2⫹, depolarization to ⫹57 mV significantly increased the relative Po to 1.23 ⫾ 0.02 (P ⱕ 0.05, n ⫽ 5). This increase, while modestly less than that observed in the presence of 1 mM Mg2⫹ (1.28 ⫾ 0.06, n ⫽ 10, plotted in Fig. 10A), was not significantly different from that value (P ⱖ 0.05). Importantly, significant voltage modulation of Po was observed even when Mg2⫹ was removed. Thus, Mg2⫹ is not an absolute requirement for voltage-dependent modulation of Po in HEL cells. One could reasonably expect the relative increase in Po induced by depolarization to be a function of the basal channel activity. For example, if the rate of channel opening is increased by depolarization, then the relative increase in Po caused by a voltage step will be greater if baseline channel activity is lower. Correspondingly, maximal channel activity would not be expected to be augmented by depolarization. Given this hypothesis, an alternative explanation for the effect of 1 vs. 5 mM Mg2⫹ on voltage modulation of Po arises from the finding that Mg2⫹ has been shown to modulate Po of KCa3.1 in erythrocytes (11). In erythrocytes, increasing Mg2⫹ resulted in a decrease in Po for any given submaximal Ca2⫹ concentration. We have found a similar influence of Mg2⫹ on KCa3.1 activity in HEL cells (data not shown). This means that the effect of Mg2⫹ on the voltage modulation of Po in Fig. 13A could be an indirect result of its effect on basal channel activity. To investigate this hypothesis, using the same patch, we compared the change in NPo at ⫹57 mV in patches exposed to 2 M free Ca2⫹-0 Mg2⫹ with the change measured in the presence of 0.5 M free Ca2⫹-0 Mg2⫹. Lowering free Ca2⫹ significantly reduced the calculated NPo value at ⫺3 mV from 0.73 ⫾ 0.2 to 0.12 ⫾ 0.02 (P ⱕ 0.05, n ⫽ 5). Under these conditions, voltage steps to ⫹57 mV increased the relative Po to 1.53 ⫾ 0.09, a significant increase over that observed with 2 M free Ca2⫹ (1.23 ⫾ 0.02, P ⱕ 0.05). These data are summarized in Fig. 13B. While both relative changes in Po are different from 1 (i.e., there was a significant relative increase in Po due to the voltage step at both free Ca2⫹ levels), these results are consistent with the hypothesis that the influence of depolarization on relative Po is a function of basal channel activity. In the whole cell configuration, we would predict that the activated component of the current response to depolarizing voltage steps would become less as the magnitude of the whole cell current is increased (i.e., Po is increased). To test this prediction, we exploited the ability of NS309 to increase channel activity by increasing the Ca2⫹ sensitivity of the channel (13). Cells were whole cell patched with a KCl-based internal solution with 10 M free Ca2⫹ and 5 mM free Mg2⫹ buffered with 5 mM BAPTA. As can be seen in Fig. 14A, depolarization-induced activation of the current was still observed at this free Ca2⫹ level in the presence of 5 mM Mg2⫹. In contrast, after superfusion with NS309, which induced a marked increase in whole cell current, voltage modulation of the current was markedly reduced (Fig. 14B). The mean effect of NS309 in eight cells is summarized in Fig. 14, C and D. In the presence of NS309, the step current was significantly increased over control, consistent with an increase in the proposed Ca2⫹ sensitivity of the channel (P ⱕ 0.05; Fig. 14D). In contrast, the magnitude of the activated component of the current was significantly smaller (P ⱕ 0.05), i.e., only 38% of the control response at ⫹97 mV (Fig. 14C). The data in Fig. 14C document a significant reduction in the absolute magni- 1.5 1.0 0.5 500 ms 0 -0.5 3.0 2.0 1.0 500 ms 0 -1.0 +97 -103 +97 -103 C D 800 I (pA) 4000 I (pA) Step I Activated I 3000 600 Control NS309 400 Control NS309 * 200 * 1000 -100 -100 -50 -200 E 40 50 100 Vm (mV) -50 -1000 50 100 Vm (mV) Activated I (% of Steady-State) Control NS309 20 * -60 -20 20 60 100 Vm (mV) Fig. 14. Effect of NS309 on step and activated component of the whole cell Ca2⫹-activated K⫹ current. A: control response of a cell whole cell patched with a KCl-based internal solution containing 10 M free Ca2⫹ and 5 mM Mg2⫹. Cell was superfused with standard NaCl-based solution containing 5 mM K⫹. Voltage steps were administered from a holding potential of ⫺103 mV. B: cell shown in A was subjected to the same voltage-step protocol in the presence of 10 M NS309. C: mean activated current component (n ⫽ 8) of the whole cell response to voltage steps in the absence (control) and presence of NS309. Control and NS309 data were obtained from each cell. *Significantly different from control (P ⱕ 0.05). D: mean step current component (n ⫽ 8) of the whole cell response to voltage steps in the absence (control) and presence of NS309. Control and NS309 data were obtained from each cell. E: mean activated current in the absence (control) and presence of NS309 presented as a percentage of the steady-state current measured at the end of the 500-ms voltage step. Activated current as a percentage of steady-state current was calculated from data set in C and D (n ⫽ 8). *Significantly different from control (P ⱕ 0.05). Values are means ⫾ SE; lack of error bars indicates that SE is within the size of the symbol. tude of the activated current component of the response to depolarizing voltage steps. The data in Fig. 14, A and B, also suggest that the contribution of the activated current component to the peak steady-state current (i.e., the current recorded at the end of the 500-ms voltage step) becomes less as the magnitude of the whole cell current increases. In Fig. 14E, the activated current in these eight cells is presented as a percentage of the steady-state current for voltage steps between ⫺43 and ⫹97 mV. These data indicate that the activated current as AJP-Cell Physiol • doi:10.1152/ajpcell.00368.2012 • www.ajpcell.org C870 VOLTAGE DEPENDENCE OF KCa3.1 a percentage of the maximal steady-state current value is significantly reduced (P ⱕ 0.05) as channel activity increases as a result of application of NS309. While the absolute current was reduced by 62% at ⫹97 mV during NS309-induced channel activation, the activated current component as a percentage of maximal steady-state current was reduced by 75%. Therefore, the activating current makes less contribution to the steady-state current as the whole cell current increases toward its maximum. These data further support the conclusion that the effect of Mg2⫹ on the voltage modulation of relative Po in Fig. 13A can be accounted for by the ability of Mg2⫹ to alter the Po of the channel and, thus, the level of basal channel activity. DISCUSSION In the present experiments, in HEL cells, we isolated a highly K⫹-selective, Ca2⫹-dependent whole cell current and single-channel correlate that displays voltage dependence. Voltage dependence manifested itself as a secondary activated current component of the whole cell response to depolarizing voltage steps. This activated current was superimposed on an instantaneous step current. The whole cell current was augmented by addition of NS309, a selective activator of KCa3.1 and the KCa2 family of channels, but not the large-conductance KCa1.1 channel (13, 34). The step and activated components of the whole cell current were blocked by the KCa3.1 inhibitors clotrimazole, TRAM-34, and charybdotoxin. Additionally, the activated current was insensitive to the selective KCa2 family inhibitor apamin and the KCa1.1 inhibitors paxilline and iberiotoxin, as is the step current (data not shown). The singlechannel correlate was also inhibited by clotrimazole and TRAM-34 and insensitive to paxilline, while channel activity was augmented by NS309. The single-channel conductance was 8.7 pS in physiological K⫹ gradients, a value very similar to that reported by other groups for KCa3.1 in human T lymphocytes and cloned KCa3.1 channels (10, 14, 22). Additionally, we found no evidence for expression of the voltagedependent KCa1.1 channel in any of our single-channel experiments. Finally, we detected mRNA for KCa3.1, but not the KCa1.1 channel, consistent with expression of KCa3.1, but not KCa1.1, in HEL cells. These findings are consistent with the whole cell current and isolated single-channel activity arising from the expression of KCa3.1. Of the three classes of Ca2⫹-activated K⫹ channels, the KCa2 family of channels and KCa3.1 have been reported to lack voltage dependence; only the large-conductance KCa1.1 channel activity was modulated by membrane depolarization (reviewed in Refs. 36 and 43). In contrast to this well-held view, we have presented evidence supporting modulation of KCa3.1 channel activity by membrane depolarization. The voltagedependent component of the whole cell current activated in a time-dependent fashion at potentials more positive than ⫺43 mV, as judged by our step protocol. Detection of tail currents on return to hyperpolarized potentials following a depolarizing voltage step further supports voltage dependence of the current. The activated component of the whole cell current detected during depolarizing voltage steps could also be interpreted as a time-dependent activation component of the current response. However, time-dependent activation is difficult to reconcile for a Ca2⫹-activated conductance in the sustained presence of elevated intracellular Ca2⫹. Under these conditions, a step change in potential would be expected to result in a step change in whole cell current. Interestingly, the voltage-dependent activated current component showed no evidence of inactivation, a characteristic distinct from the classical voltage-activated K⫹ conductances in cells such as megakaryocytes (15). Modulation of KCa3.1 activity by membrane depolarization was also significantly different from voltage modulation of the KCa1.1 channel. In contrast to voltage modulation of the large-conductance channel, depolarization was unable to activate KCa3.1 channel activity in the absence of elevated levels of cytosolic Ca2⫹. Thus, depolarization alone is not sufficient to activate KCa3.1 channel activity, at least in the voltage range investigated in the present experiments. In addition, the voltage activation relationship of the channel is not altered by free Ca2⫹ levels, as judged by a similar voltage dependence of the whole cell current in 2 and 10 M free Ca2⫹ (Figs. 2 and 14). Additional experiments undertaken with 1 M free Ca2⫹ revealed an identical voltage relationship (data not shown), thus extending the free Ca2⫹ range from 1 to 10 M, with no indication of modulation of the voltage dependence of the activated current component. This is in direct contrast to the modulation of the voltage dependence of KCa1.1 by changes in free Ca2⫹ within this concentration range (44). The voltage dependence of the whole cell current may, in theory, arise from an increase in the number of available channels (N) or an increase in Po. In our single-channel experiments, no increase in N was observed during steps in membrane potential from ⫺3 to ⫹57 mV. Rather, depolarization within this voltage range was accompanied by a graded increase in Po, which could account for the activated component of the whole cell current during depolarizing voltage steps. As would be expected of a voltage-dependent mechanism, this increase in Po was a function of the magnitude of the depolarization, with voltage steps of different magnitudes resulting in significantly different increases in relative Po (Fig. 13A). While we found no increase in N during depolarization, we cannot rule out an effect of depolarization on channel availability during voltage steps to more depolarized potentials. Our analysis of the effect of membrane voltage on Po was dependent on the generation of all-points-amplitude histograms with clearly resolvable peaks. Histograms derived from voltage steps to potentials more depolarized than ⫹57 mV were frequently contaminated by baseline fluctuations associated with an increase in background current and/or the generation of poorly resolvable single-channel events. As a result, we were forced to confine our single-channel studies to a limited voltage range. The relative increase in Po calculated from our singlechannel experiments documents a rather small influence of voltage on this parameter compared with that observed in classical voltage-dependent channels. In addition to limiting our depolarizing voltage steps to a narrow range of voltages, we used a holding potential of ⫺3 mV, a value within the voltage-dependent range of channel modulation as determined in our whole cell studies. Holding at a potential outside the voltage activating range (i.e., more negative than ⫺43 mV) would be expected to increase our measured relative increases in Po. Our selection of ⫺3 mV was predicated on the need to have clearly resolvable channel events out of the level of background noise of our recording system. Irrespective of our AJP-Cell Physiol • doi:10.1152/ajpcell.00368.2012 • www.ajpcell.org VOLTAGE DEPENDENCE OF KCa3.1 inability to report maximal changes in Po, it is important to highlight that we observed a clear, graded increase in Po associated with depolarization over the voltage range investigated in our single-channel experiments. This is a finding not previously ascribed to KCa3.1 channel function. It is interesting that the increase in Po that underlies the activated component of the whole cell current does not give rise to a greater steady-state current at large depolarizing potentials. In fact, the I-V relationship shows inward rectification, with the steady-state current actually saturating at depolarized potentials and, in some cases, actually falling at depolarized potentials (Figs. 1 and 9) (16, 23). This apparent paradox is explained by the finding that KCa3.1 is blocked in a voltage-dependent manner by intracellular Mg2⫹ and Ca2⫹ (19). Therefore, the magnitude of the steady-state current at depolarized potentials is the sum of the two opposing effects of depolarization. A key question that arises from our findings is as follows: Why has voltage dependence of KCa3.1 not been reported in other cell types? A simple explanation is that the effect of depolarization on Po is confined to HEL cells or possibly cells of leukemic origin. While this is an intriguing proposal, evidence in the literature would suggest that the effect is more widespread. As noted in the introduction, we are aware of three reports in the literature demonstrating an activated component of KCa3.1 during depolarizing voltage steps. In one case, the activated component of the current was deemed to be inconsistently present, and the authors concluded that no systematic voltage- or time-dependent activation of the current existed (16). In another report documenting cloning of KCa3.1 (14), there was comment on an activated component of the current during large depolarizations, but no further investigations were undertaken. Interestingly, small tail currents were obvious in the records, consistent with a voltage dependence of the channel and our results in HEL cells. Finally, Gao et al. (7) presented records of a KCa3.1-like current in human macrophages differentiated from peripheral monocytes that show a marked activated current component in response to depolarizing voltage steps. The authors did not discuss this component of the current. One possible mechanism for the voltage modulation arises from the finding that Mg2⫹ reduces the Po of KCa3.1 (11), a finding that we have confirmed in HEL cells (data not shown). If this mechanism were affected by the membrane potential, it could explain the voltage modulation of Po. Mg2⫹ has also been shown to mediate voltage-dependent block of KCa3.1 in murine endothelial cells (19); so, in general, the interactions of Mg2⫹ with the channel can be modulated by the membrane potential. To investigate an underlying role for Mg2⫹ in the voltage modulation of Po of KCa3.1 in HEL cells, we performed experiments in the absence of intracellular Mg2⫹. As shown in Fig. 13B, in the absence of Mg2⫹, relative Po at ⫹57 mV was significantly increased over that at ⫺3 mV. Additionally, large activated current components of the whole cell response to voltage steps, indistinguishable from those observed in the presence of 5 mM Mg2⫹, were observed in the absence of Mg2⫹ in the pipette (data not shown). Taken together, these data indicate that Mg2⫹ is not required for voltage modulation of KCa3.1 in HEL cells. An alternative explanation is that the rates of one or more of the kinetic transitions of the channel are directly modulated by voltage. This would be the case if they involved conformational changes that were sensitive to membrane potential. In C871 general, any of the kinetic transitions could involve the movement of charged moieties of the channel and, hence, could be voltage-modulated. As discussed above, voltage modulation of KCa3.1 is only observed in the presence of elevated intracellular Ca2⫹, distinguishing its voltage modulation from that observed in classical voltage-sensing ion channels. A proposed mechanism that encompasses this result involves modulation of Ca2⫹ binding or voltage-modulated changes in the Ca2⫹ affinity of the binding site. Data presented in Fig. 13A highlight the graded increase in Po with depolarization in the presence of a constant free Ca2⫹ level. If voltage modulates the affinity of the binding site or the effective free Ca2⫹ level in the vicinity of the binding site, an increase in Po is predicted. We are unable to distinguish the validity of any of the proposed mechanisms for voltage modulation of KCa3.1 in HEL cells. Further experimentation is required to address this important question. However, the present experiments highlight the previously unappreciated voltage dependence of the whole cell current while defining a critical role for modulation of Po in the response. The physiological relevance of the voltage dependence of KCa3.1 is dependent on the resting potential of the cell prior to elevations in intracellular Ca2⫹ concentration and activation of KCa3.1. Using the data presented in Fig. 2D, we can calculate the influence of resting potential on the anticipated KCa3.1 conductance. The slope of the linear component of the I-V relationship between ⫺103 and ⫹37 mV was calculated at holding potentials of ⫺103 and ⫺3 mV. Holding at ⫺3 mV resulted in a 39% increase in slope conductance over that measured from a holding potential of ⫺103 mV. This has important implications for cells with depolarized resting membrane potentials. For example, megakaryocytes from patients with myelogenous leukemia and leukemic cell lines used as models for megakaryocyte and platelet function, such as the HEL cell line, lack expression of conventional voltage-activated K⫹ channels (15). This results in a depolarized resting membrane potential (15), which is predicted to augment the hyperpolarizing ability of KCa3.1 during suboptimal elevations in intracellular Ca2⫹ concentration. This enhancement of KCa3.1-induced hyperpolarization is, in turn, expected to increase the influx of Ca2⫹ across the plasma membrane during store-operated Ca2⫹ entry, for example. Gao et al. (7) showed that KCa3.1-induced hyperpolarization increases the influx of Ca2⫹ across the plasma membrane. In fact, activation of KCa3.1 in HEL cells has been reported to augment Ca2⫹ influx (23). We previously highlighted the role of depolarization-induced stimulation of metabotropic receptors in influencing the temporal pattern of Ca2⫹ and membrane potential oscillations in rat megakaryocytes (25). We have noted the involvement of depolarization in stimulating ADP-induced Ca2⫹ release from intracellular stores and the subsequent hyperpolarization induced by activation of KCa3.1 (25). Given the present findings, a role for depolarization in modulation of KCa3.1 must also be considered in this model. AUTHOR CONTRIBUTIONS C.J.S. and M.J.M. are responsible for conception and design of the research; C.J.S., O.S., D.N.T., W.H.C., and M.J.M. performed the experiments; C.J.S., O.S., D.N.T., W.H.C., and M.J.M. analyzed the data; C.J.S., O.S., D.N.T., W.H.C., and M.J.M. interpreted the results of the experiments; C.J.S., O.S., D.N.T., and M.J.M. prepared the figures; C.J.S. and M.J.M. drafted the manuscript; C.J.S. and M.J.M. edited and revised the manuscript; C.J.S., O.S., D.N.T., W.H.C., and M.J.M. approved the final version of the manuscript. AJP-Cell Physiol • doi:10.1152/ajpcell.00368.2012 • www.ajpcell.org C872 VOLTAGE DEPENDENCE OF KCa3.1 DISCLOSURES No conflicts of interest, financial or otherwise, are declared by the authors. REFERENCES 1. Aldrich R, Chandy KG, Grissmer S, Gutman GA, Wei AD, Wulff H. Calcium-Activated Potassium Channels, Introductory Chapter (Online). International Union of Basic and Clinical Pharmacology database. http://www. iuphar-db. org/DATABASE/FamilyIntroductionForward?familyId⫽69 [1 Nov. 2013]. 2. Anderson CS, MacKinnon R, Smith C, Miller C. Charybdotoxin block of single Ca2⫹-activated K⫹ channels. J Gen Physiol 91: 317–333, 1988. 3. Aoki K, Kosakai K, Yoshino M. Monoaminergic modulation of the Na⫹-activated K⫹ channel in Kenyon cells isolated from the mushroom body of the cricket (Gryllus bimaculatus) brain. J Neurophysiol 100: 1211–1222, 2008. 4. Del Carlo B, Pellegrini M, Pellegrino M. Calmodulin antagonists do not inhibit IKCa channels of human erythrocytes. Biochim Biophys Acta 1558: 133–141, 2002. 5. DeCoursey TE, Kim SY, Silver MR, Quandt FN. Ion channel expression in PMA-differentiated human THP-1 macrophages. J Membr Biol 152: 141–157, 1996. 6. Frey BW, Carl A, Publicover NG. Charybdotoxin block of Ca2⫹activated K⫹ channels in colonic muscle depends on membrane potential dynamics. Am J Physiol Cell Physiol 274: C673–C680, 1998. 7. Gao Y, Hanley PJ, Rinné S, Zuzarte M, Daut J. Calcium-activated K⫹ channel (KCa3.1) activity during Ca2⫹ store depletion and store-operated Ca2⫹ entry in human macrophages. Cell Calcium 48: 19 –27, 2010. 8. Graham CH, Hawley TS, Hawley RG, MacDougall JR, Kerbel RS, Khoo N, Lala PK. Establishment and characterization of first trimester human trophoblast cells with extended lifespan. Exp Cell Res 206: 204 – 211, 1993. 9. Goldstein SAN, Miller C. Mechanisms of charybdotoxin block of a voltage-gated K⫹ channel. Biophys J 65: 1613–1619, 1993. 10. Grissmer S, Nguyen A, Cahalan M. Calcium-activated potassium channels in resting and activated human T lymphocytes. Expression levels, calcium dependence, ion selectivity, and pharmacology. J Gen Physiol 102: 601–630, 1993. 11. Grygorczyk R, Schwarz W. Ca2⫹-activated K⫹ permeability in human erythrocytes: modulation of single-channel events. Eur Biophys J 12: 57–65, 1985. 12. Horn R. Estimating the number of channels in patch recordings. Biophys J 60: 433–439, 1991. 13. Hougaard CH, Eriksen BL, Jørgensen S, Johansen TH, Dyhring T, Madsen LS, Strøbaek D, Christophersen P. Selective positive modulation of the SK3 and SK2 subtypes of small conductance Ca2⫹-activated K⫹ channels. Br J Pharmacol 151: 655–665, 2007. 14. Joiner WJ, Wang LY, Tang MD, Kaczmarek L. hSK4, a member of a novel subfamily of calcium-activated potassium channels. Proc Natl Acad Sci USA 94: 11013–11018, 1997. 15. Kapural L, Feinstein MB, O’Rourke F, Fein A. Suppression of the delayed rectifier type of voltage gated K⫹ outward current in megakaryocytes from patients with myelogenous leukemias. Blood 86: 1043–1055, 1995. 16. Kim SY, Silver MR, DeCoursey TE. Ion channels in human THP-1 monocytes. J Membr Biol 152: 117–130, 1996. 17. Köhler M, Hirschberg B, Bond CT, Kinzie JM, Marrion NV, Maylie J, Adelman JP. Small-conductance, calcium-activated potassium channels from mammalian brain. Science 273: 1709 –1714, 1996. 18. Latorre R, Oberhauser A, Labarca P, Alvarez O. Varieties of calciumactivated potassium channels. Annu Rev Physiol 51: 385–399, 1989. 19. Ledoux J, Boven AD, Nelson MT. Ca2⫹-activated K⫹ channels in murine endothelial cells: block by intracellular calcium and magnesium. J Gen Physiol 131: 125–135, 2008. 20. Lew V, Tiffert TT, Etzion Z, Perdomo D, Daw N, Macdonald L, Bookchin RM. Distribution of dehydration rates generated by maximal Gardos-channel activation in normal and sickle red blood cells. Blood 105: 361–367, 2005. 21. Li Y, Gamper N, Shapiro MS. Single-channel analysis of KCNQ K⫹ channels reveals the mechanism of augmentation by cysteine-modifying reagents. J Neurosci 24: 5079 –5090, 2004. 22. Logsdon NJ, Kang J, Togo JA, Christian EP, Aiyar J. A novel gene, hKCa4, encodes the calcium-activated potassium channel in human T lymphocytes. J Biol Chem 272: 32723–32726, 1997. 23. Lu X, Fein A, Feinstein MB, O’Rourke FA. Antisense knock out of the inositol 1,3,4,5-tetrakisphosphate receptor GAP1IP4BP in the human erythroleukemia cell line leads to the appearance of intermediate conductance KCa channels that hyperpolarize the membrane and enhance calcium influx. J Gen Physiol 113: 81–95, 1999. 24. Martin P, Papayannopoulou T. HEL cells: a new human erythroleukemia cell line with spontaneous and induced globin expression. Science 216: 1233–1235, 1982. 25. Mason MJ, Hussain JF, Mahaut-Smith MP. A novel role for membrane potential in the modulation of intracellular Ca2⫹ oscillations in rat megakaryocytes. J Physiol 524: 437–448, 2000. 26. Mason MJ, Schaffner C, Floto PA, Teo QA. Constitutive expression of a Mg2⫹ inhibited K⫹ current and a TRPM7-like current in human erythroleukemia cells. Am J Physiol Cell Physiol 302: C853–C867, 2012. 27. Meech RW, Strumwasser F. Intracellular calcium injection activates potassium conductance in Aplysia nerve cells (Abstract). Fed Proc 29: 834, 1970. 28. Neher E. Correction for liquid junction potentials in patch clamp experiments. Methods Enzymol 207: 123–131, 1992. 29. Park CS, Miller C. Mapping function to structure in a channel-blocking peptide: electrostatic mutants of charybdotoxin. Biochemistry 31: 7749 – 7755, 1992. 30. Patton C, Thompson S, Epel D. Some precautions in using chelators to buffer metals in biological solutions. Cell Calcium 35: 427–431, 2004. 31. Robitaille R, Charlton M. Presynaptic calcium signals and transmitter release are modulated by calcium-activated potassium channels. J Neurosci 12: 297–305, 1992. 32. Sanchez M, McManus OB. Paxilline inhibition of the ␣-subunit of the high conductance calcium-activated potassium channel. Neuropharmacology 35: 963–968, 1996. 33. Selyanko AA, Hadley JK, Brown DA. Properties of single M-type KCNQ2/KCNQ3 potassium channels expressed in mammalian cells. J Physiol 534: 15–24, 2001. 34. Strøbaek D, Teuber L, Jørgensen TD, Ahring PK, Kjaer K, Hansen RS, Oleson SP, Christopherson P, Skaaning-Jenson B. Activation of human IK and SK Ca2⫹-activated K⫹ channels by NS309 (6,7-dichloro1H-indole-2,3-dione 3-oxime). Biochim Biophys Acta 1665: 1–5, 2004. 35. Thompson J, Begenisich T. Membrane-delimited inhibition of maxi-K channel activity by the intermediate conductance Ca2⫹-activated K channel. J Gen Physiol 127: 159 –169, 2006. 36. Toro L, Wallner M, Meera P, Tanaka Y. Maxi-KCa, a unique member of the voltage-gated K channel superfamily. News Physiol Sci 13: 112– 117, 1998. 37. Trautmann A, Marty A. Activation of Ca-dependent K channels by carbamoylcholine in rat lacrimal glands. Proc Natl Acad Sci USA 81: 611–615, 1984. 38. Trudeau MC, Warmke JW, Ganetzky B, Robertson GA. HERG, a human inward rectifier in the voltage-gated potassium channel family. Science 269: 92–95, 1995. 39. Schreiber M, Salkoff L. A novel calcium-sensing domain in the BK channel. Biophys J 73: 1355–1363, 1997. 40. Tsien RY, Pozzan T, Rink TJ. T-cell mitogens cause early changes in cytoplasmic free Ca2⫹ and membrane potential in lymphocytes. Nature 295: 68 –71, 1982. 41. Tsuchiy S, Yamabe M, Yamaguchi Y, Kobayashi Y, Konno T, Tada K. Establishment and characterization of a human acute monocytic leukemia cell line (THP-1). Int J Cancer 26: 171–176, 1980. 42. Vergara C, Latorre R, Marrion N, Adelman J. Calcium-activated potassium channels. Curr Opin Neurobiol 8: 321–329, 1998. 43. Wei AD, Gutman GA, Aldrich R, Chandy KG, Grissmer S, Wulff H. International Union of Pharmacology. LII. Nomenclature and molecular relationships of calcium-activated potassium channels. Pharmcol Rev 57: 463–472, 2005. 44. Yan J, Aldrich RW. LRRC26 auxillary protein allows BK channel activation at resting voltage without calcium. Nature 466: 513–516, 2010. 45. Zuhlke RD, Pitt GS, Deisseroth K, Tsien RW, Reuter H. Calmodulin supports both inactivation and facilitation of L-type calcium channels. Nature 399: 159 –161, 1999. AJP-Cell Physiol • doi:10.1152/ajpcell.00368.2012 • www.ajpcell.org
0
You can add this document to your study collection(s)
Sign in Available only to authorized usersYou can add this document to your saved list
Sign in Available only to authorized users(For complaints, use another form )