CYAN MAGENTA YELLOW BLACK DIE MARK TOPO® Cloning Technology Fast, effective cloning of PCR products Direct your cloning future. TOPO® Cloning Technology With TOPO® Cloning Technology You Can: • Clone Taq-amplified, blunt-end, and long PCR products • Sequence or clone directly into an expression vector • Ligate in 5 minutes at room temperature and obtain up to 99% recombinants These products may be covered by one or more Limited Use Label Licenses (See the Invitrogen catalog or our web site, www.invitrogen.com). By the use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. For research use only. Not intended for any animal or human therapeutic or diagnostic use. Printed in the U.S.A. ©2003 Invitrogen Corporation. All rights reserved. Reproduction forbidden without permission. Corporate headquarters: 1600 Faraday Avenue • Carlsbad, CA 92008 USA • Tel: 760 603 7200 • Fax: 760 602 6500 • Toll Free Tel: 800 955 6288 • E-mail: tech_service@invitrogen.com • www.invitrogen.com European headquarters: Invitrogen Ltd 3 • Inchinnan Business Park • Fountain Drive • Paisley PA4 9RF, UK • Tel: +44 (0) 141 814 6100 • Fax: +44 (0) 141 814 6260 • E-mail: eurotech@invitrogen.com 710-021849 070803 10M • Obtain up to 99% recombinants • Ligate in 5 minutes at room temperature • Clone Taq-amplified, blunt-end, and long PCR products With TOPO® Cloning Kits You Can: TOPO® Cloning Kits Powerful PCR Cloning Tools For optimal cloning results, you need a technology that you can rely on. TOPO® Cloning is the most effective technology available for cloning PCR products and other DNA molecules. It yields up to 99% recombinants via a simple 5-minute, bench-top ligation. Topoisomerase greatly improves cloning TOPO® Cloning makes ligation faster and more successful. 3´ thymidine. It cleaves one DNA strand, enabling the It enables 5-minute, bench-top ligation and yields up to DNA to unwind. The enzyme then religates the ends of 99% recombinants. This speed and efficiency will save the cleaved strand and releases itself from the DNA. you hours of time over other methods of cloning. To harness the religating activity of topoisomerase, TOPO® The technology behind TOPO® Cloning vectors are provided linearized with topoisomerase I The key to TOPO® Cloning is the enzyme, DNA topoiso- covalently bound to each 3´ phosphate. This enables the merase I, which functions both as a restriction enzyme and vectors to readily ligate DNA sequences with compatible as a ligase. Its biological role is to cleave and rejoin DNA ends (Figures 1, 2, and 3) (1). In only 5 minutes at room during replication. Vaccinia virus topoisomerase I specifi- temperature, the ligation is complete and ready for cally recognizes the pentameric sequence 5´-(C/T)CCTT-3´ transformation into E. coli. and forms a covalent bond with the phosphate group of the Figure 1 - TOPO TA Cloning® of Taq-amplified DNA Topoisomerase I recognition sites 5 minutes at room temperature AGGG TTCCC TOPO P P 3´ phosphate CCCTT GGGA + A PCR Product TOPO A CCCT T GGGA A TOPO PCR Product A AGGG T TCCC Topoisomerase I is released TOPO TOPO TA Cloning® vector Taq-amplified PCR product Ligation complete Figure 2 - Zero Blunt TOPO Cloning of blunt-end DNA ® ® Topoisomerase I recognition sites 5 minutes at room temperature AAGGG TTCCC TOPO P P CCCTT GGGAA 3´ phosphate + TOPO PCR Product CCCTT GGGAA TOPO PCR Product AAGGG TTCCC Topoisomerase I is released TOPO Zero Blunt® TOPO® vector Blunt-end PCR product Ligation complete Figure 3 – Directional TOPO Cloning of blunt-end DNA ® Topoisomerase I recognition sites P 5 minutes at room temperature AAGGG TTCCC TOPO P CCCTT GGGAAGTGG 3´ phosphate + CACC GTGG PCR Product TOPO Directional TOPO® Cloning Vector TOPO CCCTT CACC GGGAA GTGG PCR Product TOPO GTGG AAGGG TTCCC Topoisomerase I is released extra GTGG released Blunt-end PCR Product (designed with CACC at the 5´ end, no modification at the 3´ end) Ligation complete ~1~ www.invitrogen.com TOPO® Cloning Kits Three simple steps TOPO® Cloning requires just three easy steps. Simply combine TOPO® Cloning means: your PCR product and a TOPO® Cloning vector in the provided • Utilizing standard PCR primers solution, wait five minutes, then transform E. coli (Figure 4). • Cloning efficiently without ligase or overnight incubations With TOPO® Cloning, the additional time, steps, and reagents • Using PCR templates without post-PCR modification or required for ligase-mediated cloning are eliminated. Table 1 gel purification* provides conservative estimates of the time saved using TOPO® Cloning versus other methods. Figure 4 - The TOPO® Cloning protocol 1. Add 1 µl of PCR reaction to 1 µl of TOPO® Cloning vector. Perform PCR with Taq or a proofreading polymerase. A CACC PCR Product A OR 2. Incubate 5 minutes at room temperature. 3. Transform the competent E. coli provided. PCR Product PCR Product TOPO TOPO 55 TOPO® Cloning Vector 0 5 10 50 45 15 20 40 35 30 25 *The TOPO® XL PCR Cloning Kit requires a 15-minute gel purification step. Table 1 – TOPO® TA Cloning vs. other methods of cloning Steps TOPO TA Cloning® TA/UA Cloning Restriction Enzyme Cutback and Ligation Order or prepare PCR Primers Special primers containing extra bases are not required Special primers containing extra bases are not required Add 10 extra bases to each 5´ and 3´ PCR primer to create restriction sites (6 for the restriction site, 4 for the spacing) Prepare the vector and PCR product for ligation Linearized TOPO® Cloning Vectors are ready for direct ligation of unmodified, unpurified PCR products TA/UA Cloning vectors are ready for direct ligation of unmodified, unpurified PCR products 1) Digest vector and PCR product with restriction enzyme(s) 2) Gel purify the digested PCR product using low-melt agarose Obtain ligation reagents All required cloning reagents are included All required cloning reagents are included Purchase ligase, ATP, and ligation buffer Prepare or purchase competent cells TOPO® Cloning Kits include One Shot® Competent E. coli 1) With competent cells=0 hrs 2) Without competent cells = Up to 6 hours 1) Purchase: 0 hours 2) Prepare: 6 hours Incubate the ligation 5 minutes 1 hour 2 to 23 hours Recombination efficiency up to 99% 60% to 80% ~ 60% Time required for cloning 1 to 12 hours 2 to 23 hours Toll Free: 800 955 6288 5 minutes ~2~ TOPO® Cloning Kits Complete product offering Whether you’re PCR cloning with Taq DNA polymerase or a proofreading enzyme, there is a TOPO® Cloning Kit available to take you quickly and efficiently to the next step. Use Tables 2 and 3 to find the right products for your specific application. For a complete list of products, please visit our web site at www.invitrogen.com/topo. Table 2 – TOPO® Cloning product guide Amplification Enzyme Application of Cloned PCR product Taq DNA polymerase: Product Page no. TOPO TA Cloning® Kit General subcloning Cloning® 4 Platinum® Taq in vitro transcription TOPO TA DNA Polymerase† Sequencing TOPO TA Cloning® for Sequencing 7 High-throughput studies HTP TOPO TA Cloning® Kit HTP TOPO TA Cloning® Kit Dual Promoter HTP TOPO TA Cloning® for Sequencing 13 13 13 Non-directional expression in E. coli, yeast, insect, or mammalian cells Various non-directional TOPO® Expression Vectors 8 Zero Blunt® TOPO® Cloning Kit 5 Zero Blunt® TOPO® Cloning Kit for Sequencing 7 Proofreading polymerase: General subcloning Platinum® Pfx in vitro transcription DNA Polymerase† Sequencing Blunt® Kit Dual Promoter TOPO® High-throughput studies HTP Zero PCR Cloning Kit for Sequencing HTP Directional TOPO® pENTR™ vectors 13 Proofreading polymerase: Directional expression in E. coli Champion™ pET Directional TOPO® Expression Kit 10 Platinum® Pfx DNA Polymerase†* Directional expression in mammalian cells pcDNA™3.1 Directional TOPO® Expression Kit pcDNA™4/HisMax TOPO® TA Expression Kit ViraPower™ Lentiviral Directional TOPO® Expression System 11 Expression of cloned PCR products in multiple hosts (via Gateway® System) Directional TOPO® pENTR™ vectors pcDNA/GW/D-TOPO® 12 General subcloning in vitro transcription Sequencing TOPO® XL PCR Cloning Kit 6 Polymerase mixtures for long PCR (3-10 kb): Platinum® Taq 13 DNA Polymerase High Fidelity† * The use of Platinum® Pfx DNA polymerase requires a PCR purification step prior to cloning. † These products may be covered by one or more Limited Use Label Licenses (See the Invitrogen catalog or our web site, www.invitrogen.com). By the use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Table 3 – Sequencing tools from Invitrogen Kit Name Application Template Page no. TOPO® Shotgun Subcloning Kit Construction of shotgun libraries for sequencing BACs, YACs, cosmids, and genomic DNA 14 TOPO® Walker Kit Determination of unknown gap sequence Partially sequenced BACs, YACs, and PACs 15 Please visit our web site at www.invitrogen.com/topo ~3~ www.invitrogen.com TOPO TA Cloning® Kits Fast cloning of Taq-amplified PCR products TOPO TA Cloning® Kits TOPO TA Cloning® Kits combine the TOPO® and TA Figure 5 - pCR®-TOPO® vectors TOPO® vectors (Figure 5) are provided linearized with TOPO 3´-T overhangs and topoisomerase I-activated to readily SP6 accept PCR products with 3´-A overhangs. This enables Nsi I Hind III Kpn I Sac I BamH I Spe I BstX I EcoR I pCR®II-TOPO® T T recombinants. The T7 TOPO fast, 5-minute TOPO® Cloning and yields up to 99% pCR®-TOPO® EcoR I EcoR V BstX I Not I Xho I Nsi I Xba I Apa I (see box below) technologies to enable fast, effi- cient cloning of Taq-amplified PCR products. The pCR®- vectors are ideal for appli- pCR®2.1-TOPO® cations such as probe generation, in vitro transcription, or M13 include: Hind III Kpn I Sac I BamH I Spe I BstX I EcoR I TOPO general subcloning. Some of their convenient features T T lacZα EcoR I EcoR V BstX I Not I Xho I Nsi I Xba I Apa I Cloning® T7 TOPO • EcoR I sites flanking the PCR product insertion site for f1 choice of selection in E. coli pCR®-TOPO® 3.9 kb yc i n pUC ori i or easy removal of inserts • Kanamycin and ampicillin resistance genes for your Am • T7 (pCR®2.1-TOPO®) or T7 and SP6 (pCR®II-TOPO®) promoter/priming sites for in vitro transcription am • Easy blue/white screening of recombinant colonies Ka pic illin n • M13 forward (-20) and reverse priming sites for TOPO sequencing or PCR screening Represents covalently bound topoisomerase I The consistency and speed of the TOPO TA Cloning® Kits make them the best way to clone all of your Taq-amplified PCR products. Direct ligation with TA Cloning® Technology The TA Cloning® technology makes it possible to easily clone PCR products produced by Taq polymerase. Taq has a terminal transferase activity that adds a single 3´-A overhang to each end of the PCR product. TOPO TA Cloning® vectors contain 3´-T overhangs that enable the direct ligation of Taq-amplified PCR products (Figure 6)(2,3). Figure 6 - How TOPO TA Cloning® works 1. Add 1 µl of a pCR-TOPO® vector to 1 µl of Taq-amplified PCR product. 2. Incubate for 5 minutes on your bench top. 3. Transform One Shot® Competent E. coli. 3´ T r Vecto 5´ Topoisomerase I 5´ + A 5´ 3´ Topoisomerase I T 3´ Topoisomerase I T Vecto r A PCR Product A T Vecto r 5´ Vector Activated TOPO TA Cloning® vector Toll Free: 800 955 6288 3´ A Taq-amplified PCR Product Taq-amplified PCR product with 3´-A overhangs Ligation complete. Vector is ready for transformation ~4~ Topoisomerase I Zero Blunt® TOPO® PCR Cloning Kits Simplified blunt-end cloning Zero Blunt® TOPO® PCR Cloning Kit TOPO® Cloning to allow easy, high-efficiency cloning of blunt-end PCR products. The pCR®-Blunt II-TOPO® SP6 vector (Figure 7) is provided linearized and topoisomerase I-acti- P lac TOPO EcoR I Pst I EcoR V Not I Xho I Nsi I Xba I Dra II Apa I unique Zero Background™ technology (see box below) with Nsi I Hind III Asp718 I Kpn I Ecl136 II Sac I BamH I Spe I EcoR I Figure 7 - pCR®-Blunt II-TOPO® vector The Zero Blunt® TOPO® PCR Cloning Kit combines the T7 TOPO lacZα ccd B vated so it readily accepts blunt-end PCR products. It pUC ori top ligation. The pCR®-Blunt II-TOPO® vector features: Kanamycin produces ≥95% recombinants via rapid 5-minute, bench- pCR®-Blunt IITOPO® 3.5 kb • The ccdB gene to eliminate background • EcoR I sites flanking the PCR product insertion site for Ze ocin easy removal of inserts • Kanamycin and Zeocin™ resistance genes for your TOPO Represents covalently bound topoisomerase I choice of selection in E. coli • T7 and SP6 promoter/priming sites for in vitro RNA transcription and sequencing • M13 forward (-20) and reverse priming sites for sequencing or PCR screening The Zero Blunt® TOPO® PCR Cloning Kit offers the easiest, most effective method available for cloning blunt-end PCR products. Eliminate high backgrounds Due to high background, cloning blunt-end and long PCR products can be difficult and often yields a low percentage of recombinants. Invitrogen’s unique Zero Background™ technology uses the lethal ccdB (control of cell death) gene to enable high-efficiency cloning. The ccdB gene is incorporated into the cloning site of Zero Background™ vectors. The ccdB protein poisons bacterial DNA gyrase, causing degradation of the Figure 8 - Positive selection by ccdB lacZα ccdB host chromosome and cell death (4,5). When an insert is ligated into the vector, the ccdB gene is disrupted, enabling only recombinant colonies to grow (Figure 8). lacZα ccdB + Blunt DNA If a Zero Background™ vector self-ligates, the lethal ccdB gene is expressed, so colonies cannot grow. By eliminating high vector background, the Zero Background™ technology yields Combine a Zero Background™ vector with blunt-end DNA. lacZα Blunt DNA ccdB nearly 100% recombinants, freeing you from having to screen hundreds of back- When an insert is cloned, expression of the ccdB gene is disrupted, so recombinants can grow. ground colonies. ~5~ www.invitrogen.com TOPO® XL PCR Cloning Kit Efficient cloning of long PCR products TOPO® XL PCR Cloning Kit The TOPO® XL PCR Cloning Kit combines TOPO® Cloning, Figure 9 - pCR®-XL-TOPO® vector Zero Background™ technology (see box, page 5), and a unique gel purification step (see box below) to optimize T T earized and topoisomerase I-activated to enable 5-minute, bench-top ligation and ≥80% recombinants‡. Pla It contains EcoR I Pst I EcoR V Not I Xho I Nsi I Xba I Dra II Apa I M13 The pCR®-XL-TOPO® vector (Figure 9) is provided lin- Mlu I Nsi I Hind III Kpn I Ecl136 II Sac I BamH I Spe I EcoR I TOPO the conditions for cloning long PCR products (3-10 kb). lacZα c cc d T7 TOPO B 3´-T overhangs for cloning PCR products produced by convenient features of pCR®-XL-TOPO® include: pCR®-XLTOPO® Kanamycin pUC ori most thermostable polymerase mixtures†. Some of the 3.5 kb • The ccdB gene to eliminate background Zeocin • Kanamycin and Zeocin™ resistance genes for your choice of selection in E. coli TOPO Represents covalently bound topoisomerase I • T7 promoter/priming site for in vitro RNA transcription and sequencing • M13 forward (-20) and reverse priming sites for sequencing or PCR screening The TOPO® XL PCR Cloning Kit combines gel purification, TOPO® Cloning and Zero Background™ technology to enable high-efficiency cloning of long PCR products. Unique gel purification step improves results Long PCR often yields multiple products, making gel purification necessary prior to cloning. Table 4 - Crystal violet protects long PCR products for safe gel purification and efficient TOPO® Cloning Crystal Violet Ethidium Bromide Total Colonies (KanR) 275 15 Colonies w/insert (KanR-AmpR) 258 9 Percent Recombinants 94% 60% However, gel purification requires exposure to ethidium bromide and UV light, which can nick and damage DNA (6). To protect against nicking, the TOPO® XL PCR Cloning Kit uses crystal violet to enable visualization of DNA bands in an agarose gel under ambient light. This eliminates ethidium bromide and exposure to UV light, ensuring safe gel purification. Crystal violet staining results in many more colonies and a greater percentage of recombinants than using ethidium bromide and UV light (Table 4). A 7 kb ampicillin resistance gene sequence was PCR amplified with Expand™ polymerase. PCR products were loaded onto one gel with crystal violet and another gel stained with ethidium bromide. The 7 kb products were gel purified and cloned into the pCR®-XL-TOPO® vector. The number of recombinants was determined by plating 125 µl of each transformation on LB plates containing either kanamycin or kanamycin and ampicillin. ‡ When using chemically competent E. coli, you can expect ≥70% recombinants. For the best results, electrocompetent cells are recommended because electroporation yields higher transformation efficiencies than chemical methods and does not bias against larger constructs. † The TOPO® XL PCR Cloning Kit has been tested with Expand™ and eLONGase®. Toll Free: 800 955 6288 ~6~ TOPO® Cloning Kits for Sequencing TOPO® Cloning vectors for optimized sequencing Figure 10 - TOPO® Cloning Vectors for Sequencing The TOPO® Cloning Kits for Sequencing allow fast cloning and streamlined sequencing of PCR products. The kits cloning site that positions the T7 and T3 priming sites M13 T3 TOPO 33 bp 33 bp Spe I Sse8387 I Pme I EcoR I 73 bp contain TOPO® Cloning vectors with a minimized multiple A Taq-amplified PCR Product A T only 33 bp away from the PCR product insertion site M13 pCR®4-TOPO® M13 pCR®4Blunt-TOPO® TOPO M13 T3 33 bp TOPO 33 bp EcoR I Not I 73 bp Spe I Sse8387 I Pme I EcoR I insert and less of the vector. The pCR®4-TOPO vector supplied in the TOPO TA Cloning® T7 Blunt-end PCR Product (Figure 10). This means you’ll sequence more of your Choice of vectors 60 bp T EcoR I Not I TOPO® Cloning Kits for Sequencing lacZ cc dB c Pla Kit for Sequencing has 3´-T overhangs for pUC o ri cloning Taq-amplified PCR products. The pCR®4BluntTOPO® vector supplied in the Zero Blunt® TOPO® PCR PCR products amplified with proofreading polymerases. 4.0 kb Each vector is supplied linearized and topoisomerase I- Am activated, enabling 5-minute, bench-top ligation and p ici T7 TOPO Kana my cin Cloning Kit for Sequencing has blunt ends for cloning pCR®4- and pCR®4BluntTOPO® 60 bp ll ii n yielding ≥95% recombinants. Some of their convenient features include: TOPO Represents covalently bound topoisomerase I • T7 and T3 promoter/priming sites for sequencing and in vitro transcription/translation • M13 forward (-20) and reverse priming sites for sequencing or PCR screening • The ccdB gene to eliminate background and improve results (see box, page 5) • EcoR I sites flanking the PCR product insertion site for easy removal of inserts • Unique Sse8387 I site to produce nested deletions for sequencing internal regions of your insert • Kanamycin and ampicillin resistance genes for your choice of selection in E. coli With their minimized multiple cloning sites, the TOPO® Cloning Vectors for Sequencing enable effective cloning and streamlined sequencing for all of your PCR products. For shotgun sequencing and cloning unknown sequences, refer to TOPO® Cloning Kits for Genomic Analysis, pages 14 and 15 ~7~ www.invitrogen.com Non-Directional TOPO® Expression Kits Effective way to express Non-Directional TOPO® Cloning Expression Kits TOPO® Cloning Expression vectors eliminate potential Using restriction enzymes to clone your gene of inter- exact DNA sequence you require by performing PCR est into an expression vector often forces you to com- with appropriately designed primers. The resulting promise the final sequence of your insert, especially recombinant expression vector contains your exact when there are no useful restriction sites close to your DNA sequence without any non-coding regions gene’s coding sequence. (Figure 11). Non-directional TOPO® Cloning expression problems by allowing you to insert the Expression vectors are available in the prokaryotic, yeast, insect, and mammalian expression systems. Figure 11 - Comparison of cloning strategies A. Restriction Digest Method B. TOPO® Cloning Method Domain of interest Domain of interest RE2 RE1 RE2 RE1 1. Digest with restriction enzymes RE1 1. PCR with properly designed primers RE2 ATG Epitope moter Pro A A + moter Pro 2. Ligate Overnight 3. Transform RE1 T T Epitope RE2 Epitope moter Pro 2. Incubate for 5 minutes 3. Transform ATG moter Pro Total time: 2 days Total time: 2 days RE = Restriction enzyme = Non-coding sequence For more information on TOPO® Cloning Expression vectors, see the Invitrogen catalog or visit our web site at www.invitrogen.com/topo ~8~ Epitope Total time: <1 day Directional TOPO® Expression Kits Time-tested expression results Directional TOPO® Expression Technology Directional TOPO® With Directional TOPO® Cloning Expression Kits, Cloning enables you to clone your blunt- end PCR products in a 5´→3´ orientation into a proven you will: • Save time – TOPO® Cloning of your PCR product takes expression vector using a 5-minute ligation reaction. just five minutes (Figure 12) Directional TOPO® Cloning vectors contain a single-strand • Obtain efficient cloning results - >90% of your recombi- GTGG overhang on the 5´ end and a blunt end on the nant clones will be in the correct orientation for expres- 3´ end. The four-nucleotide overhang invades the sion (Figure 13) double-strand DNA of the PCR product and anneals to the • Achieve high-level expression – vectors carry a powerful CACC sequence that you place in your 5´ primer. promoter for expression Topoisomerase I then ligates the PCR product in the correct orientation. Figure 12- Time comparison of cloning strategies Traditional cloning Directional TOPO® Cloning PCR PCR Restriction enzyme digest on expression vector and the PCR product Directional TOPO® Cloning 5 minutes 1 hour Gel purify DNA fragment. Dephosphorylate linearized vector Transformation 13 hours 2 hours Screen 5 colonies Overnight ligation 15 hours 12 hours EXPRESSION Transformation 13 hours Total time: 28 hours 5 minutes Screen 20 colonies Time Savings: 20 hours 20 hours EXPRESSION Total time: 48 hours Figure 13 – Directional cloning of human open reading frames into pcDNA3.1D/V5-His-TOPO® vector Clone No. in correct orientation No. in reverse orientation % Correct 18 2 90% AF016582 (1504 bp) 20 0 100% AF020833 (1036 bp) 19 1 95% D32129 (1171 bp) ~9~ Directional TOPO® Expression Kits High-level protein production in E. coli Champion™ pET Directional TOPO® Expression Kits Champion™ pET vectors are powerful E. coli expression vectors that use the highly-efficient T7 RNA polymerase to Figure 14 – Strong expression in pET Directional TOPO® vectors 1 2 3 4 5 6 7 8 I U I U I 9 10 β-gal achieve strong transcription levels and high protein yields. T7 RNA polymerase is expressed by host E. coli under the control of the IPTG-inducible lacUV5 promoter. This U allows you to regulate transcription with IPTG. The additional lacO element found in the T7lac promoter used in the pET vectors further reduces the basal expression levels while maintaining strong transcriptional activity upon induction with IPTG. Reported yields of recombinant proteins from the pET vectors are typically in the range of tens to hundreds of milligrams per liter of culture (Figure 14). The pET Directional TOPO® Expression Kits offer: • Advanced cloning technology I U U I U=Uninduced I=Induced The lacZ gene was cloned directionally into pET100/D-TOPO®, pET101/D-TOPO®, and pET102/D-TOPO® vectors and cloned using the restriction digest method into pET15b and pET32a vectors. Constructs were transformed into BL21 Star™(DE3) E. coli. A single colony from each transformation was used to inoculate 1 ml LB medium supplemented with 100 µg/ml ampicillin. Induction with 1 mM IPTG was performed at OD600=0.5. Two and one-half hours post induction, cultures were harvested by centrifugation. Pellets were resuspended in 300 µl sample buffer. Ten microliters of each sample was analyzed on a 4-20% Novex® Tris-Glycine gel. Note: pET15b contains an N-terminal 6xHis tag while pET32a contains an N-terminal thioredoxin fusion and a C-terminal 6xHis tag. Lanes 1 and 2: pET15b/lacZ Lanes 3 and 4: pET101/D-TOPO®/lacZ • High-level and regulated expression Lanes 5 and 6: pET100/D-TOPO®/lacZ Lanes 7 and 8: pET102/D-TOPO®/lacZ Lanes 9 and 10: pET32a/lacZ • Multiple purification, detection, and cleavage options BL21 Star™: for highest expression BL21 Star™(DE3) One Shot® Competent E. coli is designed to give you significantly improved expression levels of recombinant protein. BL21 Star™ is the only strain that contains a mutation in the endonuclease RNase. This mutation causes less RNA degradation and as a result more RNA is available for translation. With BL21 Star™ you can get up to a ten-fold increase in protein production. Use BL21 Star™ with any T7 expression system. For added convenience BL21 Star™ are available in the convenient, cost-effective One Shot® format. Product BL21 Star™ One Shot® Chemically Competent E. coli Efficiency 8 1 x 10 Quantity Cat. no. 20 x 50 µl C6010-03 BL21-AI™: for tightly regulated, highly inducible expression BL21-AI™ One Shot® Competent E. coli is an arabinose-inducible strain designed to give you the maximum expression with the tightest regulation available from a T7 expression system. It’s the only strain that gives you both tight regulation and high yields, making it great for high-level expression of toxic proteins. Because it has the tightly regulated arabinoseinducible araBAD promoter upstream of the T7 RNA polymerase gene, you can use it with any T7 promoter-based vector. All that in the convenient, cost-effective One Shot® format. Product BL21-AI™ One Shot® Chemically Competent E. coli Toll Free: 800 955 6288 Efficiency 8 >1 x 10 ~ 10 ~ Quantity Cat. no. 20 x 50 µl C6070-03 Directional TOPO® Expression Kits High-level, constitutive mammalian expression pcDNA™3.1 Directional TOPO® Expression Kit Figure 15 – pcDNA3.1D/V5-His-TOPO® Vector The pcDNA3.1™ Directional TOPO® Expression Kit offers TOPO following features (Figure 15): BGH pA V mammalian cell lines with Geneticin® selection agent p U C ori pA 40 SV l li n 5.5 kb • Neomycin resistance gene for selection of stable Neomy cin A m pi c i nant protein and rapid purification using ProBond™ resin pcDNA3.1D/ V5-His-TOPO® ri 40 o SV in a wide range of mammalian cell hosts • C-terminal V5-His epitope for easy detection of recombi- pcDNA3.1D/V5-His-TOPO® vectors, expression of lacZ Stop P CM • The CMV promoter for high-level constitutive expression To demonstrate the high-level expression achieved with 6xHis Pme I V5 epitope Age I ucts. The pcDNA3.1D/V5-His-TOPO® vector contains the TOPO EcoR V BstX I Not I Xho I Xba I Apa I Sac II T7 Hind III Asp718 I Kpn I BamH I efficient and directional cloning of blunt-end PCR prod- Figure 16 – Expression of β-galactosidase from pcDNA3.1D/V5-His-TOPO® 1 from the vector was compared to pcDNA™3.1/V5-His/lacZ 2 3 The lacZ gene was PCR amplified and cloned into pcDNA3.1/V5-His-TOPO© and lacZ pcDNA3.1D/V5-His-TOPO® directional (Figure 16). The results show that the equivalent expres- vectors. These constructs were each transfected into 7.5 x 104 COS-7 cells using the calcium phosphate method. Forty-eight hours post transfection, cells were harvested. Ten micrograms of total protein was loaded on each lane of an SDS-PAGE gel. Expression was analyzed by western blot using an anti-β-gal antibody. Lane 1: Mock; Lane 2: pcDNA™3.1/V5-His/lacZ; Lane 3: pcDNA™3.1D/V5-His/lacZ. sion levels are achieved. High-level, stable expression in mammalian cells ViraPower™ Lentiviral Expression System Figure 17 – pLenti6/V5-D-TOPO® Vector stable gene expression and reproducible delivery to both TOPO CCC TT GGG AAG TG G AAG GGC TTC CCG Xho I Apa I Sac II Sfu I Lentiviral Expression System provides BamH I Spe I BstX I The ViraPower™ V5 epitope Stop TOPO dividing and non-dividing cells. You can use the PSV4 0 V P CM RR ψ ’L P RSV/5 TR • CMV promoter for high-level expression pLenti6/V5D-TOPO® 7.0 kb LT RR pU • C-terminal V5 tag for convenient detection C • Blasticidin resistance gene for fast, efficient stable selection i Ampicillin • Components for efficient packaging of your gene of pA 40 SV or ∆U3 /3’ Expression Vector (Figure 17). The vector contains: idin stic Bla 5-minute TOPO® Cloning reaction to prepare your Lentiviral EM E 7 pLenti6/V5-D-TOPO® vector to take advantage of a simple, Figure 18 - Lentivirus readily transduces non-dividing cell types interest A B The ViraPower™ Lentiviral Directional TOPO® Expression System provides you with the high levels of stable gene expression necessary for valid results in virtually any cell line (Figure 18). Primary fibroblasts Adult rat hippocampal neurons Contact-inhibited, non-dividing, quiescent primary human foreskin fibroblasts (A) or adult hippocampal neurons (B) were transduced with pLenti6/CMV/V5-GFP at an MOI of 5 or 1, respectively. GFP was detected 48 hours post-transduction by fluorescence microscopy. ~ 11 ~ www.invitrogen.com Directional TOPO® Expression Kits Quick and easy way to enter the Gateway® System Gateway® entry clones with Directional TOPO® Cloning Figure 19 - Gateway™ Directional TOPO® entry vectors pENTR/SD/D-TOPO® Two Directional TOPO® entry vectors are available for creating a Gateway® entry clone. Once you have cloned gene 10 RBS AAG GGT TTC CCA GGG AAG TGG your PCR product into an entry vector, it can be rapidly Asc I Not I TOPO CCC TT TOPO shuttled to a wide variety of Gateway® destination vectors pENTR/D-TOPO® for your downstream expression and functional analysis offer the following features (Figure 19): Asc I Not I needs. pENTR/D-TOPO® and pENTR/SD/D-TOPO® vectors AAG GGT T TC C CA CC C T T GGG AAG TGG • attL recombination sites for efficient transfer into any attL1 Gateway® destination vector att L2 • Universal M13 sites to facilitate sequencing • pUC-based ori for high plasmid yields • Kanamycin resistance gene for selection in E. coli C ori pU pENTR pcDNA/GW/D-TOPO Vectors ® 2.6 kb pcDNA/GW/D-TOPO® vectors give you high-level expres- Kana m sion in mammalian cells, and allow you to save signifi- y ci n cant cloning and screening time. Once your gene of interest is cloned into the vector, it will immediately express from the built-in CMV promoter. This powerful promoter drives high-level constitutive expression in a wide variety Figure 20 - pcDNA/GW/D-TOPO® expression vectors of mammalian cells. pcDNA/GW/D-TOPO® vectors offer the following (Figure 20): TOPO Gateway® entry clone Asc I Not I • attB recombination sites for rapid conversion into a • Universal M13 sites to facilitate sequencing attB1 • pUC-based ori for high plasmid yields CM selection in mammalian cells V5 ep V pe ito • Choice of neomycin or Blasticidin resistance genes for TOPO attB2 pU C ori PS 0 V4 pA 7 40 ® ) PO om TO ® ) ycin / DO B la (p c D N A 3. 2 / G W P O s ti c D-T id in (pc D N A 6. 2 / G W / ne Toll Free: 800 955 6288 ~ 12 ~ EM SV TkpA fl origin a mp pcDNA/GW/ D-TOPO® HTP TOPO® Cloning Kits Easily clone thousands of PCR products High-Throughput TOPO® Cloning plates, incubate for only 5 minutes, then transform the HTP TOPO® Cloning kits couple TOPO® technology to supplied chemically competent E. coli with a multi-chan- high-throughput format, enabling you to easily and simul- nel pipette (Table 5). With the speed and high efficiency taneously clone thousands of PCR products. With 500 of TOPO® Cloning, you’ll not only get your clones fast, reactions of TOPO® vector supplied in a single tube, you can quickly set up your TOPO® reactions in multi-well you’ll get them the first time, eliminating time wasted repeating unsuccessful reactions. Table 5 – HTP TOPO® Cloning Kits Vector* TOP10 E. coli Format† Reactions Cat. no. pCR®2.1-TOPO® Bulk MultiShot™ MultiShot™ StripWell 500 480 480 K4500-500 K4500-480 K4500-05 HTP TOPO TA Cloning® Kit Dual Promoter pCR®II-TOPO® Bulk MultiShot™ MultiShot™ StripWell 500 480 480 K4600-500 K4600-480 K4600-05 HTP TOPO TA Cloning® Kit for Sequencing pCR®4-TOPO® Bulk MultiShot™ MultiShot™ StripWell 500 480 480 K4575-500 K4575-480 K4575-05 pCR®4Blunt-TOPO® Bulk MultiShot™ MultiShot™ StripWell 500 480 480 K2875-500 K2875-480 K2875-05 pENTR/D-TOPO® Bulk MultiShot™ StripWell 500 480 K2400-500 K2400-480 pENTR/SD/D-TOPO® Bulk MultiShot™ StripWell 500 480 K2420-500 K2420-480 Description HTP TOPO TA Cloning® Kit HTP Zero Blunt® TOPO® PCR Cloning Kit for Sequencing Directional TOPO® pENTR™ Vectors * For more information on these vectors, see the catalog or visit our web site at www.invitrogen.com/topo † Bulk (five 5-ml aliquots) • MultiShot™ (five 96-well plates) • MultiShot™ StripWell (five stripwell plates) ~ 13 ~ www.invitrogen.com TOPO® Cloning Kits for Genomic Analysis Streamlined shotgun subcloning TOPO® Shotgun Sequencing Kit Figure 21 – TOPO® Shotgun Subcloning Kit saves over 13 hours of time versus traditional shotgun method The TOPO® Shotgun Subcloning Kit is specifically designed to expedite traditional shotgun subcloning procedures by saving Hours both time and effort in each step. 0 2 4 6 8 10 12 14 16 Traditional Shotgun Procedure TOPO® Shotgun technology was built upon examining each step of a traditional shotgun subcloning protocol and eliminating tedious steps and lengthy incubations (Figure 21). TOPO® Shotgun Subcloning Kit This kit includes a specialized vector with numerous features to make shotgun subcloning easier than ever before. The TOPO® Shotgun Subcloning Kit includes pCR®4Blunt-TOPO® vector Shear DNA (Figure 10, page 7) that allows you to: Repair DNA and Dephosphorylate • Easily construct shotgun libraries—readily accepts blunt- Gel Purify Clone ended DNA fragments. Cloning takes just 25 minutes. • Eliminate multiple inserts—only vectors containing single inserts will circularize and propagate. The TOPO® Shotgun Subcloning Kit utilizes a nebulizer— • Keep background low—expression of a lethal ccdB gene a small plastic device used to atomize liquids—and ensures only recombinant clones will grow (page 5). compressed air to shear large DNA into 2 kb fragments • Streamline sequencing—increase efficiency by reading more suitable for cloning into the pCR®4Blunt-TOPO® vector. insert and less vector. Toll Free: 800 955 6288 ~ 14 ~ TOPO® Cloning Kits for Genomic Analysis The fast way to fill in sequence gaps TOPO® Walker Kit need to carry out cloning experiments that can add addi- The TOPO® Walker Kit eliminates the need for tional days to your experiment. The TOPO® Walker Kit hybridization-based library screens when isolating saves you time by: unknown DNA sequences. Instead, the kit uses • Ligating a topoisomerase-activated linker to the unknown end of a DNA fragment in just 5 minutes. a simple 5-step protocol to save time in your chromosome walking experiments (Figure 22). • Using PCR to rapidly amplify the unknown sequence Once the unknown DNA fragment is amplified, the PCR • Sequencing the PCR product directly—no subcloning steps are required product can be sequenced directly. There’s no Figure 22 – How TOPO® Walker works Step 1 P 3 5 ACGT 1. Digest complex DNA (such as BAC, YAC, or PAC) to completion with an enzyme that leaves a 3´ overhang. TGCA 5 3 P Step 2 5 3 3 5 2. Dephosphorylate the DNA to allow ligation of the TOPO® Linker. TGCA ACGT Step 3 3 5 GSP1 ACGT 3. Primer extend with TGCA Taq DNA polymerase and a gene-specific primer (GSP1). A 3 5 Step 4 5 A 5 TTCCC GSP1 ACGT 3 TOPO® Linker 4. Ligate the TOPO® 3 5 Linker to the DNA. TOPO Step 5 GSP1 ACGT GSP2 A T 3 TOPO® Linker 5 3 5. Perform PCR using a second gene-specific primer (GSP2) and a primer complementary to the TOPO® Linker (LinkAmp Primer 1 or 2). 5 LinkAmp Primer 1 or 2 Known DNA Unknown DNA PCR makes it easy — TOPO® Technology makes it fast which topoisomerase I is covalently bound. In just The key to the speed of the TOPO® Walker Kit is 3´-A overhang of your DNA sequence. Subsequent the TOPO® Linker (Figure 23). The TOPO® Linker is 5 minutes you can ligate the TOPO® Linker to the PCR using a primer specific to the linker and a a 58 bp, double-stranded DNA sequence containing gene-specific primer from your known sequence two PCR primer sites, and a 3´- T overhang in amplifies the sequence gap. Figure 23 – The topoisomerase-activated TOPO® Linker LinkAmp Primer 1 LinkAmp Primer 2 TAGAAGGCACAGTCGAGGACTTATCCTAGCCTCTGAATACTTTCAACAAGTTACACCCTT AAAAAAAATCTTCCGTGTCAGCTCCTGAATAGGATCGGAGACTTATGAAAGTTGTTCAATGTGGGA P ~ 15 ~ TOPO TOPO Represents covalently bound topoisomerase I www.invitrogen.com TOPO® Cloning Technology Custom TOPO® Cloning Adaptation Service The development of gene-based therapeutics and diagnostics products requires the rapid analysis of a vast number of gene sequences. When screening gene targets that are of commercial importance, being the first to identify, clone, express, and validate these genes is crucial. Invitrogen’s Custom TOPO® Cloning Adaptation Service puts the power of TOPO® Cloning into your vector. With your own vector adapted to TOPO® Technology, you can: • TOPO® Clone your favorite vector – you won’t have to compromise on vector features to meet your needs • Save time – TOPO® Cloning takes only 5 minutes and is so effective, you won’t have to repeat experiments • Maintain your current experimental strategy – adapting your own vector for TOPO® Cloning doesn’t change your downstream studies, but it will get you there faster Your results are guaranteed Every TOPO® Cloning Kit is functionally tested to ensure polymerase. The size of the PCR product is verified and that you get successful results. To test each kit, a control TOPO® Cloned. The resulting percent recombinants must DNA fragment is PCR amplified with the appropriate DNA meet our stringent standards in order to pass quality control. Clone it today With unrivaled consistency and speed, TOPO® Cloning Kits reactions all in the same day. And up to 99% recombinants are the most effective way to clone PCR products. ensures that you’ll get your clones the first time, every time. The rapid 5-minute, bench-top ligation enables you to For PCR cloning results you can count on, order a perform your PCR, TOPO® Cloning, and transformation TOPO® Cloning Kit today. References: 1. Shuman, S. (1994) J. Biol. Chem. 269: 32678-32684. 2. Clark, J.M. (1988) Nuc. Acids Res. 16: 9677-9678. 3. Mead, D. et al. (1991) Bio/Techniques 9: 657-663. 4. Bernard, P. and Couturier, M. (1992) J. Mol. Biol. 226: 735-745. 5. Bernard, P. et al. (1993) J. Mol. Biol. 234: 534-541. 6. Rand, K.N. (1996) Elsevier Trends Technical Tips Online. Important Licensing Information Performance of the polymerase chain reaction (PCR) is covered by one or more of U.S. Patent Nos. 4,683,202; 4,683,195; and 4,899,818 issued to Cetus Corporation and owned and licensed by Hoffmann-LaRoche Molecular Systems, Inc. Purchase of any of Invitrogen’s PCR-related products does not convey a license to use the PCR process covered by these patents. Purchasers of these products must obtain a license to use the PCR process before performing PCR. TOPO TA Cloning® is covered under one or more of U.S. Patent Nos. 5,487,993; 5,766,891; 5,827,657 and corresponding foreign patents. For research purposes only. Other patents pending. Products referred to herein which are the subject of one or more of U.S. Patent No. 5,910,438 and 6,180,407, and/or corresponding foreign patents, are sold under license from the Université Libre de Bruxelles for research purposes only (Limited Use Label License No. 54: ccdB-Fusion Vectors). Zeocin™ is a trademark of CAYLA. For research use only. Expand™ is a trademark of Boehringer Mannheim Corporation. 710-021849 070803 10M ~ 16 ~ CYAN MAGENTA YELLOW BLACK DIE MARK TOPO® Cloning Technology Fast, effective cloning of PCR products Direct your cloning future. TOPO® Cloning Technology With TOPO® Cloning Technology You Can: • Clone Taq-amplified, blunt-end, and long PCR products • Sequence or clone directly into an expression vector • Ligate in 5 minutes at room temperature and obtain up to 99% recombinants These products may be covered by one or more Limited Use Label Licenses (See the Invitrogen catalog or our web site, www.invitrogen.com). By the use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. For research use only. Not intended for any animal or human therapeutic or diagnostic use. Printed in the U.S.A. ©2003 Invitrogen Corporation. All rights reserved. Reproduction forbidden without permission. Corporate headquarters: 1600 Faraday Avenue • Carlsbad, CA 92008 USA • Tel: 760 603 7200 • Fax: 760 602 6500 • Toll Free Tel: 800 955 6288 • E-mail: tech_service@invitrogen.com • www.invitrogen.com European headquarters: Invitrogen Ltd 3 • Inchinnan Business Park • Fountain Drive • Paisley PA4 9RF, UK • Tel: +44 (0) 141 814 6100 • Fax: +44 (0) 141 814 6260 • E-mail: eurotech@invitrogen.com 710-021849 070803 10M • Obtain up to 99% recombinants • Ligate in 5 minutes at room temperature • Clone Taq-amplified, blunt-end, and long PCR products With TOPO® Cloning Kits You Can: