FACULTY OF HEALTH SCIENCES
UNIVERSITY OF COPENHAGEN
PhD thesis
Thomas Tuxen Poulsen, MSc
Gene Therapy for Small Cell Lung Cancer
- Targeting the Neuroendocrine Phenotype
Head Supervisor: Hans Skovgaard Poulsen, MD, DMSc
Submitted: February 2008
ii
Preface
This thesis is submitted to the Faculty of Health Science, University of Copenhagen,
Denmark, in order to fulfil the requirements to obtain the PhD-degree in medical sciences.
The study was performed from February 2005 to January 2008 under the supervision of
Head Supervisor Hans Skovgaard Poulsen MD, DMSc and Project Supervisor Nina
Pedersen, PhD, MSc at the Department of Radiation Biology, Copenhagen University
Hospital, Copenhagen, Denmark.
The majority of the experimental work was conducted at the Department of Radiation
Biology, while some of the further studies presented in Part I and the study presented in
Part III were carried out as part of a six months visiting research fellowship at the Cell and
Cancer Biology Branch, National Cancer Institute, National Institutes of Health, Bethesda,
Maryland, USA under the supervision of Senior Investigator Ilona Linnoila, MD.
Following a general introduction to small cell lung cancer prognosis and biology and an
introduction to cancer gene therapy this thesis is composed of three main parts or
chapters. Each part comprises a background section followed by a manuscript or
published scientific paper and a perspectives section. The contents of the three chapters
are outlined and summarized below. All manuscripts and papers included in this thesis
have either been published or submitted to scientific journals and are undergoing peerreview at the time of writing. Part I of the thesis represents the primary aim of the PhDstudy: Development of a transcriptionally targeted gene therapy for small cell lung cancer
and is therefore the most comprehensive of the three.
Part I: Development of a targeted gene therapy for SCLC
The results presented in this section describe a strategy for targeting suicide gene
therapy to small cell lung cancer cells by means of cancer specific promoters. Promoter
regions from the two genes hASH1 and EZH2, which are highly and specifically active in
small cell lung cancer were cloned and tested in reporter and suicide gene assays in a
panel of small cell lung cancer and non-neuroendocrine control cell lines. The results
iii
show, that a chimeric construct comprising compononents of both promoters confers high
reporter- and therapeutic gene activity and small cell lung cancer specificity.
Part II: Neuronal Pentraxins and SCLC sensitivity to taipoxin
This chapter describes the discovery that the snake venom neurotoxin taipoxin induces
specific toxicity in small cell lung cancer cells in culture compared to transformed and
untransformed control cell lines. Part of the work was prompted by a preceeding Masters
study, which identified a surface receptor of the neuronal pentraxin family as highly
expressed in small cell lung cancer. This receptor had previously been associated with
binding of taipoxin in neurons and neuroendocrine cells. The study involved evaluation of
the effect of taipoxin on small cell lung cancer cell survival and its correlation to neuronal
pentraxin expression. Taipoxin was found to specifically induce a cytotoxic response in
small cell lung cancer cell lines at concentrations leaving other control cells unaffected,
although the effects of taipoxin correlate poorly to neuronal pentraxin expression levels.
Part III: Studies of carcinogen induced pulmonary neuroendocrine hyperplasia
Hyperproliferation of pulmonary neuroendocrine cells is a general observation associated
with lung damage caused by inflammation or exposure to carcinogens. In this study, the
effect of exposure to two lung carcinogens on expression of the neuroendocrine marker
PGP9.5 in the lung was investigated. Interestingly, apart from inducing a general
pulmonary neuroendocrine cell hyperproliferation, naphthalene – one of the carcinogens
used – triggered the expression of PGP9.5 in the non-neuroendocrine epithelium in the
days immediately following exposure. The findings link to the recent observation, that
lungs of healthy smokers express elevated levels of PGP9.5 and suggest a functional role
for this protein in the repair of acute lung injury and possibly early lung carcinogenesis.
Appendices
The PhD-study also included the development of a Cre-loxP based strategy for promoter
cloning (Appendix 1). Furthermore, a book chapter comprising an overview of lung cancer
molecular biology for a clinical audience was composed (Appendix 2). Co-authorship
declarations for the enclosed manuscripts and papers are included in Appendix 3.
iv
Acknowledgements
During the experimental as well as the theoretical work of this PhD-study a number of
people have been involved to whom I would like to express my gratitude.
First of all I am thankful to Dr. Hans Skovgaard Poulsen, for giving me the opportunity to
perform my PhD-studies at the Department of Radiation Biology. Hans has provided
helpful inputs and the funding and facilities necessary for the projects success and
encouraged me to seek national and international collaborators during the proces.
A particular word of gratitude goes out to Nina Pedersen, my Project Supervisor, who
has been an endless source of useful ideas and suggestions and with whom I shared
numerous interesting discussions during the study.
Pia Pedersen, Lab technician at the Department of Radiation Biology provided me with
countless hours of technical assistance especially during the second part of this project,
for which I am truly grateful.
Dr. Ilona Linnoila gave me the opportunity to join her group at the Cell and Cancer
Biology Branch, Center for Cancer Research, NCI, NIH, Bethesda, Maryland, USA for a
period of six months. I am grateful to Dr. Linnoila and her staff – in particular Laboratory
Biologist Xu Naizhen – for introducing me to the world of pathology, immunostaining and
animal experiments.
Finally, the staff at the Department of Radiation provided inspiration and encouragement
during the entire process. A special thanks goes out to Marie Stockhausen and Camilla
Laulund Christensen for critical reading and useful suggestions during the final writing of
this thesis.
Copenhagen, February 2008
v
Table of Contents
Preface ........................................................................................................................................................... ii
Acknowledgements ..................................................................................................................................... iv
Table of Contents.......................................................................................................................................... v
Dansk Resumé ............................................................................................................................................. vi
English Summary........................................................................................................................................ vii
List of Abbreviations ................................................................................................................................. viii
Introduction ................................................................................................................................................... 1
The neuronal and neuroendocrine phenotype of SCLC........................................................................ 2
Mouse models for SCLC and NE-hyperplasia....................................................................................... 3
Gene Directed Enzyme Prodrug Therapy for systemic cancer treatment ............................................. 4
Part I: Development of a targeted gene therapy for SCLC ........................................................................ 7
Background........................................................................................................................................... 7
Manuscript I ........................................................................................................................................ 13
Perspectives and further studies......................................................................................................... 14
hASH1 regulated gene activity in vivo, discussion and preliminary data .................................. 47
Other therapeutic gene systems – discussion and preliminary data......................................... 50
Supplementary Materials and Methods .................................................................................... 54
Part II: Neuronal Pentraxins and SCLC sensitivity to taipoxin................................................................ 56
Background......................................................................................................................................... 56
Manuscript II ....................................................................................................................................... 59
Perspectives ....................................................................................................................................... 60
Part III: Carcinogen induced pulmonary neuroendocrine hyperplasia................................................... 72
Background......................................................................................................................................... 72
Manuscript III ...................................................................................................................................... 75
Perspectives ....................................................................................................................................... 96
Conclusion ................................................................................................................................................ 100
References................................................................................................................................................. 102
Appendix I: A Cre-loxP based strategy for cloning of mammalian promoters .................................... 107
Appendix Manuscript I ...................................................................................................................... 108
Appendix II: Book Chapter: Molecular Biology of Lung Cancer ........................................................... 116
Appendix Manuscript II ..................................................................................................................... 117
Appendix III: Declarations of Co-Authorship.......................................................................................... 133
vi
Dansk Resumé
Småcellet lungecancer (SCLC) er en særdeles ondartet kræftform, der er tæt associeret
til tobaksrygning. De eksisterende behandlingstilbud er utilstrækkelige, hvilket giver sig
udslag i en dårlig prognose og der er et stort behov for udvikling af nye systemiske
behandlinger. SCLC celler udtrykker et udvalg af neuroendokrine markører og enkelte af
disse er ikke udtrykt i de normale væv hos voksne. Mange af disse markører mistænkes at
spille en central rolle for transitionen af normal celle til SCLC – en proces, der langt fra er
kortlagt.
Det primære mål med dette PhD-studium har været at udvikle en transkriptionelt
reguleret genterapeutisk strategi til behandling af SCLC. Strategien går ud på at afprøve
regulatoriske regioner fra et eller flere gener, der er specifikt udtrykt i SCLC, som
aktivatorer af et cytotoksisk gen. Formålet er at opnå en regulering, der tillader at genet
kun aktiveres i SCLC cellerne og slår disse ihjel, mens kroppens normale væv forbliver
upåvirkede af behandlingen. Ved hjælp af Microarray-analyse af genekspressionsprofilen i
SCLC har vi identificeret et udvalg af gener med SCLC specifik ekspression og
regulatoriske regioner fra to af disse: Achaete-Scute Homolog 1 og Enhancer of Zeste
Homolog 2 viste sig at være særdeles aktive i SCLC celler. Derudover var et
fusionskontrukt bestående af udvalgte regulatoriske regioner fra begge disse gener i stand
til at inducere SCLC-specifik gen-ekspression og celledød.
Samme Microarray analyse viste højt og specifikt udtryk af den Neuronale Pentraxin
Receptor i SCLC. Neuronale Pentraxiner er tidligere blevet associeret med binding til
slangegift-toksinet taipoxin i neuroner og dette førte til undersøgelse af effekten af taipoxin
i SCLC-celler. Taipoxin viste sig at være cytotoksisk i SCLC ved koncentrationer, der ikke
var toksiske for en række kontrolceller.
Idet en øget forståelse for de neuroendokrine ændringer, der opstår i lungeepithelet efter
tobaksrøgseksponering formentlig vil kunne bidrage til at forklare ætiologien bag SCLC,
blev udtrykket af forskellige neuroendokrine markører undersøgt i lunger på mus
eksponeret for carcinogenet naphthalen, der findes i tobaksrøg. Ved hjælp af
immunhistokemi
og
kvantitativ
RT-PCR
detekteredes
en
midlertidig
stigning
i
ekspressionen af den neuroendokrine markør PGP9.5, efter naphthalen-behandling,
hvilket indikerer at dette protein har betydning for tidlig lungecarcinogenese.
vii
English Summary
Small cell lung cancer (SCLC) is a highly aggressive smoking-associated malignancy
with poor prognosis, provding an urgent need for the development of novel systemic
treatments.
SCLC
cells
exhibit
high
expression
of
numerous
developmental
neuroendocrine markers, some of which are absent or expressed at trace levels in adult
normal tissues. Many of these markers are suspected to play central roles in the
unresolved transition from normal cell to SCLC.
The primary focus of the current PhD-project has been to develop a novel
transcriptionally targeted gene therapy for SCLC-treatment. The strategy is based on the
use of regulatory regions from one or more SCLC specific gene(s) to drive the expression
of a cytotoxic suicide gene in order to specifically induce cell death in SCLC cells. By
Microarray profiling we identified SCLC specific genes with potential promoter candidates
for this purpose. In vitro studies confirmed that regulatory regions from the human Achaete
Scute Homolog 1 and Enhancer of Zeste Homolog 2 genes potently activate reporter and
therapeutic gene expression in SCLC cells. Furthermore, a chimeric construct comprising
regions from both promoters induces high gene expression exclusively in SCLC cells while
retaining specificity in control cells of different origin.
In a search for surface receptor candidates for targeting gene therapy to SCLC cells, the
Neuronal Pentraxin Receptor was identified. Because previous reports identified Neuronal
Pentraxins as binding partners for the snake venom neurotoxin taipoxin, the toxic effect of
taipoxin on SCLC cell survival was investigated. The neurotoxin was found to potently
induce cell death at nanomolar drug concentrations to which control cells remained
insensitive.
Finally, to gain insight into the neuroendocrine transitions in the lung epithelium occuring
during exposure to tobacco related carcinogens; expression of selected neuroendocrine
(and SCLC) markers was investigated in mice after exposure to the carcinogen
naphthalene. Further knowledge in this field could potentially aid the understanding of the
processes involved in lung carcinogenesis. On the basis of immunohistochemical and
quantitative RT-PCR studies, increased expression of the neuroendocrine marker Protein
Gene Product 9.5 (PGP9.5) was observed in the non-neuroendocrine pulmonary
epithelium, potentially pointing to a role for this protein in early lung carcinogenesis.
viii
List of Abbreviations
NCAM: Neural Cell Adhesion Molecule
5FC: 5-FluoroCytosine
NE: NeuroEndocrine
5FdUrd: 5-FluorodeoxyUridine
NEB: NeuroEndocrine Body
5FU: 5-FluoroUracil
NICD: Notch IntraCellular Domain
CGRP: Calcitonin Gene Releasing eptide
NP: Neuronal Pentraxin
D5W: 5% Dextrose in Water
NPR: Neuronal Pentraxin Receptor
dGTP: 2’-deoxyguanosine Triphosphate
NSAID: Non-Steroidal Anti-Inflammatory
DOTAP:Chol:
Drug
1,2-bis(Oleyloxy)-3-
(TrimethylAmmonio)Propane mixed with
NSCLC: Non-Small Cell Lung Cancer
Cholesterol
NSE: Neuron Specific Enolase
ECN: Notch ExtraCellular Domain
PGP9.5: Protein Gene Product 9.5
EZH2: Enhancer of Zeste Homolog 2
PLA2: Phospholipase A2
GCV: Ganciclovir
PNEC: Pulmonary NeuroEndocrine Cell
GCVMP: Ganciclovir MonoPhosphate
PRC: Polycomb Repressor Complex
GCVTP: Ganciclovir TriPhosphate
qPCR:
GDEPT: Gene Directed Enzyme Prodrug
Transcription Polymerase Chain Reaction
Therapy
Rb: Retinoblastoma
GFI-1: Growth Factor Independent-1
SCD: Super Cytosine Deaminase
GRP: Gastrin Releasing Peptide
SCLC: Small Cell Lung Cancer
hASH1: human Achaete-Scute Homolog1
TACE: TNF-α Converting Enzyme
HES-1: Hairy and Enhancer of Split-1
VGSC: Voltage Gated Sodium Channel
HSVTK: Herpes Simplex Virus Thymidine
YCD: Yeast Cytosine Deaminase
Kinase
YUPRT: Yeast Uracil PhosphoRibosyl
INR: Transcription Initiator
Transferase
MASH1:
Homolog 1
Mammalian
Achaete-Scute
Quantitative
Reverse
1
Introduction
Introduction
According to the latest estimates from the World Health Organisation, cancer is the
primary cause of 7,6 million deaths annually worldwide. The largest proportion of cancer
deaths (~17%) is due to lung malignanciesa, which are generally divided into Non-Small
Cell- and Small Cell Lung Cancer (NSCLC and SCLC respectively) on the basis of clinical
and histological appearance.
Of these, SCLC is the most malignant and the majority of SCLC-patients today are
diagnosed with disseminated advanced disease, requiring systemic treatment with
chemotherapy1.
While SCLC patients often respond well to the primary treatment, most of them ultimately
die from recurrent disease. Thus, in spite of decades of intensive efforts to improve
treatment, long-term survival remains almost exclusively confined to a subset of patients
with limited stage disease. The lack of curative treatment results in a dismal prognosis for
SCLC patients, of which less than 10% survive 5 years after diagnosis2. Consequently,
there is an urgent demand for development of novel treatments, which can supplement or
replace the existing modalities.
In recent years a number of novel molecular targeted cancer therapeutics have been
developed and treatments were designed to specifically target the molecular signaling
pathways, which underlie the malignant phenotypeb. Examples include signal transduction
inhibitors, which target oncogenic signaling, angiogenesis inhibitors that aim to inhibit
formation of tumor vasculature and drugs promoting apoptotic signaling. Many of these
targeted modalities have been tested in clinical studies for the treatment of SCLC, but
unfortunately results so far have been discouraging since no survival benefit but often
potent side effects of the molecular targeted treatments have been reported1.
There are many potential reasons for the poor results obtained using these novel
treatments for SCLC but one explanation may be that most of the strategies attempt to
repair or knock-out single molecular targets and that the cancer cells are capable of
a
According to the latest World Health Organisation cancer mortality rates from February 2006 available at:
http://www.who.int/mediacentre/factsheets/fs297/en/index.html
b
A book chapter on the molecular biology of lung cancer (both SCLC and NSCLC) providing a concise
overview of the molecules involved and status for derived targeted treatments is enclosed as Appendix II of
this thesis.
2
Introduction
successfully bypassing such one-hit strategies. Furthermore, the targeted treatments have
been focused on targeting systems frequently altered in cancer in general rather than
focusing specifically on pathways specifically altered in SCLC. As presented below, SCLC
cells exhibit numerous neuronal, embryonic and endocrine characteristics and one key to
a more successful SCLC treatment may be to directly target or utilize the SCLC phenotype
in the development of novel modalities.
The neuronal and neuroendocrine phenotype of SCLC
SCLC is classified as a neuroendocrine (NE) malignancy and the cancer cells are
characterized by the presence of dense core vesicles and expression of a number of NE
markers, neuropeptides and surface receptors including the Neural Cell Adhesion
Molecule (NCAM), L-amino acid decarboxylase, Chromogranin A, Gastrin Releasing
Peptide (GRP), Calcitonin (termed Calcitonin Gene Releasing Peptide (CGRP) in mice),
Neuron Specific Enolase (NSE), Synaptophysin and Protein Gene Product 9.5 (PGP9.5
alias ubiquitin carboxyl-terminal esterase L1, UCHL1)3, 4. Additionally, components of
neurotransmitter systems are found in SCLC cells such as actively signaling acetylcholine
receptors and sodium channels capable of inducing action potentials5-7.
During the latest decades accumulating information has been obtained about the genetic
program underlying the characteristic NE-phenotype of SCLC. However, the SCLC
precursor cell and premalignant lesions remain to be identified (the role of the NEphenotype in normal and injured non-malignant lung and SCLC will be further discussed in
Part III of this thesis).
A number of studies have identified the expression and reactivation of NE developmental
genes in SCLC, many of which play central roles in embryonic development, but are
otherwise inactive in the normal adult organism. One of the central developmental genes
highly upregulated in SCLC is Achaete-Scute Homolog 18 (hASH1, ASCL1 termed MASH1
in rodents). hASH1 is a basic helix-loop-helix transcription factor, normally involved in
establishment of the neural and NE phenotype during embryogenesis and studies of
mouse embryonic development revealed MASH1 as early and transiently expressed in
subpopulations of neural precursor cells in the rodent embryo9-11. The importance of
MASH1 in neuronal development is underlined by the fact that MASH1-knock out mice die
at birth, exhibiting extensive lack of sympathetic, parasympathetic and enteric neurons as
3
Introduction
well as a pronounced decrease of sensory neurons in the olfactory epithelium12. Basic
helix-loop-helix transcription factors are often expressed in a highly tissue specific manner
and become activated via heterodimerization with members of the widely expressed Eprotein family (including E2-2, E12 and E47, which are confirmed partners for hASH113, 14).
These heterodimers activate the transcription of target genes by recruiting transcriptional
co-activators and binding to specific DNA recognition motifs known as E-boxes.
Importantly, from a cancer therapeutic perspective high hASH1-expression is almost
exclusively confined to malignancies with NE expression profiles such as SCLC and the
childhood malignancy neuroblastoma. This is further illustrated by the observation that
variant SCLC cell lines, which are characterized by loss of NE-features are hASH1negative15-17. The high expression of hASH1 observed in vitro has been confirmed by
histological studies on tumor specimens, demonstrating hASH1-expression in the majority
of SCLC samples18. Interestingly, hASH1-expression was found to correlate with
expression of Chromogranin A, GRP and Calcitonin, but not with expression of the classic
marker NCAM suggesting that hASH1 may be associated with establishment and
maintenance of the endocrine phenotype rather than with NE-differentiation. Importantly, a
recent in vitro study demonstrated that siRNA-mediated knock out of hASH1-expression
induces growth arrest and induction of apoptotic markers in hASH1-positive SCLC and
NE-NSCLC cells and suppresses tumor growth of hASH1-positive cells in a xenograft
mouse model19. Importantly, hASH1-expression was also found to correlate with
decreased overall survival of SCLC patients18, suggesting that the hASH1-mediated
endocrine phenotype is important for the pathobiology of SCLC.
Mouse models for SCLC and NE-hyperplasia
To further study the role of hASH1 in carcinogenesis a transgenic mouse model has
been designed, in which hASH1 is constitutively expressed in non-NE airway epithelial
cells (under control of a promoter from the CC10-gene, which is constitutively active in
non-NE lung epithelial cells). These animals demonstrate progressive airway hyperplasia
and metaplasia20. The hASH1-expressing epithelial cells responsible for the hyperplastic
activity in this model stained negative for classic NE markers, such as CGRP and
synaptophysin, indicating (in support of observations by Jiang et al.18) that hASH1
expression alone is not sufficient for NE differentiation (at least in otherwise non-NE lung
4
Introduction
epithelial cells). A double transgenic mouse model constitutively expressing both hASH1
and SV40 Large T-antigen in non-NE lung epithelium demonstrates tumor formation with
NE characteristics20 bearing resemblance to human NSCLC with NE-features.
Important roles of SV40 Large T-antigen in carcinogenesis includes binding to and
inhibition of the tumor suppressors p53 and Rb21. Furthermore, loss of function of both p53
and Rb is identified in up to 90% of all SCLC tumors suggesting inactivation of these tumor
suppressors to be of major importance in SCLC pathogenesis22-24. To further investigate
their role in SCLC a mouse model with conditional knock out of Rb and p53 was recently
designed. Since murine embryos with homozygous knock-out of the Rb gene are not
viable25 a Cre-loxP based recombination strategy was applied where somatic inactivation
of the p53 and Rb genes (flanked by loxP-sites) is induced by adenoviruses carrying the
Cre-Recombinase
gene
administered
to the
animals
intratracheally after birth.
Interestingly, (albeit with a long latency time of no less than 200 days) a large proportion of
the mice develop tumors with close morphological and histological similarity to human
SCLC, including expression of MASH1 and NE-markers. Importantly, the metastatic
pattern in these mice closely resembles that of human SCLC (with metastatic lesions
observed in bone, brain, adrenal gland, ovary and liver) and the model has consequently
been termed murine SCLC26. Studies using this model may contribute to an increased
understanding of the development of SCLC including the identification of a distinct cell
type of origin.
Gene Directed Enzyme Prodrug Therapy for systemic cancer treatment
As previously mentioned, the far majority of SCLC patients are diagnosed with advanced
disease and novel treatments must therefore be optimized to penetrate and target distant
metastases. Gene Directed Enzyme Prodrug Therapy (GDEPT) or simply suicide gene
therapy constitutes a potential experimental cancer therapeutic strategy for systemic use.
GDEPT is based on the delivery of a therapeutic (suicide) gene encoding a catalytic
enzyme, which upon activation causes cell death by converting a non-toxic prodrug to a
cytotoxic analog (Figure 1). The GDEPT strategy holds several advantages compared to
conventional chemotherapy. While conventional regimes do not discriminate between
normal and malignant cells leading to deleterious and often dose limiting side effects,
GDEPT can be optimized to specifically target the cancer cells. As will be discussed in
5
Introduction
Parts I and II of this thesis, targeted GDEPT can be accomplished at different levels – for
instance by introducing a ligand in the delivery vector, which specifically binds to cell
surface receptors highly upregulated on the cancer cells (Figure 1)27, 28. Another approach
is to target expression of the suicide gene to the cancer cells by placing it under the control
of a regulatory promoter region, which is highly and specifically activated in the cancer
cells of interest – a strategy often referred to as transcriptional targeting. This method is
further explored in Part I of this thesis, where the development of a novel transcriptionally
targeted GDEPT for SCLC is presented.
Apart from GDEPT, other gene therapeutic strategies have been developed and tested
for treatment of lung cancer. These include re-introduction gene therapy where a
functional tumor suppressor is re-introduced into the cancer cells, or oncolytic viruses,
Figure 1: The principle of GDEPT/suicide gene therapy.
The therapeutic DNA is packaged into a delivery vector, which can be of viral or non-viral origin and fused to ligand for
increased cancer cell targeting. The vector delivers the gene to the target cell and internalizes by either direct fusion (1a)
or endocytosis (1b). Once internalized and released into the cytoplasm, the therapeutic gene is delivered to the nucleus
where it is transcribed (2). The resulting therapeutic enzyme catalyzes the conversion of systemically administered nontoxic prodrug into a cytotoxic analog (3), resulting in cell death (4). Illustration modified from and courtesy of Peter
Andersen, Department of Radiation Biology.
6
Introduction
designed to specifically replicate exclusively in the cancer cells. While some of these
strategies have reached clinical trials for treatment of NSCLC29 their success are mainly
limited by insufficient efficacy of repeated treatments. As discussed in Manuscript I only
few preclinical studies of gene therapy targeting SCLC have been reported and none have
proceeded to clinical trials.
7
Part I: Development of a targeted gene therapy for SCLC
Part I: Development of a targeted gene therapy for SCLC
As previously mentioned it is imperative for cancer gene therapy, that the treatment is
targeted to the cancer cells to avoid non-specific toxicity. One targeting strategy involves
tight regulation of gene expression at the transcriptional level, by introduction of a highly
active cancer specific regulatory promoter element. In the current part of this PhD-thesis,
studies involving the identification and evaluation of novel SCLC-specific promoter regions
for gene therapy are presented.
Background
In order to identify novel SCLC specific promoter regions, data from a global microarray
analysis of gene expression comprising a large panel of SCLC cell lines, xenografts and
18 representative normal tissues were analyzed for genes upregulated in SCLC17. To
account for in vitro artifacts due to cell culture, data from a similar study on SCLC patient
tumors was included in the profile30. The microarray analysis identified a number of genes
(many of which are related to neuroembryonic development) as highly and specifically
activated in SCLC with low or absent expression in normal adult tissues and a subset of
these may potentially be upregulated by a cancer specific promoter. However, cellular
gene expression can be upregulated in a number of ways, some of which are promoter900
10000
9000
700
8000
500
400
300
200
100
7000
6000
CLASSIC
VARIANT
GLC 2
GLC 3
GLC 3 Xeno
DMS 114
DMS 273
DMS 273 Xeno
NCI 417
NCI 417 Xeno
MAR H24
MAR H24 Xeno
MAR 86MI
600
CPH 136A
GLC 14
GLC 14 Xeno
GLC 16
GLC 19
GLC 26
GLC 28
DMS 53
DMS 79
DMS 92
DMS 153
DMS 406
DMS 456
NCI H69
NCI H69 Xeno
Microarray signal
5000
4000
3000
2000
1000
0
0
RT-PCR
Fetal brain
Brain
Adrenal gland
Colon
Heart
Kidney
Liver
Lung
Pancreas
Prostate
Salivary gland
Skeletal muscle
Small intestine
Spleen
Stomach
Testes
Thyroid
Trachea
CPH 54A
CPH 54A Xeno
CPH 54B
CPH 136A Xeno
GLC 2
GLC 3
GLC 3 Xeno
GLC 14
GLC 14 Xeno
GLC 16
GLC 19
GLC 26
GLC 28
DMS 53
DMS 79
DMS 92
DMS 114
DMS 153
DMS 273
DMS 273 Xeno
DMS 406
DMS 456
H69
H69 Xeno
NCI 417
NCI 417 Xeno
MAR H24
MAR H24 Xeno
MAR 86H
SCLC tumor 1
SCLC tumor 2
SCLC tumor 3
SCLC tumor 4
SCLC tumor 5
SCLC tumor 6
Fetal Brain
Brain
Adrenal Gland
Large Intestine
Heart
Kidney
Liver
Lung
Pancreas
Prostate
Salivary Gland
Skeletal
Small Intestine
Spleen
Stomach
Testes
Thyroid Gland
Trachea
RT-PCR
NORMAL TISSUES
SCLC CELL LINES AND XENOGRAFTS
TUMORS
NORMAL TISSUES
SCLC CELL LINES AND XENOGRAFTS
SCLC tumor 1
SCLC tumor 2
SCLC tumor 3
SCLC tumor 4
SCLC tumor 5
SCLC tumor 6
Microarray signal
800
TUMORS
Figure 2: RT-PCR validated expression of EZH2 and hASH1 mRNA in SCLC and normal tissues
The normalized microarray data for EZH2 (left graph) and hASH1 (right graph) transcripts were validated by semiquantitative RT-PCR. EZH2-mRNA is highly expressed in all SCLC cell lines and derived xenografts, while expression
could only be detected in testes in of all adult normal tissues. Expression of hASH1-mRNA is high in all SCLC tumors
and all classic SCLC cell lines. In contrast, variant SCLC cell lines have lost expression of hASH1 transcript as
discussed in detail in Manuscript I. Of the adult normal tissues low expression of hASH1-mRNA is observed only in
17, 30
.
brain. Microarray data for cell lines/xenografts and patient tumors are adapted from
8
Part I: Development of a targeted gene therapy for SCLC
independent. Promoter-independent mechanisms of gene activation include gene
amplification, hypo- or hypermethylation and deletion of silencing domains or amplification
of activating chromosomal regions. Therefore, to pinpoint genes from the profile, which are
transcriptionally upregulated, literature studies were performed to exclude genes known to
be upregulated by promoter-independent mechanisms. The combination of microarray
analysis and literature search identified the hASH1 and Enhancer of Zeste Homolog 2
(EZH2) genes (among others) as specifically highly active in SCLC compared to normal
tissues (Figure 2) seemingly due to increased transcriptional activity. Interestingly, as
shown in the left panel of Figure 2 only SCLC cell lines classified as classic express
hASH1 transcript, while cell lines of the variant SCLC phenotype are hASH1-negativec. All
6 of 6 SCLC patient tumors express high levels of both EZH2 and hASH1-mRNA.
The hASH1-gene and upstream promoter region has been characterized for its activity in
SCLC cells and in hASH1-negative cells of non-NE origin32 and the gene structure and its
transcriptional regulatory regions are schematically depicted in Figure 3. The gene is
comprised of two exons spanned by a 357bp intron. Of these, exon 1 contains the entire
protein coding sequence, whereas the downstream located exon 2 comprises a 3’untranslated transcript. Promoter studies demonstrated that transcription of hASH1 is
controlled by a number of upstream regulatory regions and the high hASH1-mRNA levels
observed in SCLC have been found (by in vitro transcriptional assays) to depend on high
transcriptional gene activity, rather than on stabilization of hASH1-mRNA. Two
transcription start sites were identified: one site corresponding to a TATA box 516bp
upstream of a dominant transcription initiator (INR) sequence (Figure 3). In addition a
generally active enhancer element (which activates gene expression in both hASH1positive and negative cells) was identified, positioned between -234 and –46 relative to
INR. In contrast to the activating sequences, two repressor regions specifically inactive in
NE-cancer cells were identified, located in the proximal (between positions -308 and -234)
and distal (between positions -15.900 and -13.500) 5’-flanking region.
c
The variant classification of SCLC was originally introduced two decades ago, when it was observed that a
number of SCLC derived cell lines lost expression of certain NE-characteristics and proliferated more
15, 31
. However, the evidence that variant SCLC cell lines represent a cell type present in patient
rapidly
tumors is scarce and today variant SCLC cell lines are generally thought to arise from classic SCLC tumor
cells which have lost classic SCLC traits in the process of in vitro culture.
9
Part I: Development of a targeted gene therapy for SCLC
Figure 3: hASH1 gene structure and upstream regulatory regions
The hASH1 gene comprises two exons of which Exon 1 contains the protein coding sequence. Upstream regulatory
elements include a proximal and a distal repressor sequence and a proximal general enhancer sequence. The repressor
sequences down regulate hASH1-gene expression in hASH1-negative cells, while lack of repressive transcription factors
32
in hASH1-positive cells (such as SCLC) allows for potent gene activation mediated by the general enhancer sequence .
Central factors involved in inhibition of hASH1-transcription include members of the
Notch signaling pathway. Notch signaling is a key regulator of hASH1 expression during
NE differentiation in the brain and lungs33 and an overview of the Notch activation pathway
is presented in Figure 4. Notch receptors (four of which have been identified termed
Notch1-4) are heterodimeric single pass membrane bound proteins, which are activated by
membrane bound ligands positioned on adjacent cells (5 Notch ligands have been
identified: Jagged1 and 2 and Delta-like 1, 3 and 4). Interaction with ligand triggers two
successive cleavage reactions: First TNF-α-converting-enzyme (TACE) catalyzes the
release of the Notch extracellular domain (ECN) from the membrane. Subsequently, a
multiprotein complex with γ-secretase activity mediates a secondary internal cleavage,
resulting in cytoplasmic release of the Notch intracellular domain (NICD), which transports
itself to the nucleus (Figure 4). In the nucleus, NICD associates with co-transcription
factors, resulting in the displacement of transcriptional repressors, and recruitment of
transcriptional activators mediating transcription of Notch target genes. Notch1, the most
intensively studied Notch-receptor, is known to activate expression of transcription factors
of the Hairy and Enhancer of Split (HES) family (comprising 7 members designated (HES1 to 7). HES-1 has been found to inhibit hASH1-expression via binding to a specific (Class
C) recognition sequence (CAGNAG/CANNTG) in the proximal hASH1 promoter34 (Figure
3). When SCLC cells are transfected with NICD, cell cycle arrest and morphological
changes are observed (suspension cell lines turn adherent and vice versa) in concert with
10
Part I: Development of a targeted gene therapy for SCLC
a decrease in hASH1 levels due to
inhibited
transcription
and
protein
degradation. Introduction of constitutive
HES-1 expression in the same cells leads
to downregulation of hASH1-mRNA, but
the effect is more moderate than that
observed
after
suggesting
that
Notch1
Notch1
hASH1-downregulation
expression
can
in
mediate
a
HES1
independent manner which awaits further
elucidation (? in Figure 4)35, 36.
To date no examples of hASH1-gene
amplification or rearrangement have been
Figure 4: Notch-receptor activation by ligand binding
For further explanation – see text.
reported in SCLC and the high expression
of hASH1 mRNA in SCLC (reported to comprise 16% of the total pool of cDNA’s
sequenced from a SCLC library33) illustrates the high transcriptional activity of the hASH1
gene in SCLC and yields promise for the development of a hASH1-promoter regulated
gene therapeutic strategy.
EZH2 belongs to the polycomb group of genes, the products of which provide the
building blocks for two multimeric Polycomb Repressor Complexes (PRC1 and 2), which
interact with and modify core histones, thereby regulating the expression of a number of
embryonic genes and promoting cell proliferation. The EZH2 protein functions as the
catalytical histone-methylating component of PRC2, catalyzing the methylation of lysine 9
and 27 on histone H3 resulting in transcriptional repression37, 38. EZH2-gene expression is
up-regulated by E2F-transcription factors39,
40
. Members of the Retinoblastoma (Rb)
protein family serve as binding partners and inhibitors of E2Fsd, thereby causing
transcriptional inactivation of a number of genes associated with cell proliferation41.
Characterization of the EZH2 upstream regulatory promoter region has been performed
and sequence analysis and reporter gene assays revealed the presence of four E2F
binding sites positioned ~400bp upstream of the transcription start site in a 1,1kb promoter
d
The Rb-signaling pathway and its effect on E2F-transcription factors is further discussed and schematically
depicted in Figure 3.5 of the Book Chapter on Molecular Biology in Lung Cance enclosed as Appendix II of
this thesis
11
Part I: Development of a targeted gene therapy for SCLC
construct42. In a reporter gene assay, the 1,1kb EZH2-promoter was highly activated upon
co-transfection with E2F1, while a truncated 0,2kb EZH2-promoter lacking the E2F-binding
sites was unresponsive to ectopic E2F1 expression. Interestingly, in quiescent cells, the
E2F-binding sites appear to be important inhibitors of EZH2-gene expression, since the
truncated 0,2kb EZH2-promoter lacking E2F binding sites demonstrated 20 fold higher
activity in non-dividing cells than the 1,1kb promoter42.
These
results
might
reflect
the
importance of active Rb signaling in
inhibiting the cell proliferative role of
EZH2 in non-dividing cells although this
has not been fully elucidated. In the same
study, the amplification of the EZH2 gene
in a number of human cancers was
evaluated by FISH analysis. EZH2-gene
amplification was observed in a subset of
tumors (15% of 225 analyzed tumors),
and
therefore
multiple
gene
copies
cannot be ruled out as a promoting factor
for
EZH2-expression
although
amplification seems to be restricted to a
minority
of
tumors.
Since
Rb
is
universally inactivated in all SCLC43-45,
while members of the E2F family are
highly expressed46, 47, the EZH2-promoter
could be a promising transcriptional
regulator
Figure 5: Cellular activation of GCV by HSVTK
GCV is freely diffusible across cell membranes. HSVTK
catalyzes the phosphorylation of GCV to GCV-mono
phosphate (GCVMP), which can be further phosphorylated by
cellular kinases into GCV-tri phosphate (GCVTP). GCVTP
directly competes with the nucleotide dGTP for incorporation
into the elongating DNA strand resulting in aberrant replication
and ultimately cell death.
Illustration courtesy of Camilla Laulund Christensen,
Department of Radiation Biology.
for
gene
therapy
in
this
malignancy.
While the promoter is an important
regulatory
mediator
of
therapy, the choice of
cancer
gene
an effective
therapeutic gene and prodrug is equally
important for GDEPT-success. One of the
12
Part I: Development of a targeted gene therapy for SCLC
most elaborately studied suicide gene/prodrug systems for cancer gene therapy to date is
the Herpes Simplex Virus Thymidine Kinase (HSVTK) gene in combination with the
prodrug Ganciclovir (GCV) which was introduced more than two decades ago48. Upon
delivery of the HSVTK gene to the cancer cells, GCV is administered and freely diffuses
across the cell membrane. Once synthesized, the HSVTK-enzyme can phosphorylate
GCV into a monophosphate analog (GCVMP). Mammalian kinases can further
phosphorylate GCVMP to yield GCV-triphosphate (GCVTP) (Figure 5), which can be
incorporated into the DNA during replication, serving as a direct competitor for the
endogenous purine nucleotide 2’-deoxyguanosine-triphosphate (dGTP). However, in
contrast to dGTP, GCV-TP is a poor substrate for successive DNA replication resulting in
DNA chain termination49 and ultimately cell death.
As presented in the following manuscript, regions of the hASH1 and EZH2 promoters
have been evaluated alone and in combination as regulators of reporter and HSVTKsuicide gene activation in SCLC and control cells.
13
Part I: Development of a targeted gene therapy for SCLC
Manuscript I
A chimeric fusion of the hASH1 and EZH2 promoters mediates high and
specific reporter and suicide gene expression and cytotoxicity in small
cell lung cancer cells
Authors:
Thomas T. Poulsen, Nina Pedersen and Hans S. Poulsen
Manuscript in press in Cancer Gene Therapy, 2008
Author Contributions:
Thomas T. Poulsen: All experimental work and design (excluding EZH2-reporter and
suicide gene assay); preparation of manuscript
Nina Pedersen: Supervision; EZH2 reporter and suicide gene assay; manuscript revision
Hans S. Poulsen: Supervision; manuscript revision
14
Part I: Development of a targeted gene therapy for SCLC
15
Part I: Development of a targeted gene therapy for SCLC
16
Part I: Development of a targeted gene therapy for SCLC
17
Part I: Development of a targeted gene therapy for SCLC
18
Part I: Development of a targeted gene therapy for SCLC
19
Part I: Development of a targeted gene therapy for SCLC
20
Part I: Development of a targeted gene therapy for SCLC
21
Part I: Development of a targeted gene therapy for SCLC
22
Part I: Development of a targeted gene therapy for SCLC
23
Part I: Development of a targeted gene therapy for SCLC
24
Part I: Development of a targeted gene therapy for SCLC
25
Part I: Development of a targeted gene therapy for SCLC
26
Part I: Development of a targeted gene therapy for SCLC
27
Part I: Development of a targeted gene therapy for SCLC
28
Part I: Development of a targeted gene therapy for SCLC
29
Part I: Development of a targeted gene therapy for SCLC
30
Part I: Development of a targeted gene therapy for SCLC
31
Part I: Development of a targeted gene therapy for SCLC
32
Part I: Development of a targeted gene therapy for SCLC
33
Part I: Development of a targeted gene therapy for SCLC
34
Part I: Development of a targeted gene therapy for SCLC
35
Part I: Development of a targeted gene therapy for SCLC
36
Part I: Development of a targeted gene therapy for SCLC
37
Part I: Development of a targeted gene therapy for SCLC
38
Part I: Development of a targeted gene therapy for SCLC
39
Part I: Development of a targeted gene therapy for SCLC
40
Part I: Development of a targeted gene therapy for SCLC
41
Part I: Development of a targeted gene therapy for SCLC
42
Part I: Development of a targeted gene therapy for SCLC
43
Part I: Development of a targeted gene therapy for SCLC
44
Part I: Development of a targeted gene therapy for SCLC
45
Part I: Development of a targeted gene therapy for SCLC
46
Part I: Development of a targeted gene therapy for SCLC
Perspectives and further studies
As described, we have evaluated fragments of the hASH1 and EZH2 promoter alone and
in combination for regulation of GDEPT in SCLC cells. The data suggest that hASH1 and
hASH1EZH2-regulated gene therapy sufficiently restricts potent gene activation (and
cytotoxicity) specifically to SCLC cells. However, the promising in vitro data prompts
further investigations in animal models for evaluation of certain essential endpoints. First of
all, due to the harmful potential of the HSVTK-GCV system to exert a general toxicity, it is
vital that the specificity of the promoter constructs is carefully assessed and expression
confirmed to be low/absent in normal tissues. Secondly, it is important that the system is
functional after systemic gene delivery via the bloodstream in a setup that mimics a patient
therapeutic setting. For systemic delivery the DNA must be packaged in a vector to avoid
its degradation, since naked DNA has a short half-life in the bloodstream. Effective cancer
gene therapy thus depends on effective delivery of the therapeutic gene to the target cells,
but the development of a highly effective, specific and non-toxic gene delivery vector
system has proven a major obstacle.
For both local and systemic gene delivery a variety of viral and non-viral vector systems
have emerged27, 50, 51. Viral delivery systems are based on the innate ability of viruses to
effectively deliver exogenous genetic material to mammalian cells. The most frequently
used viral vectors are derived from retro- or adenoviruses, which have reached Phase I/II
clinical trials for the treatment of different malignancies including NSCLC29. While
antitumor effects have been observed in these studies demonstrating proof-of-principle for
cancer gene therapy, a major limiting factor for viral gene delivery is host immune
response against the vector. Reactions with components of the complement system and
the generation of vector specific antibodies generated against viral proteins (either due to
previous exposure to a related virus or generation of new antibodies against the vector)
results in vector neutralization and elimination which limits DNA-delivery52,
53
. Another
problem with viral vectors is that they often show preference for certain normal tissue sites
reflecting the natural tropism of the virus. For instance, adenoviral vector systems of the
Ad5 serotype (the predominant serotype used for adenoviral gene therapy vectors) tend to
home to the liver54. A final important problem with retroviral vectors in particular, is that
these vectors integrate their DNA stably into the genome at random sites. In normal cells
47
Part I: Development of a targeted gene therapy for SCLC
this poses a latent risk of interference with cell signaling in a growth promoting manner, for
instance by integrating into (and knocking out) tumor suppressor components and thereby
promoting a secondary treatment induced cancer.
Due to these limitations increasing efforts have been made to develop non-viral gene
delivery vectors. Of the different strategies developed to date, liposome based systems
have shown increasing promise although further development is clearly necessary before
these systems can be of practical use in a clinical setting. Major advantages of non-viral
vectors include their low immunogenicity and the possibility to design and optimize the
vector to avoid unspecific absorption to normal tissues and to target the cancer cells, for
instance by introducing a ligand or a surface receptor targeting antibody in the vector
system. In contrast, major drawbacks of the non-viral strategies include general toxicity of
the vector-DNA complexes and low levels of gene transfer due to insufficient release from
endosomes after uptake of the vector into the cells (resulting in lysosomal degradation)
and incomplete DNA delivery to the nucleus51.
hASH1 regulated gene activity in vivo, discussion and preliminary data
Aiming to further elucidate the specificity of the hASH1-promoter in vivo initial preliminary
gene delivery and expression studies were performed in mice. For this purpose the nonviral lipid based delivery vector extruded 1,2-bis(Oleyloxy)-3-(TrimethylAmmonio)Propane
mixed with Cholesterol (DOTAP:Chol) was used. When mixed with DNA, the liposome
particles form complexes between 200-450nm in size, which have been shown to
effectively deliver DNA systemically to
tumors in mice. In the absence of DNA,
the liposome particles form “vase like”
structures with a cationic surface. Upon
mixing with the negatively charged DNA,
the
liposomes
structure,
form
thereby
a
bilammellar
invaginating
and
completely encapsulating the DNA (as
shown in Figure 6). The resulting neutral
Figure 6: Packaging of DNA into DOTAP:Chol liposome
The positively charged vase like DOTAP:Chol liposomes
invaginate and encapsulate the anionic DNA forming
55
bilammellar structures. Illustration from .
liposome-DNA
complex
efficiently
protects the DNA from systemic and
48
Part I: Development of a targeted gene therapy for SCLC
enzymatic degradation55. The DOTAP:Chol delivery vector has been demonstrated to
effectively deliver CMV-promoter regulated reporter- and tumor suppressor genes in vivo
to xenotransplanted NSCLC tumors and experimentally disseminated metastases after
local (intratumoral) and systemic (tail vein) injection respectively. These studies
demonstrated significant tumor suppression after single and repeated treatments resulting
in prolonged survival of the treated animals56,
57
. Further studies with a reporter gene
activated by a promoter region derived from the survivin gene demonstrated NSCLC
specific reporter activity in vitro and in vivo using DOTAP:Chol particles for delivery58.
Although DOTAP:Chol based delivery has been reported to exert a dose dependent
inflammatory response in immunocompetent mice, the toxicity can be effectively minimized
by co-administration of a non-steroidal anti inflammatory drug (NSAID) and systemic
DOTAP:Chol based gene therapy is currently in clinical Phase I trial for patients with
NSCLC59, 60.
Functional studies using a fluorescently labeled vector have shown that DOTAP:Cholcomplexed DNA has a preference for tumor cells residing in the lung compared to adjacent
normal lung tissue and that the cellular uptake may be mediated by phago or pinocytosis61
although the exact uptake mechanism remains to be fully elucidated.
In collaboration with Senior Investigator, Dr. Ilona Linnoila, Cell and Cancer Biology
Branch, National Cancer Institute, National Institutes of Health, Bethesda, Maryland, USA,
initial evaluations of hASH1 promoter-specificity in vivo after DOTAP:Chol-based delivery
were performede. These studies were performed prior to the in vitro finding that the
hASH1EZH2 chimeric construct is potentially more active than 0,7hASH1 alone while fully
retaining SCLC specificity and therefore the chimeric construct has not yet been evaluated
for specificity after systemic administration in mice.
The animals received one tail vein injection per day for three successive days of either
0,7hASH1-promoter- (0,7hASH1-LUC) or CMV-promoter- (CMV-LUC) luciferase (-LUC)
DNA packaged in DOTAP:Chol. Three hours prior to each DNA injection, the NSAID
Naproxen was administered to limit the inflammatory response. 48 hours after the last
DNA injection, the luciferase activity was assessed using whole body imaging after
intravenous injection of the luciferase substrate Luciferin. Results of a representative
e
For a more detailed description of the experimental setups in this section– see Supplementary Materials &
Methods at the end of Part I
49
Part I: Development of a targeted gene therapy for SCLC
Figure 7: Expression of 0,7hASH1 vs. CMV-promoter regulated luciferase in vivo after systemic administration
The results show luciferase expression levels quantified by whole body imaging and RT-PCR after once daily treatment
with 0,7hASH1-LUC or CMV-LUC construct for three days. Results shown in A demonstrate expression from the chest
region of the mouse treated with CMV-LUC (right picture), while no expression could be detected in the mouse treated
2
2
with 0,7hASH1-LUC. The unit of quantification is photons/second/cm (p/sec/cm ). B: Imaging of selected organs
dissected from the mice in A, demonstrating expression only in the lungs of the CMV-LUC treated mouse. C: Expression
levels of luciferase transcript (LUC) by RT-PCR in total RNA preparations from the mice in A. A mouse treated with DNAfree DOTAP:Chol and RT-PCR without RNA (WATER) was used as negative control. A RT-reaction without Reverse
Transcriptase (LUC no RT) was used as a negative control for plasmid contamination of the RNA-extracts. RT-PCR for
Actin was used as loading control. The presence of plasmid DNA was confirmed by PCR (LUC DNA) in all DNA treated
tissues using CMV-LUC plasmid as a positive control (POS.CONTROL).
experiment are shown in Figure 7A and B. As shown, luciferase expression is detected in
the lung from mice treated with CMV-LUC by whole body imaging, while no signal can be
detected in animals treated with 0,7hASH1-LUC or empty vector (data not shown). To
further confirm these results, luciferase expression was measured by semi-quantitative
RT-PCR performed on RNA extracted from lung, heart and brain of hASH1-LUC and
CMV-LUC treated animals using primers specific for luciferase transcript. As shown in
Figure 7C Luciferase transcript was only detected in lung from CMV-LUC treated micef.
The observed reporter gene expression in lungs of CMV-LUC treated animals, suggests
that the administered DNA is efficiently delivered to the lung in vivo, while the failure to
detect transcript in organs from 0,7hASH1-LUC treated mice suggests that the 0,7hASH1-
f
The signal observed near the right hind leg of the CMV-LUC treated mouse (Figure 7A, right panel) was
only detected in this mouse and was not found in subsequent experiments. The explanation for the signal in
this particular mouse is unknown and has not been investigated further.
50
Part I: Development of a targeted gene therapy for SCLC
promoter is inactive in the tested organs. However, it cannot be ruled out that the lack of
expression in the selected organs after 0,7hASH1-LUC delivery could be due to
incomplete delivery rather than promoter specificity. To investigate this further, PCR was
performed to detect the presence of expression vector-DNA in DNA-preparations from the
three organs of 0,7hASH1- and CMV-LUC treated mice and results are shown in the
bottom panel of Figure 7C. Plasmid DNA is detected in DNA extracted from all three
organs in both CMV-LUC and hASH1-LUC treated animals. This crude PCR-based
approach fails to discriminate between DNA in the blood and cells of the target organ, but
the results show that the 0,7hASH1-LUC DNA is distributed in a manner similar to CMVLUC after systemic injection, strongly suggesting that the delivery system is functional for
both vectors. In summary, the preliminary results indicate that DOTAP:Chol-packaged
reporter gene is systemically delivered after injection and that expression is efficiently
silenced in normal tissues using the 0,7hASH1-promoter element. Further studies, such as
demonstration of 0,7hASH1-LUC plasmid DNA in lung by in situ hybridization, could
further support this conclusion.
Importantly, the effect of the 0,7hASH1-promoter must be evaluated in a therapeutic
system for instance in mice bearing subcutaneous SCLC xenografts or using the murine
SCLC model previously discussed26. Even though no luciferase expression from the
0,7hASH1-promoter was detected in lung and heart (the two primary normal target tissues
for DOTAP:Chol-based gene therapy55), delivery of a suicide gene to these tissues or
potentially other organs might result in non-specific toxicity due to background expression
from the promoter construct. For instance (as discussed in detail in Part III of this thesis),
the lungs contain a very rare subset of NE cells, which stain positive for hASH1-expression
and the effect of systemic hASH1-promoter regulated GDEPT on these cells remains to be
investigated. Furthermore, although in vitro studies on cell lines show a cytotoxic effect on
SCLC cells, it is unknown whether the 0,7hASH1 construct is sufficiently active to induce
tumor regression using the presently available delivery systems. Finally, the specificity and
activity of the chimeric hASH1EZH2 promoter construct remains to be evaluated in vivo.
Other therapeutic gene systems – discussion and preliminary data
Apart from optimizing the promoter region regulating the therapeutic gene, it is likely that
the therapeutic gene system used can also be improved to sensitize SCLC cells, since
51
Part I: Development of a targeted gene therapy for SCLC
cancers of different origin may exhibit considerable differences in sensitivity to different
therapeutic gene systems. The purpose of a recent Masters study at the Department of
Radiation Biology was to evaluate the sensitivity of SCLC cells to different tumor
suppressor genes, inhibitors of oncogenes and GDEPT-systems62, 63. The results from this
study showed that four tumor suppressor genes: p53, Rb, FHIT and FUS1 all proved
inefficient in inducing SCLC-cytotoxicity in vitro. Furthermore, introduction of genes
encoding inhibitors of the antiapoptotic Bcl-2-protein and members of the HSP70 family
(which play a cytoprotective role in a wide number of malignancies inducing stabilization of
oncogenic proteins and antiapoptotic signaling64) failed to induce SCLC cytotoxicity
although downstream cellular death pathways were activated after transfection. While
insufficient transfection efficiencies may partly explain the discouraging outcome of these
studies it is possible (as previously discussed in the Introduction to this thesis) that the
results reflect an important drawback of single-target gene therapy strategies for cancer
treatment. In the transition from normal to malignant cells, the cancer cells have adapted
to bypass complex systems of growth regulatory signaling and since many of these
systems overlap, it is likely that the cell can survive the targeting of single components in
this network. For instance, both FUS1 and FHIT have been demonstrated to activate p53
signaling in NSCLC cells. The genes were found to downregulate or bind to and inactivate
the p53-inhibitory ubiquitin ligase MDM2 resulting in p53 stabilization and induction of
NSCLC cytotoxicity when p53 and FUS1 or FHIT genes are introduced in combination65, 66.
However, since SCLC cells are insensitive to p53 re-introduction, it is likely that the
inefficiency of FUS1 and FHIT gene therapy in SCLC can be ascribed to the mechanisms
underlying the poor effect of p53 alone.
Conversely, as briefly mentioned in Manuscript I and previously described by others35, an
anti-proliferative effect of full length Notch1 and NICD-transfection was observed in SCLC
cells, suggesting Notch1 as a cytotoxic gene candidate for SCLC gene therapy. The
potential for Notch1 as therapeutic gene is further supported by the observation that
hASH1 knock-out induces apoptosis and inhibits proliferation of SCLC cells in culture and
tumor growth in vivo19.
While the introduction of tumor suppressors and oncogene inhibiting genes proved
inefficient for SCLC gene therapeutic purposes, a GDEPT strategy based on the dual
introduction of Yeast Cytosine Deaminase (YCD) and Yeast Uracil PhosphoRibosyl
52
Part I: Development of a targeted gene therapy for SCLC
Transferase (YUPRT) in a combined enzymatic gene construct termed Super CD (SCD)
was found to effectively sensitize SCLC cells to the prodrug 5FluoroCytosine (5FC)62,
63
.
5FC is a fluor-conjugated analog of cytosine, which can be systemically administered and
is non-toxic on its own due to the lack of the CD enzyme in mammalian cells. As shown in
Figure 8, YCD converts 5FC to 5FluoroUracil (5FU), which exerts toxicity to the cell at
different levels. 5FU is sequentially phosphorylated to 5FUMP and 5FUTP, which can
incorporate into the synthesized RNA-string during transcription resulting in inhibition of
protein translation. Additionally, cellular enzymes can convert 5FU to 5FluorodeoxyUridine
(5FdUrd), which can be sequentially phosphorylated to 5FdUMP and 5FdUTP. 5FdUMP
directly inhibits thymidylate synthase, which is responsible for the intracellular synthesis of
dTMP – a precursor for the dTTP used for incorporation into DNA during replication67. The
resulting lack of dTTP directly inhibits DNA-replication and 5FdUTP is incorporated into the
elongating DNA-string resulting in cell death (Figure 8). 5FU has long been used clinically
for the treatment of various gastrointestinal cancers and malignancies of the head and
neck. However, many cancers are insensitive to 5FU treatment and a major factor in this
resistance is the rate limiting conversion of 5FU to 5FUMP. The introduction of YUPRT
allows for direct conversion of 5FU to 5FUMP, resulting in a more efficient production of
toxic metabolites, and introduction of YUPRT has been demonstrated to induce a
significant increase in 5FC sensitivity in vivo in a rat hepatoma model68. To summarize, the
overall cellular effect of activation of the SCD-5FC system is inhibition of both RNA and
DNA synthesis which is advantageous compared to other GDEPT systems, such as
HSVTK-GCV, which only targets DNA-replication and thus depends on active target cell
division and DNA-synthesis.
To date, the hASH1 and hASH1EZH2 promoters have only been tested using the
HSVTK-GCV system, but a different promoter from the INSM1 gene, which was previously
shown to be highly and specifically active in SCLC69, potently induces cell death in the
SCD-5FC system compared to the unspecific SV40-promoter62, 63. In contrast, the effects
of the INSM1 and SV40 promoters were similar using the HSVTK-GCV system even
though reporter gene assays showed higher activity from the INSM1 than the SV40promoter. These results indicate that the SCD-5FC system may be a more potent GDEPTstrategy than HSVTK-GCV for treating SCLC.
53
Part I: Development of a targeted gene therapy for SCLC
Symbol
5-FC
5-FU
5-FdUMP
5-FdUDP
5-FdUTP
5-FUMP
5-FUDP
5-FUTP
5-FUrd
5-FdUrd
dUMP
dUTP
dTMP
dTTP
Chemical name
5’-fluorocytosine
5’-fluorouracil
5’-fluoro-2’-deoxyuridine-5’monophosphate
5’-fluoro-2’-deoxyuridine-5’diphosphate
5’-fluoro-2’-deoxyuridine-5’triphosphate
5’-fluorouridine-5’-monophosphate
5’-fluorouridine-5’-diphosphate
5’-fluorouridine-5’-triphosphate
5-fluorouridine
5-fluoro-2’-deoxyuridine
2’-deoxyuridine-5’-monophosphate
2’-deoxyuridine-5’-triphosphate
2’-deoxythymidine-5’-monophosphate
2’-deoxythymidine-5’-triphosphate
Figure 8: Cellular activation of 5-FC by SCD and its multiple cytotoxic effects
Syper Cytosine Deaminase (SCD) is a fusion protein comprising the enzymes Yeast Cytosine Deaminase (YCD) and
Yeast Uracil PhosphoRibosylTransferase (YUPRT). YCD converts 5-Fluorocytosine (5-FC) to 5-Fluoruracil (5-FU). 5-FU
is further modified by multiple mammalian kinases to 5-FUTP, which incorporates into RNA during transcription and
prevents protein synthesis. YUPRT further facilitates this inhibition by directly converting 5-FU to 5-FUMP. 5-FU can also
be converted to 5-FdUMP and 5-FdUTP. 5-FdUMP inhibits dTMP synthesis thus reducing the dTTP-pool available for
incorporation into DNA. 5FdUTP can directly incorporate into the elongating DNA string instead of dTTP causing
premature DNA-string termination. Illustration courtesy of Camilla Laulund Christensen, Department of Radiation Biology.
Insufficient delivery resulting in a poor tumor transfection rate represents a major
challenge for cancer gene therapy. However, GDEPT based strategies can (at least partly)
compensate for the poor delivery by means of so-called bystander mediated cell death.
The bystander effect defines the cytotoxic effect of delivery of the active drug from a
transfected cell to neighboring cells, which have not obtained the therapeutic gene.
However, the cytotoxic effect may be more or less pronounced depending on the GDEPT
system, especially with regards to the ability of the cytotoxic drug to deliver itself effectively
into adjacent cells. While unphosphorylated GCV freely diffuses across cell membranes,
the
charged
phosphorylated
GCV-metabolites
(Figure
5)
require
gap-junctional
connections to spread to the neighboring cells although the role of the bystander effect in
the HSVTK-GCV GDEPT system remains controversial (for a review see70). In contrast to
the phosphorylated GCV-metabolites, 5FU is freely diffusible across biological membranes
and the SCD-5FC systems has been shown to induce a potent bystander effect with tumor
regression of colorectal xenografts observed when as few as 2% of the tumor cells
express the therapeutic gene71. Interestingly, a distant bystander effect has also been
observed, where expression of the therapeutic gene in one tumor may lead to regression
of a distant tumor in the same animal. This effect could be explained by the triggering of an
54
Part I: Development of a targeted gene therapy for SCLC
immune response to the dying transfected cells, which may also target distant
untransfected tumor cells72. It therefore remains important to assess the bystander effect
in vivo not only to evaluate its contribution to the therapeutic efficacy but also to ensure
lack of toxicity due to unspecific uptake of converted pro-drug in the normal tissues.
In summary, the presented data show that hASH1 and hASH1EZH2 promoter constructs
can specifically activate reporter and suicide gene constructs at a level sufficient to induce
SCLC specific cytotoxicity in vitro. Further optimization of the system, the evaluation of
different therapeutic genes and the implementation of the strategy in vivo will reveal
wheter hASH1 or hASH1EZH2 promoter regulated SCLC gene therapy is a feasible
therapeutic approach.
Supplementary Materials and Methods
A brief description of the experimental setup for the studies presented above is provided
in the following sections.
Mouse treatment with reporter vector followed by whole body and organ imaging
Plasmid (CMV-LUC or 0,7hASH1-LUC) was transduced into TOP10-competent bacteria
(Invitrogen, Carlsbad, CA, USA) and a 2,5 l bacteria batch in LB-medium (Invitrogen) was
harvested for endotoxin free plasmid extraction using the EndoFree Plasmid Giga Kit
(Qiagen, Valencia, CA, USA) according to vendor’s instructions. DOTAP:Chol (20mM) was
produced as previously described56,
61
and provided by Associate Professor, Pharmacist
Vagn N. Handlos, Rigshospitalet. Fresh preparations of DNA:DOTAP:Chol were made
each day prior to injection as follows: 90µg DNA was diluted into a total volume of 100µl
5% dextrose in water (D5W) and 40µl 20mM DOTAP:Chol was mixed with 60µl D5W. The
DNA was added to the DOTAP:Chol solution and immediately mixed by vigorous pipetting.
6 to 8 week old female FVB-mice were treated once daily with 25µg CMV-LUC, 25µg
0,7hASH1-LUC or no DNA packaged in DOTAP:Chol liposomes with tail vein injections for
three successive days. To minimize a toxic inflammatory response the mice were orally
administered 3,75ml/kg body weight solution of Naproxen (4 mg/ml) in PBS 3 hours prior
to each DNA injection.
48 hours after the third injection of DNA:DOTAP:Chol imaging was performed as follows.
The animals were anaesthetized with Isofluorane (2% in 100% O2) and injected
intraperitoneally with 200µl of a 30mg/ml solution of D-Luciferin K+-salt in PBS (Xenogen,
55
Part I: Development of a targeted gene therapy for SCLC
Caliper Life sciences, Hopkinton, MA, USA). 5 minutes later the mice were imaged using
the IVIS® Lumina imaging system (Xenogen) with standard machine settings for 5 min.
Next, animals were euthanized by lethal injection of Nembutal solution and the lung, heart
and brain were removed. Tissues were immediately split in two portions and either
immediately frozen on dry ice for RNA and DNA extraction (see below) or placed on a dish
with PBS and imaged for 5 min. Imaging data were normalized using the Living Image®
software from Xenogen.
PCR/RT-PCR detection of luciferase transcript and plasmid DNA in mouse tissues
RNA and DNA was extracted from snap frozen pulverized tissues using a combined
TriZol (Invitrogen) and RNeasy (Qiagen) based protocol. Briefly, the frozen tissues were
pulverized using a hammer and homogenized in TriZol solution with a polytron
homogenizer. The samples were centrifuged and the clear supernatant was transferred to
RNeasy columns. RNA extraction was performed with DNase treatment according to the
protocol provided by Qiagen. DNA was extracted from the remaining two phases of TriZol
solution according to the Invitrogen protocol.
Reverse transcription was performed using Superscript RT III and PCR amplification
using Platinum Taq Polymerase (both Invitrogen) with 25 cycles of amplification. The
annealing temperature was 65°C for both transcripts.
Actin
primers:
Sense:
5’-
GTCGACAACGGCTCCGGCATGTGCA,
Antisense:5’-
GCCAGCCAGGTCCAGACGCAGGATG.
Luciferase primers: Sense: 5’- CGCCATTCTATCCGCTGGAAGA, Antisense: 5’CCCAACACCGGCATAAAGAATTGA.
As a negative control for DNA contamination of the RNA-extracts analogous RT-PCR
reactions were performed without addition of SuperscriptIII enzyme to the RT-reaction
mixture.
Detection of plasmid DNA in the tissue samples was performed on extracted DNA using
Luciferase specific primers and the PCR-conditions specified above.
56
Part II: Neuronal Pentraxins and SCLC sensitivity to taipoxin
Part II: Neuronal Pentraxins and SCLC sensitivity to taipoxin
As schematically presented in Figure 1 the delivery of a cytotoxic or gene therapeutic
treatment to cancer cells can be potentiated by targeting its delivery to surface receptors
highly and specifically expressed on the cancer cell. Receptor targeting can be performed
by coupling of a specific ligand or antibody directed against the cancer specific surface
molecule to the gene delivery vector or cytotoxic drug. The work presented in the following
section was motivated by the aim to identify novel SCLC specific surface receptor/ligand
systems for therapeutic targeting. Experimental work performed during a Masters project
that preceded the current PhD-study involved the initial identification and characterization
of a subset of SCLC specific receptor candidates with regards to receptor expression
levels and evaluation of ligand binding73. It was not possible from these studies to identify
a functional and SCLC-specific ligand-receptor system for targeting and therefore it was
decided to proceed with transcriptional targeting as presented in Part I of this thesis.
However, the work presented in the following sections represents further studies of one of
the identified receptors, the Neuronal Pentraxin Receptor (NPR) and especially its relation
to the snake venom neurotoxin taipoxin in SCLC. The findings may have potential for
future therapeutic strategies targeting the neuronal and NE phenotype in SCLC.
Background
The global gene expression profile of SCLC cells compared to normal tissues, revealed a
number of potential cancer specific receptor candidates one of which was NPR17. The
SCLC and normal tissue microarray profile of NPR demonstrates low/absent expression of
NPR-mRNA in normal tissues except for brain, while 5 of 6 patient tumors, the far majority
of tested SCLC cell lines and xenografts expressed NPR mRNA (Figure 9). Protein
expression in SCLC was further confirmed by Western blot analysis on cell line protein
lysates17 (see Manuscript II).
57
Part II: Neuronal Pentraxins and SCLC sensitivity to taipoxin
The neuronal pentraxins (NPs) define a
700
Microarray signal
600
group of proteins comprising NPR and
500
400
NP1 and 2g. While traditional “short”
300
200
pentraxinsh are the size of ~25kDa and
100
NORMAL TISSUES
SCLC CELL LINES AND XENOGRAFTS
SCLC tumor 1
SCLC tumor 2
SCLC tumor 3
SCLC tumor 4
SCLC tumor 5
SCLC tumor 6
CPH 54A
CPH 54A Xeno
CPH 54B
CPH 136A Xeno
GLC 2
GLC 3
GLC 3 Xeno
GLC 14
GLC 14 Xeno
GLC 16
GLC 19
GLC 26
GLC 28
DMS 53
DMS 79
DMS 92
DMS 114
DMS 153
DMS 273
DMS 273 Xeno
DMS 406
DMS 456
H69
H69 Xeno
NCI 417
NCI 417 Xeno
MAR H24
MAR H24 Xeno
MAR 86H
RT-PCR
Fetal brain
Brain
Adrenal gland
Colon
Heart
Kidney
Liver
Lung
Pancreas
Prostate
Salivary gland
Skeletal muscle
Small intestine
Spleen
Stomach
Testes
Thyroid
Trachea
0
TUMORS
Figure 9: RT-PCR validated expression of NPR mRNA in
SCLC and normal tissues
The normalized microarray data for NPR transcripts was
validated by semi-quantitative RT-PCR. NPR-mRNA is
expressed in most SCLC cell lines and derived xenografts,
while most normal tissues exhibit low/absent expression.
Microarray data for cell lines/xenografts and patient tumors
17, 30
are adapted from
.
present in serum, NPs are generally
longer (~40-65kDa) and were originally
isolated from rat brain lysates74. Short
pentraxins are known to form penta- or
decameric structures via association of
their
pentraxin
domains
and
the
characteristic pentraxin domain signature
is also found in NPs. NP1 is a rare
secreted glycosylated protein with moderate mRNA expression confined to the brain75.
Low stringency screening of human brain transcripts with an NP1-specific probe resulted
in the identification of NP2, which has high homology to NP1 and contains a putative Nterminal signal sequence indicative of secretion, although NP2 exhibits a wider tissue
expression pattern than NP176. In contrast to the secreted NPs, NPR contains a
hydrophobic N-terminal domain indicative of surface membrane association. The Cterminal half of NPR, which contains the pentraxin domain and glycosylation sites, bears
significant homology to the C-terminus of NP1 and 277.
The identification and isolation of the three NPs was originally motivated by the search
for a neuronal uptake mediator and/or receptor for the snake venom neurotoxin taipoxin
from the Australian Taipan snake Oxyuranus scutellatus scutellatus and all three NP’s can
be isolated by affinity chromatography of rat brain lysate on columns of immobilized
taipoxin77. Further studies in mammalian cells suggest that NPR binding to taipoxin is
Ca2+-dependent and that this binding may require the receptor to be associated with NP1
and/or 2 in a heteromultimeric complex, synthesized within the same cell78. Recently,
secreted NP1-NPR-complex was reported necessary for the recruitment of Glutamate
receptor 4 subunits to synapses79, but the role of NP-NPR multimers in the cellular uptake
of taipoxin remains to be fully elucidated.
g
Also known as Neuronal activity regulated protein (Narp) in rats and p50/apexin in guinea pigs
Traditional pentraxins include the proteins C-reactive protein and serum amyloid P component present in
serum and highly expressed during the acute phase innate immune response.
h
58
Part II: Neuronal Pentraxins and SCLC sensitivity to taipoxin
Taipoxin is a highly neurotoxic snake venom toxin (LD50~2µg/kg in the mouse),
composed of three homologous subunits termed α, β and γ of which only α is considerably
toxic on its own81. Structurally, taipoxin belongs to the Phoshpolipase A2 (PLA2) family of
neurotoxins, which bind to presynaptic neurons in a Ca2+-dependent manner. The binding
and endocytosis of taipoxin in neurons leads to the recomposition of lipids in the synaptic
plasma membrane ultimately blocking the re-endocytosis of vesicles and terminating
synaptic signaling (Figure 10A)80,
82
. This blockade of vesicle endocytosis results in the
presence of characteristic Ω-shaped structures in the membranes of taipoxin intoxicated
neurons83, 84 (Figure 10B). In addition to blockade of vesicle recycling, taipoxin has been
reported to induce F-actin fragmentation in NE cells in a seemingly Ca2+-independent
manner85.
The high expression of NPR in SCLC, the capability of NPs to bind taipoxin in vitro and
the report that taipoxin is toxic to NE cells, prompted us to further investigate NP
expression and taipoxin toxicity in SCLC cells. The results of the study are presented in
Manuscript II on the following pages.
Figure 10: Putative model for PLA2 uptake and neurotoxicity
A: After docking of synaptic vesicles to the presynaptic cell membrane (1), the vesicle fuses to the membrane allowing
for release of neurotransmitter to the synaptic space (2). This allows for binding and recruitment of the Phospholipase A2
(PLA2) toxin to the intravesicular space. Following re-endocytosis of the vesicle (3), the toxin facilitates hydrolysis of
lipids in the vesicle membrane generating fatty acids (FA) and lysophospholipids (LysoPL) (4). This facilitates the
+
activation of an ATPase proton pump in the vesicular membrane, resulting in the influx of H and facilitating the refilling of
the vesicle with neurotransmitter (NT) (5). The Fatty acids and lysophospholipids redistribute in the vesicle membrane to
facilitate docking to the cell membrane and release of neurotransmitter (6) but prevent re-endocytosis. B: Inhibiton of reendocytosis results in Ω-shaped indentations (red arrowheads) observed in a PLA2 intoxicated neuromuscular junction.
The muscle was removed when the animal died from respiratory paralysis. The axon terminal (AX) is virtually devoid of
synaptic vesicles and there are many invaginations facing both the muscle cell (MF), where neuroexocytosis normally
takes place, and the Schwann cell (SC), where neurotransmitter is not released at normal conditions. Figures modified
80
from .
59
Part II: Neuronal Pentraxins and SCLC sensitivity to taipoxin
Manuscript II
Specific sensitivity of small cell lung cancer cell lines to the snake
venom toxin taipoxin
Authors:
Thomas T. Poulsen, Nina Pedersen, Mark S. Perin, Celia K. Hansen and Hans S.
Poulsen
Manuscript published in Lung Cancer, 2005 December; 50: 329-337.
Author Contributions:
Thomas T. Poulsen: All experimental work and design except MTT-assay on two SCLC
cell lines and Western blot for NPR; preparation of manuscript
Nina Pedersen: Supervision; manuscript revision
Mark S. Perin: Helpful theoretical discussions; provided the NP1 expression vector;
manuscript revision
Celia K. Hansen: MTT-assay on two SCLC cell lines; Western blot for NPR; manuscript
revision
Hans S. Poulsen: Supervision; manuscript revision
60
Part II: Neuronal Pentraxins and SCLC sensitivity to taipoxin
61
Part II: Neuronal Pentraxins and SCLC sensitivity to taipoxin
62
Part II: Neuronal Pentraxins and SCLC sensitivity to taipoxin
63
Part II: Neuronal Pentraxins and SCLC sensitivity to taipoxin
64
Part II: Neuronal Pentraxins and SCLC sensitivity to taipoxin
65
Part II: Neuronal Pentraxins and SCLC sensitivity to taipoxin
66
Part II: Neuronal Pentraxins and SCLC sensitivity to taipoxin
67
Part II: Neuronal Pentraxins and SCLC sensitivity to taipoxin
68
Part II: Neuronal Pentraxins and SCLC sensitivity to taipoxin
69
Part II: Neuronal Pentraxins and SCLC sensitivity to taipoxin
Perspectives
The investigation of NP-expression in SCLC revealed expression and membrane
association of NPR in all the cell lines tested. Furthermore, NP1 and 2 mRNA and protein
was detected in a subset of the cell lines. Finally, a highly significant cytotoxic effect of
taipoxin in the nanomolar range was observed in some of the SCLC cell lines. Although
one of the taipoxin responsive SCLC cell lines (DMS53) was found to express NP1
protein, taipoxin sensitivity in the other three responsive cell lines (GLC3, NCIH69 and
DMS53) does not directly correlate with expression of NP1 or 2 (Manuscript II, Table 1).
Therefore, although it has been previously reported that NPR when complexed with NP1
and/or 2 is capable of binding taipoxin our data suggest that this interaction is not
necessary to induce taipoxin sensitivity in SCLC cell lines. As such, other mechanisms
than binding to NPs may be responsible for the taipoxin-induced toxicity in SCLC although
a role for NPR in this process cannot be excluded based on the available data.
It is worth noting, that even though NPR is the only membrane bound molecule to date,
which has been demonstrated to bind taipoxin (indirectly via association with secreted
NPs) all binding studies were performed by chromatography of rat brain and cell line
lysates on columns of immobilized taipoxin. Furthermore, while the association of NPR
with secreted NPs has been demonstrated in cell lines, interaction of taipoxin with NPcomplexes on the surface of intact cells has never been reported77, 78. Therefore, whether
taipoxin is in fact capable of binding NPR-NP complexes on the surface of cells remains to
be determined.
The three SCLC cell lines CPH54A, DMS114 and DMS273 were insensitive to taipoxin
concentrations up to 200nM. As discussed in Manuscript II, the transcriptional profile of
CPH54A raises doubt about the origin of this cell line although initially classified as
SCLC17,
86
. Furthermore, since DMS273 and DMS114 both grow in adherent monolayer
and phenotypically resemble fibroblasts rather than SCLC cells it can be speculated that
these cell lines may have lost some of the NE characteristics of importance for the uptake
or cytotoxic action of taipoxin although this has not been investigated further.
While the performed study does not begin to answer questions related to the functional
uptake or mechanism of action in SCLC, a likely explanation for the taipoxin-induced
toxicity in SCLC cells may reside in the NE-properties of this malignancy. As previously
70
Part II: Neuronal Pentraxins and SCLC sensitivity to taipoxin
discussed, SCLC cells express and secrete a number of enzymes and neuropeptides,
many of which promote cancer cell growth via autocrine and paracrine signaling through
surface receptors expressed by the SCLC cells themselves3. Furthermore, SCLC cells
express necessary components of (and actively signal through) neurotransmitter systems
such as nicotinic and muscarinic acetylcholine receptors, although it has not been
elucidated whether this signaling involves the formation of vesicles5. Functionally active
voltage gated sodium channels (VGSCs) are also expressed in SCLC cells allowing for the
generation of action potentials in these cells6, 7. Finally, a more recent study reports a role
for VGSCs in endocytosis in SCLC cells, a process of potential importance for SCLC
growth and metastasis87. Collectively, these observations support that neuronal-like
signaling, the generation of action potentials and active endocytosis are important growth
stimulatory factors in SCLC cells. Since taipoxin appears to exert its toxicity via blockade
of re-endocytosis of vesicles and by generation of F-actin fragmentation in NE cells it
appears likely that the same mechanisms could be involved in inducing cytotoxicity in
SCLC-cells.
Apart from the long-term perspective of modifying and using taipoxin or taipoxin subunits
therapeutically or indirectly as targeting agents for SCLC-treatment as discussed in
Manuscript II, it is intriguing in the context of this PhD-study to implement the findings in a
transcriptionally regulated gene therapeutic strategy. More specifically it would be of
interest to evaluate the use of a taipoxin-derived gene as suicide gene for SCLC gene
therapy. As mentioned, of the three taipoxin subunits only the α-component demonstrates
PLA2-activity and appreciable toxicity in mice81. While the γ-subunit does not appear toxic
after systemic administration in mice, it has been reported to be cytotoxic to NE
phaeochromocytoma cells in culture88.
The sequence of the gene or genes involved in taipoxin subunit expression in the
venomous glands of the Australian Taipan snake has (to our knowledge) not been
elucidated to date, but since the amino acid sequence of the α- and γ-subunits is known89,
90
it is possible to chemically synthesize a DNA-sequence which translates into the primary
structure of for instance the taipoxin α-subunit as it has previously been described for
other snake venom toxins91. Transfection of SCLC cells with a synthesized α-subunit gene
may induce cytotoxicity due to the membrane lipid modifying effects mediated by its PLA2activity as discussed above. Internal application of a different snake PLA2-toxin (Crotoxin
71
Part II: Neuronal Pentraxins and SCLC sensitivity to taipoxin
subunit B) by direct microinjection into neurons and NE cells has been reported to result in
blockade of neurotransmitter release92, demonstrating that external application and active
uptake of toxin is not necessary to induce a response in these cells and thus suggesting
that gene therapeutic delivery and intracallular expression of taipoxin α could also be a
feasible strategy.
Although the toxic effect of taipoxin seems to be confined to neurons and NE cells, this
lack of specificity may present problems in a gene therapeutic setting. However, the use of
a transcriptionally targeted strategy, for instance by fusing the toxin-subunit gene to a
cancer specific promoter as previously discussed in Part I, would induce a secondary level
of specificity and targeting to SCLC cells.
The use of snake venom derived drugs for cancer treatment has previously been
reported. Probably the most investigated snake venom component based anti-cancer
strategy involves venom-derived disulfide rich peptides termed disintegrins. These
molecules have been found to effectively bind to and block the function of cellular integrins
resulting in inhibition of tumor angiogenesis and tumor cell growth and metastasis93.
Finally a few reports have recently been published involving an effect of PLA2-based
snake venom toxins and derived peptides on cancer cell growth, but the full potential of
these initial studies awaits further investigation94, 95.
In conclusion, while much remains to be investigated regarding the sensitivity and
therapeutic potential of taipoxin in SCLC these initial findings may pave the way for the
design of future therapeutic strategies.
72
Part III: Carcinogen induced pulmonary neuroendocrine hyperplasia
Part III: Carcinogen induced pulmonary neuroendocrine hyperplasia
A gained understanding of SCLC carcinogenesis can provide important knowledge for
the development of effective novel treatments, but despite many efforts the cellular origin
and precursor lesions of SCLC are yet to be identified. Central to this understanding is
also a fuller elucidation of the role of the NE-markers highly expressed in SCLC.
The work presented in the following sections reports the identification of the classical NE
marker PGP9.5 as transiently overexpressed in non-NE airway epithelium after carcinogen
induced lung damage. The study was carried out during a 6-month visiting research
fellowship at the Cell and Cancer Biology Branch of the Center for Cancer Research,
National Cancer Institute, Maryland, USA under the supervision of Senior Investigator Dr.
Ilona Linnoila.
Background
Normal lung epithelium contains a rare distinct cell type: the Pulmonary NeuroEndocrine
Cell (PNEC), which bears certain striking phenotypic resemblance to SCLC cells. The
bottle shaped PNECs are dispersed throughout the lung epithelium either as solitary cells
or associated in cluster like structures termed NeuroEndocrine Bodies (NEBs)96 (Figure
11). In the adult normal lung, PNECs are rare and have been estimated to constitute less
than 0,5% of the total epithelial cell population97. Furthermore, (and in contrast to infant
and fetal lung) PNECs in adult human lung are almost exclusively distributed as solitary
cells while NEBs are virtually non-existing96,
97
. Like SCLC cells, PNECs contain dense
core vesicles and produce and secrete a number of NE-peptides and markers including
serotonin, GRP, CGRP and PGP9.598 and bHLH-transcription factors such as hASH199.
Interestingly, in lungs from newborn MASH1-knock out mice no PNECs are observed11.
Functionally, PNECs have been related to lung branching morphogenesis during fetal
development and the NEBs have been associated with pulmonary oxygen sensing in late
fetal and postnatal life100, 101.
73
Part III: Carcinogen induced pulmonary neuroendocrine hyperplasia
Thus, while PNECs play a relatively welldefined role in normal fetal and newborn
pulmonary development, their function in
the adult lung is less clear. However, an
increasing number of observations point to
a role of PNECs and NEBs in adult lung
pathophysiology and carcinogenesis.
PNEC hyperplasia and NEB formation is
observed under inflammatory conditions,
which may be caused by acute injury (i.e.
after exposure to chemical carcinogens
such as those present in tobacco smoke)
and under pathologic circumstances such
as chronic bronchitis or emphysema102, 103.
As it will be discussed in further detail in
manuscript III, the tobacco smoke
constituent naphthalene induces acute and
Figure 11: PNEC and NEBs in mouse and human lungs
A: A NEB stained for CGRP residing at the bifurcation of
two distal airways in mouse lung four days after
naphthalene treatment. Note the damaged pulmonary
epithelium B: A whole mount of a large piece
(approximately 1.3 0.9 cm) of human bronchial mucosa
stained for GRP immunoreactivity and viewed from the
luminal surface by confocal microscope. PNECs appear as
small yellow spots. Picture A is unpublished data obtained
as described in the Materials and Methods section of
96
Manuscript III, picture B is adapted from .
specific injury to the non-NE lung epithelial
cells (Clara cells) in mice followed by an
increase in PNEC-proliferation and Clara
cell reconstitution102 (Figure 11). Due to the
PNEC hyperproliferation observed in
response to naphthalene102 and their close
morphological resemblance to SCLC cells,
PNECs have been suggested to serve as SCLC-precursor cells98. However, more recent
studies suggest that the regeneration of Clara cells following naphthalene exposure is not
directly dependent on the NE-hyperplasia but may rather depend on non-NE cells
associated with PNECs or residing in NEBs104, 105. Furthermore, although PNEChyperplasia is observed in cancer inflicted lungs, the increase in PNEC-abundance is
generally confined to non-malignant inflammatory regions distant from the areas adjacent
to or directly associated with the tumor tissue106.
74
Part III: Carcinogen induced pulmonary neuroendocrine hyperplasia
Therefore a direct link between PNEC-hyperplasia and SCLC carcinogenesis remains to
be demonstrated. However, bearing in mind the similarities between PNECs and SCLC
cells further studies of the function of PNEC-hyperplasia during lung injury can potentially
provide useful links to critical processes involved in the carcinogenesis of SCLC and other
NE-malignancies of the lung.
The initial purpose of the current study was to develop a real-time quantitative Reverse
Transcription PCR (qPCR) based approach to quantify NE-hyperplasia after mouse lung
exposure to carcinogens such as naphthalene. The only method for quantifying NEhyperplasia presently available is immunostaining for NE-markers followed by counting the
number of PNECs and NEBs (defined as NE-foci) per airway (See Manuscript III, Figure
1A). Since counting of NE-foci is highly laborious, we aimed to test whether the
carcinogen-induced NE-hyperplasia could be monitored and quantified by qPCR of NEmarker transcripts such as MASH1, Synaptophysin and PGP9.5 in total RNA-isolates from
mouse lung. Such a method would not only be a faster and more convenient screening
procedure for NE-hyperplasia but could also provide a more accurate measure for PNEChyperplasia than the NE-foci per airway ratio.
While no difference in MASH1 and synaptophysin transcripts was detected after
naphthalene exposure compared to control treated animals (data not shown), we found a
significant transient increase in PGP9.5-mRNA in the days immediately following
naphthalene exposure. However, as reported in the following manuscript, rather than
reflecting PNEC hyperproliferation, the rise in PGP9.5-mRNA after naphthalene can be
ascribed to its expression in recovering non-NE airway epithelial cells.
75
Part III: Carcinogen induced pulmonary neuroendocrine hyperplasia
Manuscript III
Acute damage by naphthalene triggers expression of the
neuroendocrine marker PGP9.5 in airway epithelial cells
Authors:
Thomas T. Poulsen, Xu Naizhen, Hans S. Poulsen and Ilona R. Linnoila
Manuscript submitted to Toxicology Letters, February 2008
Author Contributions:
Thomas T. Poulsen: Naphthalene experiments; Immunostaining and qPCR; Preparation
of manuscript
Xu Naizhen: NNK-experiments; Immunostaining and qPCR; Revision of manuscript
Hans S. Poulsen: Supervision; Revision of manuscript
Ilona R. Linnoila: Study design; Supervision; Revision of manuscript
76
Part III: Carcinogen induced pulmonary neuroendocrine hyperplasia
77
Part III: Carcinogen induced pulmonary neuroendocrine hyperplasia
78
Part III: Carcinogen induced pulmonary neuroendocrine hyperplasia
79
Part III: Carcinogen induced pulmonary neuroendocrine hyperplasia
80
Part III: Carcinogen induced pulmonary neuroendocrine hyperplasia
81
Part III: Carcinogen induced pulmonary neuroendocrine hyperplasia
82
Part III: Carcinogen induced pulmonary neuroendocrine hyperplasia
83
Part III: Carcinogen induced pulmonary neuroendocrine hyperplasia
84
Part III: Carcinogen induced pulmonary neuroendocrine hyperplasia
85
Part III: Carcinogen induced pulmonary neuroendocrine hyperplasia
86
Part III: Carcinogen induced pulmonary neuroendocrine hyperplasia
87
Part III: Carcinogen induced pulmonary neuroendocrine hyperplasia
88
Part III: Carcinogen induced pulmonary neuroendocrine hyperplasia
89
Part III: Carcinogen induced pulmonary neuroendocrine hyperplasia
90
Part III: Carcinogen induced pulmonary neuroendocrine hyperplasia
91
Part III: Carcinogen induced pulmonary neuroendocrine hyperplasia
92
Part III: Carcinogen induced pulmonary neuroendocrine hyperplasia
93
Part III: Carcinogen induced pulmonary neuroendocrine hyperplasia
94
Part III: Carcinogen induced pulmonary neuroendocrine hyperplasia
95
Part III: Carcinogen induced pulmonary neuroendocrine hyperplasia
96
Part III: Carcinogen induced pulmonary neuroendocrine hyperplasia
Perspectives
The finding that PGP9.5 is expressed in proliferating and recovering Clara cells in mice
immediately after naphthalene induced acute lung damage is somewhat surprising since
PGP9.5 expression in the normal lung is strictly confined to PNECs and neurons.
However, as discussed, the results presented in this study draws parallels to the recent
observation that PGP9.5 is up-regulated in non-malignant lung epithelium of healthy
smokers107. As previously mentioned, apart from expression in neurons and PNECs
PGP9.5 is also highly expressed in SCLC (Figure 12)4.
The functional role of the ubiquitin hydrolase PGP9.5 has been most intensively studied
within the research fields of neurology and neurodegenerative disorders and appears to
include multiple different functions such as ligation of ubiquitin dimers and stabilization of
ubiquitin monomers apart from the classic hydrolase activity108. Accumulating evidence
obtained from patient samples and mouse models of Alzheimer’s and Parkinson’s disease
point to a central role for PGP9.5 in the proper function and survival of neurons.
Downregulation and extensive oxidative damage of PGP9.5 is observed in brains of
Alzheimer’s and Parkinson’s disease patients109.Furthermore, exogenously applied
Microarray signal
PGP9.5 alleviates β-amyloid induced synaptic dysfunction in hippocampal section slices
2500
and inhibits memory loss in a mouse
2000
model
1500
Interestingly, retinal neurons from mice
1000
that lack expression of PGP9.5, are more
for
resistant
500
disease110.
Alzheimer’s
to
acute-stress
induced
apoptosis, have higher levels of anti-
SCLC CELL LINES AND XENOGRAFTS
TUMORS
tumor
tumor
tumor
tumor
tumor
tumor
1
2
3
4
5
6
SCLC
SCLC
SCLC
SCLC
SCLC
SCLC
NORMAL TISSUES
CPH 136A
GLC 2
GLC 3
GLC 3 Xeno
GLC 14
GLC 14 Xeno
GLC 16
GLC 19
GLC 26
GLC 28
DMS 53
DMS 79
DMS 92
DMS 114
DMS 153
DMS 273
DMS 273 Xeno
DMS 406
DMS 456
H69
H69 Xeno
NCI 417
NCI 417 Xeno
MAR H24
MAR H24
MAR 86H
Fetal brain
Brain
Adrenal gland
Colon
Heart
Kidney
Liver
Lung
Pancreas
Prostate
Salivary gland
Skeletal
Small intestine
Spleen
Stomach
Testes
Thyroid
Trachea
0
Figure 12: Microarray expression of PGP9.5 mRNA in
SCLC and normal tissues
The normalized microarray data indicate high expression of
PGP9.5-mRNA in all SCLC cell lines and derived xenografts,
while expression is only detected in brain and kidney of all
adult normal tissues. Microarray data for cell lines/xenografts
17, 30
.
and patient tumors were from
apoptotic
and
pro-survival
signaling
pathway proteins and exhibit increased
resistance
to
ischemia
induced
cell
death111. At a first glance these results
conflict with an oncogenic role of PGP9.5
in cancer, but since some cancers such as
SCLC and NSCLC112-114 exhibit elevated
protein levels, while the gene is silenced in
97
Part III: Carcinogen induced pulmonary neuroendocrine hyperplasia
other malignancies including colorectal and ovarian cancer115 the role of PGP9.5 in cancer
appears to be highly context dependent. Nevertheless, the finding that PGP9.5 can
associate with JAB1 and the tumor suppressor p27Kip1 in NSCLC cells targeting p27Kip1 for
degradation suggests a growth-promoting function of PGP9.5 in lung cancer116.
Since the primary scope of this PhD-project has been to develop a transcriptionally
targeted gene therapy for SCLC and PGP9.5-protein and mRNA is highly expressed in
SCLC (Figure 12) it is of interest to ask whether regulatory regions from the PGP9.5 gene
may qualify for suicide gene regulation in SCLC gene therapy. In order to obtain sufficient
regulation by means of a PGP9.5-regulatory element the gene must be predominantly
transcriptionally activated in SCLC and regulated independently of genetic and epigenetic
alterations such as gene duplication or promoter methylation, as previously discussed in
Part I. Reporter gene studies to elucidate functional elements in the PGP9.5 promoter
region identified a 233bp CpG-rich cis-element with a high general activity (both in cells
with and without endogenous PGP9.5-expression) and an upstream negative regulatory
region capable of inhibiting gene expression in PGP9.5-negative HeLa cells117. Further
studies revealed heavy methylation in the CpG-island of the PGP9.5-promoter in HeLa
cells and colorectal and ovarian cancers, while methylation was not detected in normal
lung and cervical tissues115,
118
. Collectively, these data suggest that PGP9.5 may be
down-regulated by methylation in certain neoplasms, while normal tissues appear to
downregulate expression in a methylation-independent and perhaps transcriptional
manner.
However,
although
the
PGP9.5-promoter
may
be
down-regulated
by
transcriptional mechanisms in normal tissues – and as such candidates as a potential
gene therapy regulator – the abundant expression of the PGP9.5 in brain, peripheral
neurons and PNECs presents a considerable lack of specificity, which may potentially
require additional modifications to prevent unspecific neuronal toxicity of PGP9.5-promoter
regulated cancer gene therapy. The finding that PGP9.5 is reactivated in the normal lung
epithelium of smokers107 argues further against PGP9.5-promoter regulated SCLC gene
therapy for obvious specificity reasons. Therefore, the PGP9.5 promoter has not been a
primary suicide gene regulatory candidate in the current PhD-study and has not been
further tested for this purpose.
In the current study, we used naphthalene to induce acute lung epithelial injury in mice
and detected expression of PGP9.5 in the recovering pulmonary epithelium. Even though
98
Part III: Carcinogen induced pulmonary neuroendocrine hyperplasia
naphthalene – a carcinogenic component of cigarette smoke119 – induces NE-hyperplasia
in mouse lungs102 and SCLC is a NE malignancy closely related to smoking2 the
mechanistic relations between murine epithelial injury exerted by naphthalene and human
SCLC carcinogenesis have not been fully established. However, naphthalene has been
found to activate developmental signaling pathways such as Hedgehog signaling, which is
also highly active in SCLC in vivo120,
121
. Hedgehog activation appears important for the
growth of SCLC cells and introduction of Hedgehog signaling inhibitors inhibits expression
of other prominent neuroembryonic transcription factors such as hASH1 in SCLC.
Interestingly, like PGP9.5, the Hedgehog signaling components Gli1 and Sonic Hedgehog
are detectable in the non-NE airway epithelium after naphthalene injury and Hedgehog
signaling therefore appears to precede NE-differentiation during the process of epithelial
reconstitution120.
The transcriptional repressor Growth Factor Independent-1 (GFI1) is involved in the
development of NE-cells including PNECs, neurons and hematopoietic cells122. Expression
of GFI1 correlates closely to hASH1 and CGRP expression in PNEC, NE-lung cancer cell
lines and primary NE lung tumor specimens and forced GFI1-expression promotes tumor
formation of a SCLC cell line in nude mice123. Furthermore, the same study reports that
GFI1-knock out mice exhibit a reduced NE-phenotype in pulmonary airways. These
observations prompted the investigation of whether PNEC-hyperplasia was impaired after
naphthalene exposure in GFI1-knock out mice. While the lack of GFI1 significantly inhibits
PNEC-hyperplasia in the naphthalene-exposed lungs of knock out mice, the impaired NEproliferation does not appear to affect Clara cell recovery104.
Finally, the NEB-compartment has been found to harbor a population of naphthalene
resistant non-NE cells, which express Clara cell specific markers. Interestingly, after
conditional knock out of the NEB-residing Clara cell variant, PNEC hyperproliferation was
induced although the airway epithelium failed to regenerate from naphthalene induced
injury105.
Collectively these reports indicate that the NE-phenotype per se is not directly
responsible for lung epithelium regeneration, but that the naphthalene resistant NEBresiding Clara cell variant could play a role in recovery from carcinogen induced injury and
perhaps SCLC carcinogenesis.
99
Part III: Carcinogen induced pulmonary neuroendocrine hyperplasia
In summary, much remains to be learned about the link between the non-malignant
proliferation of PNEC and NE-differentiation in response to injury on one side and the
development of SCLC on the other. Accumulating data, including the observations
presented in Manuscript III suggest, that the transient activation of certain developmental
and NE-markers in response to injury and cytotoxic stress in non-NE epithelium may
provide mechanisms that contribute to SCLC and NE-NSCLC carcinogenesis.
100
Conclusion
Conclusion
The main scope of this PhD-study has been to develop a transcriptionally targeted gene
therapy for SCLC. During these studies the distinct neuronal and NE-phenotype of SCLC
turned out to be a central player, not only because a number of NE-proteins are highly
expressed in SCLC, but also because increasing evidence points to a role for neuronal
and NE-markers during repair of normal lung epithelium subjected to carcinogen inflicted
injury and perhaps early carcinogenesis.
Data from a microarray analysis of the human SCLC transcriptome allowed for the
identification of promoter candidates with a potential for upregulating suicide gene
expression in SCLC cells while at the same time restricting gene activation to the cancer
cells to minimize unspecific toxicity. By transfection of a panel of SCLC cell lines and cells
of different origin it was succesfully demonstrated that promoter regions from the NE
hASH1-gene, which is highly up-regulated in SCLC could sufficiently activate a reporter
and suicide gene in SCLC and induce cell death. SCLC-specific gene expression was
further potentiated by fusing the hASH1-promoter region to a regulatory region from the
EZH2-gene, which is generally associated with cell proliferation in embryonic development
and activated in many malignancies.
The specificity of the hASH1-promoter was further evaluated by systemic treatment of
mice with a hASH1-promoter luciferase reporter construct packed in a non-viral delivery
vector. While an unspecific CMV-promoter construct induced luciferase expression in
normal tissues, no signal was detected in mice treated with hASH1-promoter regulated
luciferase gene. Collectively, these results prompt further therapeutic in vivo investigations
of hASH1 and hASH1EZH2-promoter SCLC gene therapy.
In spite of high and specific gene expression using this strategy in vitro it is likely that the
present lack of effective systemic gene delivery systems may limit the therapeutic
efficiency of transcriptionally targeted cancer gene therapy in vivo. Increasing efforts have
emerged to improve gene therapy delivery by means of targeting the vector to highly
expressed cell surface receptors on the cancer cells using ligands or receptor specific
antibodies. In pursuit of this task, NPR was identified as highly expressed in SCLC
compared to normal tissues and surface membrane association was confirmed. However,
it has not been possible to identify ligands for NPR, which retain functionality when applied
101
Conclusion
exogenously and the use of this recptor for targeting gene delivery therefore awaits the
identification of novel ligands or development of specific NPR-targeting antibodies. Since
NPR has previously been associated with binding of the snake venom neurotoxin taipoxin,
we evaluated the effect of taipoxin on SCLC cell survival and its correlation with
expression of NPR and associated NPs. A number of SCLC cell lines were sensitive to
taipoxin at nanomolar concentrations rendering the control cell lines unaffected. Since no
correlation was observed between NPs and taipoxin sensitivity it is likely that the taipoxin
uptake mechanism and activity is independent of NPs. Further investigations of the
internalization of taipoxin in SCLC cells are required to elucidate the toxin mechanism of
action in SCLC cells. Nevertheless, the finding that a neurotoxin can potently induce cell
death of SCLC adds further arguments to the notion that targeting the neuronal and NE
phenotype of SCLC may constitute a feasible therapeutic approach.
In recent years, it has become increasingly clear, that markers previously considered to
be confined to a rare subset of NE-cells in the lung may play a role in the general recovery
from pulmonary epithelial injury. Importantly, a recent study links expression of the NEmarker PGP9.5 to cigarette smoking, since healthy smokers express elevated levels of
PGP9.5 in the non-NE epithelium where it is normally absent. The current study reveals
that exposure of mouse lungs to the tobacco constituent naphthalene, resulting in damage
to the lung epithelium induces a similar response to that observed in smokers – namely a
transient increase in PGP9.5 expression in the non-NE epithelial cells in the days
immediately following carcinogen exposure. These results point to naphthalene as the
component in tobacco smoke involved in inducing elevated PGP9.5 in the lung. Obviously,
the mechanistic role of PGP9.5 in lung epithelium after tobacco smoke and naphthalene
exposure requires further studies, but the results indicate, that PGP9.5 may be important
for injury and stress related re-constitution of pulmonary epithelium. Furthermore, since
PGP9.5 overexpression is frequently observed in both NSCLC and SCLC tumors, there
appears to be a link between overexpression of this marker and lung carcinogenesis.
In summary, the findings of the current PhD-study illustrate that the distinct neuronal and
NE profile of SCLC is likely to provide an important platform for gaining a fuller
understanding of SCLC tumor biology, identifying novel targets and developing more
efficient therapeutics for treating this devastating disease.
102
References
enhancer. Proc Natl Acad Sci U S A 1992 April
15;89(8):3596-600.
References
14
Persson P, Jögi A, Grynfeld A, Pahlman S, Axelson H.
HASH-1 and E2-2 are expressed in human
neuroblastoma cells and form a functional complex.
Biochem Biophys Res Commun 2000 July
21;274(1):22-31.
15
Carney DN, Gazdar AF, Bepler G et al. Establishment
and identification of small cell lung cancer cell lines
having classic and variant features. Cancer Res 1985
June;45(6):2913-23.
16
Borges M, Linnoila RI, van de Velde HJ et al. An
achaete-scute homologue essential for neuroendocrine
differentiation in the lung. Nature 1997 April
24;386(6627):852-5.
17
Pedersen N, Mortensen S, Sørensen SB et al.
Transcriptional gene expression profiling of small cell
lung cancer cells. Cancer Res 2003 April
15;63(8):1943-53.
18
Jiang SX, Kameya T, Asamura H et al. hASH1
expression is closely correlated with endocrine
phenotype and differentiation extent in pulmonary
neuroendocrine tumors. Mod Pathol 2004
February;17(2):222-9.
19
Osada H, Tatematsu Y, Yatabe Y, Horio Y, Takahashi
T. ASH1 gene is a specific therapeutic target for lung
cancers with neuroendocrine features. Cancer Res
2005 December 1;65(23):10680-5.
Tischler AS, Dichter MA, Biales B. Electrical excitability
of oat cell carcinoma. J Pathol 1977 July;122(3):153-6.
20
Ball DW, Azzoli CG, Baylin SB et al. Identification of a
human achaete-scute homolog highly expressed in
neuroendocrine tumors. Proc Natl Acad Sci U S A
1993 June 15;90(12):5648-52.
Linnoila RI, Zhao B, DeMayo JL et al. Constitutive
achaete-scute homologue-1 promotes airway dysplasia
and lung neuroendocrine tumors in transgenic mice.
Cancer Res 2000 August 1;60(15):4005-9.
21
Lo LC, Johnson JE, Wuenschell CW, Saito T,
Anderson DJ. Mammalian achaete-scute homolog 1 is
transiently expressed by spatially restricted subsets of
early neuroepithelial and neural crest cells. Genes Dev
1991 September;5(9):1524-37.
Magdaleno SM, Wang G, Mireles VL, Ray MK,
Finegold MJ, DeMayo FJ. Cyclin-dependent kinase
inhibitor expression in pulmonary Clara cells
transformed with SV40 large T antigen in transgenic
mice. Cell Growth Differ 1997 February;8(2):145-55.
22
Gouyer V, Gazzeri S, Bolon I, Drevet C, Brambilla C,
Brambilla E. Mechanism of retinoblastoma gene
inactivation in the spectrum of neuroendocrine lung
tumors. Am J Respir Cell Mol Biol 1998
February;18(2):188-96.
23
Takahashi T, Takahashi T, Suzuki H et al. The p53
gene is very frequently mutated in small-cell lung
cancer with a distinct nucleotide substitution pattern.
Oncogene 1991 October;6(10):1775-8.
24
Takahashi T, Nau MM, Chiba I et al. p53: a frequent
target for genetic abnormalities in lung cancer. Science
1989 October 27;246(4929):491-4.
25
Jacks T, Fazeli A, Schmitt EM, Bronson RT, Goodell
MA, Weinberg RA. Effects of an Rb mutation in the
mouse. Nature 1992 September 24;359(6393):295300.
26
Meuwissen R, Linn SC, Linnoila RI, Zevenhoven J,
Mooi WJ, Berns A. Induction of small cell lung cancer
by somatic inactivation of both Trp53 and Rb1 in a
1
Tiseo M, Ardizzoni A. Current status of second-line
treatment and novel therapies for small cell lung
cancer. J Thorac Oncol 2007 August;2(8):764-72.
2
Govindan R, Page N, Morgensztern D et al. Changing
epidemiology of small-cell lung cancer in the United
States over the last 30 years: analysis of the
surveillance, epidemiologic, and end results database.
J Clin Oncol 2006 October 1;24(28):4539-44.
3
Onganer PU, Seckl MJ, Djamgoz MB. Neuronal
characteristics of small-cell lung cancer. Br J Cancer
2005 November 28;93(11):1197-201.
4
Addis BJ, Hamid Q, Ibrahim NB, Fahey M, Bloom SR,
Polak JM. Immunohistochemical markers of small cell
carcinoma and related neuroendocrine tumours of the
lung. J Pathol 1987 October;153(2):137-50.
5
6
7
8
9
Song P, Sekhon HS, Jia Y et al. Acetylcholine is
synthesized by and acts as an autocrine growth factor
for small cell lung carcinoma. Cancer Res 2003
January 1;63(1):214-21.
Blandino JK, Viglione MP, Bradley WA, Oie HK, Kim
YI. Voltage-dependent sodium channels in human
small-cell lung cancer cells: role in action potentials
and inhibition by Lambert-Eaton syndrome IgG. J
Membr Biol 1995 January;143(2):153-63.
10
Franco dA, Gendron-Maguire M, Swiatek PJ, Gridley T.
Cloning, sequencing and expression of the mouse
mammalian achaete-scute homolog 1 (MASH1).
Biochim Biophys Acta 1993 January 23;1171(3):323-7.
11
Ito T, Udaka N, Yazawa T et al. Basic helix-loop-helix
transcription factors regulate the neuroendocrine
differentiation of fetal mouse pulmonary epithelium.
Development 2000 September;127(18):3913-21.
12
Guillemot F, Lo LC, Johnson JE, Auerbach A,
Anderson DJ, Joyner AL. Mammalian achaete-scute
homolog 1 is required for the early development of
olfactory and autonomic neurons. Cell 1993 November
5;75(3):463-76.
13
Johnson JE, Birren SJ, Saito T, Anderson DJ. DNA
binding and transcriptional regulatory activity of
mammalian achaete-scute homologous (MASH)
proteins revealed by interaction with a muscle-specific
103
References
conditional mouse model. Cancer Cell 2003
September;4(3):181-9.
27
Schätzlein AG. Targeting of Synthetic Gene Delivery
Systems. J Biomed Biotechnol 2003;2003(2):149-58.
28
Glasgow JN, Everts M, Curiel DT. Transductional
targeting of adenovirus vectors for gene therapy.
Cancer Gene Ther 2006 September;13(9):830-44.
methyltransferase EZH2 gene. Oncogene 2004 July
29;23(34):5759-69.
41
Ross JF, Naar A, Cam H, Gregory R, Dynlacht BD.
Active repression and E2F inhibition by pRB are
biochemically distinguishable. Genes Dev 2001
February 15;15(4):392-7.
42
Bracken AP, Pasini D, Capra M, Prosperini E, Colli E,
Helin K. EZH2 is downstream of the pRB-E2F pathway,
essential for proliferation and amplified in cancer.
EMBO J 2003 October 15;22(20):5323-35.
29
Poulsen TT, Pedersen N, Poulsen HS. Replacement
and suicide gene therapy for targeted treatment of lung
cancer. Clin Lung Cancer 2005 January;6(4):227-36.
43
30
Bhattacharjee A, Richards WG, Staunton J et al.
Classification of human lung carcinomas by mRNA
expression profiling reveals distinct adenocarcinoma
subclasses. Proc Natl Acad Sci U S A 2001 November
20;98(24):13790-5.
Hensel CH, Hsieh CL, Gazdar AF et al. Altered
structure and expression of the human retinoblastoma
susceptibility gene in small cell lung cancer. Cancer
Res 1990 May 15;50(10):3067-72.
44
Bepler G, Jaques G, Neumann K, Aumuller G, Gropp
C, Havemann K. Establishment, growth properties, and
morphological characteristics of permanent human
small cell lung cancer cell lines. J Cancer Res Clin
Oncol 1987;113(1):31-40.
Rygaard K, Sorenson GD, Pettengill OS, Cate CC,
Spang-Thomsen M. Abnormalities in structure and
expression of the retinoblastoma gene in small cell
lung cancer cell lines and xenografts in nude mice.
Cancer Res 1990 September 1;50(17):5312-7.
45
Chen H, Biel MA, Borges MW et al. Tissue-specific
expression of human achaete-scute homologue-1 in
neuroendocrine tumors: transcriptional regulation by
dual inhibitory regions. Cell Growth Differ 1997
June;8(6):677-86.
Yuan J, Knorr J, Altmannsberger M et al. Expression of
p16 and lack of pRB in primary small cell lung cancer.
J Pathol 1999 November;189(3):358-62.
46
Eymin B, Gazzeri S, Brambilla C, Brambilla E. Distinct
pattern of E2F1 expression in human lung tumours:
E2F1 is upregulated in small cell lung carcinoma.
Oncogene 2001 March 29;20(14):1678-87.
Ball DW. Achaete-scute homolog-1 and Notch in lung
neuroendocrine development and cancer. Cancer Lett
2004 February 20;204(2):159-69.
47
Chen H, Thiagalingam A, Chopra H et al. Conservation
of the Drosophila lateral inhibition pathway in human
lung cancer: a hairy-related protein (HES-1) directly
represses achaete-scute homolog-1 expression. Proc
Natl Acad Sci U S A 1997 May 13;94(10):5355-60.
Cooper CS, Nicholson AG, Foster C et al. Nuclear
overexpression of the E2F3 transcription factor in
human lung cancer. Lung Cancer 2006
November;54(2):155-62.
48
Moolten FL. Tumor chemosensitivity conferred by
inserted herpes thymidine kinase genes: paradigm for
a prospective cancer control strategy. Cancer Res
1986 October;46(10):5276-81.
Sriuranpong V, Borges MW, Ravi RK et al. Notch
signaling induces cell cycle arrest in small cell lung
cancer cells. Cancer Res 2001 April 1;61(7):3200-5.
49
Ilsley DD, Lee SH, Miller WH, Kuchta RD. Acyclic
guanosine analogs inhibit DNA polymerases alpha,
delta, and epsilon with very different potencies and
have unique mechanisms of action. Biochemistry 1995
February 28;34(8):2504-10.
50
Waehler R, Russell SJ, Curiel DT. Engineering
targeted viral vectors for gene therapy. Nat Rev Genet
2007 August;8(8):573-87.
51
Li SD, Huang L. Gene therapy progress and prospects:
non-viral gene therapy by systemic delivery. Gene Ther
2006 September;13(18):1313-9.
52
Kiang A, Hartman ZC, Everett RS et al. Multiple innate
inflammatory responses induced after systemic
adenovirus vector delivery depend on a functional
complement system. Mol Ther 2006
October;14(4):588-98.
53
Schuler M, Herrmann R, De Greve JL et al.
Adenovirus-mediated wild-type p53 gene transfer in
patients receiving chemotherapy for advanced nonsmall-cell lung cancer: results of a multicenter phase II
study. J Clin Oncol 2001 March 15;19(6):1750-8.
31
32
33
34
35
36
Sriuranpong V, Borges MW, Strock CL et al. Notch
signaling induces rapid degradation of achaete-scute
homolog 1. Mol Cell Biol 2002 May;22(9):3129-39.
37
Cao R, Wang L, Wang H et al. Role of histone H3
lysine 27 methylation in Polycomb-group silencing.
Science 2002 November 1;298(5595):1039-43.
38
Kuzmichev A, Nishioka K, Erdjument-Bromage H,
Tempst P, Reinberg D. Histone methyltransferase
activity associated with a human multiprotein complex
containing the Enhancer of Zeste protein. Genes Dev
2002 November 15;16(22):2893-905.
39
40
Müller H, Bracken AP, Vernell R et al. E2Fs regulate
the expression of genes involved in differentiation,
development, proliferation, and apoptosis. Genes Dev
2001 February 1;15(3):267-85.
Tang X, Milyavsky M, Shats I, Erez N, Goldfinger N,
Rotter V. Activated p53 suppresses the histone
104
References
54
Bernt KM, Ni S, Gaggar A, Li ZY, Shayakhmetov DM,
Lieber A. The effect of sequestration by nontarget
tissues on anti-tumor efficacy of systemically applied,
conditionally replicating adenovirus vectors. Mol Ther
2003 November;8(5):746-55.
55
Templeton NS, Lasic DD, Frederik PM, Strey HH,
Roberts DD, Pavlakis GN. Improved DNA: liposome
complexes for increased systemic delivery and gene
expression. Nat Biotechnol 1997 July;15(7):647-52.
67
Vermes A, Guchelaar HJ, Dankert J. Flucytosine: a
review of its pharmacology, clinical indications,
pharmacokinetics, toxicity and drug interactions. J
Antimicrob Chemother 2000 August;46(2):171-9.
56
Ramesh R, Saeki T, Templeton NS et al. Successful
treatment of primary and disseminated human lung
cancers by systemic delivery of tumor suppressor
genes using an improved liposome vector. Mol Ther
2001 March;3(3):337-50.
68
Graepler F, Lemken ML, Wybranietz WA et al.
Bifunctional chimeric SuperCD suicide gene -YCD:
YUPRT fusion is highly effective in a rat hepatoma
model. World J Gastroenterol 2005 November
28;11(44):6910-9.
57
Ito I, Ji L, Tanaka F et al. Liposomal vector mediated
delivery of the 3p FUS1 gene demonstrates potent
antitumor activity against human lung cancer in vivo.
Cancer Gene Ther 2004 November;11(11):733-9.
69
Pedersen N, Pedersen MW, Lan MS, Breslin MB,
Poulsen HS. The insulinoma-associated 1: a novel
promoter for targeted cancer gene therapy for smallcell lung cancer. Cancer Gene Ther 2006
April;13(4):375-84.
58
Chen JS, Liu JC, Shen L et al. Cancer-specific
activation of the survivin promoter and its potential use
in gene therapy. Cancer Gene Ther 2004
November;11(11):740-7.
70
van Dillen IJ, Mulder NH, Vaalburg W, de Vries EF,
Hospers GA. Influence of the bystander effect on HSVtk/GCV gene therapy. A review. Curr Gene Ther 2002
September;2(3):307-22.
71
Huber BE, Austin EA, Richards CA, Davis ST, Good
SS. Metabolism of 5-fluorocytosine to 5-fluorouracil in
human colorectal tumor cells transduced with the
cytosine deaminase gene: significant antitumor effects
when only a small percentage of tumor cells express
cytosine deaminase. Proc Natl Acad Sci U S A 1994
August 16;91(17):8302-6.
72
Khatri A, Zhang B, Doherty E et al. Combination of
cytosine deaminase with uracil phosphoribosyl
transferase leads to local and distant bystander effects
against RM1 prostate cancer in mice. J Gene Med
2006 September;8(9):1086-96.
73
Poulsen TT. Receptor Candidates for Targeted
Treatment of Small Cell Lung Cancer Masters Thesis
submitted to the Faculty of Health, University of
Copenhagen, Copenhagen, Denmark; 2004.
74
Goodman AR, Cardozo T, Abagyan R, Altmeyer A,
Wisniewski HG, Vilcek J. Long pentraxins: an emerging
group of proteins with diverse functions. Cytokine
Growth Factor Rev 1996 August;7(2):191-202.
75
Schlimgen AK, Helms JA, Vogel H, Perin MS. Neuronal
pentraxin, a secreted protein with homology to acute
phase proteins of the immune system. Neuron 1995
March;14(3):519-26.
76
Hsu YC, Perin MS. Human neuronal pentraxin II
(NPTX2): conservation, genomic structure, and
chromosomal localization. Genomics 1995 July
20;28(2):220-7.
77
Dodds DC, Omeis IA, Cushman SJ, Helms JA, Perin
MS. Neuronal pentraxin receptor, a novel putative
integral membrane pentraxin that interacts with
neuronal pentraxin 1 and 2 and taipoxin- associated
calcium-binding protein 49. J Biol Chem 1997 August
1.
59
60
61
62
63
Gopalan B, Ito I, Branch CD, Stephens C, Roth JA,
Ramesh R. Nanoparticle based systemic gene therapy
for lung cancer: molecular mechanisms and strategies
to suppress nanoparticle-mediated inflammatory
response. Technol Cancer Res Treat 2004
December;3(6):647-57.
Lu C, Sepulveda CA, Ji L et al. Systemic therapy with
tumor suppressor FUS1-nanoparticles for stage IV lung
cancer. American Association for Cancer Research
Annual Meeting: Proceedings; 2007 Apr 14-18; Los
Angeles, CA.Philadelphia (PA): AACR; 2007.Abstract
nr LB-348 . 17-4-2007.
Ito I, Began G, Mohiuddin I et al. Increased uptake of
liposomal-DNA complexes by lung metastases
following intravenous administration. Mol Ther 2003
March;7(3):409-18.
Christensen CL. Therapeutic Genes for Small Cell
Lung Cancer Gene Therapy University of Copenhagen,
Faculty of Health, Copenhagen, Denmark; 2007.
Christensen CL, Pedersen N, Poulsen TT, Rohde M,
Poulsen HS. Effect of therapeutic genes for small cell
lung cancer gene therapy. American Association for
Cancer Research Annual Meeting: Proceedings; 2007
Apr 14-18; Los Angeles, CA.Philadelphia (PA): AACR;
2007.Abstract nr 3322 . 2007.
64
Mayer MP, Bukau B. Hsp70 chaperones: cellular
functions and molecular mechanism. Cell Mol Life Sci
2005 March;62(6):670-84.
65
Nishizaki M, Sasaki J, Fang B et al. Synergistic tumor
suppression by coexpression of FHIT and p53
coincides with FHIT-mediated MDM2 inactivation and
p53 stabilization in human non-small cell lung cancer
cells. Cancer Res 2004 August 15;64(16):5745-52.
66
Deng WG, Kawashima H, Wu G et al. Synergistic
tumor suppression by coexpression of FUS1 and p53
is associated with down-regulation of murine double
minute-2 and activation of the apoptotic proteaseactivating factor 1-dependent apoptotic pathway in
human non-small cell lung cancer cells. Cancer Res
2007 January 15;67(2):709-17.
105
References
78
Kirkpatrick LL, Matzuk MM, Dodds DC, Perin MS.
Biochemical interactions of the neuronal pentraxins.
Neuronal pentraxin (NP) receptor binds to taipoxin and
taipoxin-associated calcium-binding protein 49 via NP1
and NP2. J Biol Chem 2000 June 9;275(23):17786-92.
90
Lind P, Eaker D. Amino-acid sequence of the alphasubunit of taipoxin, an extremely potent presynaptic
neurotoxin from the Australian snake taipan
(Oxyuranus s. scutellatus). Eur J Biochem 1982
June;124(3):441-7.
79
Sia GM, Beique JC, Rumbaugh G, Cho R, Worley PF,
Huganir RL. Interaction of the N-terminal domain of the
AMPA receptor GluR4 subunit with the neuronal
pentraxin NP1 mediates GluR4 synaptic recruitment.
Neuron 2007 July 5;55(1):87-102.
91
Anangi R, Chen CY, Cheng CH et al. Expression of
snake venom toxins in Pichia pastoris. Toxin Reviews
2007;26(2):169-87.
92
Wei S, Ong WY, Thwin MM et al. Group IIA secretory
phospholipase A2 stimulates exocytosis and
neurotransmitter release in pheochromocytoma-12
cells and cultured rat hippocampal neurons.
Neuroscience 2003;121(4):891-8.
93
Swenson S, Ramu S, Markland FS. Anti-angiogenesis
and RGD-containing snake venom disintegrins. Curr
Pharm Des 2007;13(28):2860-71.
94
Yan CH, Yang YP, Qin ZH, Gu ZL, Reid P, Liang ZQ.
Autophagy is involved in cytotoxic effects of crotoxin in
human breast cancer cell line MCF-7 cells. Acta
Pharmacol Sin 2007 April;28(4):540-8.
95
Cull-Candy SG, Fohlman J, Gustavsson D, LullmannRauch R, Thesleff S. The effects of taipoxin and
notexin on the function and fine structure of the murine
neuromuscular junction. Neuroscience 1976
June;1(3):175-80.
Araya C, Lomonte B. Antitumor effects of cationic
synthetic peptides derived from Lys49 phospholipase
A2 homologues of snake venoms. Cell Biol Int 2007
March;31(3):263-8.
96
Weichselbaum M, Sparrow MP, Hamilton EJ,
Thompson PJ, Knight DA. A confocal microscopic
study of solitary pulmonary neuroendocrine cells in
human airway epithelium. Respir Res 2005;6:115.
Harris JB, Grubb BD, Maltin CA, Dixon R. The
neurotoxicity of the venom phospholipases A(2),
notexin and taipoxin. Exp Neurol 2000
February;161(2):517-26.
97
Boers JE, den Brok JL, Koudstaal J, Arends JW,
Thunnissen FB. Number and proliferation of
neuroendocrine cells in normal human airway
epithelium. Am J Respir Crit Care Med 1996
September;154(3 Pt 1):758-63.
98
Engelholm SA, Spang-Thomsen M, Vindelov LL et al.
Comparison of characteristics of human small cell
carcinoma of the lung in patients, in vitro and
transplanted into nude mice. Acta Pathol Microbiol
Immunol Scand [A] 1986 September;94(5):325-36.
Van LA. Pulmonary neuroendocrine cells (PNEC) and
neuroepithelial bodies (NEB): chemoreceptors and
regulators of lung development. Paediatr Respir Rev
2001 June;2(2):171-6.
99
Ito T, Udaka N, Okudela K, Yazawa T, Kitamura H.
Mechanisms of neuroendocrine differentiation in
pulmonary neuroendocrine cells and small cell
carcinoma. Endocr Pathol 2003;14(2):133-9.
Onganer PU, Djamgoz MB. Small-cell lung cancer
(human): potentiation of endocytic membrane activity
by voltage-gated Na(+) channel expression in vitro. J
Membr Biol 2005 March;204(2):67-75.
100
O'Kelly I, Stephens RH, Peers C, Kemp PJ. Potential
identification of the O2-sensitive K+ current in a human
neuroepithelial body-derived cell line. Am J Physiol
1999 January;276(1 Pt 1):L96-L104.
101
Youngson C, Nurse C, Yeger H, Cutz E. Oxygen
sensing in airway chemoreceptors. Nature 1993
September 9;365(6442):153-5.
102
Peake JL, Reynolds SD, Stripp BR, Stephens KE,
Pinkerton KE. Alteration of pulmonary neuroendocrine
cells during epithelial repair of naphthalene-induced
airway injury. Am J Pathol 2000 January;156(1):27986.
103
Gosney JR, Sissons MC, Allibone RO, Blakey AF.
Pulmonary endocrine cells in chronic bronchitis and
emphysema. J Pathol 1989 February;157(2):127-33.
80
Montecucco C, Rossetto O. How do presynaptic PLA2
neurotoxins block nerve terminals? Trends Biochem
Sci 2000 June;25(6):266-70.
81
Fohlman J, Eaker D, Karlsson E, Thesleff S. Taipoxin,
an extremely potent presynaptic neurotoxin from the
venom of the australian snake taipan (Oxyuranus s.
scutellatus). Isolation, characterization, quaternary
structure and pharmacological properties. Eur J
Biochem 1976 September 15;68(2):457-69.
82
83
84
85
86
87
88
89
Rigoni M, Caccin P, Gschmeissner S et al. Equivalent
effects of snake PLA2 neurotoxins and
lysophospholipid-fatty acid mixtures. Science 2005
December 9;310(5754):1678-80.
Ñeco P, Rossetto O, Gil A, Montecucco C, Gutierrez
LM. Taipoxin induces F-actin fragmentation and
enhances release of catecholamines in bovine
chromaffin cells. J Neurochem 2003 April;85(2):329-37.
Lipps BV. Isolation of subunits, alpha, beta and gamma
of the complex taipoxin from the venom of Australian
taipan snake (Oxyuranus s. scutellatus):
characterization of beta taipoxin as a potent mitogen.
Toxicon 2000 December;38(12):1845-54.
Fohlman J, Lind P, Eaker D. Taipoxin, an extremely
potent presynaptic snake venom neurotoxin.
Elucidation of the primary structure of the acidic
carbohydrate-containing taipoxin-subunit, a
prophospholipase homolog. FEBS Lett 1977 December
15;84(2):367-71.
106
References
104
105
Linnoila RI, Jensen-Taubman S, Kazanjian A, Grimes
HL. Loss of GFI1 impairs pulmonary neuroendorine cell
proliferation, but the neuroendocrine phenotype has
limited impact on post-naphthalene airway repair. Lab
Invest 2007 April;87(4):336-44.
Hong KU, Reynolds SD, Giangreco A, Hurley CM,
Stripp BR. Clara cell secretory protein-expressing cells
of the airway neuroepithelial body microenvironment
include a label-retaining subset and are critical for
epithelial renewal after progenitor cell depletion. Am J
Respir Cell Mol Biol 2001 June;24(6):671-81.
106
Sheard JD, Gosney JR. Endocrine cells in tumourbearing lungs. Thorax 1996 July;51(7):721-6.
107
Carolan BJ, Heguy A, Harvey BG, Leopold PL, Ferris
B, Crystal RG. Up-regulation of expression of the
ubiquitin carboxyl-terminal hydrolase L1 gene in human
airway epithelium of cigarette smokers. Cancer Res
2006 November 15;66(22):10729-40.
108
Setsuie R, Wada K. The functions of UCH-L1 and its
relation to neurodegenerative diseases. Neurochem Int
2007 July;51(2-4):105-11.
109
Choi J, Levey AI, Weintraub ST et al. Oxidative
modifications and down-regulation of ubiquitin
carboxyl-terminal hydrolase L1 associated with
idiopathic Parkinson's and Alzheimer's diseases. J Biol
Chem 2004 March 26;279(13):13256-64.
110
111
112
Gong B, Cao Z, Zheng P et al. Ubiquitin hydrolase
Uch-L1 rescues beta-amyloid-induced decreases in
synaptic function and contextual memory. Cell 2006
August 25;126(4):775-88.
Harada T, Harada C, Wang YL et al. Role of ubiquitin
carboxy terminal hydrolase-L1 in neural cell apoptosis
induced by ischemic retinal injury in vivo. Am J Pathol
2004 January;164(1):59-64.
Hibi K, Liu Q, Beaudry GA et al. Serial analysis of gene
expression in non-small cell lung cancer. Cancer Res
1998 December 15;58(24):5690-4.
113
Hibi K, Westra WH, Borges M, Goodman S, Sidransky
D, Jen J. PGP9.5 as a candidate tumor marker for nonsmall-cell lung cancer. Am J Pathol 1999
September;155(3):711-5.
114
Chen G, Gharib TG, Huang CC et al. Proteomic
analysis of lung adenocarcinoma: identification of a
highly expressed set of proteins in tumors. Clin Cancer
Res 2002 July;8(7):2298-305.
115
Okochi-Takada E, Nakazawa K, Wakabayashi M et al.
Silencing of the UCHL1 gene in human colorectal and
ovarian cancers. Int J Cancer 2006 September
15;119(6):1338-44.
116
Caballero OL, Resto V, Patturajan M et al. Interaction
and colocalization of PGP9.5 with JAB1 and p27(Kip1).
Oncogene 2002 May 2;21(19):3003-10.
117
Mann DA, Trowern AR, Lavender FL, Whittaker PA,
Thompson RJ. Identification of evolutionary conserved
regulatory sequences in the 5' untranscribed region of
the neural-specific ubiquitin C-terminal hydrolase
(PGP9.5) gene. J Neurochem 1996 January;66(1):3546.
118
Bittencourt Rosas SL, Caballero OL, Dong SM, da
Costa Carvalho MG, Sidransky D, Jen J. Methylation
status in the promoter region of the human PGP9.5
gene in cancer and normal tissues. Cancer Lett 2001
September 10;170(1):73-9.
119
Schmeltz I, Tosk J, Hoffmann D. Formation and
determination of naphthalenes in cigarette smoke. Anal
Chem 1976 April;48(4):645-50.
120
Watkins DN, Berman DM, Burkholder SG, Wang B,
Beachy PA, Baylin SB. Hedgehog signalling within
airway epithelial progenitors and in small-cell lung
cancer. Nature 2003 March 20;422(6929):313-7.
121
Vestergaard J, Pedersen MW, Pedersen N et al.
Hedgehog signaling in small-cell lung cancer: frequent
in vivo but a rare event in vitro. Lung Cancer 2006
June;52(3):281-90.
122
Kazanjian A, Gross EA, Grimes HL. The growth factor
independence-1 transcription factor: new functions and
new insights. Crit Rev Oncol Hematol 2006
August;59(2):85-97.
123
Kazanjian A, Wallis D, Au N et al. Growth factor
independence-1 is expressed in primary human
neuroendocrine lung carcinomas and mediates the
differentiation of murine pulmonary neuroendocrine
cells. Cancer Res 2004 October 1;64(19):6874-82.
107
Appendix I: A Cre-loxP based strategy for cloning of mammalian promoters
Appendix I: A Cre-loxP based strategy for cloning of mammalian promoters
A primary research activity at the Department of Radiation biology in recent years and a
main focus of the current PhD-study has been the cloning, isolation and evaluation of
different promoter regions for use in SCLC gene therapy. These studies have more
recently been further extended to evaluate different therapeutic gene systems for SCLC
gene therapy.
For the characterization of different promoters in various reporter and therapeutic gene
systems, extensive and laborious DNA-cloning is necessary, which is traditionally
performed using various restriction enzymes and DNA-ligase. However, these strategies
present a number of problems, such as discrepancy between the published promoter
region and the cloned sequence resulting in addition or lack of restriction sites compared
to the published DNA-sequence, difference in restriction sequences between expression
vectors etc.
Therefore, we aimed to develop a Cre-loxP based cloning system, which is independent
of restriction enzymes and allows for a high throughput shuttling of cloned promoter
regions between different expression vectors. The developed system is presented in the
following manuscript.
108
Appendix I: A Cre-loxP based strategy for cloning of mammalian promoters
Appendix Manuscript I
Cre-loxP recombination vectors for promoter studies
Authors:
Nina Pedersen, Thomas T. Poulsen and Hans S. Poulsen
Manuscript published in Electronic Journal of Biotechnology, 2007 April; 10: 315-321
Author Contributions:
Nina Pedersen: All experimental work and design (except ASCL1-cloning and reporter
gene assay); Preparation of manuscript
Thomas T. Poulsen: ASCL1 cloning and reporter gene assay; Revision of figures and
manuscript
Hans S. Poulsen: Manuscript revision
109
Appendix I: A Cre-loxP based strategy for cloning of mammalian promoters
110
Appendix I: A Cre-loxP based strategy for cloning of mammalian promoters
111
Appendix I: A Cre-loxP based strategy for cloning of mammalian promoters
112
Appendix I: A Cre-loxP based strategy for cloning of mammalian promoters
113
Appendix I: A Cre-loxP based strategy for cloning of mammalian promoters
114
Appendix I: A Cre-loxP based strategy for cloning of mammalian promoters
115
Appendix I: A Cre-loxP based strategy for cloning of mammalian promoters
116
Appendix II: Book Chapter: Molecular Biology of Lung Cancer
Appendix II: Book Chapter: Molecular Biology of Lung Cancer
Due to the high disease prevalence and poor prognosis, the molecular biological
characteristics of NSCLC and SCLC have been intensively studied. The book chapter
presented in the following sections was composed for the 2nd edition of the Textbook on
Lung Cancer, which is published by the International Association for the Study of Lung
Cancer (IASLC) and presents an overview of the molecular aberrations observed in lung
cancer for a clinical audience.
117
Appendix II: Book Chapter: Molecular Biology of Lung Cancer
Appendix Manuscript II
Book Chapter: Molecular Biology of Lung Cancer
Authors:
Thomas T. Poulsen, Hans S. Poulsen and Helle Pappot
Manuscript will be published as Chapter 3 in the IASLC Textbook of Lung Cancer, 2nd
edition, edited by Heine H. Hansen to be released in Spring 2008.
Author Contributions:
Thomas T. Poulsen: Authored the sections: “Growth Signals and Lung Cancer”;
“Aberrant anti-growth signaling”; “Replicative Potential and Telomerases” and “Conclusion”
Hans S. Poulsen: Authored the section: “Apoptosis in Lung Cancer”
Helle Pappot: Authored the sections: “Introduction”; “Angiogenesis” and “Tissue Invasion
and Metastasis”
118
Appendix II: Book Chapter: Molecular Biology of Lung Cancer
119
Appendix II: Book Chapter: Molecular Biology of Lung Cancer
120
Appendix II: Book Chapter: Molecular Biology of Lung Cancer
121
Appendix II: Book Chapter: Molecular Biology of Lung Cancer
122
Appendix II: Book Chapter: Molecular Biology of Lung Cancer
123
Appendix II: Book Chapter: Molecular Biology of Lung Cancer
124
Appendix II: Book Chapter: Molecular Biology of Lung Cancer
125
Appendix II: Book Chapter: Molecular Biology of Lung Cancer
126
Appendix II: Book Chapter: Molecular Biology of Lung Cancer
127
Appendix II: Book Chapter: Molecular Biology of Lung Cancer
128
Appendix II: Book Chapter: Molecular Biology of Lung Cancer
129
Appendix II: Book Chapter: Molecular Biology of Lung Cancer
130
Appendix II: Book Chapter: Molecular Biology of Lung Cancer
131
Appendix II: Book Chapter: Molecular Biology of Lung Cancer
132
Appendix II: Book Chapter: Molecular Biology of Lung Cancer
133
Appendix III: Declarations of Co-Authorship
Appendix III: Declarations of Co-Authorship
On the following pages are copies of co-authorship declarations for the manuscripts and
published papers enclosed in this thesis.
Manuscript I
134
Appendix III: Declarations of Co-Authorship
Manuscript II
135
Appendix III: Declarations of Co-Authorship
Manuscript III
136
Appendix III: Declarations of Co-Authorship
Appendix Manuscript I
137
Appendix III: Declarations of Co-Authorship
Appendix Manuscript II