- Persatuan Genetik Malaysia

advertisement
Abstract & Proceeding
Advances in Genetics,
Biotechnology and Genomics
3rd – 5th December 2013
Palm Garden Hotel IOI Resort, Putrajaya, Malaysia
www.persatuangenetikmalaysia.com
Contents
1
Plenary Abstract
2
Oral Presentation Abstract
18
3
Poster Presentation Abstract
37
4
Extended Abstract
81
1
10th Mendel Lecture: Frontline of Evolutionary and Comparative Genomics
Takashi Gojobori
KAUST (King Abdullah University of Science and Technology), KSA and
NIG (National Institute of Genetics), Mishima, Japan
E-mail: [email protected]
Acute advancement of nucleotide sequencers called the “Next-Generation Sequencers (NGS)” has changed the premise of genome-related
researches: Time and cost for sequencing genomes and transcriptomes are reduced by several orders of magnitudes (namely, a thousand
to ten thousand times reduction). Thanks to the NGS technologies, genomic sciences are now in tremendous progress in a wide spectrum
of research areas. For example, the personalized medicine on the basis of genomic information has become almost realistic. Moreover, the
evolutionary and comparative studies can be now conducted at the levels of genome and gene expression. The so-called meta-genomics
conducted by the NGS technologies will provide us with a unique opportunity of elucidating microorganism composition in the soil, marine,
and air. Here, first, I would present the overview of the current situation of genomic research, putting emphasis on the importance of data
analysis and database construction. Then, I would discuss a possibility of elucidating the evolutionary origin of the neural system, exploring
marine micro-biodiversity by a novel method of real-time monitoring meta-genomics. Finally, I would like to propose the vision of our
society in the future that can be foreseen through the studies of genomic information: I call it as the “Genome Information-oriented Society
(g-Society).”
PLENARY 1
Lynch Syndrome: A Paradigm for Advancement of Identification and
Management of Genetic Risk
Finlay Macrae
Professor, Depts of Medicine, University of Melbourne and Monash University
E-mail: [email protected]
Contemporary approaches to screening for Lynch Syndrome principally depend on tumour testing for molecular or protein expression
signatures indicating mismatch repair deficiency - microsatellite instability (MSI) or through immunohistochemistry (IHC). Traditionally these
have been applied to patients selected either by age or family history, enshrined in Amsterdam and Bethesda criteria. Next gen sequencing
technologies can facilitate detection of MSI, promising a cheaper approach in population screening. Germline testing conventionally with
Sanger sequencing and MLPA (for large deletions and duplications) follows targeting the gene indicated as mutated in tumours (eg by IHC).
This paradigm is shifting as exome capturing, exome sequencing and whole gene sequencing are becoming cheaper. Blood (RNA) based
screening strategies have the potential to pinpoint the specific MMR gene – overcoming the need to always have access to tumours. Even
the tumour testing strategy itself may become obsolete, once the costs of whole exomeor genome sequencing fall further.
If one broadens the goals of gene testing to provide a once in a lifetime DNA template which could provide filtered information unfolding
with application of age- specific risk management strategies – with a diminishingly small cost for the sequencing and other testing data
associated with anyone disease detection and risk management strategy.
But how and who will deal with the tsunami of variants of uncertain significance identified through this clinical approach; will
deletions/duplications be identified, and if so how will they be interpreted in current algorithms?
InSiGHThas implemented a widely acclaimed process to curate and assign pathogenicity to variants drawing on its world wide reach of
expertise, and access to unpublished information, to reach conclusions on pathogenicity otherwise not possible from the published
literature alone. Good governance, outstanding pro bono commitment of its expert members, standard setting, a full time curator and a
process of microattribution have important elements its success
Interested professionals are invited to join InSiGHT (www.insight-group.org), and its VIC (contact [email protected]). We particularly
welcome submissions to the InSIGHT database (contact [email protected]
1 | MGC10
S1: GENOMICS
S1(a): Cytogenetics and Cytometric Applications in Oil Palm Genetics and Breeding
Hjh. Maria Madon
Malaysia Palm Oil Board
E-mail: [email protected]
Cytogenetics and cytometric applications have been used routinely in MPOB to implement studies involving the oil palm nucleus particularly
the chromosomes and whole nucleus. Cytogenetics analysis include basic cytological preparations for performing chromosome counting,
karyotyping, anomalies observation, identification of microspore nuclear stages, locating DNA sequences such as rDNA on chromosomes
via FISH (fluorescence in situ hybridization) technique and characterizing the parental genomes in interspecific hybrids via GISH (genomic in
situ hybridization) technique. Cytometric applications such as flow cytometry for estimation of genome size and determination of ploidy level
have been optimized for oil palm. In contrast, genome sizes of oil palm calli and suspension cultures are not possible to be estimated by
flow cytometry due to limitation of samples and low nuclei population hence an image cytometry method has been developed. Due to the
advances in oil palm genome studies, techniques such as flow cytogenetics to sort individual chromosomes as well as high resolution FISH
to locate unique sequences on oil palm chromosomes for identification need to be developed.
S1(b): Gene Signatures as Predictor of Survival in Colorectal Cancer
Roslan Harun
UKM Medical Molecular Biology Institute, Universiti Kebangsaan Malaysia
E-mail: [email protected]
Histopathology assessment is inadequate to predict disease progression and clinical outcomes in colorectal cancers (CRC). Patients may
experience different clinical outcomes although they are in the same stage of cancers. A more specific and sensitive biomarkers to
determine the patient’s survival are needed. The aim of this study was to determine gene expression signatures that could predict the
survival of patients with colorectal cancers. We examined microarray gene expression profiles of 78 FFPE colorectal tissues samples using
the whole genome cD
DNA-mediated Annealing, Selection, extension and Ligation (DASL) assay (Illumina, USA). The gene expression data
was analysed using GeneSpring GX 12.0.2.Outliers were detected and automatically replacedwith robust means. The normalised
expression values were randomly divided into training and test sets. Hundred different data sets of training and test sets were generated
randomly andthreedifferent statistical tests (SAM, LIMMA and t-test) were applied to identify the differentially expressed genes. There were
16 significant genes identified from the permutation, namely MRPL52, TRIP13, ITPRIP, SLC38A9, FRMD6, SORCS2, TAT, NOTCH2,
CPXCR1, PIGM, ELTDI, HSD17B13, OR10H5, PDC, CCDC66 and GFRA4.This 16-gene signaturewas able tosignificantly predict the
survival of patients with CRCs compared to the conventional Dukes’ classificationin bothtraining (p= 1.603e-09) and test set (p=3.675e-10).
The performance of this signaturewas further validated as a significant independent predictor of survival (p=0.0121) in independent external
validation datasets from Australian cohort (n=185).In conclusion, profiling of these 16 genes may provide a more accurate method to
predict survival of patients with CRCs and assists in identifying patients who require more intensive treatment.
2 | MGC10
S2: BIOTECHNOLOGY
S2(a): What Modern Biotechnology Researchers Need to Know to Comply with the Biosafety Act 2007
Letchumanan Ramatha and Mohana Anita Anthonysamy
Department of Biosafety, Ministry of Natural Resources and Environment, Putrajaya, Malaysia.
E-mail: [email protected]
There is a huge advance in gene manipulation research that has moved beyond the conventional techniques. The results of this
advancement can contribute to sustainability of food, environment and even energy. Modern biotechnology offers great potential through
the creation of living modified organisms (LMOs) and its products but at the same time draws concern that there should be safety in
handling, waste management and biosafety measures taken to prevent unintended release from a contained use facility. Research activities
involving modern biotechnology are regulated through the Biosafety Act 2007 and the Biosafety (Approval and Notification) Regulations
2010. It is pertinent for a researcher to know what information to provide and how to get an approval from the National Biosafety Board to
conduct such research activities. In addition, there is a set up of Institutional Biosafety Committee (IBC) at all institutes that are involved in
modern biotechnology research activities. The IBC plays a crucial role to monitor and ensure compliance to risk mitigation measures at the
institutional level. Emphasis is given on safe handling, therefore a researcher is required to establish effective risk management strategies
and an emergency response plan for the activities conducted based on a risk assessment done. The Department of Biosafety provides
guidance on risk assessment through various publications to enable safe handling and conduct of modern biotechnology research activities.
S2(b): Sustainable Biotechnology Business Development Through Bioeconomy Transformation
Programme
K. I. Kandasamy
Malaysian Biotechnology Corporation
Kuala Lumpur, Malaysia
E-mail: [email protected]
Humans have benefited tremendously from the evolution of science including biotechnology, where science has influenced every aspect of
our lives. Over the past decades, the advances in biotechnologyhad ensured safety, sustainability and environmental protection, in the
development of most industries, including agriculture, healthcare and industrial processes. This is particularly so with the global demand
for Agriculture produce expanding rapidly due to increasing population and shrinking availability of arable land. The Food and Agriculture
Organisation (FAO) estimates that to feed a population of 9.3 billion people in 2050, food production will need to increase by 70% of which
90% will need to occur through intensification on existing arable land. In addition to which, a major portion of this has to happen in the
developing world. Furthermore, food security is no longer the only factor affecting nations and policies around the world, but also food
safety and the need to ensure sustainability, both in food production as well as ensuring environmentally safe production methods.The
increasing use of biotechnology in primary production (agriculture), healthcare and industrial application has led to a strategic interest by
many nations in the development of a bio-based economy, or bioeconomy. Broadly speaking, a bioeconomy is an economy based on
renewable biological resources that are converted into food, feed, energy, chemicals, and healthcare/wellness products via innovative and
efficient technologies. Malaysia, being one of the most competitive biotechnology hubs in the Asia-Pacific,has joined the rest of the world
in harnessing its potential through bioeconomy. Where, the Organisation for Economic Coorperations and Development (OECD) has
estimated that by 2030, the global bioeconomy will contribute an average of 2.7% to the world’s Gross Domestic Product (GDP).
3 | MGC10
S3: GENETICS
S3(a): Tracing the Colonization Route and Phylogeography of the Freshwater Tire Track Eel,
Mastacembelus favus in Southeast Asia
Jamsari Amirul Firdaus Jamaluddin1, Amiruddin Ahmad 2, Nam So3, Bui Minh Tam 4,
Preeda Phumee 5 and Siti Azizah Mohd Nor1,6
1
School of Biological Sciences, Universiti Sains Malaysia, Penang, Malaysia
2
Faculty of Science & Technology, Universiti Malaysia Terengganu, Terengganu, Malaysia
3
Inland Fisheries Research and Development Institute (IFReDI), Phnom Penh, Cambodia
4
College of Aquaculture, Can Tho University, Vietnam
5
Faculty of Science and Fisheries and Technology, Rajamangala University of Technology Srivijaya Trang Campus, Thailand
6
Centre for Marine and Coastal Studies (CEMACS - Muka Head), Universiti Sains Malaysia, Penang, Malaysia
E-mail: [email protected]
Despite covering only 4% of the earth’s land surface, Southeast Asia has a very complex physiography, supporting an extremely
biologically diverse assemblages and rich in endemic species. The complex geological history of Southeast Asia has determined the most
important aspects of the current phylogeographical structure and distribution of biodiversity throughout the region. Numerous studies on
obligate freshwater species have been conducted to test the hypothesis, however, the results have been varied and uncertain. Therefore,
for better understanding of the effects of geological alteration for species diversification in this region, we are focusing on the genetic
structure of the Asian spiny eel, Mastacembelus favusa tropical freshwater fish which is distributed across Southeast Asia Mainland
(Thailand, Lao PDR, Cambodia, Vietnam and Peninsular Malaysia). Samples were collected from eightriversacross its native range to
evaluate the phylogeography, historical demography and species distribution by using partialcytochrome b gene.The results classified all
haplotypes into two main haplogroups (1) Lower-Middle Mekong (2) Lower Mekong + Malay-Thai Peninsula + Maeklong River. Two
genetically distinct forms of M. favus was found in Mekong River (Lower Middle Mekong/ Lower Mekong) which probably resulted from
historical drainage amalgamation.However, haplotype characteristics in Eastern Peninsular Malaysia is hypothesized to result from
postglacial dispersal from Mekong/ Central Thailand river basin to Malay-Thai Peninsula through extended Pleistocene drainage network
(Paleo-Chao Phraya River). The resultsalso indicates M. favus has clearly resided across Mekong for a long period of evolutionary time.The
study is on-going and additional collections in the Thailand river basin, Red River and Upper-Middle Mekong Regionwill generatea better
understanding of its phylogeography and biogeography,subsequently providing information on the geomorphological history of Southeast
Asia.
4 | MGC10
PLENARY 2
Integration of Omics in Translational Researches
Mohd. Zaki Salleh
Integrative Pharmacogenomics Institute (iPROMISE),
Universiti Teknologi MARA
E-mail: [email protected],[email protected]
Scientists have been working on various omics such as genomics and proteomics since the 20th century. Today, “omics” is a broad
discipline of science with the main focus to understand life via many platforms and technologies. “Omics” focus on generation and analysis
of mega scale of data/information which reflect the advancement of current scientific researches. The explosion of the omics reflects 1)
reinforced holistic point of view in understanding life, 2) expansion and differentiation of life into various encapsulated biological domains,
and 3) technical advancement in computer science to integrate complex biological data through bioinformatics. Integration of these various
subfieldsof omics to solve the puzzle of life is now the focus of many research areas. With the advanced integration of different omics
which generated complex biological knowledge, its translation into clinical would be practical. We have conducted genome sequencing of a
few pathogens that were isolated from patients who were diagnosed septicaemic in local hospitals. The genome sequences of these
bacteria were mapped and annotated for characteristics of virulence and resistance to antibiotics. The objectives are to sought for better
diagnostic tests and ways to combat resistance in patients.We had also successfully sequenced a full-genome of a Malay subject by
utilising the Next-Generation Sequencing technology available at iPROMISE. The outcome of this study is to provide novel and fundamental
knowledge on the genomic architecture which will provide useful life sciences information to the local community and also serve as an
instant resource in carrying out relevant medical research in the future. The Malay genome was successfully re-sequenced with 70x
coverage using the whole genome sequencing technologies. We identified 100,898 novel variations in the Malay genome through a
sequential filtering approach. We hope that this study will provide the bioinformatics analysis pipeline and be the starting point for the
systematic evaluation and analysis of personal genomes with its eventual application in planning therapeutic options.
S4: HUMAN GENETICS
S4(a): Challenges in Forensic DNA Profiling and Critical Issues in Interpretation of STR profiles
Seah Lay Hong
Department of Chemistry Malaysia
E-mail: [email protected]
Rapid advancements in forensic DNA technology has resulted in its increasing use to resolve crime cases, particularly in the detection of
low-level DNA traces. This has been made possible by the increasing sensitivity of STR typing kits. Low-template DNA analysis requires
careful consideration of the derived stochastic variations that lead to heterozygote imbalance, allele drop-out and increased detection of
background contamination. The relevance of the evidence and the probative value of the DNA profile are important issues in the evaluation
of forensic evidence.
5 | MGC10
S4(b): Human Genetic Determinant of Dengue Virus Susceptibility:
The Glucose-6-Phosphate Dehydrogenase (G6PD) Gene
Narazah Mohd Yusoff
Advanced Medical and Dental Institute (AMDI),
Universiti Sains Malaysia, Bertam, Penang
E-mail: [email protected]
Background:
Background Dengue virus is endemic in peninsular Malaysia. The clinical manifestations vary depending on the incubation period of the
virus as well as the immunity of the patients. Glucose-6-phosphate dehydrogenase (G6PD) deficiency is prevalent in Malaysia where the
incidence is 3.2%. It has been noted that some G6PDdeficient individuals suffer from more severe clinical presentation of dengue infection.
In this study, we aim to investigate the oxidative responses of dengue virus type 2 (DENV2) -infected monocytes from G6PD-deficient
individuals. Methodology:
Methodology Monocytes from G6PDdeficient individuals were infected with DENV2 and infection rate, levels of oxidative
species, nitric oxide (NO), superoxide anions (O2-), and oxidative stress were determined and compared with normal controls. Principal
Findings:
Findings Monocytes from G6PD-deficient individuals exhibited significantly higher infection rates compared to normal controls. In an effort
to explain the reason for this enhanced susceptibility, we investigated the production of NO and O2- in the monocytes of individuals with
G6PD deficiency compared with normal controls. We found that levels of NO and O2- were significantly lower in the DENV2-infected
monocytes from G6PD-deficient individuals compared with normal controls. Furthermore, the overall oxidative stress in DENV2-infected
monocytes from G6PD-deficient individuals was significantly higher when compared to normal controls. Correlation studies between
DENV2-infected cells and oxidative state of monocytes further confirmed these findings.. Conclusions/Significance:
Conclusions/Significance Altered redox state of
DENV2-infected monocytes from G6PD-deficient individuals appears to augment viral replication in these cells. DENV2-infected G6PDdeficient individuals may contain higher viral titers, which may be significant in enhanced virus transmission. Furthermore, granulocyte
dysfunction and higher viral loads in G6PD-deificient individuals may result in severe form of dengue infection.
S5: PLANT GENETICS
S5(a): Transcriptome: Large and Small RNA Expression in Salt Stressed Banana
Lee Wan Sin, Gudimella Ranganath, Norzulaani Khalid and *Jennifer
*Jennifer Ann Harikrishna
Centre for Research in Biotechnology for Agriculture (CEBAR) and Institute of Biological Sciences, Faculty of Science, University of Malaya
E-mail: [email protected]
The most widely consumed fruit on the planet and a staple food for millions of people in the third world countries, banana is an important
crop for world food security. World production of banana is hampered by both pathogens and harsh cultivation environments and, as with
other crops, likely to be adversely affected by climate change. Our research group uses salinity as a model stress factor to study gene
expression in the roots of the local banana, Musa acuminata cv. Berangan (AAA Genome). By examining both total RNA and small RNA
libraries, we aim to determine a clearer picture of stress related biology at a genome wide level. In the current study, several libraries were
constructed and examined by high throughput sequencing, followed by transcriptome assembly and expression analysis with various
bioinformatics tools. From comparisons of sequence data from plants stressed with sodium chloride exposure to their non-exposed
controls, we predict several new gene candidates related to a salt stress response. Among these we identified many stress related miRNA
and their targets, including new targets of known miRNA in addition to novel miRNA sequences. Our data also provide an indication that
siRNA expression patterns change in response to salt stress, providing new insights into the banana small RNAome. In this presentation,
we will share the highlights and latest findings of our banana research.
6 | MGC10
S5(b): Genetic Diversity and Practical Taxonomy of Indonesian Mango Cultivars
Alex Hartana and Fitmawa*
Department of Biology, Bogor Agricultural University,Darmaga
E-mail: [email protected]
Mango (Mangiferaindica) germplasm of Indonesia were collected since 1941 and grownat Cukur Gondang Research Station, Pasuruan,
East Java. Based on 92 morphological characters of mango plant structures, namely leaves, flowers, and fruits showed high diversity of 76
mango cultivars. Based on those characters, Unweighted Pair Group Method with Aritmatic Average (UPGMA) and SAHN clustering
produced dendrogram of mango cultivars and formed 3 main clustered with 50% similarity. However, that clustering was not determined
by fruit shapesand the origin where mango cultivars were collected. RAPD using 8 primers on 82 mango cultivars showed polymorphic of
RAPD markers suggested genetic diversity of mango germplasm, and produced dendrogram that was different from one based on their
morphological characters. A taxonomic analysis on morphological and agronomic characters obtained key identification of mango cultivars
using 17 diagnostic fruit characters of 84 mango cultivars and produced 7 main cultivar-groups: Berem, Madu, Gedong, Golek, Bapang,
Arumanis, Kepodang, and Kebo.
Key words: Indonesian mangogermplasm, genetic diversity, practical taxonomy, key identification, cultivars, RAPD.
S6: MICROBIAL GENETICS
S6(a): Arbuscular Mycorrhizal Fungi Biotechnology to Support Sustainable Agriculture
Maria Viva Rini
Department of Agrotechnology, Facylty of Agriculture, University of Lampung
E-mail: [email protected]
Mycorrhizaare symbiotic association that form between the roots of most plant species and certain soil fungi. Generally, mycorrhiza are
divided into two main groups based on the type of fungus-root structure formed: ecto- and endomycorrhiza. The most important and
most widely distributes (geographycally as well as within the plant kingdom) type of endomycorrhiza is the arbuscularmycorrhiza fungi
(AMF). The AMF has been reported formed association with more than 80% of plant species in all terrestrial habitats. There are more than
150 species from 29 genera has been identified belong to AMF. Benefit from AMF symbiosis occur because AMF hyphae extend beyond
the root hair zone, thus increasing the absorptive surface areas of the root for nutrients and water, enhance the formation of soil aggregates,
while altering the chemical and microbiological composition of rhizosphere soils. The important of AMF symbiosis for plant mineral nutrition
and water, and more generally for plant health, makes it one of potentially more useful biological means of assuring plant production with a
minimum input of chemicals such as fertilizer. Therefore, the technology to produce AMF as a biofertilizer has been establishedrapidly. A
lot of AMF products now available commercially in the market and one of them from Malaysia. There are some factors that affecting the
successful of AMF inoculum production i.e. the suitable of AMF and the host; the fertility, temperature, and moisture of media used, etc.
The most crucial problem facing by the producer of AMF is the fact that after several cycles of production using the same condition,
number of AMF spore produced are decreased tremendously. This phenomena will reduce the quality of AMF inoculum produced. To
overcome this problem, the producer need to change the condition of inoculum production. They need to reselect the host and media
condition again which yield the high AMF spore.
7 | MGC10
S6(c): Assessing the Emergence of Vibrio cholerae atypical O1 El Tor in Malaysia
and Comparative Genomics with other Vibrio cholerae
Cindy Shuan Ju Teh
Department of Medical microbiology, Faculty of Medicine, University of Malaya
E-mail: [email protected]
Sporadic outbreak of cholera by endemic O1 V. cholerae strains remain as a major health concern in Malaysia. In late 2009, acholera
outbreak occurred in Terengganu, Peninsular Malaysia. It began in the capital, Kuala Terengganu, and spread to several districts within a
week. More than 400 people were hospitalized due to acute diarrhea during the outbreak period, and resulted to one fatalitybefore the local
health authorities declared an outbreak. Molecular evidence revealed that the outbreak was caused by two genotypes of O1 V.
choleraewith indistinguishable pulsotype. The widespread atypical O1 El Tor in Asian countries was likely to be responsible for the outbreak.
Therefore, the genome of the atypical O1 El Tor strain was investigated and compared to other V. cholerae strains. Among the compared
genomes, more than 2000 homologous genes were identified. Interestingly, the Malaysian atypical O1 El Tor strain showed closer
relationship to the Haiti outbreak strains in comparison to other atypical O1 El Tor strains isolated from Indian subcontinent. In addition, the
Malaysian atypical O1 El Tor strain has inherited the genes that promote environmental fitness from 7th pandemic El Tor, and
demonstrated greater infectivity due to the retention of virulence traits of the Classical O1. The Malaysian atypical O1 El Tor strainalso
containeda~98 kb ICE-like element that harboured antibiotic resistance clusters thatbelongs to the SXT/R391 family.The unique genome
characteristics have provided the bacterium a competitiveecological dominance with greater infectivity. Without further preamble, this
explained the wide dispersal of the cholera infection in Malaysia within the four months duration in 2009.
PLENARY 3
Mapping Genetic Patterns of Marine Fish in South China Sea
Zohrah Sulaiman
Universiti Brunei Darussalam
E-mail: [email protected]
The South China Sea lies in the tropical zone of the western Pacific Ocean and covers a total area of about 3.4 million square kilometers.
The Sea is known for both its high productivity and rich diversity of its plants and animals. At least 3,365 species of fish are recorded from
the area. It provides major fisheries resource for people in Brunei Darussalam, Sabah, Sarawak, Philippines, Taiwan, China, Vietnam,
Cambodia, Thailand, Sumatra, west Malaysia and Singapore. In this study, six different species of fishes were sampled from various
locations in Southeast Asia and, studied for their proteins and genomic DNA: Rastrelliger kanagurta (Indian mackerel), Lutjanus malabaricus
(red snapper), Epinephelus coiodes (orange-spotted grouper), Sardinella gibbosa (gold stripe sardine), Scomberomorus commerson
(Spanish mackerel) and Thunnus tonggol (longtail tuna).The aim of the study is to address the following questions: (1) Is there evidence of
genetic structure in fish within South China Sea: (2) Is there evidence of inter- and intra- population variation? and (3) Is there evidence of
genetic connectivity in South China Sea and adjacent seas? The results of the studies showed that fishes were either originated from one
common gene pool, might consist of 1-2 stocks and they lacked genetic structuring. Biogeographic boundary for example, Wallace’s Line,
may separate fish stocks to east and westsides as in the case of Scomberomoru scommerson and Thunnustonggol. Contemporary
population genetic structure can also be reflective of historical episodes of isolation rather than recent patterns of connectivity. The
traditional belief that many fishes are genetically homogeneous across wide geographical scales has since shift. There is now mounting
empirical evidence of factors such as biogeographic barriers, contemporary oceanographic patterns, larval behavior, local adaptation and
the ecological requirements of each species may all be responsible in shaping population connectivity.
8 | MGC10
S7: HUMAN GENETICS
S7(a): Suspension Peripheral Blood Mononucleated Cell as Alternative Stem Cell Source
1
Shahrul Hisham, Z.A.
Z.A. 1*, Intan Zarina, Z.A. 1 & Rohaya, M.A.W. 2
School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia
2
Department of Orthodontic, Faculty of Dentistry, Universiti Kebangsaan Malaysia
E-mail: [email protected] / [email protected]
Adult stem cells are undifferentiated cells found throughout the body that divide indefinitely to replenish dying cells and regenerate damaged tissues.
Peripheral blood is one of the adult stem cells sources which consists majority of hematopoietic stem cells. However, study on suspension (non-adherent)
peripheral blood cells is not as extensive as bone marrow cells. Our aim in this study was to identify the potentialities of suspension peripheral blood cells to
differentiate into three types of mature cells which originated from different lineages. Mononucleated cells were isolated from peripheral blood using density
gradient centrifugation approach and in vitro cultured in complete medium for certain period. The stemness analysis via RT-PCR showed that the suspension
mononucleated cells were positive for hematopoietic stem cell (HSC) markers. The suspension mononucleated cells then were subjected for osteoblast,
osteoclast and chondrocyte cells differentiations using specific differentiation mediums. The differentiation analyses done showed that the suspension
mononucleated cells have the characteristics of osteoblast, osteoclast and chondrocyte cells when cultured in their respective differentiation mediums.
These indicate that the suspension mononucleated cells able to differentiate into osteoblast, osteoclast and chondrocyte cells. These three types of cells
originated from two different lineages. Osteoblasts and chondrocytes are originated from mesenchymal stem cells, whilst osteoclasts from hematopoietic
stem cells. In conclusion, suspension peripheral blood cell population is potential in multilineage differentiation and can be an alternative source for stem cells
therapy.
Keywords: multilineage differentiation; suspension mononucleated cells; osteoblast; osteoclast; chondrocyte.
S7(b): Identification of Missense Mutations in Genes Related to Cancer Pathways in Glioma Using the
Personal Genome Machine (PGM)
Nor Azian Abdul Murad 1, Saiful Effendi Syafruddin1, Muhiddin Ishak 1, Mohd Ridhwan Abdul Razak 1, Sri Noraima Othman1, Soo Bee
Hong1, 2, Azizi Abu Bakar2, FarizalFadzil2
Jegan Thanabalan2, TohCharng Jeng2, Isa Mohamed Rose 3, Rahman Jamal1
1
UKM Medical Molecular Biology Institute (UMBI), Kuala Lumpur
2
Department of Surgery, Faculty of Medicine, UKM Medical Centre, Kuala Lumpur
3
Department of Pathology, Faculty of Medicine, UKM Medical Centre, Kuala Lumpur
E-mail: [email protected]
Glioma is the most common primary brain tumor of the central nervous system. Many genetic alterations and mutations have been
identified in glioma using various approaches. We performed DNA sequencing on the tumours of 16 patients with Grade I, II, III and IV
glioma. The AmpliSeq Cancer Primers Pool was used to generate the amplicons. The targeted-ion sphere particles were prepared using
the Ion One Touch and Ion Enrichment systems. DNA sequencing was performed on the Ion Torrent Personal Genome Machine (PGM) and
the data were analyzed using the Torrent Suite Software. In total, 14 mutations were identified in the following genes: KDR (Q472H), MLH1
(V384D), MET (N375S), PTPN11 (E69K), BRAF (V600E), TP53 (D149E, E154K, V157F), IDH1 (R132H), PIK3CA (H1047R), CSF1R
(c1061_1061 ins A), KIT (M541L), PTEN (c1373_1373 del A),and PDGFRA (E556V). There were four novel mutations identified;TP53
(E154K, and D149E), CSF1R (c1061_1061 ins A) and PDGFRA (E556V). The pathogenicity prediction showed that only 3 mutations were
pathogenic: PTPN11 (E69K), BRAF (V600E) and Tp53 (E154K). These mutations result in changes of the proteins’ structure and could
affect their functions. Pathway analyses suggested that these genes are closely related to the pathogenesis of GBM through several
pathways such as proliferation and invasion, metabolism and angiogenesis. In conclusion, PGM in combination with the AmpliSeq Cancer
Panel could be utilized as a potential molecular diagnostic tool not only for glioma but also for other cancers.
Keywords: Glioma, DNA sequencing, Personal Genome Machine (PGM), AmpliSeq Cancer Panel
9 | MGC10
S8: PLANT GENETICS
S8(a): Twenty Years of Oil Palm Genetic Engineering
Parveez GKA, A.R.
A.R. Omar, M.Y. Abdul Masani, A.M. Dayang Izawati, B. Bahariah, M. Siti Masura, A. Nur Hanin, W.S. Wan Nur
Syuhada, I. Zamzuri, H. Ahmad Tarmizi, O. Abrizah, R. Umi Salamah, A.M. Mohamad Arif, S. Ravigadevi and A. Kushairi.
Malaysian Palm Oil Board
E-mail: [email protected]
Palm oil is the number one source of vegetable oil in the world and Malaysia is the largest exporter of palm oil in the world. Being a major
producer, the country faces a number of challenges, such as labour and arable land shortages and fluctuation in commodity prices, which
have forced the industry to increase the return per unit area. Genetic engineering with all the promises and advantages was considered and
implemented for overcoming the above problems. Successful production of transgenic oil palm and isolation of useful genes and tissuespecific promoters has push forward the genetic engineering programme towards producing novel and higher quality palm oil. Among the
targets for genetic engineering of oil palm are increasing oleic acid and stearic acid content, enhancing lycopene content and synthesizing
biodegradable plastics. Constructions of various combinations of transformation vectors carrying different genes and promoters have been
achieved successfully. Transformation of oil palm embryogenic calli with the above constructs has been successfully carried out and
resulted in a number of transgenic palms that have been transferred onto soil in a contained greenhouse. Various analyses revealed the
successful transformation of oil palm with the targeted products. The progress made for the pass 20 years and problem faced during the
experimental period will be elaborated.
S9: ANIMAL GENETIC
S9(b): Elucidating Species Boundaries ofthe Peninsular Malaysian Fungus-Feeding Odontotermes
Using Mitochondrial DNA and Microsatellite Markers
Cheng S.*, Thinagaran D. *, MontazariMontazari-Barforoushi S. †, Nadaviana, A. †
*Genetics Laboratory, Forest Research Institute Malaysia
†
Institute of Biological Sciences, Universiti Malaya
E-mail: [email protected], [email protected]
Termites from the genus Odontotermes are distributed from Africa through Southeast Asia where they feature as decomposers in the Old
World tropics and as pests of agriculture and forestry. They are difficult to identify using morphology–based taxonomybecause species
within the genus often overlap in size and shape and there are limited morphological characters available to distinguish between them. In
this study, we elucidated their species boundaries by reconstructing their phylogenies using mitochondrial DNA (mtDNA) genes specifically
the 16S ribosomal RNA (16S rRNA) and cytochrome oxidase subunit I (cox1) genes. The 16S rRNA and cox1 phylogenies supported the
presence of up to twelve species in Peninsular Malaysia, which were identified as O. azmiensis sp. nov, O. denticulatus, O. minutus, O.
escherichi, O. hainanensis, O. javanicus, O. longignathus, O.malaccensis, O. oblongatus, O. paraoblongatus, O. sarawakensis, and O.
srinakarinensis. The number of species found in this study using DNA methods was more than the initial nine species thought to occur in
Peninsular Malaysia. The support values for the clades and morphology of the soldiers provided further evidence for the existence of these
species. Two species, that is, O. denticulatus and O. sarawakensis could only be teased apart after higher resolution genetic markers such
as microsatellites were isolated/used to genotype their population, afterwhich dendograms were constructed from the proportion of
shared-alleles between their individuals.This study demonstrates how mtDNA is needed to elucidate species boundaries in organisms that
are difficult to tell apart morphologically and how microsatellite markers or nuclear markers are needed to differentiate between cryptic
species in some clades, especially those which have diverged rather recently.Dating the split between these two species using a molecular
clock on the phylogenetic tree or by calibrating the tree with a known palaeogeographic event would allow us to better understand some of
the factors that may have been responsible for the origins of these species.
10 | MGC10
S10: HUMAN GENETICS
S10(a): Genetic Counseling and Genetic Testing in Malaysia in the Genomics Era
THONG MeowMeow-Keong
Genetics & Metabolism Unit, Department of Paediatrics, Faculty of Medicine, University of Malaya
E-mail: [email protected]
Genetic diseases are a main cause of chronic illnesses in childhood and adults. Genetic counseling is a non-directive communication
process that deals with the human problems associated with the occurrence or risk of occurrence of a genetic disorder. It helps the
individual or family to understand the diagnosis and burden of disease, recurrence risk in relatives and to make the best possible
adjustment to the disorder.
Genetic counseling is provided before genetic testing to help clients identify their risks for inherited disorders, investigate family health
history, interpret types of genetic results that may be returned – positive for a deleterious mutation, negative or a variant of unknown
significance (VUS), facilitate decision-making and help families cope with post-test results and psychosocial implications such as societal
discrimination, reproductive choices and relations with patient support groups.
The development of genomic tools such as array comparative genomic hybridisation, exome and whole genome sequencing raised
concerns regarding clinical validity and utility of these tests. Their clinical applications lie in the delineation of new Mendelian loci for
previously unrecognised syndromes or identification of additional genes or loci contributing to known disease entities. As the cost of these
tests decreased, the cost-effectiveness of mutation screening in multiple loci-associated disorder increased.
The challenges lie in the interpretion of “VUS” and this may lead to increased counseling consultations to allay anxiety and healthcare cost.
At present these tests may have limited value in complex disorders or in health screening for lifestyle change decisions in a multi-ethnic
populations due to lack of molecular epidemiological data. In addition, genomic health risk assessments may be difficult for clients to
understand and there is limited evidence to show this lead to improved health outcomes.
Genetic counseling will continue to evolve during this transition period to genomic medicine. It is likely that ‘genomic counseling’ and testing
will play a major role in healthcare services in the near future.
S11: BIOTECHNOLOGY
S11(a): Towards Construction of Plant Artificial Minichromosomes
1,2
Teo Chee How,
How, 2Ma Lu, 2Eszter Kapusi, 2Götz Hensel, 2Jochen Kumlehn, 2Ingo Schubert,
2
Andreas Houbenand 2Michael Florian Mette
1
Agro-Biotechnology Institute Malaysia, Ministry of Science, Technology and Innovation, c/o MARDI Headquaters2Leibniz Institute of
PlantGenetics and Crop Plant Research (IPK), Corrensstr.3, 06466 Gatersleben, Germany.
E-mail: [email protected]
Minichromosomes offer an enormous opportunity to plant biotechnology as they have the potential to simultaneously transfer and stably
express multiple genes. Following a top-down approach, we truncated endogenous chromosomes in Arabidopsis thalianaand
Hordeumvulgareby Agrobacterium-mediated transfer of T-DNA constructs containing telomere sequences. Blocks of A. thalianatelomeric
repeats were inserted into a binary vector suitable for stable transformation. After transfer of these constructs into diploid and tetraploidof A.
thalianaand H. vulgare, chromosome truncation by T-DNA-induced de novo formation of telomeres could be confirmed by DNA gel blot
analysis, PCR (polymerase chain reaction), and fluorescence in situ hybridisation. In A. thaliana, the addition of new telomere repeats in this
process could start alternatively from within the T-DNA-derived telomere repeats or from adjacent sequences close to the right border of
the T-DNA. Truncated chromosomes were transmissible in sexual reproduction, but were inherited at rates lower than expected according
to Mendelian rules.
11 | MGC10
S12: ANIMAL GENETICS
S12(a): Applied Genomic Work for Genetic Diversity and Efficient Animal Production in Pakistan
Masroor Ellahi Babar*1, Tanveer Hussain2
Department of Livestock Production, University of Veterinary & Animal Sciences, Lahore-Pakistan
2
Institute of Biochemistry & Biotechnology, University of Veterinary & Animal Sciences, Lahore-Pakistan
E-mail: [email protected]
1
Large and small ruminants are major contributor of agriculture economy in Pakistan providing milk, meat, skins, hides, bio fuel, and work
force to millions of people in the country. We have applied the latest molecular biology and biotechnological approaches to explore the
hidden potential of our indigenous animals to get maximum benefit of their superior and unique genetic makeup. In most of the developing
countries including Pakistan where the accurate animal production records are lacking the latest biotechnological tools like whole genome
sequencing using high throughput technologies, genome wide association studies, genotyping by sequencing, epigenetic studies,
microRNAs expression profiling, microarray technology, nutrigenetics, nutrigenomics and assisted reproductive technologies along with
relevant bioinformatics tools can be used to further improve the production and health of indigenous animals with high certainty in
comparatively shorter period of time. To explore the rich genetic resources of Pakistan using FAO recommended protocols, we have
studied mitochondrial and microsatellites markers along with SRY gene on various indigenous cattle, buffalo, sheep, goat, camel, yak and
chicken breeds to examine their genetic architecture, diversity, origin and phylogeny. A lot of work has been done on their production,
fecundity and immunity genes as well. Our work resulted in useful and unique information that can be used for the conservation of animal
treasure efficiently and to enhance the animal productivity in future.
Key word: Livestock species, molecular biology, microsatellite and mitochondrial markers, animal diversity, conservation, efficient animal
production
PLENARY 4
Current Issues on Development of Genetically Modified For (Gmf) Detection Technology in Malaysia
Zamri Ishak,
Ishak, Adlin Azlina Abdul Kadir, Mohamad Kamal Abdul Kadir,Mohd Afendy Abdul Talib,
Hazalina Zulkifli, Suria Mohd Saad,
Biotechnology Research Centre, MARDI HQ, PERSIARAN MARDI-UPM,
43400 Serdang, Selangor
E-mail: [email protected]
Genetically modified food (GMF) contains an additional trait encoded by the introduced genes, which generally produce additional proteins
that confer the trait of interest. Raw material and processed products derived from GM crops might thus be identified by testing for the
presence of introduced DNA, or by detecting expressed novel proteins encoded by the genetic material. Qualitative detection methods for
GMF DNA sequences in foods have evolved fast during the past years. However, quantitative results about the fraction of GM material in a
composite food will be needed and the fast increasing number of GM foods on the market demands the development of more advanced
multi-detection systems. Challenges arisen from the decreasing relevance of methods which screen for sequences commonly found in
GMF, the inability to detect GMF for which the modified sequence is unknown, the lengthy standardization procedures and the need to update continuously databases comprising commercially available GM foods and the respective detection strategies. A reliable quantitative
protocol and sampling procedures which are relevant for all parties involved in inspections and control measures are extremely required
before marketing the GMF products. In Malaysia, food industries are faced with the question of the use and labeling requirements on GM
crops and its derivatives. Currently, Malaysia has tabled the labelling act for GMO products. Pre-requisites step is important to implement
the establishment systems for documenting the distribution of GM crops in the food chain, as well as analytical methods for verification of
this information. The greatest uncertainty of using DNA-based assays, as for protein-based methods, is that not all products derived from
GMF contain enough DNA. In this paper, labelling issue and detection of GMO using biosensor technology and bioassay method as well for
sample preparation, sensitivity, validation are discussed in Malaysian scenario.
12 | MGC10
PLENARY 5
Genomic Sequencing of Yeast Glaciozyma antarctica for Understanding Cold Adaptation Mechanism
Abdul Munir Abdul Murad
School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia
E-mail: [email protected]
Microbes living in freezing environments must contend with an array of challenges such as freezing temperatures, reduced membrane
fluidity, low nutrient availability and high water viscosity. To understand how microbes survive in the harsh environment, we sequenced the
genome and analysed the transcriptomes as well as the proteomes of Glaciozyma antarctica, an obligate psychrophilic yeast isolated from
the Antarctic sea ice. It is expected that this yeast has evolved mechanisms that allow it to overcome the constraints posed by cold
environment, making it an ideal model organism to study psychrophily within eukaryotes. The genome of G. antarctica with a size of 20.03
Mb has been sequenced and a total of 7857 genes were predicted. Several genes, postulated to be involved in cold-adaptation
mechanisms, were identified from the G. antarctica genome. These include genes that encode for fatty acid desaturase, heat shock
proteins, chaperones, antifreeze proteins (AFP) and cold-active enzymes. Searches for fatty acid desaturases, a group of enzymes
involving in membrane desaturation, had identified three genes encoding for ∆9-fatty acid desaturase, two genes for ∆12- fatty acid
desaturase and two genes for ∆6-fatty acid desaturase. Gene expression analysis revealed that the expression of these genes were
generally higher when cells were grown at low temperature (0°C) as compared to a higher temperature (15°C). A total of nine genes
encoding for putative antifreeze proteins were also identified from the genome. Gene expression analyses showed that all AFP genes were
highly expressed at lower temperatures (0 and -12°C) as compared to a higher temperature (15°C). Characterisation of several G.
antarctica enzymes such as chitinases and proteases indicate that these enzymes are active at low temperatures, a property which is
essential for this microbe to remain active in its natural habitat. Initial proteomic data shows a significant level of expression of several stress
proteins when the growth temperature is lowered to 0°C. This study has shed light on several cold adaptation strategies employed by this
yeast to survive in its unique environment.
13 | MGC10
S13: HUMAN VARIOME
S13(b): The International Society for Gastrointestinal Hereditary Tumours (InSiGHT)
and the Human Variome Project
Finlay Macrae
Professor, Depts of Medicine, University of Melbourne and Monash University
E-mail: [email protected]
Recognizing synergies in their missions, InSiGHT has collaborated with the Human Variome Project since 2007. Following strategies
articulated by the HVP, InSiGHT implemented the following activities:
1
2
A merge of existing international databases relating to the genes responsible for Lynch Syndrome (mismatch repair genes):
Establishment of a Governance Committee of its databases, informed by its curator and the Chair of its Variant Interpretation
Committee and responsible to its democratically elected Council:
3 Incorporation to offer a high level of legal protection for its database (and other) activities.
4 Appointment of a full time curator of its databases
5 Establishment of an ethics committee to oversee the activities of the database work.
6 Advocacy for funding for its database activities.
7 Outreach to encourage submission of national and individual laboratory variant data.
8 Establishment of the InSiGHT Variant Interpretation Committee, which is now widely acknowledged as an outstanding example of
international collaboration and essential to harvest the rewards of the expansion of genetic sequencing technologies.
9 Development of gene specific modifications of the IARC 5 tier system for pathogenicity assignment process.
10 Systematic assignment pathogenicity status by the VIC of all the variants on its database against the modified IARC 5 tier system.
This has moved a large number of variants from a status of uncertain to definitely pathogenic (or not). This work is in press in
Nature Genetics.
11 Posting of the VIC determinations on its public database through the InSIGHT website (www.insight-group.org);
12 Development of the process of microattribution to encourage and reward submission of data to its database
InSiGHT is strategically moving forward to support non MMR locus specific databases of GI cancer predisposition. It is engaged in the U41
grant developing submission of variants to the NCBI database ClinVar.
InSiGHT is keen to encourage submission of variant data from South East Asia to enrich its international collection, and provide support for
interpretation of VUSs which are clinically troublesome. The most productive engagement is with interactive and two way involvement: we
welcome Malaysian and South East Asian colleagues to join InSiGHT and its VIC, to submit variant and associated phenotype data, and to
draw on the expertise enshrined in its database and its faculty of international experts. Please contact our curator [email protected]
S13(c): Gene Hunting Using Whole Exome Sequencing
Azlina Ahmad Annuar
Department of Biomedical Science, Faculty of Medicine, University of Malaya
E-mail: [email protected]
Gene hunting has undergone a technical transformation recently. Whilst genome-wide linkage analysis had been the method of choice for
many years, Whole Exome Sequencing (WES) and Whole Genome Sequencing (WGS) are now the preferred approach towards uncovering
the genetic aetiology of disease. Typically, the WES or WGS approach yields a massive amount of variant information which needs to be
analysed for pathogenicity. At present, we need to rely on in-house control exome datasets to filter out the common, non-pathogenic
variants. Access to datasets which catalogue genetic variation is also essential for annotation and disease information. Here, I will present
our experience with WES and the challenges of identifying pathogenicity when working with poorly annotated variants in Asian samples.
14 | MGC10
S13(d): Orang Asli Genetic Pool and the Role of Human Variome Project in
Future Health of the Population
Endom Ismail
Universiti Kebangsaan Malaya
E-mail: [email protected], [email protected]
Being a special community with differential faces among the rest of the Malaysian populations has primarily categorised Orang Asli as a
unique populations. Not only that, their health story is intriguing and their genetics are the least known. We are beginning to unravel this
information with high interest and hopes that one day their genetic pool is fully gathered. Until then, a lot of questions will remain
unanswered. In order to answer these questions, the process of collecting information need to be fully organized and Malaysian Human
Variome Project (MHGV) is doing what we need to make sure all Orang Asli genetic information are not absent-mindedly collected. MHGV
can play a huge role for all Malaysian Genomics, Transcriptomics, Proteomics variation and many more towards better understanding of
the whole Malaysians transgressing across every aspect of human religion, health, ethnicities, skin colour etc. Therefore, what the future
means for being Malaysians could be well achieved by MHGV.
S13(e): Mutational analysis of FLT3, NPM1 and DNMT3A in patients with Acute Myeloid Leukaemia
Noraini Mat Yunus1, Abdul Rahim Hussein2, Rosline Hassan1 & Muhammad Farid Johan1
1
Department of Haematology, School of Medical Sciences, UniversitiSains Malaysia
2
Advanced Medical & Dental Institute, UniversitiSains Malaysia, 13200 Kepala Batas, Penang, Malaysia.
E-mail: [email protected]
Pathogenesis of leukaemia is a multistep process that involves multiple genetic alterations of normal cells to transform into a malignant
phenotype. Mutations in the receptor tyrosine kinase (RTK/RAS) signalling pathway frequently provide a proliferative signal particularly the
core binding factors leukaemia. The role of tyrosine kinase FMS-like receptor-3 gene (FLT3) and downstream effectors of RTK/RAS
signalling; NRAS,NPM1, DNMT3a has been investigated to determine if point mutation is involved in pathogenesis of myeloid leukaemia.
Data on the incidence and mutational status of these genes in Malaysian patients however are limited. Therefore the study was carried out
to determine the frequency and mutational status of these genes that provide molecular data forMyHVP (Malaysian Node of Human
Variome Project).Genomic DNAs from Acute Myeloid Leukaemia (AML) patients was obtained from bone marrow aspirates and/or
peripheral blood samples at diagnosis, from 67 patients presented at Hospital USM, KubangKerian, Kelantan [French-American-British
(FAB) subtypes: M0=1, M1=2, M2=10, M3=22, M4=9, M5=12, M6=2, M7=1, Not Otherwise Spesified (NOS)=8]. The DNAs were screened
for mutations in FLT3-ITD (exons 14 and 15), FLT3-835 (exon 20), NPM1 (exon 12), DNMT3a (exon 23) and NRAS (exons 1 and 2) genes
using conformational sensitive gel electrophoresis (CSGE). Cases displaying abnormal profiles were directly sequenced.FLT3-ITD and
NPM1s mutations were found in 12%(8/67) and 10%(7/67) AML respectively. Sequence analysis of FLT3-ITD revealed in-frame
duplications in between 30-100 base pairs. NPM1 cases involved frameshift mutations. Four FLT3-ITD positive patients have concurrent
mutations with NPM1 gene. Two patients have concurrent mutations in bothDNMT3a and FLT3-835. Interestingly, FLT3-ITD, NPM1 and
DNMT3a mutations were concurrently identified in a 69 y.o female (M5b FAB subtype) who survived for only 2 months after diagnosis. Our
study demonstrates that both FLT3-ITD and NPM1 mutations occur in a significant percentage of adult AML and moreover for the
possibility of targeted therapy for patients with AML.
15 | MGC10
S14: PLANT GENETICS/BIOTECHNOLOGY
S14(a): Highlights on Successes in Radiation Mutation Breeding of Crops in Malaysian Agriculture
Abdul Rahim Harun
Malaysian Nuclear Agency
Ministry of Science, Technology and Innovation Malaysia
E-mail: [email protected]
The application of nuclear technologies provides a unique tool in achieving sustainable food production and has a proven record in
increasing agricultural productivity since 1970s. In crop improvement, radiation mutation breeding accelerated the production of crop
varieties with desired characteristics compared to conventional breeding for better adaptation to climate change. To date, more than 3000
improved crop varieties such as rice, wheat, banana, potato, yam and soya bean plants that are more resistant to disease or drought or
able to grow in marginal or saline soils and under harsh conditions have been developed and registered.In Malaysia, the earliest record was
in 1973 in an attempt to improve rubber trees using x-rays for dwarfism and disease resistance by researchers from Rubber Research
Institute of Malaysia (RRIM). The first success story of radiation mutation breeding in Malaysia was the induction of rice (Oryza sativa cv.
Mahsuri) for generating mutant resistant to blast disease. Since then many mutation breeding projects were undertaken and until now more
than 20 new lines have been registered, with improved characteristics. Later, more efforts were taken up by universities to promote the
technology for genetic changes and creation of new genetic resources, particularly in crops that are not easily achievable through
conventional techniques. Malaysian Nuclear Agency (Nuclear Malaysia) formerly known as Malaysian Institute for Nuclear Technology
Research (MINT) has initiated a radiation mutation breeding programme for the improvement of importance food crops such as rice,
legumes, and other potential crops for export, like fruit trees and ornamentals.Untilnow more than 30 mutant varieties have been released
and commercialized. Severalmutants thatare not commercially released will be used as germplasm collection for cross breeding
purposes.In the Eight Malaysia Plan the Gamma Green House, a chronic irradiation facility has been constructed, consideredas one of the
major achievements in plant radiation mutation breeding in Malaysia. The facility began operation in September 2010 and opened to
researchers not only for Nuclear Malaysia but also for interested counterpartsfrom RIs and universities in Malaysia and the region.Research
on mutation breeding in Malaysia has been supported by IAEA under its Technical Cooperation and Coordinated Intensified Research
Project (CiRP) and other regional projects. Collaboration under the Forum for Nuclear Cooperation in Asia (FNCA) programme was
established in 1993 with member countries from China, Indonesia, Japan, Korea, Malaysia, the Philippines, Thailand and representative
from the IAEA.
S14(b): Application of Inducible Cre/loxP Embryonic Stem Cell System in Understanding Neurogenesis
In Vitro
Norshariza Nordin1, Gao Liyang2 and John Mason3
ClinicalGenetics Unit, Department of Obstetrics and Gynaecology, Faculty of Medicine and Health Sciences, Universiti Putra Malaysia
2
Genetic and Regenerative Medicine Research Centre, Faculty of Medicine and Health Sciences, Universiti Putra Malaysia
3
Centres for Integrative Physiology and Neuroscience Research, School of Biomedical Sciences, University of Edinburgh, Hugh Robson
Building, George Square, Edinburgh EH8 9XD UK
E-mail: [email protected]
1
Neurogenesis of the central nervous system (CNS) is regulated by many signalling molecules, including Wnt. Wnt/β-catenin signalling
pathway has been shown to play important roles in neural differentiation and proliferation. Increasing evident clearly shows the involvement
of Wnt in regulating neural differentiation of embryonic stem (ES) cells. Activation of Wnt/β-catenin signalling has been shown to either
inhibit or promote the differentiation of ES cells into neurons, depending on the stage of differentiation. Many Wnt genes exhibit dynamic
RNA expression profiles during neural differentiation, suggesting the possible multiple regulatory roles of Wnts in this process. Therefore
unravelling the role(s) of specific Wnt molecules at different points in the process of neural differentiation will be complex, but essential.
Combining two techniques, Cre/loxP-based genetic recombination and ligand-dependent activation of Cre, we have generated transgenic
embryonic stem (ES) cell lines that allow for the temporal control of expression and activity of Wnt genes and a Wnt antagonist. Specifically,
the system allows for stimulation or inhibition of Wnt signalling at specific steps of the differentiation process. Here, the use of this inducible
system in monitoring the effects of Wnt1 and Dkk1 (a Wnt antagonist) overexpression at specific time points during neural differentiation
process will be discussed. The system has managed to increase the understanding of Wnt function on neurogenesis in vitro.
16 | MGC10
S15: GENOMICS
S15(a): Brainomics of the Ts1Cje Down syndrome mouse model
KingKing-Hwa Ling1, KaiKai-Leng Tan1, HanHan-Chung Lee 1, Chelsee Hewitt2, Hamish Scott3 & PikePike -See Cheah1
NeuroBiology and Genetics Group, GRMRC-Medical Genetics Laboratory, Faculty of Medicine and Health Sciences,
Universiti Putra Malaysia, Malaysia.
2
Pathology Department, The Peter MacCallum Cancer Centre, East Melbourne, Victoria 3002, Australia.
3
Department of Molecular Pathology, SA Pathology and Centre for Cancer Biology, P.O. Box 14 Rundle Mall Post Office,
Adelaide, SA 5000, Australia.
1
The Ts1Cje mouse model of Down syndrome has partial triplication of mouse chromosome 16 (MMU16), which is homologue to the human
chromosome 21 (HSA21). The mouse is featured by various neuropathologies found in DS individuals. To identify the dysregulated
molecular pathways caused by the extra set of genes in Ts1Cje, we performed microarray gene expression analysis on three brain regions
(cerebral cortex, cerebellum and hippocampus) at four different postnatal time-points between triplicates of Ts1Cje and wildtype mice. We
identified more than 300 differentially expressed genes (DEGs) over all time-points and brain region comparisons. Functional clustering
analysis and various validation approaches suggested a global disruption of interferon-related signal transduction pathways during
postnatal development of the Ts1Cje mouse brain.
S16: PLANT GENETICS
S16(a): Bayesian Analysis Helps to Understand Mating System and Pollen Dispersal on Tall Tropical Trees
1
Naoki Tani1,2
Forestry Division, Japan International Research Center for Agricultural Sciences (JIRCAS)
2
Forestry Biotechnology Division, Forest Research Institute Malaysia (FRIM)
E-mail: [email protected]
In order to understand pollinator-plant symbioses and to conserve forest resources effectively, we need knowledge of pollen dispersal
patterns, mating system and the spatial and temporal heterogeneity of male fecundity. However, inaccessibility to tall canopy of tropical rain
forest has inhibited to reveal processes of propagation occurring in their canopy. We developed Bayesian mating model to estimate
parameters of the pollen dispersal patterns, male fecundity and self pollen affinity simultaneously from paternity of seeds. Seeds from
mother trees were collected following three general flowering (GF) events since 1998 and their paternity determined. Sporadic GF in 2002
was accompanied by longer pollen dispersal distances than recorded in 1998 and 2005 (mass GF). The effective number of male
individuals during mass GF was larger than during sporadic GF. Although Shorea curtisii is dominant species with high density in hill
dipterocarp forest, pollen was dispersed effectively and selfing rate was maintained at low level, which suggested that a rapid increase in
the thrips population could absorb the competition among individuals. This incident leaded that a hypothesized reduction in pollinator
competition by sequential flowering periods observed between species of section Mutica in lowland dipterocarp forest might be not
important. There is great variation in male fecundity between individuals; tree size is influential, with small trees contributing less fecundity
than large trees. Selective logging leaves small trees from which the dipterocarp forest must regenerate; our data suggest that this will
adversely affect reproduction. Comparison of estimated parameters of self pollen affinity between high density undisturbed and low density
selectively logged forests indicated that self pollen was selectively excluded from mating in the former, probably due to partial self
incompatibility or inbreeding depression until seed maturation. By estimating the self pollen affinity of each mother tree in both forests, a
negative relationship was detected between the gross amount of the pollen pool and self pollen affinity. This implies that exclusion of self
mating occurs under conditions of large pollen pool size, whereas reproductive assurance increases self mating in environments with
smaller pollen pool size.
17 | MGC10
List of Oral Abstracts
DAY 1 | Tuesday, 3rd December 2013
No
Abstract
ID
Time of
Presentation
Venue
Page No
FP 1
002
Lai Kok Song
A TILLING Resource for Functional Genomics in
Arabidopsis thaliana Accession C24
1530 - 1545
Putra 3
21
FP 2
068
Mohamad Bahagia
Abd Ghaffar
Transcriptomics Application for the Understanding of
the BPH Resistance in Rice
1545 - 1600
Putra 3
21
FP 3
006
Ashley E R Soosay
Comparative Genomic Approach for Identifying Novel
Imprinted Genes Involved in the Nasopharyngeal
Cancer Pathogenesis
1600 - 1615
Putra 3
22
FP 4
022
Lee Chai Ting
Individual Identification Database of Kempas in
Malaysia
1530 - 1545
Perdana
Ballroom
22
FP 5
041
Arif Anwar
Leveraging World’s 1st Fully-Functional and
Correctly Folded Protein Array Technology for
Disease, Infection and Immuno-Biomarker Discovery
1545 - 1600
Perdana
Ballroom
23
FP 6
030
Zahirunisa Abd
Rahim
In Silico Analysis on the ß-Defensin Functional Gene
in Human and Primates
1600 - 1615
Perdana
Ballroom
23
FP 7
058
Marahaini Musa
Cell Proliferation and Cytotoxicity Study of PeriVitelline Fluid (PVF) Obtained from Fertilized Eggs of
Horseshoe Crab on Human Dental Pulp Stem Cells
1615 - 1630
Perdana
Ballroom
24
FP 8
013
Ho Licia
Comparative Study on the Genetic Diversity of
Proboscis Monkey (Nasalis larvatus) from Selected
Populations in Malaysian Borneo
1530 - 1545
Putra 4
24
Genetic Analysis of Some Production Traits in Flue
Cured Virginia Tobacco (Nicotiana tabacum L.)
1545 - 1600
Putra 4
25
Presenter
Session
S1:
GENOMICS
S2:
BIOTECHNOLOGY
S3:
GENETICS
FP 9
064
Fida Mohammad
Paper Title
18 | MGC10
List of Oral Abstracts
DAY 2 | Wednesday, 4th December 2013
No
Abstract
ID
Time of
Presentation
Venue
Page No
FP 10
039
Mohammed
Alowain
A Decade-Long Research in Clinical Genetics: A
Perspective on the Autosomal Recessive Genetic
Diseases in Saudi Arabia
1045 - 1100
Putra 3
25
FP 11
043
Ernie Zuraida Ali
Predicting Functional Impact of A Novel
Missense Mutation (p.Asn199His) in Ornithine
Transcarbamylase (OTC) Gene
1100 - 1115
Putra 3
26
FP 12
085
Muhammad Farid
Johan
Restoration of SHP-1 Expression by 5-Azacytidine
Confer Sensitivity in Imatinib-Resistant BCR-ABL
Chronic Myeloid Leukaemia
1115 - 1130
Putra 3
26
FP 13
018
Sadegh Ashkani
High-Throughput Multiplex PCR with FluorescentLabeled Microsatellite Marker for Genotyping and
Genetic Analyses in Rice (Oryza sativa L.)
1045 - 1100
Perdana
Ballroom
27
FP 14
021
Ng Chin Hong
DNA Profiling of Meranti Timber (Shorea platyclados)
for Chain-of-Custody Certification
1100 - 1115
Perdana
Ballroom
27
036
Iftikhar H. Khalil
Location Effect on Heritability and Selection
Response for Maturity and Yield Traits in Wheat
under Rain-Fed Conditions
1115 - 1130
Perdana
Ballroom
28
FP 16
008
Kavitha
Murulitharan
Recovery of a Malaysian Recombinant Newcastle
Disease Virus Strain
1115 -1130
Putra 4
28
FP 17
057
Emmanuel Jairaj
Moses
Small Interfering RNA as a Versatile Tool for
Functional Studies of Acute Myeloid Leukaemia
1545 - 1600
Putra 3
29
Update on the Genetic Basis of Hearing Loss in the
Saudi Arabian Population
1600 - 1615
Putra 3
29
Construction and Characterization of the Partial
Small-Insert Genomic Libraries of Eucheuma and
Kappaphycus (Solieriaceae, Rhodophyta) Seaweeds
1545 - 1600
Perdana
Ballroom
30
Assessment of Variability of Cameroon-based
Biparental dura x pisifera Oil Palm Genotypes for Oil
Quality Traits and Interrelationships among Traits
1600 - 1615
Perdana
Ballroom
30
Molecular Phylogeny of Malaysian Primates Inferred
from mtDNA Cytochrome Oxidase II Gene
1545 - 1600
Putra 4
31
Molecular Phylogenetics of the Sole Sweet TasteSpecific Receptor Gene TAS1R2 in Primates
1600 - 1615
Putra 4
31
Presenter
Session
S4:
HUMAN
GENETICS
S5:
PLANT
GENETICS
FP 15
FP 18
114
Khushnooda
Ramzan
FP 19
047
Sallahaudin Bin
Maili Mohd Rasli
FP 20
023
Beyegue Djonko
Honore
FP 21
012
Millawati bt Gani
FP 22
031
Nur Aida Md
Tamrin
S6:
MICROBIAL
GENETICS
S7:
HUMAN
GENETICS
S8:
PLANT
GENETICS
S9:
ANIMAL
GENETICS
Paper Title
19 | MGC10
List of Oral Abstracts
DAY 2 | Wednesday, 4th December 2013
No
Abstract
ID
FP 23
102
Abdul Halim Fikri
bin Hashim
FP 24
103
Wan Khairunnisa
Binti Wan Juhari
FP 25
059
Nur Izyan Azmi
Presenter
FP 26
078
Nur Nadiah Roslan
FP 27
048
Jeffrine RovieRyan Japning
Session
S10:
HUMAN
GENETICS
S11:
BIOTECHNOLOGY
S12:
ANIMAL
GENETICS
Time of
Presentation
Venue
Page No
Malaysian Node of the Human Variome Project
Database (MyHVPDb)
1715 - 1730
Putra 3
32
Analyses of DNA Variants in Kelantan Malays and
Chinese with Hereditary Nonpolyposis Colorectal
Cancer: A Preliminary Study
1730 - 1745
Putra 3
32
Effects of Transforming Growth Factor Beta-1 and
its Inhibitor (SB431542) on Stem Cells from Human
Exfoliated Deciduous Teeth Cultured in Keratinocyte
Growth Medium
1715 - 1730
Perdana
Ballroom
33
Overexpression of Chalcone Synthase (CHS) in the
Cell Suspension Cultures of Fingerroot, Boesenbergia
rotunda
1730 - 1745
Perdana
Ballroom
33
Using Y-Chromosome to Elucidate the Evolution
and Dispersal Pattern of the Long-Tailed Macaques
(Macaca fascicularis) in Southeast Asia
1715 - 1730
Putra 4
34
Paper Title
List of Oral Abstracts
DAY 3 | Thursday, 5th December 2013
No
Abstract
ID
FP 28
033
Presenter
Mohd Hanif
Ridzuan Mat Daud
FP 29
035
Aswini Leela
Loganathan
FP 30
087
Pedram Kashiani
FP 31
094
Nurul Farhanah
Zakaria
Session
S15:
GENOMICS
S16:
PLANT
GENETICS
Paper Title
Time of
Presentation
Venue
Page No
Evolution of Opsin Genes in Primates
1145 - 1200
Perdana
Ballroom
34
Mapping of Genes Related to Immunity in the Nasalis
larvatus Genome Using Bioinformatic Approaches
1200 - 1215
Perdana
Ballroom
35
Association Mapping of Quantitative Traits in Tropical
Sweet Corn
1145 - 1200
Putra 3
35
Genetic Diversity of Aquilaria malaccensis
(Thymelaeaceae) in Peninsular Malaysia
1200 - 1215
Putra 3
36
FP1
ID 002
A TILLING Resource for Functional
Functional Genomics in Arabidopsis thaliana
Accession C24
1
KokSong Lai* , 2Pulla Kaothien Nakayama, and 2Seiji Takayama
Agro-Biotechnology Institute Malaysia, Ministry of Science, Technology and
Innovation
2
Graduate School of Biological Sciences, Nara Institute of Science and Technology
E-mail: [email protected]
1
ABSTRACT:
TILLING (Targeting Induced Local Lesions IN Genomes) is a reverse genetic
method that can be employed to generate allelic series of induced mutations in
targeted genes for functional analyses. To date, TILLING resources in Arabidopsis
thaliana are only available in accessions Columbia and Landsbergerecta. Here, we
extended the Arabidopsis TILLING resources by developing a new population of
ethyl methanesulfonate (EMS)-induced mutant lines in another commonly used A.
thalianaaccession C24.A permanent collection of 3,509 independent EMS
mutagenized M2 lines was developed in A. thalianaaccession C24, and designated
C24TILL. Using the TILLING method to search C24TILL for mutations in four
selected genes identified a total of 73 mutations, comprising 69.6% missense,
29.0% sense, and 1.4% nonsense mutations. Consistent with the propensity of
EMS to induce guanine alkylation, 98.4% of the observed mutations were G/C to
A/T transitions. Based on the mutations identified in the four target genes, the
overall mutation density in the C24TILL collection was estimated to be 1/348 kb.
TILLING theDUO POLLEN 1 (DUO1) genefrom the C24TILL collection identified a
truncation mutation leading to a deficiency in sperm cell differentiation.Taken
together,a new TILLING resource, the C24TILL collection, was generated for A.
thaliana accession C24. The C24TILL collection provides an allelic series of
induced point mutations that will serve as a useful alternative reverse genetic
resource for functional genetic studies in A. thaliana.
FP2
FP2
ID 068
Transcriptomics Application for the Understanding of the BPH
Resistance in Rice
A.G.M Bahagia1,2, A. B. Norliza1, J. Pritchard2, and B. V. FordFord- Lloyd2
Malaysian Agricultural Research and Development Institute (MARDI)
Rice and Industrial Crop Research Centre, SeberangPerai Research Station,
13200 Kepala Batas, Pulau Pinang
School of Biosciences, University of Birmingham, Edgbaston, Birmingham, B15
2TT, U.K
Email: [email protected]
ABSTRACT:
Recent developments in rice genomics has greatly facilitated new technologies to
be used to decipher the complex process of resistance mechanism against rice
brown planthopper (BPH), Nilaparvatalugen before any efficient strategies to
control the dangerous pest were to be implemented. In this study, microarray
analysis (44K genes Agilent chip) was conducted on 12 rice varieties with different
background of BPH resistance to identify candidate genes that plays the role in
BPH resistance. The results revealed differences in gene expression between the
resistant and susceptible varieties which coincide with Electrical Penetration
Graph (EPG) and honeydew clock experiments carried out previously. A total of
21556 probes successfully passed the filter of the statistical analysis using
quantile method. A number of 239 probes were significantly identified to be
different in the analysis between the resistant versus susceptible varieties. The
expression of eighty nine genes were up-regulated while hundred fifty genes were
down regulated. GO (gene ontology) analysis based on biological process
indicated that the genes were classified into 11 categories such as response to
stress (44 genes), response to external stimulus (27 genes), transportation (18
genes), cellular process (16 genes), metabolic process (13 genes and cell
differentiation (7 genes). Some of the genes identified, correlated highly with the
phenotype data. Among them are hexose transporter (R=0.71), zinc transporter
(ZIP1) (R=0.8) and UDP-glucosyltransferase (R=-59) gene which are highly
correlated with the type 4 EPG waveform. Here we present the microarray analysis
on the 12 rice varieties and the potential candidate genes that may play a role in
BPH resistance to be further analysed and validated in the future. This project
applied advance tools to understand Bph resistance in rice. By studying the
fundamentals, this works aim to decipher the complex mechanism of BPH
resistance in rice. An improvement of rice plant breeding program for
tolerance/resistance rice against BPH is envisaged.
21 | MGC10
FP3
FP3
ID 006
FP4
FP4
Comparative Genomic Approach for Identifying Novel Imprinted
Genes Involved in the Nasopharyngeal Cancer Pathogenesis
ID 022
Individual Identification Database of Kempas in Malaysia
Lee C.T.1*, Tnah, L.H. 1, Lee S.L. 1, Ng, K.K.S. 1, Ng, C.H. 1, Diway, B. 2,
Eyen, K3.
1
Genetic Laboratory, Forest Research Institute Malaysia,
2
Sarawak Forestry Corporation, Forest Research Centre
3
Forest Research Centre, Forestry Department
Email: [email protected]
Ashley E. R. Soosay*
Faculty of Medicine & Health Sciences, Universiti Malaysia Sarawak
Email: [email protected]
ABSTRACT:
Genomic imprinting is an epigenetic chromosomal modification that enables
parent-of-origin allele specific gene expression. Deregulation of imprinted genes
leads to the genesis of cancer and genetic disorders. Nasopharyngeal carcinoma
(NPC) is common in southern Asia. Epstein-Barr virus has been implicated with
NPC. Environmental factors such as dietary consumption of salted food and
genetic susceptibility play pivotal roles in NPC pathogenesis. Juxtapositioning
data from reported NPC genetic/cytogenetic studies and known/predicted human
imprinted genes has identified genes which may be involved in NPC pathogenesis.
Our screening has identified chromosome 14q32 as a pertinent region for NPC
pathogenesis. A well defined imprinted domain DLK1-DIO3 is located within
chromosome 14q32. This region contains 53 microRNAs and 38 C/D-box small
nucleolar RNAs. Small regulatory RNAs controlled by genomic imprinting have
been implicated in cancer. Retrotransposon-like 1 (Rtl1) located within this region
is a retrotransposon-derived imprinted gene implicated in hepatocarcinogenesis.
Therefore, characterization and analysis of imprinted segment on 14q32 will
elucidate the biological role of the imprinted microRNAs and genes. Our novel
screening approach has successfully identified an imprinted domain on
chromosome 14q32 which may be involved in the genesis of NPC.
ABSTRACT:
DNA marker technology offers a tool to combat illegal logging activities by
providing means to trace the geographic origins of stolen logs or match an alleged
stolen log to its stump. Studies have demonstrated the feasibility of using DNA
markers for timber tracking and forensic forestry investigations. As in the case of
human forensics, the establishment of individual identification database is
essential for the statistical evaluation of genetic evidence in a court case. At the
Forest Research Institute Malaysia, DNA profiling database have been established
for two important timber species, namely Chengal and Ramin. Here we report the
DNA profiling database for another indigenoustimber species,
Koompassiamalaccensis. Locally known as kempas, K.malaccensisis one of the
major commercial timber species in South-East Asia, of the Family Leguminosae.
A total of 1467 K. malaccensis samples collected from 56 locations all over
Malaysia were genotyped using nine polymorphic microsatellite markers or short
tandem repeats (STRs). Forensic parameters and the allele frequencies for each
locus were estimated, with the minimum allele frequency adjusted to 5/2n.
Assuming independence between alleles and loci, the theoretical 9-locus STR
profile estimates can range from 7.8631x10-9 to 7.5240x10-48. Based on the
results of STRUCTURE analyses, the individual identification database can be further
divided into local databases, namely East Malaysia, West Malaysia and Peat
Swamp Ecotype. From the assignment tests, the mean proportion of baseline
individuals correctly assigned to respective subgroups was 99.2%. Hence, the
DNA database established for K. malaccensis is not only useful for individual
identification, but also enables geographic traceability of its wood to a certain
extent.
22 | MGC10
FP5
FP5
ID 041
041
Leveraging World’s 1st FullyFully -Functional and Correctly Folded Protein
Array Technology for Disease, Infection and ImmunoImmuno-Biomarker
Discovery
Dr. Arif Anwar
Sengenics Sdn Bhd,
Email: [email protected]
ABSTRACT:
Sengenics has established the 1st protein array facility outside Oxford that
leverages a protein array technology that was jointly developed by Oxford and
Cambridge Universities. The unique feature of the protein array is that every
protein is correctly folded, full-length and functionally validated. All proteins are
full-length, and have been cloned in frame with the Biotin Carboxyl Carrier Protein
(BCCP) tag. The unique BCCP tag technology ensures that only correctly folded,
functional and full-length proteins are presented on the array. The tag also
provides a single point of attachment which negates the problems of protein
unfolding, random orientation and non-specific binding that can occur with other
protein attachment methods. Key applications of this platform in biomarker
discovery, response to infection and pharmacological response will be reviewed.
FP6
FP6
ID 030
030
In Silico Analysis on the ßß -Defensin Functional Gene in Human and
Primates
Zahirunisa Abd Rahim*1, Suhaili Abu Bakar1, Yuzine Esa2, Ahmad Hata
Ahmad Rasit3& Mohd Tajuddin Abdullah4
1
Molecular Biology and Bioinformatics Unit, Department of Biomedical Science,
Faculty of Medicine and Health Sciences, Universiti Putra Malaysia
2
Department of Aquaculture, Faculty of Agriculture, Universiti Putra Malaysia
3
Faculty of Medicine and Health Sciences, Universiti Malaysia Sarawak
4
Department of Zoology, Faculty of Resource Science and Technology, Universiti
Malaysia Sarawak
Email: [email protected]; [email protected]
ABSTRACT:
ß-defensin gene is a functional gene that is found in various parts of the
mammalian genome especially in the innate and adaptive immune system and act
as moderator in the reproductive functions. Therefore, disruption of beta defensins
gene in primates and human could relate to disease-associated risks. Although
many studies conducted on the evolution of beta defensins gene, the evolutionary
dynamics of this functional gene in primates and human have not been resolved.
In silico human and primate genomics were analysed to identify the evolutionary
divergence within the functional gene ß-defensinin the two mammalian groups. A
total of 101 in-groups were studied comprising of 22 human sequences (Homo
sapiens) while another 79 sequences of primates (Pan troglodytes,
PongoPygmaeus, Macacafascicularis and Hylobateslar). All of the sequences were
obtained from GenBank. From this, 22 ß-defensin subtypes were aligned and
further constructed into evolutionary phylogeny. The 22 subtypes were located on
chromosome 7, 8, 12, 17, 18, 20 and 21 from either the short arm or long arm of
the chromosomes. From the 707 nucleotides analysed, 68 are conserved and
639 are variables. The parsimony informative sites comprises of 478 bases.
Neighbor joining phylogeny constructed shows a paraphyletic topology. The most
basal clade was defined by DEFB129 subtypes while the most distant neighbor
belongs to DEFB105. The phylogeny also defines eight monophyletic groups. The
topology feature specialised grouping according to the ß-defensin subtypes but do
not discriminate the host of the functional gene. The human and primates host
cluster randomly in their respective ß-defensin subtypes group. However,
DEFB119 for Homo sapiens transcript variant 3 and 4 show clustering with the
DEFB120 subtypes. Nonetheless, they still group as sister clade. Most studies
found that the beta defensin gene is a species specific paralogous group gene
given by the conserved synteny within the common ancestors. This In silico
analysis, however, shows higher variables in nucleotide composition and feature
negative selection of the ß-defensin gene. Thus, it is important to constantly
evaluate the evolutionary relationship for better understanding of the ß-defensin
gene selection.
Keywords: In silico, ß-defensin, human, primates
23 | MGC10
FP7
FP7
ID 058
058
Cell Proliferation and Cytotoxicity Study of PeriPeri -Vitelline Fluid (Pvf)
Obtained From Fertilized Eggs of Horseshoe Crab on Human Dental
Pulp Stem Cells
a
b
b
Marahaini Musa , Nor Shamsuria Omar , Anil Kumar Chatterji , Azlina
Ahmada, T.P. Kannana, KhairaniIdah Mokhtar a.
a
School of Dental Sciences, Universiti Sains Malaysia
b
Universiti Malaysia Terengganu
Email:: [email protected]
ABSTRACT:
Horseshoe crab which is known as “living fossil” is identified as one of the bestknown living creature in this earth. This organism can be found in the coastline of
various countries including Malaysia, Japan and Indonesia.Horseshoe crab
possesses many clinical and medical applications. The objectives of the study are
to evaluate the cell proliferation and cytotoxicity of perivitelline fluid (PVF) from
horseshoe crab on dental pulp stem cells (DPSCs) using MTT assay and Alamar
Blue test. Fertilized eggs of the horseshoe crab (Tachypleusgigas) were collected
from the nests located on the sandy beach at Balok (Kuantan), Malaysia. The eggs
werethen incubated and cleaned before the peri-vitelline fluid (PVF) was
collected.For the testing, the freeze dried PVF was mixed and diluted with
phosphate buffer saline (PBS). For MTT assay (cytotoxicity test), 2 x 103 of DPSCs
were seeded in 96-well plate and treated with different concentrations of PVF (45,
22.5, 11.25, 5.625, 2.813, 1.406, 0.703, 0.352 mg/ml) for 72 hours. IC50and
IC25valueswererecorded from triplicate tests. Alamar Blue test (proliferation assay)
was performed whereby 1 x 103 of DPSCs were seeded and treated with
concentrations of PVF that produced IC50 and IC25. Other concentrations of PVF
which produced higher percentages of cell viability compared to the controlwere
also included. Experiment was conducted in triplicates for 10 consecutive days. In
MTT assay, higher concentration of PVF produced lower cell viability and the more
diluted PVF produced greater percentage of cell viability. The determination of
IC50and IC25was performed using an Excel add-in (ED50V10).The values of IC50and
IC25are26.887 and 14.093 mg/ml respectively.From Alamar Blue assay, PVF
produced greater cell proliferation as compared to the control. In conclusion, PVF
shows promising results to enhance the proliferation of DPSCs.
FP8
FP8
ID 013
013
Comparative Study on the Genetic Diversity of Proboscis Monkey
(Nasalis larvatus)
larvatus) from Selected Populations in Malaysian Borneo
Licia. Ho1 and MT. Abdullah1
Department of Zoology, Faculty of Resource Science and Technology, Universiti
Malaysia Sarawak,
Email: [email protected]
1
ABSTRACT:
Proboscis Monkey, Nasalis larvatusis a large and sexually dimorphic non-human
primate that specifically belongs to subfamily Colobinae. These monkeys are
endemic to the island of Borneo and classified as Totally Protected Animals under
Wild Life Protection Ordinance Sarawak due to often deforestation and land
conversion that had highly restricted their nature habitat. Primate studies available
mainly focus on their living behaviors or diet, with fewer study focus on their
genetic diversity, especially in Sarawak. This research study is aim to examine the
genetic diversity of N. larvatus population from Sarawak and Sabah using D-loop
control region segment. Non-invasive sampling was applied in this study by
collecting fecal as the major samples source. Out of a total of 62 fecal samples,
29 unique haplotypes were identified. Eighteen haplotypes were discovered from
the Sarawak and 14 haplotypes were from Sabah populations. Three haplotypes
were shared within population from Sarawak and Sabah. Population from Sarawak
retained higher haplotypes diversity and nucleotide diversity compared to Sabah
population.
Keywords:
Keywords genetic diversity, proboscis monkey, D-loop control region, haplotype,
Sarawak
24 | MGC10
FP9
FP9
ID 064
064
Genetic Analysis of Some Production Traits in Flue Cured Virginia
Tobacco (Nicotiana
(Nicotiana tabacum L.)
Fida Mohammad* and Qaizar Ahmed
Department of Plant Breeding and Genetics
Faculty of Crop Production Sciences, The University of Agriculture, Peshawar,
Pakistan
Email: [email protected],pk
ABSTRACT:
This research was conducted to determine heterosis, combining ability and the
mode of gene actions for various traits in FCV tobacco. Seven varieties were
crossed in all possible combinations to generate full diallel at the Tobacco
Research Sub Station, Mansehra (hilly) during 2007. Forty two F1 hybrids along
with their parent cultivars were planted at the Tobacco Research Station (TRS),
Pakistan Tobacco Board, Khan Ghari, Mardan (plain) and the Tobacco Research
Sub Station (TRSS), Mansehra (hilly) during 2008 to 2009. Experiments were
planted in randomized complete block design with four replications. Two years
experiments over two locations were termed as 4 environments (E-1, E-2, E-3
and E-4). Data were recorded on various traits. Analysis of variance revealed
significance (P<0.01) among genotypes and their interactions with environments
for all traits. Prior to genetic analysis, the adequacy of additive-dominance model
was assessed through t2 test, regression analysis and array analysis. Both additive
(D) and dominance (H) components were significant for grade index and reducing
sugars across all environments while additive (D) component was significant only
for plant height, leaves plant-1 and leaf area. Either both (D and H) or additive (D)
components were significant for all other traits across various environments. The
environmental component (E) was significant for all traits across all environments
except reducing sugars. The Vr Wr graphs revealed partial dominance for most of
the traits. The positions of arrays on regression line for maximum dominant or
recessive genes in parent cultivars were environment-specific. Estimates of
narrow sense heritability were higher than 60% for days to flowering, leaves plant1
, internodal length, green leaves weight, cured leaves weight, number of green
leaves, number of cured leaves, yield and grade index across environments.
Analyses of combining ability revealed that the role of additive gene action was
predominant for all traits across all environments except nicotine. Reciprocal
effects were significant for days to flowering, internodal length, nicotine and
reducing sugars across all environments. However, the significance of reciprocal
effects for other traits was environment-specific. The range of heterobeltiosis for
yield related traits was exhibited as -0.03 to -62.03% for traits desirable in
negative heterosis and as 0.02 to 25.90% for traits desirable in positive heterosis.
This study indicated KHG22/Spt G 126; Spt G 28/Spt G 126; Spt G 126/KHG24
Spt G 126/Spt G 28; KHG24/Spt G 28 and Spt G 126/NC606 are best hybrids to
be considered for further investigation.
FP10
FP10
ID 039
039
A DecadeDecade-Long Research in Clinical Genetics: A Perspective on the
Autosomal Recessive Genetic Diseases in Saudi Arabia
Mohammed AlAl- Owain1,2
Department of Medical Genetics, King Faisal Specialist Hospital and Research
Centre, Riyadh, Saudi Arabia, and 2Alfaisal University, College of Medicine,
Riyadh, Saudi Arabia
Email: [email protected]
1
ABSTRACT:
Background and Purpose: Saudi Arabia (KSA) has a population of 27.1 million
and an overall consanguinity rate of 56%. Prevalence of many autosomal
recessive disorders is higher than other known populations. Research in clinical
genetics has been fascinating in KSA culminating in the dramatic increase in
mapping of various autosomal recessive disorders.
Methods: To reflect on a decade-long research in clinical genetics with a focus
on the cloning of new genes, mapping of new syndromes to specific loci, the
expansion of known phenotypes, and the description of the local genetic variants
in KSA.
Results: Many novel syndromes, novel genes, and delineating the phoenotypes of
known genetic disorders will be described depicting different genetic concepts
pertinent to this highly inbred population. Illustrative examples about founder
mutations and allelic heterogeneity will be presented. The new era of molecular
diagnosis, power of homozygosity and whole exome sequencing will be discussed.
Finally, challenges in genetic diagnosis facing the clinical geneticist in our society
will be highlighted.
Conclusions: We have had enormous research opportunities and results in
genetics in KSA paralleling the wealth of clinical findings and observations on one
side, and the power of the current molecular technologies on the other.
Addressing such genetic diseases at the national level will become a cornerstone
of strategic health care initiatives in the 21st century. Promoting research,
education about genetic diseases, establishment of a “national registry” and
mutational database, and enhanced healthcare access are crucial for success of
any preventative campaign of genetic disorders in the country.
25 | MGC10
FP1
FP11
ID 043
043
FP1
FP12
ID 085
085
Predicting Functional Impact of a Novel Missense Mutation
(p.Asn199His) in Ornithine Transcarbamylase (OTC) Gene
Restoration of SHPSHP-1 Expression by 55-Azacytidine Confer Sensitivity
in ImatinibImatinib -Resistant BCRBCR-ABL Chronic Myeloid Leukaemia
Ernie Zuraida A,
A Yusnita Y, Nurul FR, Ngu LH 1 and Siti Azma J2
Molecular Diagnostics and Protein Unit, Specialised Diagnostics Centre, Institute
for Medical Research and 1Genetics Department, Kuala Lumpur Hospital and
2
Faculty of Pharmacy, Universiti Teknologi MARA (UiTM)
Email: [email protected]
MF Johan and HA AlAl- Jamal
Department of Haematology, School of Medical Sciences, Universiti Sains
Malaysia
Email: [email protected]
ABSTRACT:
ABSTRACT:
Introduction: Ornithine transcarbamylase (OTC) deficiency is the most common
inborn error of the urea cycle. The human OTC gene is located on the short arm of
the X chromosome within band Xp21.1. The gene contains 10 exons and the
phenotype of OTC deficiency is extremely heterogenous. Mutation identification is
a key component and the gold standard for prenatal diagnosis and detection of
female carrier. Point mutations and small deletion/insertion in the OTC gene are
responsible for the majority of cases and are specific in individual families.
Introduction. Imatinibmesylate, a tyrosine kinase inhibitor specifically targets
BCR/ABLfusion protein and induces haematological remission in patients with
chronic myeloid leukaemia (CML). However, majority of CML patients treated with
imatinib develop resistant under prolonged therapy. SHP1, a tyrosine phosphatase
that negatively regulates JAK/STAT signalling pathway, is frequently absent in
CML due to gene methylation. 5-Azacytidine (5-Aza) is a demethylating agent that
has shown activity against myeloid leukaemias by reactivation of silenced tumour
suppressor genes.
Objective: To investigate the effect of novel missense mutation in OTC gene by
using bioinformatics approaches.
Objectives. To investigate potential mechanism of resistance to BCR/ABL inhibitor
(imatinib) in a BCR/ABL positive CML cell line, K562.
Methods: The OTC gene was amplified using touchdown PCR and subsequently
subjected to bidirectional sequencing. SeqScape software, SiFT, Polyphen,
Homolog, I-Mutant, homology modeling and molecular dynamics (MD) simulation
were used to predict the pathological effects of the mutations.
Methods. We developed a resistant cell line by long-term co-culture of K562
cells with imatinib, designated as K562R and treated the cells with 5-Aza
(K562R+5Aza). TaqMan® Array Human JAK/STAT Pathway gene expression
assays was performed for both K562R and K562R+5Aza in ABI 7500 Fast RealTime PCR System. Upregulated genes wereanalysed using pyrosequencing.
Sensitivity towards imatinib was determined using MTS assays and apoptosis
analysis was performed using annexin V-FITC binding assays.
Results and Discussion: Mutational analysis identified a novel missense mutation
that was detected in exon 6 at c.595A>C. This nonsynonymous substitution
resulted in changed of asparagine (Asn) to histidine (His) at a highly conserved
amino acid residue 199 (p.Asn199His). This mutation was not detected in 50
healthy unrelated individuals. Further in-silico analyses predicted this mutation to
be functionally damaging. Structural modeling revealed that the wild-type residue
(Asn-199) was located on the surface of the protein. The differences in chemical
properties between wild-type and mutant residue could disturb the binding site of
the structure. The mutation introduces a bulky residue (His) than the wild-type
residue (Asn) at this position, thus could disturb the multimeric interactions and
most likely could alter the protein structure. The mutation could also affect the
local stability when the neighbouring residues in contact with the ligand.
Conclusion: In conclusion, both in-silico and structural analysis of the mutation
revealed that this novel mutation (p.Asn199His) is likely to be pathogenic.
Results. The IC50 of imatinib on K562R+5Aza was 300 nM compared to 4000 nM
(K562R) (Z= -2.323, P=0.02) that confirmed the sensitivity. Moreover, the
apoptotic cells in K562R+5Aza were 59% compared to only 20% in K562R
(P<0.001) at 300 nM. Gene profiling reveals down-regulation of JAK/STAT
negative regulators, SOCS1, SOCS2, SOCS3, SHP1 and PTPN11 in K562R cells.
However, after treatment with 5-Aza, only SHP1gene was upregulated, by 6folds.Pyrosequencing showed that restoration was due to demethylation of SHP1
gene.
Conclusion. The results of this study suggested that, the restoration of SHP1
expression in 5-Aza treated resistant CML cells induces sensitivity response to
imatinib and increases the cell death. Our findings support SHP1 as a negative
regulator of JAK/STAT signalling pathway and may play important roles in the
treatment of imatinib resistant BCR/ABL positive CML.
26 | MGC10
FP1
FP13
ID 018
018
HighHigh -Throughput Multiplex PCR with FluorescentFluorescent-Labeled
Microsatellite Marker for Genotyping and Genetic Analyses in Rice
(Oryza sativa L.).
S. Ashkani1*• M. Y. Rafii2 • H. A. Rahim3 • M. A. Latif2, 4
1
Department of Agronomy and Plant Breeding, Shahr-e- Rey Branch, Islamic Azad
University, Tehran, Iran
2
Institute of Tropical Agriculture, Universiti Putra Malaysia
3
Agrotechnology and Bioscience Division, Malaysian Nuclear Agency, Bangi,
Kajang, Selangor, Malaysia
4
Bangladesh Rice Research Institute (BRRI),Gazipur 1701, Bangladesh
*
Corresponding author:S. Ashkani
E-mail: [email protected]
ABSTRACT:
Multiplex SSR-PCR approach is useful to increase the information per SSR assay,
variety fingerprinting, plant genotyping, genetic linkage analysis and mapping of
segregating populations. In this investigation, sixty-three polymorphic
microsatellite markers related to blast resistance genes (Pi genes), fluorescentlylabeled at 5'-end with either 6-FAM or HEX dye from set G5, Applied Biosystems,
were incorporated into the PCR reaction to enable detection of fragments in
automated system. For rice F3 families, obtained from crosses between
PongsuSeribu 2 (Malaysian blast resistant cultivar) and Mahsuri (a susceptible rice
cultivar), progeny genotypes, for each microsatellite locus from multiplex sets
were determined. Genotyping assays were carried out on a capillary-based
ABIPRISM 3100 genetic analyzer (Applied Biosystems) according to the
manufacturer’s instructions. Fragment size data (range of allele sizes) and peakarea of the true peaks were determined and analyzed using Genotyper version 3.7
and Gene-Mapper version 4.0 software (ABI). The SSR panels generated 3 alleles
per locus and the sizes of the SSR alleles observed with automated fluorescent
detection system ranged from 79 bp to 324 bp. Marker Segregation data were
also analyzed by the chi-square (χ2) test. Various conditions of multiplex-PCR
were examined and the technical aspects of the application were also described.
In summary, the objectives of this study were: 1) To develop and setup multiplex
SSR-PCR analysis with a 5´ dye-labeled marker set for genetic analysis of
segregating populations in rice 2)To evaluate the usefulness and potential of SSR
multiplex-PCR technique, and fluorescent labeling detection systems for
genotyping of rice germplasm. In the future, panels of microsatellites from each
rice chromosome developed in this study will facilitate genotyping of rice
germplasm collections and the identification of genes and QTLs underlying blast
resistance trait. The genotyping methodology was found to be both highly
informative and robust and should be transferable to similar analyses of any
species.
FP1
FP14
ID 021
021
DNA Profiling of Meranti Timber (Shorea
(Shorea platyclados)
platyclados) for ChainChain -ofofCustody Certification.
Ng CH1, Lee SL1, Tnah LH 1, Lee CT1, Ng KKS1, Diway B2&Khoo E3
Forest Research Institute Malaysia, 2Sarawak Forestry Corporation, 3 Forest
Research Centre, Sabah
Email: [email protected]
1
ABSTRACT:
The genetic variations of Shorea platyclados were captured in the form of DNA
profiling and usedasa tool in the chain-of-custody for timber trade. The DNA
profiling was produced by using short tandem repeats (STRs) and chloroplast (cp)
DNA markers. Twenty seven natural populations of S. platyclados were genotyped
with 15 STRs to develop the DNA profiling database. Cluster analysis divided the
27 populations into two genetic clusters, corresponding to West and East
Malaysia. For cp-DNA profiling, a distribution map of 35 haplotypes was
constructed by using seven cpDNA-regions (trnT-trnL, trnS-trnG, atpB-rbcL, petGtrnP, trnG-atpA, psbM-trnD and trnG-rps14). Similarly, the BARRIER results
revealed that samples from West and East Malaysia were distinguishable. Both
the STR and cp-DNA databases are useful to track the origin of S. platyclados
from West and East Malaysia. Hence, for sustainable forest management
practices, this DNA-based method could serve as an add-on tool to the existing
timber tracking systems by monitoring the supply chain of timber wood trading.
Key words: Rice (Oryza sativa L.), Simple sequence repeats (SSR), Polymerase
Chain Reaction (PCR), Multiplex PCR, Fluorescent-labeled microsatellite
27 | MGC10
FP1
FP15
ID 036
036
FP1
FP16
ID 008
008
Location Effect on Heritability and Selection Response for Maturity
and Yield Traits in Wheat under RainRain -Fed Conditions
Recovery of a Malaysian Recombinant Newcastle Disease Virus
Strain
Dr Iftikhar Hussain Khalil
Plant Breeding and Genetics, Faculty of Crop Production Sciences, The University
of Agriculture Peshawar, Pakistan
Email: [email protected]
Kavitha Murulitharan1, Khatijah Yusoff1,2, Abdul Rahman Omar 1, Aidin
Molouki1,*
1
Institute of Biosciences, Universiti Putra Malaysia
2
Department of Microbiology, Faculty of Biotechnology and Biomolecular Sciences,
Universiti Putra Malaysia.
Email: [email protected]
ABSTRACT:
Wheat breeders evaluate new genotypes at several locations to ascertain their
yield potential and stability before release as new cultivars. Twenty wheat
genotypes were evaluated at three locations (AUP, NIFA and CCRI) of Khyber
Pakhtunkhwa province, Pakistan as independent rainfed experiments during
2011-12 using RCB design with three replications at each location. Analysis of
variance across locations revealed significant differences (P < 0.05) among wheat
genotypes and locations for tillers m-2, spike length, grains spike-1, 1000-grain
weight and grain yield. Genotype × location interaction was also significant (P <
0.05) for all traits indicating differential performance of genotypes over the three
test locations. Averaged over 20 wheat genotypes, tillers m-2, spike length, grains
spike-1, and grain yield were significantly greater at AUP than the other two
locations. Ranking of wheat genotypes for major yield components varied over
three locations. Maximum tillers m-2 were produced by genotype WG-08036 at
AUP (421 tillers m-2), WG-08019 at NIFA (354 tillers m-2) and CT-08055 at CCRI
(287 tillers m-2). More grains spike-1 were recorded for genotype CT-08055 at
AUP (80 grains spike-1), SRN-28 at NIFA (69 grains spike-1) and SRN-28 at CCRI
(51 grains spike-1). Genotypes CT-08055, CT-09095 and CT-09128 were top
ranking for 1000-grain weight at AUP (42.9 g), NIFA (50.7 g) and CCRI (60.2 g).
Genotypes SRN-55, SRN-28 and CT-09095 were high grain yielder at AUP (7222
kg ha-1), NIFA (4756 kg ha-1) and CCRI (5859 kg ha-1). Expression of genetic
variability in form of heritability and selection response also varied over the three
locations. Moderate heritability estimates (h2 = 0.43-0.71) were observed for
spike length, 1000-grain weight and grain yield. Low heritability estimates (h2<
0.44) were noticed for tillers m-2 and grains spike-1 over the three test locations.
Grain yield exhibited significantly positive genetic correlation with tillers m-2
(rG=0.32, P<0.01) and grains spike-1 (rG=0.35, P<0.01). Similarly, grain yield
exhibited strong phenotypic relationship with 1000-grain weight (rP=0.44,
P<0.05) and harvest index (rP=0.83, P<0.01). Multi-location evaluation appears
best strategy to select wheat genotypes with inherent ability to survive moisture
stress under rainfed production environments.
ABSTRACT:
Newcastle disease virus (NDV) or avian paramyxovirus 1 remains a constant major
threat to commercial poultry production. The virus has shown remarkable effect
as an oncolytic agent as well as a carrier of antigens. Clinical trials are being
conducted in the United States, Canada, China, Germany and Hungary onitsusein
cancer treatment. Although these studies have produced positive response rates,
there remains issues which need to be addressed; in particular on the mechanism
of interaction and delivery of the virus. Therefore, the recovery of the virus is
crucial for further studies in the development of recombinant vaccine from a virus
phylogenetically closer to potential outbreak as well as novel oncolytic agents. The
strain AF2240-I, a derivative of the strain AF2240; a viscerotropicvelogenic local
strain that is used as a vaccine challenge virus in Malaysia.In this study, we first
fully sequenced the genome of AF2240-I and used reverse genetics technology to
rescue the virus.Full length sequence analysis showed that the strain AF2240-I
belongs to genotype VIII. In addition, we observed that the HN protein comprises
582 amino acids and that this length has not been noticed in other NDV strains
worldwide. Full genome amplification was performed using PCR and rapid
amplification of cDNA ends (RACE) method followed by sequencing. Meanwhile,
recovery of virus was done using helper plasmid method. Three helper plasmids
(NP, P and L gene) were prepared in an expression vector. A full length genome
has been synthesized to be cloned into a transcription vector. These plasmids
were co-transfected into cells stably expressing T7 RNA polymerase. This
recovery of a local NDV will allow us to investigate the unique feature of the HN
gene length and its contribution to pathogenicity and serve as a basis for
experimental investigation of viral oncolytic properties.
28 | MGC10
FP1
FP17
ID 057
057
FP1
FP18
ID 114
Small Interfering RNA as a Versatile Tool for Functional Studies of
Acute Myeloid Leukaemia
Update on the Genetic Basis of Hearing Loss in the Saudi Arabian
Population
Emmanuel Jairaj Moses1, Dr MdAzman PKM Seeni Mohamed1, Professor Dr
Olaf Heidenreich2, Professor Dr Narazah Mohd Yusoff1.
1. Advanced Medical and Dental Institute, UniversitiSains Malaysia, Bertam
2. Newcastle University, Northern Institute for Cancer Research Paul O'Gorman
Building, Medical School, Framlington Place Newcastle upon Tyne NE2 4AD
Email: [email protected]
Khushnooda Ramzan*,
Ramzan*, Mohammed AlAl- Owain, RababAllam, Selwa AlAl-Hazzaa,
Khalid Taibah, and FaiqaImtiaz
Email: [email protected]
ABSTRACT:
Acute Myeloid Leukaemia (AML) is a heterogeneous group of malignancies
caused by transformation of hematopoietic precursors. Hallmarks of this disease
include acquisition of chromosomal aberrations and gene mutations. It is therefore
important to study the gene regulation of various oncogenes and other genes
involved in the development of this disease. Small interfering RNA (siRNA) could
be used as one approach in gene regulation studies given its track excellent
record this past decade. Methods of siRNA delivery include transfection,
electroporation and viral vectors. In this study, we used an electroporation protocol
to deliver siRNAin-vitro to AML-M 2 cell lines (Kasumi-1 and SKN0-1). Two
siRNAs (siAGF1 and siCDKN1B) were directed against the leukaemic fusion gene
AML1-ETO and CDKN1B (p27) respectively. In Kasumi-1 cell lines, the knockdown
effect with siAGF1 (100nM) was observed as early as 24 hours with a knockdown
rate of 70% in AML-ETO gene expression level. In SKNO-1 cell lines, a
knockdown rate of 62% in AML-ETO gene expression was achieved with the
same amount of siRNA. The siRNA targeted against CDKN1B gene (siCDKN1B)
yielded a similar effect in SKNO-1 cell lines when 100nM of siRNA was used
(62% knockdown rate of CDKN1B gene expression after 24 hours). Prolonged
knockdown experiments with sequential electroporation on SKNO-1 cell lines
using siAGF1 at a concentration of 100 nm showed that a 50 % knockdown rate
in AML-ETO expression after 10 days. Similarly, siCDKN1Bat a concentration of
100 nM achieved a knockdown rate of 54% in CDKN1B expression levels. In
conclusion, siRNA mediated gene knockdown via electroporation is a suitable
method to study gene regulation in Kasumi-1 and SKNO-1 cell lines.
ABSTRACT:
Hearing loss is one of the most common sensory disorders in humans with both
genetic and environmental aetiologies. Genetic causes of hearing loss are
extremely heterogeneous and the autosomal recessive inheritance accounts for a
substantial part of this disorder. To date, more than 100 genomic loci for hearing
loss have been mapped.Our study aims to comprehensively delineate the genetic
basis of hearing loss in the individuals of Saudi Arabian origin segregating with
severe to profound, non-syndromic or syndromic congenital deafness with an
autosomal recessive (ar) mode of inheritance. The first identified DFNB1 locus
(mutations in GJB2 and GJB6 genes), account for up to 50% of all the cases with
NSHL in various populations. Since then, forty-two genes contributing to
autosomal recessive non-syndromic hearing loss (arNSHL) have been identified.
Our results indicate that in the Saudi Arabian population, the genetic forms of
congenital arNSHL are not caused by mutations in GJB2 and GJB6, the most
common genes for deafness in various populations worldwide.The identification of
the causative gene/mutation in affected families with deafness is difficult due to
extreme genetic heterogeneity and lack of phenotypic variability. Consanguinous
families are a powerful resource for genetic linkage studies/homozygosity
mapping for recessively inherited hearing impairment. Prioritized linkage analysis
and homozygosity mapping for known deafness loci was conducted. Candidate
genes were selected from the chromosomal region that generated the highest
LOD score (multipoint linkage analysis) or in the largest region of homozygosity
shared among the affected individuals for a family.By using the effective bidirectional approach, we were able to identify the most common forms of
hereditary hearing loss, their incidence and distribution in the Saudi population.
Mutations in 13 different deafness genes have been identified in 80 families. The
overall results of this study are highly suggestive that the underlying molecular
basis of hearing loss in Saudi Arabia is very genetically heterogeneous. The
benefit of this study will hopefully provide the foundation for knowledge and
awareness through screening of carrier status and genetic counseling, thereby
having a major impact upon early intervention for and prevention of hereditary
hearing loss.
29 | MGC10
FP1
FP19
ID 047
047
FP20
FP20
Small--Insert
Construction and Characterization of the Partial Small
Genomic Libraries of Eucheuma and Kappaphycus (Solieriaceae,
Rhodophyta) Seaweeds
Salahaudin Maili Mohd Rasli1, Grace Joy Chin Wei Lie1*, Kenneth Francis
Rodrigues1, Wilson Yong ThauLym1
1
Biotechnology Research Institute, 88400 Jalan UMS, University Malaysia Sabah
Email: [email protected]
ID 023
Assessment of Variability of CameroonCameroon -based Biparentaldura
Biparental dura x
pisifera Oil Palm Genotypes for Oil Quality Traits and
Interrelationships among Traits
BeyegueBeyegue- Djonko H 1, 2; Kushairi A.3; Rajanaidu N.3&Jalani B.S.2
: Faculty of Agronomy & Agricultural Sciences (FASA), University of Dschang
2
: Faculty of Science & Technology, UniversitiSains Islam Malaysia (USIM)
3
: Malaysian Palm Oil Board (MPOB)
Email:[email protected]
1
ABSTRACT:
ABSTRACT:
Eucheuma and Kappaphycus seaweeds are two major sources of carrageenan
which finds application in the hydrocolloid industry, however the taxonomy of
Eucheuma and Kappaphycus are morphologically confusing with the existence of
many phenotypic variants. Shotgun cloning is useful for molecular characterization
of non-model organisms using anonymous nuclear loci.Herein, we report the
characterization of partial small-insert genomic libraries of randomly isolated
fragments which were obtained from the cloned double digestionof the genomic
DNA of Eucheumadenticulatum var. Alien Denticulatum and Kappaphycus striatum
var. Green Flower using six combination of six cutter restriction enzyme. A total of
101 cloned fragments were size selected for primer design and were successfully
used to screen among four varieties of Eucheuma seaweeds (var. Alien
Denticulatum, Alien Brown, Cacing and Denticulatum) and nine varieties of
Kappaphycus seaweeds (var. Tambalang, Giant, Yellow Flower, Buaya, Green
Flower, Aring-aring, Tangan, Brown, and Giant Flower). All the DNA sequences
were analyzedand annotated with CLC workbench and deposited in NCBI. Intraspecific and interspecific amplification of primers were successfully performed.
Specific PCR-based markers were identified and developed for fingerprinting of
Eucheuma and Kappaphycusvarieties.This study demonstrated the usefulness of
anonymous nuclear loci to provide large numbers of useful markers derived from
partial small-insert genomic libraries in seaweeds. With this approach,
amplification patterns of primers derived from partial small-insert genomic
libraries signify markers that can be used to effectively classify seaweed varieties
at the species level in a more decisivemanner as well as for application in
seaweed biotechnology.
Keywords: Eucheuma, Kappaphycus, seaweeds, partial small-insert genomic
libraries, carrageenan, molecular markers
An oil palm population made of thirteen dura (D) x pisifera (P) biparental
genotypes resulting from intra and intercrosses from five dura mother palms from
Cameroon and two pisifera palms, one from Cameroon (CMR) and the other from
the Democratic Republic of the Congo (DRC), were field tested for their oil quality
trait profiles in a trial planted at the Malaysian Palm Oil Board Research Station in
Keratong (Pahang).The aim was to study the variation among genotypes for fatty
acid content, iodine value and carotene content, and phenotypic correlations
among traits. Oil quality profiles were determined using gas chromatography for
fatty acid composition (FAC) and iodine value (IV), and mass spectrophotometry for
carotene content (CC). The analysis of variance revealed significant differences
among genotypes for all oil quality traits. Genetic parameters indicated that there
were prospects for improvement of performance of genotypes though selection.
The magnitudes of genotypic coefficient of variation (GCV), phenotypic coefficient
of variation (PCV) and the broad-sense heritability estimates revealed that
improvement of the FAC, IV and CC profiles was achievable through selection.
Genotypes scored remarkably high CC as compared to commercial D x P planting
materials with ranging between 500 ppm and 700 ppm, and could be useful for
enhancing the existing breeding populations. The genotypes CMR x CMR
outperformed genotypes CMR x DRC for IV translating thus the higher combining
ability of Cameroon pisifera palm over its counterpart from the DRC for imparting
higher unsaturation to mesocarp oil. The correlation analysis indicated that that
selection for high C16:0 would mean indirectly selecting for low IV, whereas
selection for high C18:1 would mean selecting for higher IV. The significant
positive correlation between C18:0 and C18:1 contents indicated that selecting
for high C18:1 would indirectly select for high C18:0. In the same vein, selecting
for higher C18:0 would indirectly mean to select for lower C16:0 (r=-0.59) and
higher IV meaning higher unsaturation. A negative significant correlation was also
found between C16:0 and C18:1 (r=-0.81). The study is a contribution to the
evaluation of oil palm germplasm collected by the Malaysian Palm Oil Board
worldwide.
Key words: Oil palm, assessment, variability, interrelationships, oil quality traits,
fatty acids, iodine value, carotene content, gas chromatography, mass
spectrophotometry.
30 | MGC10
FP2
FP21
ID 012
012
FP2
FP22
ID 031
Molecular Phylogeny of Malaysian Primates Inferred from mtDNA
Cytochrome Oxidase II Gene
Molecular Phylogenetics of the Sole Sweet TasteTaste-Specific Receptor
Gene TAS1R2 in Primates
1
Millawati Gani,
Gani, 2Noor Aisyah A. Rahim and 3M. T. Abdullah
Department of Zoology, Faculty Resource Science and Technology,Universiti
Malaysia Sarawak
Email: [email protected]
1,2 ,*
Nur Aida Md Tamrin1,2,*
Mohd HanifRidzuan Mat Daud1,2, Ramlah Zainuddin3,
Yuzine Esa4and Mohd Tajuddin Abdullah1,*
1
Department of Zoology, Faculty of Resource Science and Technology, Universiti
Malaysia Sarawak
2
Malaysia Genome Institute, Ministry of Science Technology and Innovation
3
Centre for Pre-University Studies, Universiti Malaysia Sarawak
4
Department of Aquaculture, Faculty of Agriculture, Universiti Putra Malaysia
Email: [email protected], [email protected]
ABSTRACT:
In Malaysia, there are 21 described primate species which consist of five families
and all of them are under protected three laws in Sarawak, Sabah and Peninsular
Malaysia. Although, there are studies on primates done in Malaysia but none of
them are conducted in detail investigation on molecular ecology. For this study,
three types of sample which are blood, tissues and fecal were collected and
preserved in both buffer form and dried forms. A total of 57 individuals comprised
of 12 species were sequenced using COII mtDNA gene with 780 base pair in
length to determine their phylogenetic relationship and genetic variation. Two
methods of phylogenetic trees were constructed which are Neighbour-joining (NJ)
and Maximum Parsimony (MP). The results showed both trees form a
monophyletic tree and the resulted in similar statistically supported clades with
minimal change in branching order. However, there are some unresolved
relationships among the Malaysian primates for this study due to lower bootstrap
value represents and lack of sample size.
ABSTRACT:
Taste perception is an essential component that provides valuable dietary and
sensory information, which is crucial for the survival of animals. Since the
discovery of the vertebrate taste receptor genes, genetic studies of taste
perception have been conducted in a number of species for bitter taste receptors.
However, similar studies for sweet taste receptors are very scarce especially the
one that include Bornean endemic primates, Nasalislarvatus (Proboscis Monkey)
and Pongopygmaeus (Bornean Orang Hutan). We provide an attempt to
investigate the phylogenetic relationship and pattern of the sole sweet tastespecific receptor gene Tas1r2 in 20 primate species, one of the most diverse
groups of mammals in terms of diet, starting from specialist folivores and
frugivores to omnivores. Phylogenetic analyses of Tas1r2 gene using four
methods, namely neighbour-joining, maximum parsimony, maximum-likelihood
and Bayesian resulted in similar statistically supported clades with minimal
change in branching order. The analyses discovered that there are three
monophyletic groups with respect to the outgroup which consists of apes (lesser
and greater apes), old world monkey and new world monkey. The study
successfully elucidates the evolution and phylogenetic relationship of Tas1r2 gene
in primates. Although the gene can be considered as conserved gene, the variable
nucleotides give enough information to separate the primate into their taxonomic
group and their diet preferences. However, more studies on the gene functionality
should be carried out to gain more understanding about the gene function in
primates.
Keywords: Primates, phylogenetics, sweet taste, Tas1r2 gene
31 | MGC10
FP2
FP23
ID 102
Malaysian Node of the Human Variome Project Database (MyHVPDb)
Halim Fikri Hashim1&4, Atif AB3, Nurul Fatihah Azman1, Wan Khairunnisa WJ1,
Ang Mia Yang5, Sarifah Hanafi2, Ab Rajab NurNur - Shafawati2; Wan Isa
2
3
Hatin ,Rosnah Bahar , Muhammad Farid Johan3 , W. Zaidah Abdullah3,
Rosline Hassan3, Zilfalil BA1, A. Zubaidi AL4 and Malaysian Node of the
Human Variome Project
1
Department of Pediatrics, School of Medical Sciences, UniversitiSains Malaysia
2
Human Genome Centre, School of Medical Sciences, UniversitiSains Malaysia
3
Department of Hematology, School of Medical Sciences, UniversitiSains Malaysia
4
Faculty of Medicine and Health Sciences, Universiti Sultan ZainalAbidin,
Terengganu, Malaysia.
5
Faculty of Science & Technology, National University of Malaysia, Bangi, Malaysia
Email: [email protected]
ABSTRACT:
The Malaysian Node of the Human Variome Project Database (MyHVPDb) is a
country specific database of human variant and gene mutation that was
established in 2011. This ethnic specific mutation and variation databases are
being continuously updated, recording extensive information over the genetic
heterogeneity of the Malaysian ethnic groups. The database comprises of SNP
Database and Mutation Database. The SNP database has stored 291718 SNPs
that was obtained by genotyping the SNPs of 103 healthy individuals from six
Malay sub-ethnic groups. The Mutation Database is a database comprising of
mutations of genes that are related to diseases common in Malaysia. It now
contains 143 mutations from 16 genes from various ethnic groups in Malaysia.
These data on mutations were collected from results published in journals. This
database also will complement other databases in South East Asia such as
Thailand and Singapore Variant and Mutation databases providing the crucial
information on the genetic background of the population in this region as well as
the pattern of disease at the molecular level. Hence, it will be useful not only for
researchers in Malaysia but also for those in countries with similar ethnic
background throughout the world.
FP2
FP24
ID 103
Analyses of DNA Variants in Kelantan Malays and Chinese with
Hereditary Nonpolyposis Colorectal Cancer: A Preliminary Study
Wan Khairunnisa WJ1, Iman S1, Nur Shafawati AR1, Nurfazreen MN1,Sarifah
H 1, Siti Noor Nina A1, Khairul Bariah AA2, Nor Aizal CH 3, Zilfalil BA4
1
Human Genome Center, 2School of Dental Sciences, 3Department of Medicine,
4
Department of Pediatrics, School of Medical Sciences, Universiti Sains Malaysia
Email: [email protected]
ABSTRACTS:
Hereditary nonpolyposis colorectal cancer (HNPCC) is commonly caused by
germline mutations in the DNA mismatch repair (MMR) genes: MLH1, MSH2,
MSH6, MSH3, PMS1 and PMS2. Among the group of MMR genes associated with
HNPCC, MLH1 and MSH2 genes make up for the majority of mutations. Mutations
in MLH1 and MSH2 genes account for almost 90% of the identified cases, while
7% of mutations occurr in MSH6 gene, and 3% in the remaining genes. The aim
of this study was to investigate the mutations found in Kelantan Malays and
Chinese with HNPCC and to compare the data obtained with other HNPCC related
studies.
Peripheral blood samples were obtained from Kelantan Malay and Chinese
patients with colorectal cancer who fulfilled the Bethesda criteria. Genomic DNA
was extracted from the peripheral blood samples. Polymerase chain reaction
(PCR) was then performed for exon 8 of MLH1 gene and exon 7 of MSH2 gene.
The PCR products were subjected to DNA sequencing to further characterize the
germline mutations. Our results showed that no mutations were found in the
seven samples that were analysed. In conclusion, although no germline mutation
was identified, the screening of mutations in other exons of the MSH2 and MLH1
genes, as well as other MMR genes are warranted. More samples are needed for
the study to be statistically significant.
32 | MGC10
FP2
FP25
ID 059
Effects of Transforming Growth Factor BetaBeta-1 and its Inhibitor
(SB431542) on Stem Cells from Human Exfoliated Deciduous Teeth
Cultured in Keratinocyte Growth Medium
Nur Izyan Azmi,
Azmi, Zurairah Berahim, Azlina Ahmad, Thirumulu Ponnuraj
Kannan and KhairaniIdah Mokhtar*
School of Dental Sciences, Universiti Sains Malaysia
Email: [email protected]
ABSTRACT:
Introduction:Transforming
Growth Factor Beta-1(TGFβ-1) is a growth
Introduction:
factorinvolved in various cellular mechanismswhich has been related with
epithelial cell differentiation.TGFβ-1 functions through a complex, consisting of
TGFβ type II and type I (ALK5) receptor. SB431542 is an inhibitor of TGFβ type I
receptor.Currently, stem cells from human exfoliated deciduous teeth (SHED) are
gaining attention in tissue regeneration in inducing SHED into epithelial-like cells.
Objectives: To study the effect of different concentrations of TGFβ1 and its
inhibitor on the cell viability of SHED cultured in a specific differentiation medium
using MTT assay.
Methods: SHED (1 x 104 cells/well) was cultured in a 96 well-plate in keratinocyte
growth medium.Serial dilution of TGFβ-1 concentrations (0.3125-320.0 ng/ml)
and SB431542 (0.156-160.0 µM) were separately incorporated into all wells and
incubated in a CO2 incubator at 37ºC for 72 hours. The cells cultured in the
medium without TGFβ1 and SB431542 were used as the control. The cell viability
was measured using MTT assay. The tests were conducted in triplicate. The cells
were also cultured in 35mm culture dish to observe the cell morphology.
Results: The cell viability of SHED was more than 50% in all the TGFβ1 and
SB431542 concentrations analyzed. The cells showed morphological changes
from long thin cell body to cuboidal shape.
Conclusions: There was a proportional increase in the cell viability of SHED with
increasing concentrations of TGFβ1. In the case of its inhibitor, the highest cell
viability was observed at 20 µM followed by a decline and then an increase. The
changes in the cell morphology suggested the process of cell differentiation.
FP2
FP26
ID 078
Overexpression of Chalcone Synthase (CHS) in the Cell Suspension
Cultures of Fingerroot, Boesenbergia rotunda
Nur Nadiah Roslan1, TehSer Huy2, Wong Sher Ming3, Norzulaani Khalid3 and
Zulqarnain Mohamed1,2
1
Division of Genetic and Molecular Biology, Institute of Biological Sciences,
University of Malaya
2
Centre for Research in Biotechnology for Agriculture, University of Malaya
3
Plant Biotechnology Incubator Unit (PBIU), Faculty of Science, University of
Malaya
Email: [email protected]
ABSTRACT:
Fingerroot, Boesenbergia rotunda (L.) is a small herbaceous plant belonging to the
Zingiberaceae family. It is widely distributed in Southeast Asian countries such as
Indonesia, Malaysia, and Thailand. This plant is commonly used as food ingredient
and/or traditional medicine. Recently, there has been increasing interest in its
rhizome as a good source of therapeutic agent as it exhibits potential analgesic
and antipyretic effects, anti-mutagenic, anti-viral and anti-inflammatory properties.
The compounds in its rhizome are usually secondary metabolites, such as
flavanones, chalcones, flavonols, anthocyanins and their derivatives, synthesized
through flavonoid biosynthesis pathway. A number of genes that function in this
pathway have been identified in other plants. Chalcone synthase (CHS) is one of
the key enzymes that involved in the early reaction of this pathway. It catalyzes the
sequential condensation of one p-coumaroyl-coenzyme-A (CoA) and three
malonyl-coenzyme-A (CoA) molecules and produces an intermediate
naringeninchalcone. Previously, we had isolated CHS gene from B. rotunda and
introduced this CHS gene into cell suspension of B. rotunda as an additional copy
intended to study the effects of overexpression of the CHS. In this study, we
screened the potential transgenic calli after a period of three months of
hygromycin selection in solid medium using GUS assay. Eight calli with positive
results from GUS assay were sub-cultured into liquid medium to verify the
presence of recombinant CHS genes and its expression level. PCR analyses
indicated that the additional copy of CHS gene was successfully integrated into B.
rotunda genome. Moreover, RT-qPCR results revealed different expressions level
of CHS gene in all transgenic cell suspension cultures where all of them were
observed to be higher (approximately 2-9-fold difference) than non-transgenic
(wildtype) control line. Further studies will be carried out to study the enzyme
functionality in these transgenic lines.
33 | MGC10
FP2
FP27
ID 048
Using YY -Chromosome to Elucidate the Evolution and Dispersal
Pattern of the LongLong -Tailed Macaques (Macaca fascicularis) in
Southeast Asia
Jeffrine J. RovieRovie-Ryan1,2,*, M. T. Abdullah2, Soon Guan Tan3, Frankie T.
Sitam1, Zainal Zahari Zainuddin4 & Zaaba Zainol Abidin5
1
Wildlife Genetic Resource Bank (WGRB) Laboratory, Ex-Situ Conservation Division,
Department of Wildlife and National Parks (DWNP) Peninsular Malaysia
2
Department of Zoology, Faculty of Resource Science and Technology (FRST),
Universiti Malaysia Sarawak (UNIMAS)
3
Department of Cell and Molecular Biology, Faculty of Biotechnology and
Biomolecular Sciences, Universiti Putra Malaysia
4
Borneo Rhino Alliance (BORA)
5
Deputy Director General II Office, DWNP
Email: [email protected]
ABSTRACT:
We employed a combined segment of the testis-specific protein (TSPY) and the
sex-determining region (SRY) of the Y-chromosome gene to elucidate the
evolutionary pattern of the long-tailed macaques (Macaca fascicularis) in
Southeast Asia. A maximum-likelihood (ML) tree and a phylogenetic network were
constructed using 147 sequences of M. fascicularis from the Peninsular Malaysia
and Sarawak including sequences from the other regions of the species range
taken from the other previous studies. Measurements of standard genetic diversity
indices were calculated. Our findings revealed that the M. fascicularis are
separated into two major groups of the continental and the insular lineages.
Furthermore, the continental lineage is separated into two faunal regions
demarcated at the Isthmus of Kra. The Y-chromosome dataset revealed a
dominant haplotype emerging at around 0.25 (±0.1) million years ago (mya)
which was shared by 82 samples from the southern region of the Isthmus of Kra
which ranges from Songkhla, Thailand, the Malay Peninsula and downwards to
Sumatra, Indonesia. The insular lineage emerged at around 0.61 (±0.4) mya
which occupied the island of Borneo and the Philippines. We also confirmed that
the introgression of the M. mulatta Y-chromosome into the Indochinese M.
fascicularis (Vietnam and Cambodia) are absent in the M. fascicularis haplotypes
from the southern region of the Isthmus of Kra.
FP2
FP28
ID 033
Evolution of Opsin Genes in Primates
Mohd Hanif Ridzuan Mat Daud1, Nur Aida Md Tamrin1, Yuzine Esa2, Ramlah
Zainuddin1, 3 and Mohd Tajuddin Abdullah1
1
Department of Zoology, Faculty of Resource Science and Technology, Universiti
Malaysia Sarawak,
2
Faculty of Agriculture, Universiti Putra Malaysia
3
Centre of Pre-University Studies, Universiti Malaysia Sarawak
Email: [email protected]; [email protected]
ABSTRACT:
Genetics of colour vision provide important insight in evolution of gene and
population genetics. Old world monkey, apes and also human have trichromatic
color vision, which enable them to fully discriminate the visible light spectrum.
Primates were sampled from selected areas in Peninsular and Malaysia Borneo to
distinguish genetic variation in different geographical locations. Three sets of gene
namely Short wave sensitive (SW), Medium wave sensitive (MW) and Long wave
sensitive (LW) Opsin genes were sequenced. SW is encoded by autosomal gene in
seventh chromosome while MW and LW Opsins genes are located head to tail
tandem array on X chromosome. Sequence data were analysed by using
Neighbour-joining, Maximum Parsimony, Maximum Likelihood and Bayesian
methods. The phylogenetic tree inferred by four methods produced almost similar
tree topologies with some changes in branching positions. The genetic distances
between primate’s species ranged from 1.2% to 9.1%. We found that there is a
pattern of mutation in the sequence among inter and intra species of human,
great apes, lesser apes and old world monkey. This research provides information
on the evolution of color vision genes among the primates and variations in
primate colour vision.
Keywords: Opsin genes; primates; phylogeny; evolution
Keywords: Macaca fascicularis, Y-chromosome, phylogenetic tree and network,
dispersal route, time estimates.
34 | MGC10
FP29
FP29
ID 035
Mapping of Genes Related to Immunity in the Nasalis larvatus
Genome Using Bioinformatic Approaches.
1
2
3
Aswini Leela Loganathan,
Loganathan, Vijay Kumar, Christopher VooLok Yung,
4
Kenneth Francis Rodrigues
Biotechnology Research Institute, University Malaysia Sabah, Jalan UMS
Email: [email protected]
FP30
FP30
ID 087
Association Mapping of Quantitative Traits in Tropical Sweet Corn
Pedram Kashiani1*, Ghizan Saleh1, Jothi Malar Panandam2 and
NurAshikinPsyquay Abdullah1
1
Department of Crop Science and 2Department of Animal Science, Faculty of
Agriculture, Universiti Putra Malaysia
E-mail: [email protected]
ABSTRACT:
ABSTRACT:
Nasalis larvatus (Proboscis Monkey) also known locally as Bekantan/Bayauare
endemic to the island of Borneo. Its habitat loss has resulted in severe decline in
endemic population and listed as Appendix I by the Convention on International
Trade in Endangered Species (CITES). This research will focus on characterizing
the genes linked to immunity and host defence which are the Major
histocompatibility complex (MHC) present in the Nasalis larvatus genome. The
MHC contains the most diverse genes in vertebrates which plays an essential role
in-host defence, kin recognition and mate choice.The aim of this study is to
assess the genes related to immunity in the Nasalis larvatus and gather novel data
that can benefit in clinical studies and eventually enable effective conservation
measures to be taken to protect the Nasalis larvatus in its natural habitats. In
order to achieve this, the Nasalis larvatus DNA was amplified using phi29.
Polymerase chain reaction (PCR) primers were designed from the MHC genes of
Non human primate obtained from EST. The primers were used to independently
amplify and sequence each DNA segment. Amplification reactions were performed
in a 96-well microtiter-plate thermal cycler (BIORAD). Gel extraction of the PCR
product was done using QIAquick gel extraction kit (QIAGEN) while Cloning was
carried out using CloneJET PCR cloning kit (Thermo Scientific). The plasmid was
purified using Gene Jet Plasmid Mini Prep Kit (Thermo Scientific). The plasmid
was then outsourced to a commercial company for sequencing. The sequencing
products were assembled and analyzed using SeqMan (DNASTAR) software.
Alignment was performed using ClustalW program in Mega 5.0. Phylogenetic tree
was constructed using Mega 5.0 to study the patterns of relationships of the
immunity genes among the Nasalis larvatus and other non primates and
presumed ancestors and the descendants are traced in time, by analysis of
homologous characters.
Association mapping (AM), based on linkage disequilibrium, is a complementary
strategy to traditional quantitative trait loci (QTL) mapping for describing
associations between genotypes and phenotypes in crop plants. Most of
agronomic traits in sweet corn (Zea mays cover. saccharata) are controlled by
several genes at different loci with varying degrees of genetic contribution. To
identify genomic regions responsible for these traits, a genome-wide association
study was conducted on 13 tropical inbred lines using 150 microsatellite DNA
markers.A total of 1347 alleles were amplified, out of which 344 were unique
among the inbred lines. Prior to association mapping, population structure was
assessed based on allele frequency using Bayesian model based approach,
identifying five main heterotic groups among the inbred lines. Association
analysiswas performed with 10,000 permutation replicates to determine
chromosome-wise and genome-wise significance levels of association tests.In
total, 19 significant marker-trait associations were identified when significance
level was set at p≤0.01.The portion of total variance estimated by the marker
ranged from 0.303 to 0.635. Each chromosome possessed at least one
(Chromosomes 1, 2 and 6) to three loci (Chromosomes 3 and 7) associated with
one of 17 agronomic traits measured.Among the yield related traits, dehusked ear
diameter was found to be associated withbnlg1526 located on Chromosome 10,
while dehusked ear length was associated with bnlg1518, umc1147, umc1265,
umc1652 and bnlg1401 located on Chromosome 10, 1, 2, 4 and 9, respectively.
Husked ear length and dehusked ear weight were found to be associated with
phi053 (Chr-3) and umc1143 (Chr-6), respectively. Significant associations
identified in the present study can be utilized as a powerful tool for uncovering
potential QTL-allele matrix for further marker-assisted breeding on tropical sweet
corn.
35 | MGC10
FP3
FP31
ID 094
Genetic Diversity of Aquilaria malaccensis (Thymelaeaceae) in
Peninsular Malaysia
Zakaria NurulNurul- Farhanah1, SoonSoon- Leong Lee1, ChaiChai- Ting Lee1, LeeLee-Hong Tnah1,
1
1
1
Chin Hong Ng , Kevin KitKit- Siong Ng , Hashim Siti Salwana , Lillian SweeSwee- Lian
Chua 1, KahKah-Hoo Lau1
1
Forest Research Institute Malaysia
Email: [email protected]
ABSTRACT:
Aquilaria malaccensis (Thymelaeaceae) is the main source of high grade gaharu in
Peninsular Malaysia. Aggressive collections and trade activities in recent decades
have resulted in heavy pressure on natural stands and concerns over the longterm survival potential of the species in Peninsular Malaysia. Genetic diversity of
A. malaccensis was investigated using nine populations distributed throughout
Peninsular Malaysia. Based on 14 micorsatellite loci, the present study revealed
moderate levels of genetic diversity in A. malaccensis. The allelic richness ranged
from 3.963 (Bukit Tapah) to 5.676 (Sungai Udang) whereas the gene diversity
ranged from 0.520 (Bukit Tapah) to 0.594 (Som). The coefficient of population
differentiation quantified using F-statistics showed that 92.8% of the total genetic
diversity was partitioned within population. The cluster analyses among
populations, however, formed two genetic clusters: Pasir Panjang/Paya
Rumput/Sungai Udang/Solok Duku/Som/Merchang as the common cluster and
Bukit Kerajaan/Gunung Semanggol/Bukit Tapah as the outlier.
36 | MGC10
List of Poster Abstracts
No
Abstract ID
1
027
2
Presenter
Category
Paper Title
Page No.
Atin Khalaj Hedayati
Genetic Charecteriztion of Macribrachium rosenbergii for Stock Improvement
Program
42
045
Tan Ying Ju
Heparin-Binding Proteins Encoded Genes Associated with Fertility in Beef Bulls
42
3
065
Habsah Bidin
Conception Rate of ICSI-Derived Bovine Embryos
43
4
066
Muhd Abdullah
Genetic Diversity of Terubok, Tenualosa toli, from Mukah, Sarawak Inferred by
Partial Cytochrome b (Cyt-b)
43
5
076
Mohd Adie Putra Mohd
Rosli
Preliminary Phylogenetic Evaluation of Isolated DNA Regions of Apomictic and
Hermaphroditic Plant-Nematodes to Infer Concerted Evolution Impedance
44
6
096
Azfar Ahmad
Microsatellite Loci Identification from Climbing Perch, Anabas testudineus
44
7
044
Ameerah Jaafar
Development of a Rapid Detection Method for Polymorphism in ARX, CDKL5 and
STXBP1 Genes
45
8
071
Siti Nurusaadah
Hamzah
Generation of Tyrosine Hydroxylase (TH) Positive Cells from Amniotic Fluid Stem
(AFS) Cells via Adherent and Non-Adherent Neural Induction Assays
45
9
072
Suzana Makpol
Modulation of Senescence-Associated Micro RNAS and Target Genes Expression
by Tocotrienol-Rich Fraction in Senescent Human Diploid Fibroblasts
46
10
003
Noor Hasima Nagoor
Overexpression of Wild-Type Anxa7 Tumour Suppressor Gene Alters CancerRelated Microrna Profiles in Human Prostate Cancer Cells
46
11
016
Wan Nurhayati Wan
Hanafi
The Frequency of Y Alu Polymorphism (YAP) Indel in Minangkabau Malays in
Peninsular Malaysia
47
12
019
Melahat Kurtulus-Ulkuer
Mitochondrial DNA Polymorphisms in Turkish Elite Wrestlers
47
Dyssegmental Dysplasia; Rolland-Desbuquois Type: A Case Report and Review
of Literature
48
ANIMAL
GENETICS
HUMAN
GENETICS
13
020
Muzhirah Haniffa
14
024
Maryam Jamielah
Yusoff
The Influence of ß-Defensins Copy Number Variable Gene in Relation to
Inflammation in Diabetic Patients
48
15
025
Phan Chin Lee
Chromosomal Abnormalities Detected with Conventional Cytogenetic and FISH
and Their Clinical Correlations in B-Chronic Lymphocytic Leukemia
49
16
028
Nik Rozma Bt Nik Abdul
Rahman
Patient’s Experiences with Prenatal Diagnosis in HKL Genetics Department
49
17
029
Noraishah Bt Abdullah
Communicating Genetic Risk Information in Families - Evaluating Tools to
Facilitate Genetic Health Services
50
18
046
Nor Afizah Binti Nuin
Analysis of Multiple Mutations in Dihydrofolate Reductase (dhfr) Gene Associated
with Antifolate Drug Resistance in Plasmodium vivax Sabah Isolates
50
37 | MGC10
List of Poster Abstracts
No
Abstract ID
19
051
20
Paper Title
Page No
Shaghik Barani
Genetic Polymorphisms of IL6 and IL8 and Over-Expression of Their Serum Levels
are More Prominent in Gastric Cancer Patients
51
052
Zana Karimi Kurdistani
Genetic Variation and Population Structure of Cytokine Genes among Six Iranian
Ethnic Populations
51
21
056
Marjan Mohammadi
The Role of TNFα and IL-1β promoter Polymorphisms in the Development of
Gastric Cancer
52
22
062
Asmida Isa
Chromosomal Abnormalities in Patients with Myelodysplastic Syndrome (MDS)
Using Karyotyping and Array-Based Comparative Genomic Hybridization (ArrayCGH)
52
23
077
Ili Syazwana Abdullah
Mutations of the Glucose-6-Phosphatase (G6PC) Gene Involving GSD1A Patients
in Malaysian Populations
53
24
081
Shirou Matsumoto
Perinatal Diagnosis and Neonatal Treatment for a Large Family with Ornithine
Transcarbamylase Deficiency
53
25
089
Nor Azimah Abdul Azize
Homozygous Splice Site Mutation in SLC25A20 Gene Causing CarnitineAcylcarnitine Translocase Deficiency in One Female Patient in Malaysia
54
26
090
Siti Aishah Abdul Wahab
Mutational Analysis of GAA Gene in Glycogen Storage Disease II Patients in
Malaysia
54
27
098
Nurul Ain Fathma
Abdullah
Detection of Beta-Globin Gene Mutations by Geneflow Beta-Thalassemia
Genotyping Test Kit (SEA) [FTPRO]: A Preliminary Study
55
28
101
Abdul Halim Fikri bin
Hashim
The Human Variome Project of South East Asia Node (HVP SEA Node)
55
29
104
Sarina Mat Yasin
Effectiveness of RAG 2 as a Genetic Marker to Inferred Phylogenetic Relationship
between Selected Orang Asli Population in Peninsular Malaysia
56
30
105
Nurul Fatihah
Genomic Variations of Malay Sub-Ethnic Groups in Peninsular Malaysia
56
31
107
Ainu Husna M S
Suhaimi
3D Structural Prediction and Modeling of xylanase in Bacillus coagulans ST-6
Fatemeh Shayesteh
Detection and Partial Characterization of an Antimicrobial Peptide Produced by
Marine Bacillus Sp. SH 10
57
Recombinant Production of Helicobacter pylori Neutrophil Activating Protein as a
Gastric Cancer Risk Screening Target
58
Targeting Recombinant Helicobacter pylori CagA C3 Domain as a Serologic
Biopsy Method for Screening the Risk of Gastric Cancer
58
Expression and Purification of Human Fibroblast Growth Factor 21 in E. coli
59
32
33
34
35
009
053
055
070
Presenter
Mohsen Doozbakhshan
Maryam Esmaili
Farnaz Emamdoust
Category
HUMAN
GENETICS
57
MICROBIAL
GENETICS
38 | MGC10
List of Poster Abstracts
No
Abstract ID
36
004
37
Presenter
Category
Paper Title
Page No
Mas Muniroh Binti
Mohd Nadzir
Improvement of Simple Mismatch Primers to Differentiate between HGGT Gene of
Elaeis guineensis and Elaeis oleifera at the Promoter Region by PCR
59
075
August Jenifer
Isolation, Characterisation and Phylogenetic Analysis of Nucleotide Binding SiteLeucine Rich Repeat (NBS-LRR) Motifs from Three Musa acuminata Varieties
60
38
106
Rafidah Badrun
Profiling of Functional Secondary Metabolic Genes from Two Pitaya Varieties,
Hylocereus undatus and Hylocereus polyrhizus
60
39
001
Ibtisam Abdul Wahab
The Presence of Calcium Oxalate Styloids in Pandanaceae
61
40
011
Mohd Asrul Sani
Fruit Quality Evaluation of Tissue Culture-Derived Mangosteen (Garcinia
mangostana L.) at Kuala Kangsar, Perak
61
41
015
Moritz Ivo Will
16S rDNA Analysis of Phosphate Solubilizing Bactria Isolated from the Rubber
Tree Hevea brasiliensis
62
42
026
Sivanaswari
Chalaparmal
Genetic Identification of Wild Aromatic Tropical Orchid (Aerides) using Inter Simple
Sequence Repeat Marker: A Breeding Strategy for Conservation
62
43
034
Noor Baiti Abdul aziz
Flower Biology Study for Future Breeding of Jackfruit
63
44
040
Mohd Norfaizal Ghazalli
Leaf Anatomical Studies of Bouea, Mangifera and Spondias (Anacardiaceae) in
Malaysia
63
45
042
Ni Made Armini Wiendi
Embryogenesis Endosperm Cells of Immature Seed of Mango (Mangifera indica
L.) Variety Gedong Gincu
64
46
049
Raimi Mohamed
Redwan
Composite Assembly of Pineapple Transcriptome Identifies the Methionine
Salvage Pathway which is Responsible for Ethylene Biosynthesis
64
47
060
Bala Aliyu
Effect of Different Media on the in Vitro Growth of Cactus (Opuntia ficus-indica)
Explants
65
48
061
Rozlaily Zainol
Genome Mapping of Red Clover (Trifolium pratense L.)
65
49
063
Yahaya Mustapha
Inheritance of Seedcoat Texture in Cowpea (Vigna unguiculata (L.)Walp)
66
50
069
Chee Fong Tyng
Genotyping for Fragrance in Sabah Rice Germplasm by Using Allele Specific
Amplification (ASA) of the BADH2 Gene
66
51
074
Mohamad Taufiq Ahmad
Global Proteome Analysis of Musa acuminata cv. Grand Naine upon Meloidogyne
incognita Infestation
67
52
080
Site Noorzuraini Abd
Rahman
Genetic Relationships of Malaysian Rice Landraces Based on Morphological
Characteristics
67
53
082
Marlini Mahadzar
Anti-Hyperglycaemic Effects of Albizzia myriophylla Aqueous Bark Extract on
Streptozotocin-Induced Glucose Responsive Cells In Vitro
68
PLANT
GENETICS
39 | MGC10
List of Poster Abstracts
No
Abstract ID
54
084
55
Presenter
Category
Paper Title
Page No
Siti Salwana Hashim
Development of Genetic Markers for Aquilaria Species Identification Using Direct
Amplification Minisatellite DNA (DAMD)
68
086
Umikalsum Mohamed
Bahari
Yield Performance of Selected Introduced Banana Cultivar in East Coast
Peninsular Malaysia
69
57
091
Ahmad Hafiz Bin
Baharom
Morphological Characterization of Averrhoa carambola Accessions at MARDI
Kluang
69
58
092
Mohd Azhar Hassan
Evaluation and Selection of Red Blush Mango Progenies
70
59
093
Norlia Basherudin
Discovery of Genes Involve in Alkaloid Biosynthesis Pathway of Tongkat Ali Root
70
60
095
Suhana Omar
Studies on Heterosis in Brinjal (Solanum melongena L.) for Yield and Its
Components
71
61
097
Nor Hazlina Mat Saat
Evaluation and Selection of Tomato Lines for Lowland Cultivation
71
62
099
Kevin Ng
Complete Chloroplast Genome Sequence of an Important Timber Tree Shorea
leprosula (Dipterocarpaceae)
72
63
100
Nor Azwani Binti Abu
Bakar
Comparative Performance of Nigerian X Avros, Cameroon X Avros and Zaire X
Avros Genetic Materials Planted on Inland Soils
72
64
108
Nor Aishah Binti Hasan
Correlation Analysis on Agronomic Characters in F1 Population Derived from a
Cross of Pongsu Seribu 2 and MR 264
73
65
109
Naransa Limpot
Molecular Assessment of Functional Fragrant Trait among Traditional Rice Cultivar
in Sabah, Malaysia
73
66
110
Norsharina Md Saad
Towards Genetic Engineering of Rice Resistant against Golden Apple Snail
(Pomacea canaliculata)
74
67
111
Nursyuhaida Mohd
Hanafi
Characterization of Jatropha curcas L. Accessions through Genetic and Field
Evaluations
74
68
005
Alyaa R. AL-Khateeb
HUMAN
GENETICS
Mutation in Both LDLR Gene and APO B-100 Gene among Malaysian Familial
Hypercholestrolemic Patients
75
70
032
Muhammad Afiq Tajol
Ariffin
PLANT
GENETICS
Preliminary Study of Syzygium samarangense Flower Development
75
71
079
Teh Ser Huy
Construction and Overexpression of Chalcone Synthase (CHS) Gene from
Boesenbergia rotunda in Bacterial Expression System
76
Chromosome Doubling In A. Malaccensis through In Vitro Polyploidization
76
Isolation of Partial Phosphate Synthase-Like Gene from Root of Tongkat Ali
(Eurycoma longifolia)
77
PLANT
GENETICS
BIOTECHONOLGY
72
088
Muhammad Fuad Yahya
73
083
Zahidah Zafhian
GENETICS
40 | MGC10
List of Poster Abstracts
No
Abstract ID
74
050
Presenter
Category
Paper Title
Page No
Gene Polymorphisms of Pro- and Anti-Inflammatory Cytokines Increase the Risk
of Gastric Cancer in Helicobacter pylori Infected Subjects
77
Helicobacter pylori BabA Genotype, Phenotype and Function
78
Morpho-Physiological Responses of Strawberry Genotypes under Different
Drought Stress Conditions
78
Genome-Wide Analysis of Cytosine- DNA Methylation, the Transcription Regulation
and Genes Expression in Oryza sativa for Salt and Drought Stress
79
Aquilaria malaccensis Shoot Regeneration-Using Different Combinations of BAP
and NAA
79
HUMAN
GENETICS
Genetic Variants in the HER-2/neu Gene and Risk of Breast Cancer
80
GENETICS
Association of Metallothionein Gene MT1A (rs11076161) and MT2A (rs10636)
Gene Polymorphisms with Type 2 Diabetes Mellitus among Malay Ethnics
80
Akbar Oghalaie
75
054
Samaneh Saberi
76
113
Arash Nezhadahmadi
77
115
Fiaz Ahmad
78
116
Nursaadiah Salam
79
117
Awatif Siddig
80
067
Ali Etemad
MICROBIAL
GENETICS
PLANT
GENETICS
41 | MGC10
Poster Board 1
ID 027
027
Genetic Charecteriztion of Macribrachium rosenbergii for Stock
Improvement Program
Atin Khalaj Hedayati, Dr. Annie Christianus, Dr. SubhaBhassu
SubhaBhassu and Dr.
NatrahFatin
University Putra Malaysia
Email: [email protected]
Poster Board 2
ID 045
HeparinHeparin -Binding Proteins Encoded Genes Associated with Fertility in
Beef Bulls
Y. J. Tan1*, C. C. Gan2, W. S. Tan2
Genetic Improvement Program, Strategic Livestock Research Centre, MARDI
2
Faculty of Biotechnology & Biomolecular Science, UPM
*Email: [email protected]
1
ABSTRACT:
ABSTRACT:
The giant Malaysian freshwater prawn, scientifically known as Macrobrachium
rosenbergii, is the largest known palaemonid in the world and plays an important
role in the aquaculture and fisheries industry.Initial studies on Macrobrachium
species were based on the analyses of external morphological traits. Genetic
markers are able to provide valuable information on various aspects of
aquaculture practice, such as population genetic studies, genetic diversity or
variation of populations and individuals, determination of differences and
similarities between stocks and individuals, monitoring of inbreeding or the
changes in the genetic composition of the stocks that may result from such
phenomena as breeding process, founder effect and genetic drift, identification of
non-interbreeding population to investigate temporal changes in the gene pools,
assessment of successful implementation of genetic manipulation such as
polyploidy (Davis and Hetzel, 2000; Fjalestad et al., 2003; Subasinghe et al.,
2003).
Heparin is a glycosaminoglycan, which is naturally secreted in the female
reproductive tract. It is believed that bulls with good fertility produce spermatozoabound proteins with high affinity for heparin than less fertile bulls. Heparin-binding
proteins (HBP) form complexes at different affinities for heparin. Addition of
heparin to semen formed complexes with sperm-bound HBP that stimulates
sperm capacitation resulting in acrosome reaction. HBP were found in seminal
plasma and bulls with detectable HBP in the seminal plasma had higher fertility
than bulls with undetectable HBP. Thus, the objectives of this study was to identify
the HBP-encoded genes in beef bulls. Semen samples were collected from 20four to six year-old Brakmas bulls. Seminal plasma HBP were isolated and
analysed by two-dimensional sodium dodecyl sulphate polyacrylamide gelelectrophoresis (SDS-PAGE). HBPs with approximate molecular weights (1315kDa, 24-26kDa, 30kDa, and 32-35kDa) were observed in seminal plasma and
were sent for peptide mass fingerprinting. From the results of fingerprinting, four
HBP-encoded genes were identified, namely clusterin (CLU), tissue inhibitor of
metalloproteinases (TIMP2) gene, seminal plasma protein (BSP-30) and tissue
factor pathway inhibitor 2 (TFPI). CLU-positive spermatozoa in bull semen are
potentially a better predictor of fertility than sperm motility or abnormal
morphology. Besides, CLU is also a candidate gene that could serve as a
biomarkers of semen quality and fertility in stallion. Second hit from the search is
TIMP2 gene. The average density of protein from this gene in seminal fluid
indicated higher fertility in the bulls while it was significantly correlated to sperm
progressive motility in fresh semen and sperm viability in frozen-thawed semen.
Apart from that, BSP-30 of approximately 29-35kDa was detected in 2D SDSPAGE. This protein is likely to be the fertility associated antigen (FAA) in bulls. By
identification of specific genes as marker, a selection pressure on fertility could be
done at a day old, prior to economic investment into the cattle herd. The benefit to
the industry will be a high-throughput protocol in identifying those bulls that
should be selected as prospective breeders.
The objectives of this study are:
1. To genetically characterize the population of M.rosenbergii using microsatellite
markers for three populationsin Malaysia
2. To identify parental stock for a selective breeding program of the prawn.
A total of 90 samples were collected from three locations (Tapah, Sg. Timon, Sg.
Bernam). DNA extraction and purification from prawn’s pleopods were carried out
by using Promega DNA purification kit.
PCR was done by Promega PCR kit and 10 primers (from University Malaya).
Capillary electrophoresis was used for analyzing the samples. Statistical analysis
were done by Popgene software.
42 | MGC10
Poster Board 3
ID 065
065
Conception Rate of ICSIICSI -Derived Bovine Embryos
1
Habsah Bidin,
Bidin, 2Izuan Bahtiar Ab Jalal, 1Mohd Padzil Abd Rahman, 1Ahmad
Johari, 1Ajis Hasan, 2Mohamad Naim Zakaria, 3Musaddin Kamaruddin.
1
National Animal Embrio Centre (NAEC),
2
Strategic Livestock Research Centre, MARDI Kluang Research Station
3
Strategic Livestock Research Centre, MARDI HQ
Email: [email protected]
Poster Board 4
ID 066
Genetic Diversity of Terubok, Tenualosa toli,
toli , from Mukah, Sarawak
Inferred by Partial Cytochrome b (Cyt(Cyt-b)
Abdul Hadi Abdul
Abdul Aziz, Shahreza Md. Sheriff, Nur Asma Ariffin, Muhd
Danish-- Daniel,
Danish
Daniel, Wong Lilian, Seah Ying Giat, Abol Munafi Ambok Bolongand
Nabilah Mohamad Ali
Faculty of Fisheries and Aqua-Industry, Universiti Malaysia Terengganu
Email: [email protected]
ABSTRACT:
ABSTRACT:
This study was initiated to determine the conception rate of embryos derived from
ICSI. Cumulus-oocytes-complexes (COCs) with more than five layers of cumulus
cells were used in the study. Following maturation, oocytes were activated using
calcium ionophore A23187 before or after ICSI. Bovine spermatozoa were injected
individually into matured oocytes. After ICSI, presumptive zygote were cultured in
CR1-amino acid culture medium at 38.5oC and 5% CO2 for 7 days post sperm
injection. The mean percentage of cleavage and blastocyst rates of pre- and postICSI activated oocytes were 65.16% and 6.00% and 59.99% and 4.84%
treatment, respectively. The embryos were frozen and subsequently transferred to
recipient dams. In vivo-produced embryos from Charoke cows were transferred to
recipient dams as control. The ICSI- and in vivo-derived embryos were transferred
to 17 recipient dams in two programmes. In the first programme, four recipient
dams each received ICSI-derived embryo and received in vivo-derived embryos,
whereas in the second programme, four and five dams received ICSI-derived
embryo and in-vivo-derived embryos, respectively. The results of the present
study showed that the conception rate of ICSI- and in vivo-derived embryos in the
first embryo transfer programme was 25% (1/4) and 50% (2/4). However, no
pregnancy was detected in the second embryo transfer programme. Thus, this
study indicated that it is possible to achieve conception in cattle using ICSI-derived
embryos. However, further studies using more ICSI-derived embryos and recipient
dams are required to determine the effectiveness of ICSI technique in achieving
conception of recipient dams.
Terubok (Tenualosa toli) is a commercially important fish from Sarawak in which
the numbers of the fish caught in the past 15 years were declining. Mukah area is
one of few sites in Sarawak where this species can be found. The populations in
this area however also have been heavily exploited for the fisheries industry.
Hence, this study was conducted to investigate the mitochondrial genetic diversity
of T. toli from Mukah, Sarawak through Cyt-b gene. DNA extractions were carried
out on 27 samples caught from the wild. PCR amplification using universal Cyt-b
primers had been conducted and sequence of 469 bp length of partial Cyt-b gene
was obtained from each sample. Phylogenetic analysis was then performed to
study the relationship amongst the individuals. The genetic diversity of the
population was determined through the haplotype and nucleotide diversity. The
haplotype diversity Hdof T. toli was relatively low (Hd = 0.214). The nucleotide
diversity was also low for this population. Moreover, only four haplotypes were
identified from the 27 individuals. Meanwhile, a single haplotype was shared
amongst 24 individuals. These findings correlate with previous study that showed
the number of the fish caught had drastically declined and might cause a genetic
deprivation towards its population. Comparably, Maximum Likelihood analysis
revealed that one T. toli individual were separated from the main clade,
suggesting that these individual might come from another Terubok populations.
The findings of this study have provided the understanding in the population
structure of this species in coastal area of Mukah region in Sarawak. Genetic
diversity of the mitochondrial DNA Cytochrome b of the T. toli would be useful in
the implementation of conservation and fisheries management of this species in
the future.
43 | MGC10
Poster Board 5
ID 076
076
Preliminary Phylogenetic Evaluation of Isolated DNA Regions of
Apomictic and Hermaphroditic PlantPlant-Nematodes to Infer Concerted
Evolution Impedance
Mohd Rosli, M. A.ࡼ
A. ૚ . & Sayed Abdul Rahman, S. A1,2
1
Unit of Genetics and Molecular Biology, Institute of Biological Sciences, Faculty of
Science, University of Malaya
2
Center for Research in Biotechnology for Agriculture, Level 3, Research &
Innovation Complex, University of Malaya
Email: [email protected]
ABSTRACT:
Concerted evolution is a universal biological phenomenon that leads to
homogenisation of DNA sequences belonging to a given repetitive family. This
molecular process involves genetic mechanisms such as unequal crossing-over
and biased gene conversion and is typical for multigenefamilies that allows
mutations to spread and evolve together at the same time. Therefore, this
phenomenon maintains copies of the multigenes from a single individual to be
similar to one another whilst being distinct interspecifically In light of this notion,
intraindividual heterogeneity (microheterogeneity) was expected to be absent or at
least occur at a much lower rate at individual level. However, it has been
suggested that the occurrence of intraindividual heterogeneity can be expected in
asexual lineages where concerted evolution could be impeded or slowed down as
a result of the absence of recombination provided by meiosis Therefore, it can be
hypothesised that different degree of intraindividual heterogeneity reported in
plant-parasitic nematode (PPN) species is due to the differing concerted evolution
rates occurring in different nematode species as a result of reproduction
strategies opted by them. Two extreme examples for nematode species with
different reproduction strategies are Meloidogyne incognita and Radopholussimilis
in which the former reproduces by means of apomictic parthenogenesis lacking
meiosis while the latter, being hemaphrodites allow gamete fertilisation to occur,
thus allowing meiosis. To prove this hypothesis, we had successfully cloned and
analysed the Internal Transcribed Spacer (ITS) 1 and 2 regions of ribosomal DNA
(rDNA, a multigene family) of both nematode species.Our preliminary phylogenetic
analysis revealed that, cloned amplicons isolated fromR. similisshowed low mean
of pairwise distance values of 0.005 compared to the ones isolated from M.
incognita with a mean of pairwise distance value of 0.108, corroborating our
hypothesis.
Poster Board 6
ID 096
Microsatellite Loci Identification
Identifi cation from Climbing Perch, Anabas
testudineus
Azfar A. M. 1,2, Nur Asma Ariffin1, Ahmed Jalal Khan Chowdhury2 and
AbolAbol- Munafi A. B. 1
1
Fakulti Perikanan dan Akua-Industri (FPAI) Universiti Malaysia Terengganu (UMT)
2
Kulliyyah of Science (KOS) International Islamic University Malaysia (IIUM)
Email: [email protected]
ABSTRACT:
This study was carried out in order to isolate and identify microsatellite from
Anabas testudineus, by using PCR-based technique. Degenerate random
amplified microsatellites (RAMs) primer, SC6, was used to amplify the DNA from
pooled 10 male and 10 female A. testudineus samples. During this study 162
microsatellite loci were successfully isolated, where, 87 loci from male and 75
female A. testudineus, respectively. The length of nucleotide sequence in male A.
testudineus range between 190bp to 428bp, with highest motif repeat in male
was 11 repetitions and lowest was three repetitions. The range of the female A.
testudineus nucleotide sequence was within 171bp to 435bp with longest motif
repeat was 14 repetitions and the lowest was three repetitions. The microsatellite
loci isolated from this study can be used to assist genetic studies on A.
testudineus species specific marker can be developed to give more accurate
information if applied in ecology, evolution and population study.
Keywords – genetic marker, microsatellite, random amplified microsatellites,
Anabas testudineus
44 | MGC10
Poster Board 7
ID 044
Development of a Rapid Detection Method for Polymorphism in ARX,
CDKL5 and STXBP1
STXBP1 Genes.
1,2
A Jaafar 1,2
, KH Ling2,3, F Alsiddiq1
Paediatrics Department, Faculty of Medicine and Health Science, Universiti Putra
Malaysia
2
Genetic Medicine Research Centre, Faculty of Medicine and Health Science,
Universiti Putra Malaysia
3
Obstetrics and gynecology Department, Faculty of Medicine and Health Science,
Universiti Putra Malaysia
Email: [email protected]
1
Poster Board 8
ID 071
Generation of Tyrosine
Tyrosine Hydroxylase (TH) Positive Cells from Amniotic
Fluid Stem (AFS) Cells via Adherent and NonNon -Adherent Neural
Induction Assays
Siti Nurusaadah Hamzah1, Sharmili Vidyadaran1,2, Norshariza Nordin1,3
Genetic Medicine Research Centre, Stem Cell Research Laboratory, Faculty of
Medicine and Health Sciences, Universiti Putra Malaysia
2
Immunology Unit, Department of Pathology, Faculty of Medicine and Health
Sciences, Universiti Putra Malaysia
3
Clinical Genetics Unit, Department of Obstetrics &Gynaecology, Faculty of
Medicine and Health Sciences, Universiti Putra Malaysia
Email: [email protected]
1
ABSTRACT:
ABSTRACT:
Introduction: Various polymorphisms in ARX,CDKL5 and STXBP1 have been
implicated in early onset Epileptic Encephalopathy (EE) patients. Conventional
screening methods such as PCR-RFLP, dHPLC and SSCP are considered
laborious, costly, less sensitive and time-consuming by today standard.High
Resolution Melting Analysis (HRMA) is more practical to distinguish the single
nucleotide polymorphism (SNP) based on GC content, length, sequence, and
heterozygosity with 100% and 90% level of specificity and sensitivity. We aim to
develop HRMA-based method as a rapid genetic screening protocol among EOEE
patients and controls.
Method:
Method Thirty healthy and consenting subjects were recruited according to
inclusion/exclusion criteria. Peripheral blood was obtained and genomic DNA was
purified. 12 primer pairs were designed for 16 known mutations. PCR specificity
and efficiency were optimized using conventional and real-time PCR prior to
HRMA. Different melting profiles were clustered and compared with homozygous
wild type reference control. Samples from varying clusters were purified and
sequenced.
Results & Discussion: All 12 assays were successfully established for ARX (2),
CDKL5 (5), and STXBP1 (5) genes with different annealing temperature (53-60ºC)
and cycles (45-55). No mutation was detected in all control samples. A variant
could be screened in duplicates within 3 hours.
Differentiation potential of stem cells has been extensively explored for their
potentialpotential usage in cell transplantation or for degenerative disease therapy.
Among all, dopaminergic (DA) neurons are currently being generated in-vitro for a
number of different type of stem cells in effort to find a cure for Parkinson’s
disease. AFS cells have been much appreciated for their ability to differentiate into
different types of cells and with less ethical issues, they have great potential for
clinical application. In the present study, we aimed to compare the percentage of
dopaminergic neurons generated from the AFS cells using two established neural
induction protocols. AFS cells were differentiated into neurons using adherent
monolayer assay and through the formation of multicellular aggregates known as
embryoid bodies (EBs) with the addition of retinoic acid (non-adherent assay) as
previously described. The efficiency of neural induction was assessed by
immunocytochemistry (ICC) for qualitative analysis and fluorescence-activated cell
sorting (FACS) for quantitative analysis using neural-associated markers. The
generation of DA neurons was evaluated by the percentage of tyrosine
hydroxylase (TH) positive cells as a marker for DA neurons. Here, we showed
promising results in neural differentiation of AFS cells to be employed for in-vitro
production of DA neurons in the therapeutic approach of Parkinson’s disease.
Conclusion: HRMA is a robust, simple, rapid, accurate, efficient and costeffective screening tool for 16 known mutations in ARX, CDKL5 and STXBP1
genes and serves as a powerful tool in clinical setting.
Keywords: HRMA, ARX, CDKL5, STXBP1
45 | MGC10
Poster Board 9
ID 072
Modulation of SenescenceSenescence-Associated Micro RNAS and Target Genes
Expression by TocotrienolTocotrienol -Rich Fraction in Senescent Human Diploid
Fibroblasts
Poster
Poster Board 10
ID 003
Overexpression of WildWild -Type Anxa7 Tumuor Suppressor Gene Alters
CancerCancer -Related Microrna Profiles in Human Prostate Cancer Cells
Sharon Gwee Sian Khee and Suzana Makpol
Department of Biochemistry, Faculty of Medicine, Universiti Kebangsaan Malaysia
Email: [email protected]
Lim Hui Yap, Lionel LA In and Noor Hasima
Institute of Biological Science (Division of Genetics and Molecular Biology), Faculty
of Science, University of Malaya
Emails:[email protected]; [email protected]; [email protected]
ABSTRACT:
ABSTRACT:
Emerging evidences highlight the implication of microRNAs as a posttranscriptional regulator in aging. Several senescence-associated microRNAs (SAmiRNAs) are found to be differentially expressed during cellular senescence.
However, the role of dietary compound on SA-miRNAs remains elusive. This study
aimed to elucidate the modulatory role of tocotrienol-rich fraction (TRF) on SAmiRNAs (miR-20a, miR-24, miR-34a, miR-106a and miR-449a) and established
target genes of miR-34a (CCND1, CDK4, SIRT1) during replicative senescence of
human diploid fibroblasts (HDFs). Primary culture of HDFs at young and senescent
were incubated with TRF at 0.5 mg/ml. Taqman microRNA assay showed
significant up-regulation of miR-24 and miR-34a and down-regulation of miR-20a
and miR-449a in senescent HDFs (p<0.05). TRF reduced miR-34a expression in
senescent HDFs and increased miR-20a expression in young HDFs and increased
miR-449a expression in both young and senescent HDFs. The results also
demonstrated ectopic expression of miR-34a reduced the gene expression of
CDK4 significantly (p<0.05). TRF inhibited miR-34a expression thus relieved its
inhibition on CDK4 gene expression. No significant change was observed on the
gene expression of CCND1, SIRT1 and miR-34a upstream transcriptional
regulator, p53. In conclusiontocotrienol-rich fraction prevented cellular
senescence of human diploid fibroblasts via modulation of SA-miRNAs and target
genes expression.
This study aims to identify microRNAs (miRNAs) regulated by the wtANXA7 tumuor
suppressor geneand corresponding pathways involved in prostate cancer. A total
of 16 miRNAs were significantly differentially expressed in response to increased
expression of wtANXA7. These include hsa-miR-874, hsa-miR-1284, hsa-miR543 and hsa-miR-409-5p with a majority of predicted targets involved in calcium
signaling. It was suggested that overexpression of wtANXA7 may have reverted
the dysregulatory effects of mutated ANXA7 on miRNAs involved in posttranscriptional regulation of calcium signaling. This study also provides a platform
on miRNAs and their targets which can be manipulated for future biotherapeutic
purposes against prostate cancer.
46 | MGC10
Poster Board 11
ID 016
The Frequency of Y Alu Polymorphism (YAP) Indel in Minangkabau
Malays in Peninsular Malaysia
Poster Board 12
ID 019
Mitochondrial DNA Polymorphisms in Turkish Elite Wrestlers
Wan Nurhayati,
Nurhayati, W.H*.,
W.H*., Muhd Shah Jehan, A.R*., Norhazwani, G**., Nur
Azimah, O**. and Farida Zuraina, M.Y*.
*Faculty of Applied Sciences, Universiti Teknologi MARA (UiTM), 40450 Shah
Alam
**Faculty of Applied Sciences, Universiti Teknologi MARA (UiTM) Cawangan Negeri
Sembilan,
Email: [email protected]
KurtulusKurtulus- Ulkuer M1., Gunay M2., Yoldas T.K3., Cicioglu I2., Celen C4., Gunes
N3., Kesici T5.
1
Gazi University, Faculty of Pharmacy, Department of Pharmaceutical Microbiology
2
Gazi University, School of Physical Education and Sports
3
Ankara Hospital
4
Erciyes University, School of Physical Education and Sports
5
University of TOBB Economics and Technology
Email:[email protected]
ABSTRACT:
ABSTRACT:
Abstract- Minangkabau Malays (Melayu Minangkabau) is one of the Malay sub
ethnic groups in Peninsular Malaysia. During the late 17th and early 18th
centuries, migration of the Minangs from West Sumatra to the state of Negeri
Sembilan Darul Khusus in Peninsular Malaysia took place and their descendants
now form the main sub ethnic group in this state. The genetic polymorphism of Y
chromosome at DYS 287 locus in Minangkabau Malays were analyzed. A total of
41 buccal cells from healthy unrelated individual males from Minangkabau Malays
were typed for the DYS 287. The PCR products were separated on 2% (w/v)
agarose gel and visualized under UV light. Three out of 41 samples (7.32%)
showed insertion (YAP+) polymorphism, while the rest of the samples (92.68%)
showed deletion (YAP-) polymorphism. This is the first report concerning the YAP
amongst the Malay population in Peninsular Malysia. The valuable data obtained
in this study will contribute to filling in the gap in knowledge of YAP distribution in
the Malaysian population and will allow a more continuous interpretation of the
evolution of YAP.
Sequence analysis of human mitochondrial DNA (mtDNA) has been demonstrated
to be a valid and reliable tool to reveal the genetic characterizations. The
noncoding, displacement (D)-loop is an approximately 1100 bp segment situated
between the mitochondrial tRNApro and tRNAphe genes and contains two
hypervariable regions, HVI and HVII. The hypervariable regions can be sequenced
to provide a high degree of information for discriminating between unrelated
individuals. The purpose of this study was to investigate whether the
polymorphisms in control region of mitochondrial DNA (mtDNA) contributes to the
ability of some of the elite wrestlers in Turkey. The hypervariable regions HVI and
HVII of mitochondrial DNA (mtDNA) were sequenced in 47 Turkish elite wrestlers
who are actively training to compete in international sporting events. Sequence
polymorphisms are reported as differences from a standard human mtDNA
reference sequence. A total of 174 different mtDNA haplotypes for HVI region and
62 for HVII region were observed. Nucleotide substitutions are the predominate
polymorphisms, and at least 79.6% and 69.3% of the substitutions in HVI and
HVII are transitions, respectfully. The most prevalent transversions are Cs
substituted for Ts and Ts substituted for Cs in both HVI and HVII. Most deletions
occur in the HVI (sites 16191-16195) and HVII region (sites 303-310), within a
stretch of C’s.
Keywords-component; Y Alu insertion polymorphism (YAP), DYS 287, FTA, PCR,
Minangkabau Malays
This study was supported by Gazi University (project number: 02/2010-33).
47 | MGC10
Poster Board 13
ID 020
Poster Board 14
ID 024
Dyssegmental Dysplasia; RollandRolland -Desbuquois Type: A Case Report
and Review of Literature
Literature
The Influence of ßß -Defensins Copy Number Variable Gene in Relation
to Inflammation in Diabetic Patients
Muzhirah Haniffa1, Andreas Zankl2 , ,Huey -Yin Leong1,Gaik,Gaik- SiewCh’ng1,
Winnie PT Ong1,
NoryatiM3 , LockLock- Hock Ngu1 ,Wee,Wee- Teik Keng1
1
Department of Genetics , Kuala Lumpur Hospital, Malaysia, 2University of
Queensland, Australia,
3
Department of Radiology, Kuala Lumpur Hospital, Malaysia
Email: [email protected]
Maryam
Maryam Jamielah Yusoff,
Yusoff, Nurul Amiera Ghazi, Patimah Ismail and Suhaili
Abu Bakar
Department of Biomedical Science, Faculty of Medicine and Health Sciences,
Universiti Putra Malaysia
Email: [email protected]
ABSTRACT:
Dyssegmental Dysplasia (DD)is a rare autosomal recessive group of disorder
characterized by micromelic dwarfism and anisospondyly. Two distinct entities
exist; the milder Rolland-Desbuquois and lethal Silverman-Handmarker
type .Although the etiology of the latter has been delineated to lack of extracellular
matrix perlecan, the former has yet to be explained. We discuss here the current
literature, clinical features and radiographic findings of the first case of RollandDesbuquois Dysplasia from Malaysia.
ABSTRACT:
ß-defensin is the most common human antimicrobial peptides, playing a role as a
first line defence against a broad spectrum of microbes. It is secreted by epithelial
cells as well as leucocytes, and was first isolated in human from plasma of a
patient with renal disease. Apart from antimicrobial properties, ß-defensin can
induce leucocytes migration towards infection or inflammation site, showing that it
connects the innate and adaptive immune system. These peptides are encoded by
ß-defensins gene; which is found to be variable in copy number, thus being
categorized under copy number variation (CNV). CNV is best defined as DNA
segment of 1 kb or larger that present in variable copy number in comparison with
a reference genome. 12% of population’s genetics was found to contain CNV.
CNV is known to be present in healthy people butat the same time is also
implicated in the pathogenesis of rare genomic disorders. ß-defensins gene is
mapped to chromosomal region 8p23.1 and its copy number varies from 2 to 7
copies in diploid human genome. High copy number of this gene is linked to
psoriasis while those with low copy numberis associated with Crohn
disease.Diabetes is one of the most common diseases in Malaysia. Diabetec
patients are at risk of developing complications due to inflammatory effects and
this is reflected in the increased levels of WBC count. .Theestablished role of βdefensinsin innate immune system suggest that there is an association between
modified copy number of ß-defensins with the susceptibility of diabetic patients in
acquiring inflammation.In this study, our main objective was to compare the
distribution of ß-defensins CNV gene between Malaysian population of normal and
diabetes in relation to inflammation.
48 | MGC10
Poster Board 15
ID 025
Chromosomal Abnormalities Detected with Conventional Cytogenetic
and Fish and Their Clinical Correlations in BB-Chronic Lymphocytic
Leukemia
Phan Chin Lee,
Lee, Rohana Hasan, Intan Shahirah Saleh, Nirmala Devi a/p
Vanamalan., Nor Hasimah Mahat, Tuan Mahansansuri Tuan Ishak, Zura
Idayu, Subramanian Yegapan, Chang Kian Meng
Clinical Hematology Laboratory, Unit Cytogenetic (Leukemia), Hematology
Department, Hospital Ampang
Email: [email protected]
ABSTRACT:
Cytogenetic abnormalities in B-cell CLL are important prognostic indicators for
predicting disease progression and treatment response. Cytogenetic fluorescence
in situ hybridization (FISH) panels are a major prognostic tool in chronic
lymphocytic leukemia CLL. Cell culture from 20 bone marrow aspirates and
peripheral blood specimens were analyzed with conventional cytogenetic analysis
and interphase fluorescence in situ hybridization (FISH) assay using a CLL FISH
panel. FISH finding showed deletion 13q14.3 was most frequent isolated, followed
by trisomy 12 and deletion 17p13. The numbers of anomalies were significantly
different in cytogenetic test and FISH analysis. This study showed that Interphase
FISH has greatly enhanced our ability to detect chromosomal abnormalities in CLL
that missed with conventional cytogenetics. Additional chromosomal changes are
identified with conventional cytogenetics that is not addressed by FISH analysis.
Poster Board 16
ID 028
Patient’s Experiences with Prenatal Diagnosis in HKL Genetics
Department
Nik Rozma Bt Nik Abdul Rahman
Department of Genetic Hospital Kuala Lumpur
Email: [email protected]
ABSTRACT:
Prenatal diagnosis is being offered by the Genetics Department, Hospital Kuala
Lumpur for about 10 years. It is performed for family with various genetic
disorders such as familial reciprocal translocation and spinal muscular atrophy. In
this study, the experience of patients who have undergone prenatal diagnosis at
the department was explored via questionnaires. The main aims were to find out
their expectations of the test, experience during pre and post test counseling and
attitude towards termination of pregnancy. The details of the results will be
discussed.
49 | MGC10
Poster Board 17
ID 029
Communicating Genetic Risk Information in Families - Evaluating
Tools to Facilitate Genetic Health Services
1
Nik Farah NYF, 2K.Yogalingam, 1Noraishah A,
A, 1HB Chew, 1WT Keng,
1
GS Ch’ng
1
Department of Genetics, Kuala Lumpur Hospital, 2Faculty of Medicine, PerdanaRoyal College Surgeon Ireland
Email: [email protected]
ABSTRACT:
Communicating genetic risk information within families is a complex process and
is an important issue for genetic professionals. Sharing appropriate and accurate
genetic risk information with other family members has impact on health and
reproductive decision making of family members. Currently there are no evidencebased interventions to facilitate the process of disclosure within families. The
objective of this study was to evaluate the degree of sharing of genetic risk
information among family members and to identify factors that may be relevant in
communicating genetic risk information. Findings from the study may aid the
development of tools to facilitate genetic risk information sharing and
communication. Interviews were undertaken using a constructed semi-structured
questionnaire with the parents/caregivers/patients who had attended genetic
counselling in the Department of Genetics, Kuala Lumpur Hospital for
chromosomal translocations/rearrangements and X- linked disorders. A total of 23
respondents were interviewed. Majority of respondents believed in their moral
obligation and family members’ right to know about their potential genetic risk and
that disclosure will empower them to take preventive actions. However, a third of
them feared alienation and stigmatisation. The 3 most effective means of
communicating genetic risk information cited were preference for genetic
counsellors to communicate risk information, provision of patient information
leaflets and sample pedigree for reference. Supporting patients and families in
genetic risk communication is not a simple task as the process is affected by
multiple factors. Understanding how these factors operate in individual families
will be helpful in development of appropriate tools to facilitate more effective
communication of genetic risk. Allowing family members to make direct access to
genetic clinic and provision of take home written information may be the initial
steps to overcome barriers in risk information communication among family
members.
Poster Board 18
ID 046
Analysis of Multiple Mutations in Dihydrofolate Reductase(dhfr)
Reductase(dhfr) Gene
Associated with Antifolate Drug Resistance
Resistance in Plasmodium vivax
Sabah Isolates
Nor Afizah Nuin1, Timothy William2, Prababakaran Dhanaraj3, and Lau Tiek
Ying1*
1
Biotechnology Research Institute, Universiti Malaysia Sabah
2
Queen Elizabeth Hospital, Kota Kinabalu, Sabah
3
Kudat District Hospital, Kudat, Sabah
Email: [email protected]
ABSTRACT:
Plasmodium vivaxis known to be the most geographically widespread malaria
parasite and ranks second to cause death globally. High level resistance to
antifolate antimalarial drugs such as sulfadoxine-pyrimethamine (SP) are known to
be associated with mutations in the dihydrofolatereductase (dhfr) gene of
Plasmodium. This study sought to identify single nucleotide polymorphisms (SNPs)
in dhfr gene of P. vivax isolated from Kudat, Keningau and Kota Kinabalu, Sabah.
Nested-PCR was conducted to amplify dhfr gene on the confirmed single P.
vivaxinfection based on species-specific nested-PCR. A total of 11 complete dhfr
sequences in P. vivaxwere amplified with product size of approximately 1.8 kb.
The pvdhfranalysis showed the existence of four haplotypes including double
(9.1%), triple (9.1%), quadruple (62.5%), and quintuple (9.1%) mutant haplotypes.
The double pvdhfrmutant haplotype, FRTNI (S58R + S117N) has already been
described in previous studies. Mutation at residue 57 (F->L) in our study resulted
a novel codon CTC instead of TTA and TTG that was described previously.
Additionally, three isolates were found to have wild-type haplotype, FSTSI with the
percentage of 27.3%. The genetic similarity of haplotypes and the specific SNPs
in P. vivaxparasites could reflect the presence of different geographic subdivision
and time frame of P. vivax parasite. Therefore, these findings could provide critical
information on the possible emergence and spread of SP drug resistance in P.
vivax Sabah isolates after the increase of failure in chloroquine (CQ) treatment.
50 | MGC10
Poster Board
Board 19
ID 051
Poster Board 20
ID 052
Genetic Polymorphisms of IL6 and IL8 and OverOver -Expression of Their
Serum Levels are More Prominent in Gastric Cancer Patients
Genetic Variation and Population
Population Structure of Cytokine Genes among
Six Iranian Ethnic Populations
Shaghik Barani
Barani1, Samaneh Saberi1, Yeganeh Talebkhan1, Akbar Oghalaie1,
Maryam Esmaili1, Mohsen Doozbakhshan1, Tannaz Samadi1, Sana Eybpoosh2,
Afshin Abdirad3, Mahmoud Eshagh Hosseini4, Mohammad Ali Mohagheghi5
and Marjan Mohammadi1*
1
HPGC Group, Medical Biotechnology Department, Biotechnology Research Center,
Pasteur Institute of Iran,2Research Center for Modeling in Health, Institute for
Future Studies in Health, Kerman University of Medical Sciences, Kerman, Iran,
3
Cancer Institute, Tehran University of Medical Sciences, 4Gastroenterology
Department, Amiralam Hospital, Tehran University of Medical Sciences, 5Cancer
Research Center, Tehran University of Medical Sciences Tehran, Iran.
Email: [email protected]
Zana Karimi Kurdistani1, Samaneh Saberi1, Yeganeh Talebkhan1, Akbar
Oghalaie1, Maryam Esmaili1, , Maryam Bababeik1, Parisa Hassanpour 1, Sana
Eybpoosh2 and Marjan Mohammadi1*
1
HPGC Group, Medical Biotechnology Department, Biotechnology Research Center,
Pasteur Institute of Iran, Tehran, Iran2, Research Center for Modeling in Health,
Institute for Future Studies in Health, Kerman University of Medical Sciences,
Kerman, Iran.
Email: [email protected]
ABSTRACT:
Introduction: IL6 is produced by immune and non-immune cells and behaves as
both an anti- and pro-inflammatory cytokine. IL8, on the other hand, is a
chemokine which is produced by the same cells but attracts neturophils toward
the site of infection. Helicobacter pylori-induced gastritis is said to increase the
levels of these cytokines in the gastric mucosa. The aim of this study was to
investigate whether genetic polymorphism and serum levels of these cytokines are
associated with gastric cancer.
Methods: This study enrolled 411 subjects with gastric cancer, 594 cancer-free
endoscopy subjects and 642 healthy individuals. Serum levels of IL6 and IL8 were
measured simultaneously by magnetic-based multiplex ELISA. IL6 G-174C and
IL8 T-251A functional polymorphismswere examined by PCR-RFLP and ARMSPCR respectively. Unconditional logistic regression model estimated odds ratio
and the corresponding 95% confidence intervals. Kruskal–Wallis and MannWhitney U tests were used to test the statistical differences among and between
these two groups respectively.
Results: A positive correlation (OR=2.2, 95%CI=1.1- 4.1) was observed between
the IL6 G-174C (GC and CC) carriers and gastric cancer, which was further
enhanced in patients with non-cardia gastric cancer (OR=2.7, 95%CI=1.2- 6.1).
Accordingly, serum IL-6 concentration was significantly higher in gastric cancer
patients (269.4± 534.1) as compared with endoscopy subjects (18.3± 51.3,
P=0.00001) and healthy individuals (2.2± 3.8, P=0.01). Similarly, IL8 T-251A
(TA and AA) carriers were at an enhanced risk of gastric cancer (OR=1.8,
95%CI=1.02-3.3) and of the non-cardiasubsite (OR=2.3, 95%CI=1.04-5.06).
Serum IL-8 concentration was also significantly higher in gastric cancer patients
(40.9± 102.2) than controls (21.3± 32.1, P=0.03).
Conclusion: Our results support a tumour promoting role of IL6 and IL8 in gastric
cancer, particularly at the non-cardiasubsite, which provides evidence for coanalysis of their genetic polymorphisms and serum levels in high risk subjects.
ABSTRACT:
Background: Single nucleotide polymorphisms (SNP), as the third generation of
heredity markers, are widely used to study human susceptibility to complex
diseases such as cancer. The aim of this study was to construct a map of cytokine
polymorphisms in the Iranian multi-ethnic population.
Methods: Genomic DNA was isolated from 422 ethnic Iranian subjects belonging
to six ethnicities. PCR-RFLP and ARMS-PCR were used to identify polymorphisms
in the following cytokine genes:IL-1β (C-511T, T -31C), IL-1RN VNTRs, IL-2 (G 384T), IL-4 (C-590T), IL-6 (G-174C), IL-8 (T-251A), IL-10 (G-1082A, C-819T, C592A) and TNF-α (G-308A). Allelic and genotypic frequencies, HWE, observed
and expected heterozygosities, Ne, PIC and FIS were calculated for each ethnic
group using Popgen-32 software. Phylogenetic trees were constructed by the
GENDIST program available in the PHYLIP package.
Results: The genotypic distributions were consistent with the assumptions of the
HWE, with the exceptions of the IL-4 (C-590T), IL-8 (T-251A), IL-10 (G-1082A)
and TNF-α (G-308A). Significant differences for allelic frequencies among the six
ethnics were only revealed for the IL-4 gene (P<0.05). A comparison of genetic
diversity demonstrated the highest and lowest heterozygosity in the Mazani
ethnicity for IL8 (0.7) and in the Kurd population for the TNF-α gene (0.08). Kurd
population had the highest and lowest Ne values ranging from 1.08 for the TNF-α
to 2.0 for the IL-2gene. The Turk population possessed the highest genetic
diversity (PIC=0.65) for the IL-4 gene. The Kurd and Fars populations revealed the
lowest genetic diversity (PIC=0.13) for the TNF-α gene. The Mazani population
demonstrated excess heterozygosity (negative FIS) for every locus except IL-10 (G1082A and C-592A).
Conclusion: The cytokine phylogenetic tree revealed a major split between Iranian
and East Asian and Sub-Sahara Africans. On the other hand, a particular
discrepancy was observed between Fars and non-Fars ethnic groups of the
Iranian population.
51 | MGC10
Poster Board 21
ID 056
The Role of TNFα
TNF and ILIL-1β promoter Polymorphisms
Polymorphisms in the
Development of Gastric Cancer
Poster Board 22
ID 062
Chromosomal Abnormalities in Patients with Myelodysplastic
Myelodysplastic
Syndrome (MDS) Using Karyotyping and ArrayArray -Based Comparative
Genomic Hybridization (Array(Array -CGH)
Yeganeh Talebkhan1, Samaneh Saberi1, Maryam Esmaili1, Akbar Oghalaie1,
Shaghik Barani1, Maryam Bababeik1, Tannaz Samadi1, Sana Eybpoosh2,
Afshin Abdirad3, Mahmoud Eshagh Hosseini4, Mohammad Ali Mohagheghi5
and Marjan Mohammadi1*
1
HPGC Group, Medical Biotechnology Department, Biotechnology Research Center,
Pasteur Institute of Iran,2Research Center for Modeling in Health, Institute for
Future Studies in Health, Kerman University of Medical Sciences, Kerman, Iran,
3
Cancer Institute, Tehran University of Medical Sciences, 4Gastroenterology
Department, Amiralam Hospital, Tehran University of Medical Sciences, 5Cancer
Research Center, Tehran University of Medical Sciences Tehran, Iran.
Email: [email protected]
ABSTRACT:
Background:
Background IL-1β, a member of IL-1 superfamily, is a pro-inflammatory and
anti-secretory cytokine which mediates cellular differentiation, proliferation and
apoptosis. IL-1RA is another member of this family and a receptor and antagonist
of IL-1β. Tumor necrosis factor (TNF-α) is also involved in the inflammation
process, activates the acute phase reaction. However, their roles in tumorigenesis
remain controversial. The aim of this study was to examine the association of
gene polymorphisms in these two pro-inflammatory cytokines and gastric cancer
(GC).
Methods:
Methods An Iranian case-control study was carried out in 423 GC patients, 719
ulcer/cancer free endoscopy patients, and 669 healthy control. TNF-α G-308A,
IL-1β C-511T and T-31C and IL-1 RN were carried out by PCR- RFLP and ARMSPCR followed by agarose gel electrophoresis. Serum Hp -specific IgG antibodies
and PG level were measured by ELISA. Demographic and life style data were
collected through patient interviews.
Results:
Results Carrying IL-1 T–31C (TC and CC) polymorphisms increased the risk of
GC by 70 percent (OR=1.7, 95% CI=1.0-3.0). IL-1 RN 2/2 homozygote subjects
were more frequent amongst gastric cardia group (OR:1.9, 95%CI 1.0-1.5).
Taking into consideration -31 and -511 position of IL-1β, IL-1β high producers
were positively associated with gastric cancer (P = 0.038). We found an
increased risk of cardia type of gastric cancer in TNF-α A carrier individuals (OR:
2.3 95% CI 1.0-5.4). Interaction study showed that the risk of gastric cancer was
increased 3.7 folds in IL-1β -31 C carriers and TNF-α A carriers patients who
were smokers (OR=3.7 95% CI 1.1-13.4). There was however no interaction
among IL-1β -31 C carriers and TNF-α A carrier patients who were infected with
Helicobacter or had lower PG ratio.
Conclusion:
Conclusion TNF-α A and IL-31 C variant alleles may accelerate gastric mucosal
inflammation and atrophy, not only by themselves, but also through the interaction
with co-factors.
Asmida Isa1, Goh Ai Sim2, Chew Teng Kiat2, Rosline Hassan3, Ravindran
Ankathil3, Syed Atif Ali1, Narazah Mohd Yusoff1
1
Advanced Medical and Dental Institute, UniversitiSains Malaysia,
2
Hospital Pulau Pinang
3
Universiti Sains Malaysia
Email: [email protected]
ABSTRACT:
Myelodysplastic Syndrome (MDS) is characterized by hypercellular bone marrow
and low peripheral blood counts. The molecular pathogenesis of MDS warrants
elucidation, however studies have shown the importance of detecting the
numerous chromosomal abnormalities associated. This study was undertaken to
investigate these chromosomal abnormalities in MDS patients using karyotyping
and array-based comparative genomic hybridization (array-CGH), Agilent, USA.
This study was done from 2011 to 2012. The subjects included 21 patients
admitted in HospitalPulau Pinang (HPP) diagnosed with MDS where they
presented with unexplained cytopaenias (anaemia, bicytopaenia and/or
pancytopaenia). Their age ranged from 56 to 81 years old. Bone marrow
aspiration and trephine biopsies samples were collected after obtaining consent.
Ethical approval for this study was obtained from the institutional research
committee and National Medical Research Registry (NMRR), Ministry of Health,
Malaysia. Investigations were done which included G-banding karyotyping
(resolution 450) and array-CGH. By cytogenetic technique, clonal cytogenetic
abnormalities were identified in 20% of the patients. Cytogenetic results revealed
six normal karyotype, a karyotype with structural abnormalities (del(5)(q13q33)
and a karyotype with complex rearrangement (t(1;11), t(2;11), del(4p), del(5p),
del(9p)). By array-CGH technique, abnormalities were detected in 40% of the
patients. The size of imbalances ranging from 700 kb to 98.7 Mb.The
abnormalities were classified into three categories; known cytogenetic aberrations,
complex chromosome aberrations and rare/cryptic aberrations (<5 Mb). In case of
common aberration, del5q was detected in one of the patient through both of
the technique, but varied in the deletion size. Large amplification of
chromosome 8 at the locus p23.3-p11.1 (46.3 Mb) and q11.1-q24.3 (98.7
Mb) was also detected by array-CGH but not by conventional cytogenetic.
Array-CGH clarified complex aberrations in 33% of the samples. In complex
aberrations, the gains and losses in the three patients were estimated to
be ranging from 0.7 Mb to 98.7 Mb. Eleven cryptic aberrations were identified
in 4 patients (44%) ranging from 0.7 Mb to 4.8 Mb. As a conclusion, wholegenome arrays with high density coverage demonstrated the usefulness of arrays
to identify common, rare and cryptic recurring imbalances in MDS. It may be
proved to be significant in monitoring disease progression or transformation to
acute myeloid leukaemia (AML) and may stratify the suitability of molecularly
targeted therapy for the patients.
52 | MGC10
Poster Board 23
ID 077
Poster Board 24
ID 081
Mutations of the GlucoseGlucose-6-Phosphatase (G6PC) Gene Involving
GSD1A Patients in
i n Malaysian Populations
Perinatal Diagnosis and Neonatal
Neonatal Treatment for a Large Family with
Ornithine Transcarbamylase Deficiency
Abdullah, Ili Syazwana1, Teh, SerSer -Huy2, Khaidizar, Fiqri Dizar1, Abdul
Rahman, A.A.1, Yap, Sufin3, Keng, WeeWee- Teik4, Ngu, LockLock- Hock4, Ong, S.Y.3,
5
5
Boey, C.C.M. , Lee, WeiWei- Seah , Mohamed, Zulqarnain1,2
1
Unit of Genetics and Molecular Biology, Institute of Biological Sciences, Faculty of
Science, University of Malaya2Centre for Research in Biotechnology for
Agriculture, University of Malaya,3Division of Inherited Metabolic Disorders,
Department of Paediatrics and University Malaya Medical Center, Faculty of
Medicine, University of Malaya 4Department of Genetics and Metabolism, Kuala
Lumpur Hospital5Division of Hepatology and Gastroenterology, Department of
Paediatrics and University Malaya Medical Centre, Faculty of Medicine, University
of Malaya
Email: [email protected]
Shirou Matsumoto, Hiroshi Mitsubuchi, Kimitoshi Nakamura, Fumio Endo.
Department of Pediatrics, Facility of life science, Kumamoto University, Japan.
Honjo 1-1-1, Kumamoto, Japan
E-mail: [email protected]
ABSTRACT:
Glycogen storage disease type Ia (GSD Ia) is an autosomal recessive disorder that
is caused by deficiencies of the microsomal glucose-6-phosphatase enzyme
(G6Pase). This enzyme hydrolyses glucose-6-phosphate to phosphate and
glucose residues in the final step of gluconeogenesis and glycogenolysis.
Mutations within the glucose-6-phosphatase (G6PC) gene that encode for G6Pase
have been found to be heterogeneous, depending on ethnicity. However, some
common mutations have been reported in certain populations. The mutation
spectrum of G6PC gene in multi-ethnic Malaysian population is still unknown. In
our study, molecular analyses on 14 GSDIa patients (Malay n=8; Chinese n=6)
were performed following patients’ consent. Genomic DNA was extracted from
patients’ peripheral blood. Five exons of G6PC gene were amplified using specific
primers and subjected to automated DNA sequencing. We identified eight different
mutations, in which three are potentially novel mutations (c.155A>T, c.226A>T,
and c.1036G>C). The remaining five mutations have been previously reported
(c.248G>A, c.518T>C, c.648G>T, c.664G>A, c.706T>A). We also found that all
our patients were shown to carry the reported polymorphism c.574A>G at exon 5.
The most common mutation found in this study is mutation c.648G>T (n=11/26
alleles, 42.3%). Another reported mutation, the c.248G>A which has been shown
to be prevalent in Chinese, Japanese and Korean population was also found in our
Chinese cohort. In summary, we successfully analysed the G6PC genes in
Malaysian GSD1a patients and found eight different mutations. We suggest that
the mutation spectrum of G6PC gene in Malaysia is heterogenous among the
Chinese and Malays.
ABSTRACT:
Ornithine transcarbamylase deficiency (OTCD) is the most common inborn error of
the urea cycle. OTCD resulting from deficiency of the mitochondrial enzyme OTC
shows extensive phenotypic heterogeneity influenced by allelic heterogeneity and
modifying environmental influences such as protein intake, infection, starvation
etc. Clinical presentation of ornithine transcarbamylase (OTC) deficiency is
complex because male hemizygotes usually present in infancy, whereas female
heterozygotes may be totally asymptomatic. On the other hand, hemizygous males
may also present at any age without any precedent symptoms or effects, whereas
heterozygous females may be severely affected in childhood. Although many
symptomatic females may present because of skewed distribution of the mutant
gene in hepatocytes due to lyonization, reasons for late-onset male presentation
remain obscure; however, some males clearly have residual enzyme activity. We
report a large family member with splicing mutation of the OTC gene. Diagnostic
evaluation for each new born baby, in addition to appropriate genetic counseling
for relevant family members have led to successful treatment strategies in this
particular family.
53 | MGC10
Poster Board 25
ID 089
Homozygous
Homozyg ous Splice Site Mutation in SLC25A20 Gene Causing
Carnitine--Acylcarnitine Translocase Deficiency in One Female Patient
Carnitine
in Malaysia.
Nor Azimah Azize BSc1, Yusnita Yakob MSc1, Zabedah Md. Yunus MPath 2,
Ngu Lock Hock MRCP
1
Molecular Diagnostics and Protein Unit, Specialised Diagnostics Centre, Institute
for Medical Research
2
Biochemistry Unit, Specialised Diagnostics Centre, Institute for Medical Research
3
Genetic Department, Kuala Lumpur Hospital
Email: [email protected]
ABSTRACT:
The enzyme carnitine-acylcarnitine translocase (CACT) is involved in the transport
of long-chain fatty acids into the mitochondria. Mutation in the SLC25A20 gene
leads to CACT deficiency that prevents the breakdown of long-chain fatty acids
from food and fats stored in the body. CACT deficiency is a life threatening
disorder with an autosomal recessive inheritance. Clinical symptoms include
hypoketotic hypoglycaemia, cardiomyopathy, liver failure, muscle weakness and
usually manifest in early infancy. The SLC25A20 gene is mapped to chromosome
3p21 and consists of 9 exons encoded for 302 amino acids; mutation analysis by
direct sequencing was performed. We report a case of a one week old female
baby whose parents are fourth cousins who presented with symptoms of recurrent
hypoglycaemia and metabolic acidosis. She has four previous siblings who died
during infancy. Acylcarnitines profile showed mild elevation of hexadecanoylcarnitine (C16) with borderline low free carnitine (C0). Octadecanoyl-carnitine
(C18:1) was normal. Based on the acylcarnitines profile, carnitine
palmitoyltransferase 2 (CPT2) was suspected. However there was no mutation
found on the CPT 2 gene. Molecular analysis on SLC25A20 gene showed a
homozygous splice site mutation at c.199-10 T > G in intron 2. Similar mutations
were also found in her parents as heterozygous mutation. This mutation has been
reported in the Human Gene Mutation Database (HGMD) for CACT deficiency. This
mutation is predicted to cause incorrect splicing and leads to truncation of the
protein, thus hypothesized to destroy the function of CACT protein.
Poster Board 26
ID 090
Mutational Analysis of GAA Gene in Glycogen Storage Disease II
Patients in Malaysia.
Siti Aishah Abdul Wahab BSc1, Yusnita Yakob MSc1,
Julaina Abdul Jalil MPath2
1
Molecular Diagnostics and Protein Unit, Specialised Diagnostics Centre, Institute
for Medical Research
2
Biochemistry Unit, Specialised Diagnostics Centre, Institute for Medical Research
Email: [email protected]
ABSTRACT:
Glycogen Storage Disease type II (GSDII) is a recessively inherited lysosomal
storage disorder caused by mutations in the GAA gene that leads to deficiency of
acid α-glucosidase enzyme activity and accumulation of lysosomal glycogen. GAA
gene is located on chromosome 17 at17q25.3 and comprises 20 exons encoding
952 amino acids. We report the mutation analysis results of GAA gene in six
patients referred with low acid α-glucosidase enzyme activity. The gene was
amplified by touch-down PCR and mutation detection by bi-directional sequencing
analysis. Molecular analysis revealed four reported mutations (c.1843G>A,
c.1082C>T, c.2238G>C, c.2815_2816delGT) and two novel mutations,
c.1726G>A (p.Gly576Ser) and c.444C>G (p.Tyr148*) in three patients.
Compound heterozygous mutations were detected in Patient 1 (c.1843G>A,
c.2815_2816delGT) and Patient 2 (c.1082C>T, c.2815_2816delGT). These
mutations have been known to affect enzyme activity. Patient 3 was a compound
heterozygous of the reported mutation c.2238G>C and a novel nonsense
mutation c.444C>G (p.Tyr148*) which was predicted to abolish protein
expression. The other two patients exhibited a novel mutation c.1726G>A
(p.Gly576Ser) which was predicted to be damaging by in silico analysis; Polyphen,
Panther & SIFT. However, further investigations on 30 normal individuals showed
that the mutation is a polymorphism. Molecular testing is an important tool in the
management and counselling of families and individuals with GSDII, and has
provided useful information of GAA mutation in Malaysia.
54 | MGC10
Poster Board 27
ID 098
Poster Board 28
ID 101
Detection of BetaBeta-Globin Gene Mutations by Geneflow BetaBetaThalassemia Genotyping Test Kit (SEA) [FTPRO]: A Preliminary Study.
The Human Variome Project of South East Asia Node
(HVP SEA Node)
NurulAin FA1, Sarifah H 2, Selamah G1, Ariffin N2,RosnahB1, Wan Zaidah A1,
CheAnuar CY3, Zilfalil BA2,Rosline H* 1.
1
Department of Hematology, School of Medical Sciences, Universiti Sains Malaysia
2
Department of Pediatrics, School of Medical Sciences, Universiti Sains Malaysia
3
Department of Obstetrics &Gynaecology, School of Medical Sciences, Universiti
Sains Malaysia
Email: [email protected]
Halim Fikri Hashim1&3, Rosnah Bahar2, Muhammad
Muhammad Farid Johan2 , W. Zaidah
Abdullah2, Rosline Hassan2, Zilfalil BA1, A. Zubaidi AL3 and Malaysian Node
of Human Variome Project
1
Department of Pediatrics, School of Medical Sciences, Universiti Sains Malaysia
2
Department of Hematology, School of Medical Sciences, Universiti Sains Malaysia
3
Faculty of Medicine and Health Sciences, Universiti Sultan Zainal Abidin,
Terengganu
Email: [email protected]
ABSTRACT:
ABSTRACT:
Beta-thalassemia is one of the most common single-gene disorders worldwide. It
is an autosomal recessive disorder that results in reduced synthesis of the betaglobin chain in hemoglobin. Beta-thalassemia has emerged as one of the most
common public health problems in Malaysia, particularly among Malaysian
Chinese and Malays. The aim of this study was to observe the spectrum of betaglobin gene mutations among randomly selected patients who attended the
outpatient clinic at Hospital UniversitiSains Malaysia ( HUSM), Kelantan, Malaysia.
A total of 28 patients were randomly selected from the outpatient clinic, HUSM.
DNA was extracted from the blood collected from the patients. The GeneFlow
Beta-Thalassemia Genotyping Test Kit (SEA) [FTPRO] approach relies on PCR
amplification and “Flow-through” hybridization technology, consisting of 21 betaglobin gene mutations used to investigate beta-thalassemia carriers. From the 28
patients tested, codon 26 G->A HbE was the commonest, followed by codon 8/9
+G, codon 41/42 – TCTT and IVS 2,654 C>T respectively. Codon 26 G->A HbE
mutation was found in Malays while codon 41/42 – TCTT and IVS 2,654 C>T
were in Chinese. There were three other patients whose hematological profile
were highly suggestive of thalassemia but their mutation was not detected by this
method. DNA sequencing shall be performed for these patients. In conclusion,
GeneFlow Beta-Thalassemia Genotyping Test Kit (SEA) [FTPRO] is simple and easy
to interpret. It covers almost all the common beta-globin gene mutations in
Malaysia; however, beta globin gene sequencing is required in certain unsolved
cases.
Malaysia has officially joined as Human Variome Project Country Node in 2010. It
was launched on the 9th October 2010 under the name Malaysian Node of the
Human Variome Project (MyHVP). MyHVP is led by Professor Dr. Zilfalil Bin
Alwi(UniversitiSains Malaysia) and the current members of the MyHVP consist of
71 individuals working in genomic research, diagnostics, and clinical care from
various Malaysian Universities and academic institution. MyHVP has now moved to
the next level by establishing the south-east asia Human Variome Project regional
node (HVP SEA node), which has the secretariat based in UniversitiSains Malaysia,
KubangKerian, Kelantan. The HVP SEA node was established by taking Malaysia
as the regional role model in genomic research and diagnostic services especially
for the developing countries in SEA. MyHVP is able to assist these countries
through human capital development by providing training and education in order
to increase public awareness on the importance of genetics and genomics in
health care. By emphasizing to the four areas of activities for the Human Variome
Project which are setting normative functions, behaving ethically, sharing
knowledge and building capacity, MyHVP will ultimately be a referral center for
SEA variome activities. This will elevate the status, enhance the visibility and
highlights the contributions of Malaysia and USM in the field of genetics,
genomics and variome.
Corresponding author: [email protected]
55 | MGC10
Poster Board 29
ID 104
Effectiveness of RAG 2 as a Genetic Marker to Inferred Phylogenetic
Relationship between Selected Orang Asli Population in Peninsular
Peninsular
Malaysia.
Sarina Mat Yasin1, 2,*, Nurfazreen
Nurfazreen Mohd Nasir 2, Endom Ismail 3 , BinBin- Alwi
Zilfalil2,*and Mohd Tajuddin Abdullah1
1
Department of Zoology, Faculty of Resource Science and Technology, University
Malaysia Sarawak
2
Department of Paediatric, School of Medical Sciences, University Science
Malaysia
3
Faculty of Science & Technology, Universiti Kebangsaan Malaysia,
Email: [email protected], [email protected]
ABSTRACT:
Many gene markers have been used to review human evolution especially
mitochondrial gene markers. However, studies using Recombination Activating
Gene 2 (RAG2) gene is lacking. According to Tinggaet al. (2011), nuclear gene is
capable of resolving mammal taxonomy. Nuclear gene has more resolving power
compared to mitochondrial genes especially for deep level mammalian clades.
Thus, in this study recombinant activating gene 2 (RAG2) was used as a genetic
marker in order to have better understanding in the evolutionary history of Orang
Asli in Peninsular Malaysia and to elucidate the phylogenetic relationship among
selected tribes, also to prove the efficiency of RAG2 gene. The Orang Asli with a
total population of 133,755 comprises 18 sub-tribes. Orang Asli is distinguished
into three categories (Negrito, Senoi and Proto Malay) based on physical
characteristics, linguistic affinities and cultural practices (Lim et al., 2010; Ang et
al.,2011). Each are further sub-divided into six sub-tribes. Blood samples were
collected and subjected to molecular technique approach which includes DNA
extraction, PCR amplification using RAG 2 gene, and direct sequencing. Phylogenetic relationships were investigated using neighbour-joining, maximum
parsimony, maximum-likelihood and Bayesian resulted in similar statistically
supported clades with minimal change. The result of this study showed that
Recombination Activating Gene 2 (RAG2) gene is a good marker for relationship
among selected tribes from three major groups of Orang Asli in Peninsular
Malaysia and those three major groups of Orang Asli were closely related to each
other.
Poster Board 30
ID 105
Genomic Variations of Malay SubSub -Ethnic Groups in Peninsular
Malaysia
1,*
Nur Shafawati Ab Rajab1,*
,Wan Nur Hatin Wan Isa1, Nik Norliza Nik Hassan2,
and Zilfalil Bin Alwi,*
1
Human Genome Center, School of Medical Sciences, University Science Malaysia
2
School of Medical Sciences, University Science Malaysia
3
Department of Paediatric, School of Medical Sciences, University Science
Malaysia
Email: [email protected], [email protected]
ABSTRACT:
The Malay of Peninsular Malaysia consist of several sub-ethnic groups that differ
in a variety of factors including language, history of migration to Malaysia, origins,
customs and daily social life. The aim of this study is to determine the common
genomic variations among the Malay sub-ethnic groups using SNP microarray
genotyping. One hundred and thirty five Malays consisted of Kelantan Malay,
Minang Malay, Javanese Malay, Bugis Malay, Kedah Malay,Champa Malay,
Pattani Malayand Banjar Malay were genotyped to characterize their genetic
differentiation. More than 50,000 SNPs were successfully genotyped. We found
that there are differences in the allele frequency among the Malay sub-ethnic
groups.We then analysed their differences by Linkage disequilibrium (LD) and the
haplotypes on three selected chromosomes that showed the highest genetic
distances. Our results have provided the genomic profile of the Malay sub-ethnic
groups in Peninsular Malaysia. These data will be useful to those who are
conducting research in this field and in related areas.
Keywords: Peninsular Malaysia, genomic variation, SNP microarray, Malay subethnic
Keywords: Recombination Activating Gene 2 (RAG2) gene, Orang Asli, Peninsular
Malaysia, genetic marker
56 | MGC10
Poster Board 31
ID 107
Poster Board 32
ID 009
3D Structural
Structu ral Prediction and Modeling of xylanase in Bacillus
coagulans STST -6
Detection and Partial Characterization of an Antimicrobial Peptide
Produced by Marine Bacillus Sp. SH 10
Ainu Husna M S Suhaimi1, Rabiatul Adawiyah Zainal Abidin2, Abdullah
Sipat3, Khatijah Yusoff4
1
Strategic Livestock Research Centre, MARDI
2
Centre for Marker Discovery & Validation, MARDI
3
Redhacare Sdn Bhd
4
Universiti Putra Malaysia
Email: [email protected]
Fatemeh shayesteh¹*,
shayesteh¹*, GiresUsup ¹and Asmat Ahmad²
School of Environmental Science and Natural Resources ¹, School of Bioscience
and Biotechnology ², Faculty of science and technology, University Kebangsaan
Malaysia
E-mail: [email protected]
ABSTRACT:
ABSTRACT:
In-silico structure prediction and modeling of 210 amino acid sequence translated
from 630 bp xylanase gene from Bacillus coagulans ST-6 was performed.
BLASTP was performed to search similarity sequences of xylanase protein
sequences against non-redundant database. SWISS-MODEL server was used for
3D modeling while the resulted 3D model was then evaluated using two programs
called PROCHECK and Combinatorial Extension (CE). The 3D model of xylanase
was constructed using 3EXUB consisting of 185 amino acid sequence as the
template. 3EXUB originated from Bacillus substilis and has the lowest e-value
scored, 1e-43 upon similarity sequences of xylanase protein using BLASTP. The
predicted 3D model consists of more beta sheets with fewer alpha helixes.
Stereochemical quality of a protein structure by producing a graphical plot called
Ramachandran Plot showed that the model generated through the homology
modeling process is acceptable, with 99.4% residues fall in the most favored
regions. important residues were also identified. The predicted catalytic residues
were Glu104, Glu197 while Tyr95, Tyr106 were predicted involved in substrate binding.
Unfortunately, another important residue (Arginine, R) was found to be
unconserved in the alignment. An arginine is predicted to be available in the
position of 138th of the sequence as it is identified to play an important role in the
active site of this enzyme. The similarity as well as identification of catalytic and
substrate binding residues in the locally isolated xylanase will provide valuable
information on the mechanisms involved in its activities which will be important to
see its potential to be utilized in the industry.
Member of the genus Bacillus are known to produce a wide arsenal of
antimicrobial substances , including peptide and lipopeptide antibiotics and
bacteriocins. Bacillus Sp. SH10 isolated from marine shellfish , was found to
produce antimicrobial peptide. This study demonstrates that the cell free
supernatant of Bacillus Sp. SH10 is effective in inhibition the growth of Grampositive and Gram-negative bacteria. Maximum Inhibitory was observed against
yeast Candida albicans. Culture supernatant of strain SH10 remained stable on
boiling (100° C , 30 minutes) and autoclaving ( 121° C , 15 Psi) up to 15 minutes
and also showed stability at a wide PH range from 2-9. It was also stable and
active in the presence of different surfactants. The protein nature of the
antimicrobial substance of strain SH10 was confirmed by its sensitivity towards
proteolytic enzymetrypsin. The antimicrobial peptide under study exhibit good
potential to be used as a food preservative.
57 | MGC10
Poster Board 33
ID 053
Poster Board 34
ID 055
Recombinant Production of Helicobacter pylori Neutrophil Activating
Protein as a Gastric Cancer Risk Screening Target
Targeting Recombinant Helicobacter pyloriCagA
pylori CagA C3 Domain as a
Serologic Biopsy Method for Screening the Risk of Gastric Cancer
Mohsen Doozbakhshan1, Yeganeh Talebkhan
Talebkhan1, Samaneh Saberi1, Maryam
Esmaili1, Akbar Oghalaie1, Parisa Hassanpour 1, Maryam Bababeik1, Tannaz
Samadi1, Azin Nahvijou2, Afshin Abdirad3, Mahmoud Eshagh Hosseini4,
Mohammad Ali Mohagheghi2 and Marjan Mohammadi1*
1
HPGC Group, Medical Biotechnology Department, Biotechnology Research Center,
Pasteur Institute of Iran, 2Cancer Research Center, Tehran University of Medical
Sciences, 3Cancer Institute, Tehran University of Medical Sciences,
4
Gastroenterology Department, Amiralam Hospital, Tehran University of Medical
Sciences, Tehran, Iran.
Email: [email protected]
Maryam Esmaili1, Yeganeh Talebkhan
Talebkhan1, Samaneh Saberi1, Akbar Oghalaie1,
Parisa Hassanpour 1, Mohsen Doozbakhshan1, Azin Nahvijou2, Afshin
Abdirad3, Mahmoud Eshagh Hosseini4, Mohammad Ali Mohagheghi2 and
Marjan Mohammadi1*
1
HPGC Group, Medical Biotechnology Department, Biotechnology Research Center,
Pasteur Institute of Iran, 2Cancer Research Center, Tehran University of Medical
Sciences, 3Cancer Institute, Tehran University of Medical Sciences,
4
Gastroenterology Department, Amiralam Hospital, Tehran University of Medical
Sciences, Tehran, Iran.
Email: [email protected]
ABSTRACT:
ABSTRACT:
Introduction: Helicobacter pylori (Hp) is one of the most widespread human
pathogens. Colonization of stomach mucosa by Hp is commonly followed by
inflammatory infiltrates, consisting primarily of neutrophils and monocytes.Hp
neutrophil activating protein (HP-NAP),is a pro-inflammatory and immune
modulating agent and is well known for its ability in inducing production of
reactive oxygen radicals from neutrophils. The aim of this study was to develop a
recombinant HP-NAP proteinfroman Iranian Helicobacter pylori strain in order to
incorporate into awestern blotting assay as a serologic biopsy method to detect
subjects at higher risk of gastric cancer.
Introduction: H. pylori (Hp) is a microaerophilic bacterium which causes gastric
diseases ranging from chronic active gastritis to gastric cancer. HpCagA is a
highly immunogenic protein which is injected into epithelial cells, where it
undergoes tyrosine phosphorylation in its EPIYA motifs. cagA-positive clinical
strains with increased EPIYA-C phosphorylation motifs are associated with gastric
epithelial pre-neoplastic changes. The aim of this study was to develop a
recombinant CagA-based western blotting assay as a serologic biopsy method for
gastric cancer risk screening.
Methods: The napA gene was PCR-amplified using specific primers including
NdeI and XhoI restriction sites at the 5’ and 3’ ends respectively. The resulting
fragment was cloned and expressed in T-vector and pET23a respectively. The
identities of the recombinant gene and proteinwere confirmed by gene sequencing
(Genbank Accession No.: KC616343.1) and immune reactivity againstAnti-His6
antibody as well as pooled Hp-positive sera. Serum reactivity of 31 Hp-infected
gastric cancer patients and 58 cancer-free endoscopy controls was assessed
againstrHP-NAP by western blotting.
Methods: PCR amplification of the triple EPIYA-C domain of the 3’ terminal of
cagA from an ABCCC type clinical Hp strain yielded a 400bp fragment, which was
cloned into pET23a and sequenced for identity confirmation. The identity of the
cloned fragment and the expressed 18kDa rCagA-C3 protein were confirmed by
gene sequencing (Genbank Accession No.: GQ845004.1) and anti His6 antibodybased western blotting respectively. Non-ulcer dyspeptic patients (N=360) were
evaluated for Hp infection according to biopsy based assays and categorized
according to OLGA histopathology classification system for gastric inflammation
and atrophy. Patients’ sera were assessed against rCagA-C3 by western blotting.
Results: Serologic reactivity to rNapA was associated with biopsy-based Hp
infection status (determined by culture, histology and urease test; p=0.028). The
frequency of anti-rHP-NAPseropositivity was higher in GC patients than NUDs
(58.1% Vs. 39.7%) which resulted in a 2.7 folds increased of gastric cancer
development (OR=2.7, 95% CI=1.03-6.87). Stratification of cases according to
tumor subsite and subtype did not reveal any difference.
Results: Serologic reactivity to rCagA-C3 was associated with biopsy-based Hp
infection status (determined by culture, histology and urease test; p<0.05) and
was able to detect Hp strains possessing the cagAEPIYA-C domain (P<0.001).
Furthermore, seropositive subjects had a higher tendency to develop gastric
inflammation and atrophy (p<0.05), which yielded a risk impact of at least two
folds for developing inflammation (OR=2.3, 95% CI= 1.4-3.9) and atrophy
(OR=2.0, 95% CI= 1.1-3.5).
Conclusion: Cloning and expression of rHP-NAP resulted in a western blotting
assay which can identify Hp-infected subjects who are at higher risk of gastric
cancer development. In countries with high prevalence of Hp infection, noninvasive identification of the more severe caseshelps direct allocation of the
limited costly resources towards high risk individuals.
Conclusion: Serologic screening of populations against the rCagA triple C
fragment represents a non-invasive method for identification of subjects infected
with the more virulent Hp strains (EPIYA-C positive cagA) at risk of pre-neoplastic
lesions such as atrophic gastritis.
58 | MGC10
Poster Board 35
ID 070
Expression and Purification of Human Fibroblast Growth Factor21 in
E. coli
Emamdoust Farnaz1, Teh SerSer- Huy2, Rothan HussinAlwan3, & Mohamed
Zulqarnain1,2
1
Institute of Biological Science, Faculty of Science, University of Malaya
2
Center for Research in Biotechnology for Agriculture (CEBAR), University of
Malaya
3
Department of Molecular Medicine, Faculty of Medicine, University of Malaya.
Emails: [email protected], [email protected], [email protected],
[email protected]
Poster Board 36
ID 004
Improvement of Simple Mismatch Primers to Differentiate between
HGGT Gene of Elaeis guineensis and Elaeis oleifera at the Promoter
Region by PCR
Mas Muniroh Mohd Nadzir1, *Siti Nor Akmar Abdullah1,2, Adriaan (W)Van
Heusden 3
1. Dement of Agriculture Technology, Faculty of Agriculture, Universiti Putra
Malaysia
2. Laboratory of Plantation Crops, Institute of Tropical Agriculture, 43300
Universiti Putra Malaysia
3. Wageningen University and Research Centre
Email: [email protected]
ABSTRACT:
ABSTRACT:
Fibroblast Growth Factor21 (FGF21) is a novel target, useful for treatment of
hyperglycemia, insulin resistance diseases and hyperlipidemia. FGF21 is encoded
by FGF21 genelocated on chromosome 19. This gene comprises three exons and
two introns, expressing a 209-a.a.protein with a molecular weight of ~19.4kDa.
Although production of FGF21 in the E. coli without using fusion proteins has
been reported, but accumulation and formation of recombinan FGF21 in inclusion
bodies impeded the downstream purification process. Therefore, establishing an
alternative expression method for FGF21 production is much desired. In this study
we constructed thefullengthFGF21 gene by employing overlapping PCR and
ligatedthe construct to bacterial expression vectors, c4x and p4x,under the control
of the lactase promoter. Expression of rFGF21 was directed into cytoplasm and
periplasm, respectively. In addition, rFGF21 was fused with maltose binding
proteins (MBP) that facilitated the detection and purification process. SDS-PAGE
and western blotting were used to detect and analyse the expressedrecombinant
protein.The optimal culturing conditions for rFGF21 expression includeinduction of
the bacterial culture with 0.75 mM IPTG for three hours. Preliminary results
showed that the molecular weight of rFGF21 was larger than expected because of
the attachment of MBP fusion protein (~55kDa). This additional tag however,
would be excised using Factor Xa after purification. Current purification method
(affinity chromatography by MBP) requires modifications because the recovery rate
of rFGF21 was low.Investigation on the functionality of rFGF21 is currently ongoing.
Palm oil contains the highest tocotrienol content compared to other vegetable oils
from agronomically important crops. The enzyme involves in catalyzing the first
committed step of tocotrienol biosynthesis is homogentisate geranylgeranyl
transferase (HGGT). Two important oil palm species, the African oil palm (Elaeis
guineensis Jacq.) and Latin American oil palm (Elaies oleifera Cortez), reveal high
variability in tocotrienol content and thus HGGT gene is a potential candidate for
marker development for improvement of nutritional quality. One of the fastest and
cheapest ways to develop marker and fingerprint is by using Allele-Specific PCR
(AS-PCR). In an AS-PCR method, a single mismatch nucleotide is introduced right
before the single nucleotide polymorphism (SNP) site for better specificity.
However, three possible mismatches can be produced and each of them will
produce different result. Which nucleotide to use for better specificity is still in
question. In this study, molecular marker using simple mismatch primer method
was designed at the SNP located at the promoter region of the oil palm HGGT
gene which is specific to E. guineensis and E. oleifera species. Two types of
primers were designed with different penultimate base pairing and destabilization
strength. Both primer sets were tested on 37 of E. guineensis accessions and 37
E. oleifera accessions, and analysis was done based on the banding patterns
produced on the agarose gel. The result shows that primer set with guanine (G)
mismatch (132GFG and 132GFO) produced bands when tested on both species
whereas primer set with cytosine (C) mismatch (132CFG and 132CFO) only
produced species-specific bands thus showing the highest specificity to
discriminate between the HGGT gene from the two species. This finding is
beneficial for developing simple and cost-effective markers in crop improvement
for marker assisted selection.
59 | MGC10
Poster Board 37
ID 075
Isolation, Characterisation and Phylogenetic Analysis of Nucleotide
Binding SiteSite-Leucine Rich Repeat (NBS(NBS-LRR) Motifs from Three Musa
acuminata Varieties
Jenifer, A. 2, Tan, V. 1, Khalid,N.
Khalid,N. 1, 2, Mohamed, Z.1, 2, Sayed Abdul Rahman,
S. A. 1, 2
1
Unit of Genetics and Molecular Biology, Institute of Biological Sciences, Faculty
of Science
University of Malaya
2
Center for Research in Biotechnology for Agriculture, Level 3, Research &
Innovation Complex, University of Malaya
Email: [email protected]
ABSTRACT:
Most commercial banana cultivars are reported to be susceptible to a numerous
environmental threats such as pathogens, pests and viruses. Since cultivated
bananas are sterile and parthenocarpic, breeding resistant varietiesto produce
elite cultivars is impossible, hence the choice of developing transgenic lines using
the naturally established pathogen resistance/ tolerance entity available inMusa
gene pool. Disease resistance genes (R genes) have long been the target for
genetic manipulations as they encode proteins that are responsible in plant
perception for diverse pathogen infections. R genes are divided into five major
groups with NBS-LRR class being a widely recorded group. This R gene group is
named after its characteristics ofpossessing a conserved nucleotide binding (NB)
domain and aleucine rich repeat (LRR) motif. The presence of these conserved
domains allowed the cloning of numerous NBS-LRR R gene analogues from
diverse plant species. This study aims to isolate and characterise NBS-LRRR gene
analogues from different Musa acuminatavarieties namely Berangan (AAA), Grand
Naine (AAA) and LemakManis (AA) using a degenerate primer pair. This enabled
us to study the diversity and phylogenetic relationship between the clones of
isolated partial R gene analogues for future R gene expression analysis.
Phylogenetic analysis conducted showed that the isolated clones were different
from Musa acuminata R gene reference sequences available in the GenBank and
these sequences clustered into four different sequence groups.
Poster Board 38
ID 106
Profiling of Functional Secondary Metabolic Genes from Two Pitaya
Varieties, Hylocereus undatus and Hylocereus polyrhizus
Rafidah Badrun1, Sew Yun Shin
Shin1, & Dr. ZainuddinHj Meon2
1
Biotechnology Research Centre, MARDI
2
Station Centre, MARDI
Email: [email protected]
ABSTRACT:
Pitaya is a non-seasonal fruit crop with short fruiting cycle which takes around 45
days. These fruits had gained much interest in society because of its exotic
features, attractive colour, nutritional value and pleasant taste. Studies have
shown that pitaya fruit is rich in phenolic compounds and high
phytoalbuminantioxidants value that prevents the formation of cancer-causing free
radicals. This research has been carrying out to discover key functional secondary
metabolic genes from white pitaya (Hylocereus undatus) and red pitaya
(Hylocereus polyrhizus) and also to determine the stage of pitaya fruit ripening
when the functional secondary metabolic genes of interests are highly expressed.
We have outsourced RNA-sequencing of two mRNA from white and red pitaya
samples at stage 35 DAA (Day after anthesis) to ILLUMINA, USA. Sequence
assembly using Velvet software version 0.7.55 revealed a total of 62,333
unigenes (red pitaya) and 61,272 unigenes (white pitaya). Homology search
(BlastX) against non-redundant amino acid database revealed 31,423unigenes
(red pitaya) and 32,820 unigenes (white pitaya) with significant hits at cut off Evalue ≤10-5. Functional genes associated with secondary metabolism of white and
red pitayas that mapped onto biochemical pathways were been identified.
Subsequently, the identified genes will assist in distinguishing the promising
underlying biochemical pathways between those two varieties of pitaya studied.
This will ultimately enable us in harnessing the potential of pitaya as functional
food with optimal level of beneficial phyto-chemicals and also to control the
production of those phyto-nutrients through genetic manipulation.
60 | MGC10
Poster Board 39
ID 001
001
The Presence of Calcium Oxalate Styloids in Pandanaceae.
Poster Board 40
ID 011
Fruit Quality Evaluation of Tissue CultureCulture-Derived Mangosteen
(Garcinia mangostana L.) at Kuala Kangsar,
Kangsar, Perak.
Eshak, Z., Mohsin, H. F. &Abdul
&Abdul Wahab, I.
Faculty of Pharmacy, UniversitiTeknologi MARA
Email: [email protected]m.edu.my
Mohd Asrul, S.,
S., 1Sarip, J., 2, Mohd Shaib, J., 3
1Horticulture Research Centre, MARDI Station Bukit Tangga.
2Horticulture Research Centre, MARDI Headquarters
3Seed Unit, MARDI Headquarters
E-mail: [email protected]
ABSTRACT:
The presence of calcium oxalate crystals (CaC2O4.H2O) in plants were discussed in
the literatures. In this study, the crystals were extracted from the natural
Pandanus samples. This genus belongs to the Pandanaceae family, which
consists of three other genera, including Sararanga Hemsl., Freycinetia Gaidich
and Martellidendron. Most Pandanus are likely to be found in tropical and
subtropical region, where they prefer to grow in coastal or dry habitat. Here, the
oxalates’ photomicrographs are presented, following the advanced resolution
analyses using scanning electron microscopy (SEM). The crystals hold a
significant attribute for guiding plant taxonomists and archaeologists in the
investigation of sustainable species. From a review, this stable mineral exists in
higher plant species and commonly consists of five basic morphological types; (1)
needle-shaped raphides, (2) rectangular or pencil-shaped styolids, (3) macehead-shaped aggregates called druses, (4) block-shaped aggregates called
crystal sand, and (5) various shape of prisms. Their sizes and appearances can
differ within and between the plant families. However in the Pandanaceae family,
the needle-shaped raphides are mostly viewed. The other morphological type of
crystalline called styloid, is now mentioned from an unidentified species of the
Pandanus genus. Previously, it is reported in two known Pandanus and one
Freycinetia species. The size of these crystals is definitely smaller when compared
with the mega-styloids. It is hoped that this information could assemble the
chemotaxonomical and pharmacognostical significance of the underutilized
Pandanus species. Finally, this microscopic screening could support the point that
the crystals’ distinctiveness is probably under the plant genetic control.
ABSTRACT:
The fruit quality evaluation of tissue culture-derived mangosteen was done at
MARDI Station Kuala Kangsar for 2012 fruiting season. Fruit quality characters
such as fruit weight, flesh weight, fruit diameter, fruit length, skin thickness,
number of pulps, number of seeds and total soluble solids content were collected
and analysed in comparison with seed-derived mangosteen. Establishment of this
research plot was completed in 1999 with four treatments in five replicates. The
study showed that there were highly significant differences (P<0.01) among all
studied characters except for skin thickness, number of seeds and total soluble
solids content. Tissue culture-derived Mesta performed better than other
treatments i.e. seed-derived mesta, tissue culture-derived mangosteen and seedderived mangosteen. However, further evaluation is needed to observe the
existence of tree-to-tree variation.
Keywords: oxalate, Pandanus, plant genetics, microscopy
61 | MGC10
Poster Board 41
ID 015
16S rDNA Analysis of Phosphate Solubilizing Bactria Isolated from
the Rubber Tree Hevea brasiliensis
Moritz Ivo Will1, *Halimi Mohd Saud1
Department of Agriculture Technology, Faculty of Agriculture, Universiti Putra
Malaysia
Email: [email protected]
1
Poster Board 42
ID 026
Genetic Identification of Wild Aromatic Tropical Orchid (Aerides)
using Inter Simple Sequence Repeat Marker: A Breeding Strategy for
Conservation
Sivanaswari, C.1 ,Thohirah, L.A.2, Abdullah, N.A.P. 2, and Fadelah, A.A. 1.
1
Horticulture Research Centre, MARDI, Serdang
2
Department of Crop Science, Faculty of Agriculture, Universiti Putra Malaysia
Email: [email protected]
ABSTRACT:
ABSTRACT:
Plant growth promoting bacteria (PGPB) are currently under focus to improve plant
nutrition, phytohormone production, and prevent plant diseases. The para rubber
tree (Hevea brasiliensis) is one of Malaysia’s important plantation tree crops.
Studies revealing its microbial diversity are currently lacking and much more study
has to be done to obtain a full understanding of its genetic function to improve its
management practices. Out of 273 isolated bacteria from the rhizopsphere of
Hevea brasiliensis, 24 PGPB which were previously identified as producers of
phytohormones and plant nutrient promoters were sampled and identified with
16S rRNA method. Blasted sequencing results obtained with BLAST® showed
that all identified bacteria belong to the phylum of proteobacteria with 18 isolates
belong to the class of betaproteobacteria and 6 isolates to gammaproteobacteria.
All betaproteabacteria were members of the genus of Burkholderia with species of
B arboris, B. cepacia, B. cenocepacia, B. metallica and B. seminalis. The
gammaproteobacteria were identified as Acinetobacter calcoaceticus and A.
venetianus, Enterobacter aerogenes and E. asburia, and Erwinia tasmaniensis.
These findings are beneficial for the development of a multifunctional biofertilizer
in natural rubber production.
Aerides odorata, Aerides odorata var. Yellow, Aerides quinquevulnera var. Calyana,
Aerides flabellata and Aerides houlletiana are five wild and endangered tropical
orchid species with immense floricultural traits. Comparative study using PCR
based marker, ISSR, were performed to access the genetic variation among these
aromatic orchids. Among 15 ISSR primers tested, 14 primers showed
reproducible bands. 71 bands out of 75 bands were polymorphic. A. odorata and
A. odorata var. Yellow with A. flabellata and A. houlletiana were closest genetically.
While, A. quinquevulnera var. Calyana was found to be most genetically diverse as
compared to the other four species. Physical clustering of the loci present in the
species were identified. Loci comparison proved unique relationship through ISSR
amplification where there were some specific locus present in specific species
while some loci found in two and more species. Presence and absence of
fragments will be used for identifying species. An understanding of species
relationship is prerequisite for the effective utilization of the genetic variation
available to a breeder.
62 | MGC10
Poster Board 43
ID 034
Poster Board 44
Flower Biology Study for Future Breeding of Jackfruit
ID 040
Leaf Anatomical Studies of Bouea, Mangifera and Spondias
(Anacardiaceae) in Malaysia
Noor Baiti,
Baiti, A. A1, Maimun, T2. and Rozlaily, Z.2
1. Horticulture Research Centre, MARDI Kluang Station, Johor
2. Horticulture Research Centre, MARDI Headquarters, Serdang
Email: [email protected]
Mohd.Norfaizal,
Mohd.Norfaizal, G.
G.a & A. Latiffb
- Strategic Resources Research Centre, Bioresources and Utilization
Management Programme (SR1), MARDI Head Quarters, Serdang
2
- School of Environmental & Natural Resources Sciences, Faculty of Science and
Technology, UniversitiKebangsaan Malaysia (UKM)
Email: [email protected]
1
ABSTRACT:
Jackfruit (Artocarpus heterophyllus)or
heterophyllus) locally known as nangka has become a
popular tropical fruit in Malaysia and it has being grown for commercial
production for local and export market.However with the limited number of
varieties available for cultivation and the issues of bacterial wilt disease and ‘karat
buah’ attacking the present varieties, limit the expansion of the cultivation area.
Hybridization could become one of the important way in developing improve
variety of jackfruit. In able to ensure the success rate of hybridization process, the
flowering behavior of jackfruit cultivated under Malaysian tropical climate was
studied. Observation was carried out on anther dehiscence and flower anthesis on
five different jackfruit varieties of 10 years old age. The male flowerstarts to
dehisce in the afternoon and reached maximum at 4 p.m. whereby the female
flowers anthesis commenced for five days where the peak time was between the
third to fifth daysdepending on the variety. It was also found that the time of
pollination could affect the fruit shape. This information is important to
determinetime setting to conduct crossing activity.
ABSTRACT:
This study aims to use anatomical characters in species and genus identification.
Leaves anatomy and morphological characters of two species of Bouea, eleven
species of Mangifera and two species of Spondias were observed in order to see
the differences in stomata type, petiole anatomy, midrib, lamina and leaves
venation. Common characters showed in this study were absence of trichome,
closed vascular bundle, uniseriate epidermal layer, resin canal in parenchyma
cells, anticline wall pattern and druses crystals in leaf lamina transverse sections.
All species showed closed vascular bundle except M. pajang which showed
combination of medullary vascular bundle. Uniseriate epidermal layer was
observed in all species. All species showed straight-wavy anticlinal wall. Druses
crystals were observed in the parenchyma cells of all species. Four types of
stomata were observed namely anomocytic, anisocytic, staurocytic and diacytic.
Anomocytic, anisocytic and staurocytic stomata were observed in Mangifera,
diacytic in Boueaand anomocytic in Spondias. In conclusion, a combination of
morphological and anatomical characters can be used in species and genus
identification.
Keywords: Leaf anatomy, Bouea, Mangifera, Spondias,Anacardiaceae, Malaysia
63 | MGC10
Poster Board 45
ID 042
Embryogenesis Endosperm Cells of Immature Seed of Mango
(Mangifera indica L.) Variety Gedong Gincu
Ni Made Armini Wiendi1, Okti Hanayanti2,Irni Furnayanti Hindaningrum2,
Alex Hartana3
1)
Department of Agronomy and Horticulture, Faculty of Agriculture, Bogor
AgriculturalUniversity, Jl. Meranti, Kampus IPB Darmaga, Bogor, Indonesia 16680
E-mail: [email protected]
Poster Board 46
ID 049
Composite Assembly of Pineapple Transcriptome Identifies the
Methionine Salvage Pathway which is Responsible
Responsible for Ethylene
Biosynthesis
Raimi Mohamed Redwan,
Redwan, Christopher VooLokVooLok- Yung, and Vijay Kumar
Biotechnology Research Institute, Universiti Malaysia Sabah
Email: [email protected]
ABSTRACT:
ABSTRACT:
Embryogenesis from endosperm cells is one opportunity to produce seedless
triploid plant in Mangifera indica var Gedong Gincu, a diploid polyembryonic
mango. Endosperm cells are formed as a result of fusion of three haploid nuclei,
one from male gametophyte and the other two from female gametophyte.
Endosperm cells from different age of immature seed were 1 week old, 2 weeks
old and 3 weeks old from the initial fruit set was cultured in ten medium
combinations M1-M5 and B1-B5, with several plant growth regulators and
organic complex to induce embryonic cells. Three weeks old immature seed
showed the best explant as endosperm cells source for endospermic callus and
embryogenic induction. B3 and B4 medium with 2,4-D and glutamine were the
best media for endospermic callusinduction, but M1 and M3with gibberellins
werethe best media for endospermic embryosinduction. The best proliferation
medium for secondary endospermic embryos induction was M3 with 1 mg/l poly
vinylpyrrolidone. The cotyledonary embryo as stage of endospermic embryos was
transferred into germination medium to obtain plantlet. The best medium for
germination was medium with 1.5 mg/l GA3.
Keywords:gedong gincu, triploid, endospermic embryo
Our current understanding of fruit ripening is based mainly on the research work
that has been done on tomato, which is a model organism for climacteric fruits
group. This group of fruits are characterized by their pronounce increase in
respiration and synthesis of ethylene upon ripening. Response to ethylene is
conventionally used to draw the line in characterizing fruits into climacteric and
non-climacteric groups. Our main focus is to understand the ripening process in
pineapple, as a model organism for tropical non-climacteric fruits. To achieve this,
two transcriptome libraries from the mature green and mature yellow fruit were
assembled de novo together with the pineapple ESTs downloaded from the NCBI
database. This was done in order to maximize the assembly information for
subsequent annotation purposes. This final ‘composite transcriptome assembly’
produced 34,279 contigs with an average length of 1,025 bp and a N50 of 1,599
bp. Approximately, 68% of these sequences were in match with NCBI
Viridiplantae non-redundant protein database through Blast with an e-value of 1e06 and 84% of these sequences were further annotated through multiple public
domain databases. The assembly provide insight to many pathways related to fruit
development but most importantly it identifies the previously incomplete
methionine salvage pathways, which plays an important role in ethylene
biosynthesis. Other pathways related to fruit development were also revealed.
This latest addition to the pineapple transciptome sequence information leads to
many questions to be answered in deciphering the process of pineapple fruit
development. In addition, this assembly will provide as an excellent reference to
compare expression between the unripe and ripe pineapple fruits transcriptome
library.
64 | MGC10
Poster Board 47
ID 060
Effect of Different Media
Media on the in Vitro Growth of Cactus (Opuntia
(Opuntia
ficusficus-indica)
indica) Explants
Bala Sidi Aliyu*
Aliyu* and Yahaya Mustapha
Department of Plant Biology, Faculty of Science, Bayero University
Email: [email protected]
Poster Board 48
ID 061
Genome Mapping of Red Clover (Trifolium
(Trifolium pratense L.)
Rozlaily Zainol1, Glyn Jenkins, Charlotte Jones, Matthew Lowe, Elaine James,
Kirsten Skot, Phil Olyott, Ellen Coverdale and Michael Abberton2
1
Horticulture Research Centre, MARDI Headquarters
2
Institute of Biological, Environmental and Rural Sciences, Aberystwyth University
E-mail: [email protected]
ABSTRACT:
ABSTRACT:
The effect of media composition on the growth of cactus explants was
investigated. Two media designated A and B were used in the study. Medium A
contained basal Murashige Skoog (MS) salt and vitamins supplemented with 5%
sucrose and 1% BAP (benzyl amino purines) and media B containing vitamins and
MS salt supplemented with 3% sucrose, 1.25 mg/l BAP and 0.25 mg/l IAA (indole
acetic acid). These media were used to culture cactus explants over a period of
30 days, with a view to determine the effect of difference in the supplements on
days to shoot emergence, shoot height, percentage survival and percentage
oxidation (secretion of phenolic compounds) of the explants in vitro. Analysis of
the results indicated that there was no significant difference between the two
media used in terms of the shoot height and days to shoot emergence.
A new genetic linkage map of red clover, an important temperate forage legume
was constructed using simple sequence repeats (SSR) and amplified fragment
length polymorphism (AFLP) markers derived from F1 mapping family developed
from parents with diverse traits of interest, the early (Milvus) and late (Britta)
flowering diploid genotypes. Linkage mapping was performed based on a single
parent analysis using JoinMap® 3.0 and two parental maps were constructed
using 417 (317 AFLP and 100 SSR) markers, developed from a 327 genotypes of
F1 mapping family. Each map consisted of seven linkage groups (LGs)
corresponding to seven chromosome of red clover (2n=14). And an integration of
these maps resulted in eight LGs annotated with 139 (72 SSR and 67 AFLP)
marker loci along 807 cM map length where LG 7b was the shortest (49 cM) and
LG 2 was the longest (124 cM), and only 10% were skewed markers (6 SSR and
8 AFLP). The average distance between locus (map density) was 5.8 cM ranging
from 4 cM in LG 6 to 12.3 cM in LG 7b. The large number of individuals used in
the mapping population and considerably high coverage of co-dominant SSR
markers mapped to the linkage group provides a strong basis for dissecting the
genetic control of key traits by QTL analysis. Therefore, the red clover genetic
linkage map developed in this work is appropriate for QTL analysis.
65 | MGC10
Poster Board 49
ID 063
Poster Board 50
ID 069
Inheritance of Seedcoat Texture in Cowpea (Vigna
(Vigna unguiculata
(L.)Walp).
Genotyping for Fragrance in Sabah Rice Germplasm by Using Allele
Specific Amplification (ASA) of the BADH2 Gene
1
Mustapha, Y.
Y. and 2Singh, B.B.
Dept. Of Biological Sciences, Bayero University
2
Department of Genetics and Plant breeding, G.B. Pant University of Agriculture
and Technology, India.Formerly : Officer-in-charge, International Institute of
Tropical Agriculture (IITA) Kano Station, Nigeria.
E-mail: [email protected]
Chee Fong Tyng1,2, KhairunNisaa’ Bt Mohd Nor 2, Mariam Abdul Latip2,3&
Vijay Kumar1*
1
Biotechnology Research Institute,
2
School of Sustainable Agriculture,
3
Centre of Postgraduate Study, Universiti Malaysia Sabah
Email:[email protected]
1
ABSTRACT:
ABSTRACT:
ABSTRACT:
Hybridization experiments were conducted in the screen house in Kano ( latitude
120 03' N, longitude 80 34' E and altitude 486.5m ) Nigeria, located in the Sudan
savanna, to study the inheritance of seed coat texture in cowpea. Six cowpea
varieties comprising three (3)smooth-seeded namely: IT97K-1101-5, IT88DM345, IT98K-1095 and three(3) rough- seeded:TVx-3236-1, TVx-3236-2 and
IT98K-628-1, were used as parents for the investigation. Parental, F1 and F2
populations were raised in the field to study segregation pattern and the
investigation showed that smooth coat texture is dominant over rough .The study
also revealed two patterns of inheritance for seed coat texture (monogenicity, 3:1
and digenicity, 15:1) depending on whether one or two pairs of recessive alleles
are involved respectively.
The occurrence of fragrance in rice has been associated with the accumulation of
2-acetyl-1-pyrroline (2AP). The presence of 2AP is widely accepted as a result of
an 8 bp deletion and three SNPs in exon 7 of the BADH2 gene (encoding for
betaine aldehyde dehydrogenase 2) located on chromosome 8 of the rice genome.
The two types of mutations caused a premature stop codon that disables the
production of the BADH2 enzyme. In order to differentiate between fragrant and
non-fragrant rice varieties, a simple PCR based technique known as Allele
Specific Amplification (ASA) was employed in this study. A sensory test was also
used to verify the outcome of the ASA genotypes. A total of 53 Sabah rice
germplasm were used to ascertain its fragrance status. A Thailand rice variety,
Thai Hom Mali, was used as a positive control for fragrant rice, as well as another
rice variety, IR36, was used as a negative control for non-fragrance. Four primers,
namely, the External Sense Primer (ESP), Internal Fragrant Antisense Primer (IFAP),
Internal Non-fragrant Sense Primer (INSP) and External Antisense Primer (EAP)
were used in the PCR reaction during ASA of the BADH2 gene. Out of 53
germplasm, 84.9% are homozygous dominant and are categorized as nonfragrance. Two germplasm (3.8%) are heterozygous but are in the category of
non-fragrance as well. Meanwhile, eight (11.3%) were found to be homozygous
recessives and were categorized as fragrant. After the ASA and the sensory test
were compared, it was found that 56.5% of the genotyping results were not in
concordance with the phenotypic results derived from the fragrance sensory
evaluation. Further investigations are required to identify the reasons for this
incongruence. Nevertheless, this study provides a quick and easy way to identify
fragrant rice varieties which will become a valuable resource in crop development
programs.
Keywords Traditional rice, fragrant, 2-acetyl-1-pyrroline (2AP), Betaine Aldehyde
Dehydrogenase 2 (BADH2), Allelle Specific Amplification (ASA)
66 | MGC10
Poster Board 51
ID 074
Poster
Pos ter Board 52
ID 080
Global Proteome Analysis of Musa acuminata cv. Grand Naine upon
Meloidogyne incognita Infestation
Genetic Relationships of Malaysian Rice Landraces Based on
Morphological
Morphological Characteristics
Ahmad, M. T.1, Mohamed, Z.1,2, Khalid, N.1,2, Anuar, M.,N.
M.,N.3, Dahniar Afandi,
N.1 & Sayed Abdul Rahman, S. A.1,2
1
Unit of Genetics and Molecular Biology, Institute of Biological Sciences, Faculty of
Science, University of Malaya,
2
Center for Research in Biotechnology for Agriculture, Level 3, Research &
Innovation Complex, University of Malaya
3
Pest and Disease Management Programme, Horticulture Research Centre,
MARDI Headquarters, Persiaran MARDI-UPM
Email: [email protected]
Site Noorzurainibinti Abd Rahman1, Mohd Shukri Mat Ali2, Ismail Muhamod
Nor 1,and Fauziah binti Shafie1.
1
Strategic Resource Research Center. MARDI SeberangPerai
2
Strategic Resource Research Center, MARDI Headquarters
Email: [email protected], [email protected], [email protected]
ABSTRACT:
Nematode infestation has been burdening banana growing countries worldwide.
To overcome this problem, alternative nematode management method needs to
be developed. Current cultivated bananas are sterile, complicating the chances of
obtaining the desired traits through conventional breeding programme. Besides,
introducing external resistance gene into bananas has been proven to be
ineffective. Therefore, we aimed to manipulate naturally established nematode
resistance/ tolerance mechanisms in Musa gene pool by understanding the
molecular basis of plant-pathogen interaction using banana plants and an
economically important plant-parasitic nematode species (Meloidogyne incognita)
as a model system. In this study, we treated Musa acuminata cv. Grand Naine
(susceptible variety) plantlets with 1000 M. incognita J2 for 30 days using
published single inoculation procedures. Proteins were isolated from both treated
and control root fragments and the proteomes were compared using TwoDimensional Electrophoresis. Our study revealed that out of 1482 aligned protein
spots across 5 gels, 164 showed significant abundance difference (2-Anova <
0.05) with Kolmogorov-Smirnov value of 1.0. Out of these, 51 spots were found
present in both treated and control samples where 50 spots showed decreased
protein abundance in treated samples compared to control samples. Only one
spot showed increased protein abundance in treated samples compared to the
control ones. It is interesting to highlight that the remaining 113 spots were found
only in control samples and not in treated samples. This pilot study proved the
hypothesis that nematode infestation triggers molecular changes in plant roots
that were reflected as protein abundance differences in 2–D SDS-PAGE gels.
ABSTRACT:
In Malaysia, the first modern rice variety was released in year 1964 and officially
known as Malinja. The variety was produced through hybridization between local
rice landrace, Padi Siam and Japonica rice variety, Pebifun. Until now, more than
ten rice landraces were used in rice breeding activities such as Pandan Gelap,
Engkatek, Secupak, and Radin Goi. Due to the evolvement of breeding activities,
conservation, and evaluation of local or traditional rice landraces are essential.
Therefore, MARDI Rice Genebank was established in 1989 to collect local rice
genetic resources in the genus Oryza and conserve the germplasm collection
ideally under secured storage conditions. Currently, MARDI Rice Genebank has
conserved a total of 8247 accessions of local rice landraces collected from entire
Peninsular Malaysia, Sabah, and Sarawak. Expeditions to collect all rice landraces
in each planting areas, it was observed that some landraces are duplicated. A
study was undertaken to evaluate the genetic diversity of the landraces based on
their morphological characteristics. Twelve rice landraces were selected namely
Anak Didek, Anak Ikan, Ana kLimbat, Anak Naga, Anak Puteh, Anak Rambai,
Mayang Segumpal, Mayang Puteh, Mayang Ebos, Radin Ebos, Radin Goi, and Seri
Raja. The morphological characterization data was extracted from Rice Information
System (RGBIS). The characterization was carried out from the rice descriptor list
developed by IBPGR-IRRI Rice Advisory Committee (1980). Twenty two (22)
morphological characters were selected for this study; consisted of 11 quantitative
traits and 11 qualitative traits. Coefficient of variation of the quantitative traits
showed culm number was more variable followed by ligule length and leaf width.
While, for qualitative traits, most of the traits showed higher variability with the
highest was stigma colour followed by culm strength and leaf angle. The
correlation coefficients observed most of the traits have significant and highly
significant correlation among the traits. This study revealed that these
morphological traits may useful to breeders for crop improvement as most of the
traits showed high variability. However, further study based on molecular analysis
may be proposed for detecting the genetic diversity of these rice landraces
because selected markers can detect high degree of polymorphism in rice.
67 | MGC10
Poster Board 53
ID 082
Poster Board 54
ID 084
AntiAnti -Hyperglycaemic Effects of Albizzia myriophylla Aqueous Bark
Extract on StreptozotocinStreptozotocin -Induced Glucose
Gl ucose Responsive Cells In Vitro
Development of Genetic Markers for Aquilaria Species Identification
Using Direct Amplification Minisatellite DNA (DAMD)
Marlini Mahadzar 1, Muhajir Hamid2,Rozita Rosli1,3
Genetic Medicine Research Centre, Medical Genetis Laboratory, Faculty of
Medicine and Health Sciences
2
Department of Microbiology, Faculty of Biotechnology and Biomolecular Sciences,
3
Clinical Genetics Unit, Department of Obstetrics & Gynaecology, Faculty of
Medicine and Health Sciences, Universiti Putra Malaysia
Email: [email protected]
Siti Salwana Hashim,
Hashim, Norwati Muhammad, Lee Chai Ting &
NurulNurul- Farhanah Zakaria.
Forest Research Institute of Malaysia
Email: [email protected]
1
ABSTRACT:
Introduction: Diabetes mellitus if left untreated, causes long-term insulin
deficiency or hyperglycemia, which may deteriorate the eyes, kidneys, heart and
nerves. There are many available glucose-lowering drugs in the market, but due
to their adverse effects, many studies are progressively finding alternative
treatments. Medicinal plants such as Albizzia myriophylla (ABZ) has been
traditionally used to treat fungal infections, influenza, wound, cough, and also to
manage diabetes symptoms. ABZ aqueous bark extract has been shown to have
hypoglycaemic activity in streptozotocin- induced diabetic rats.However, the
mechanisms by which ABZ aqueous bark extract exert this effect have yet to
beexplored.
Objective: To evaluate theeffectsof ABZ on insulin secretion and cell viability after
exposure of cells to streptozotocin (STZ)in vitro.
ABSTRACT:
A total of 15 agarwood-producing Aquilaria species have been identified as
potential species for plantation establishment. Identification of Aquilaria species is
a crucial issue in the establishment of Aquilaria plantation because Aquilaria, as in
many other species, are indistinguishable at seedling stage and planters often
encounter problem in identifying them. Therefore, there is a need to verify the
authenticity of planting materials as claimed by the suppliers. Development of
genetic markers for Aquilaria species identification provides a solution. In this
study, we looked for potential molecular markers for species identification using
Direct Amplification Minisatellite DNA (DAMD) technique. This study was carried
out for four major local species, namely A. malaccensis (agarwood, karas or
depu), A. microcarpa (garu), A. hirta (candan), and A. beccariana (gaharutanduk),
and three exotic species, A. crassna, A. subintegra and A. sinensis. The DAMD
markers were amplified from genomic DNA using M13 universal primer. From the
cluster analysis, all seven species were group into different clusters except A.
crassna and A. subintegra. However, prominent species specific bands were only
detected in A. hirta and A. malaccensis, one for each species.
Method: BRIN BD11,a clonal glucose-responsive insulin secreting cell line,was
induced with STZ to mimic the diabetic condition, followed by glucose and viability
tests. Upon treatment with ABZ aqueous bark extract, the changes in the level of
insulin secretion and cell viability were determined.
Results: BRIN BD11 cells was shown to secreteinsulin at a higher glucose
concentration (16.5mM), compared to basal glucose concentration (5.5mM). This
study also showedthat cell viability was less than 50% in cells treated with STZ
alone and more than 70% when the cells were treated with STZ, with subsequent
ABZ (600ug/ml) treatment, post 48 h. The ABZ-treated cells secreted a 10-fold
higher concentrations of insulin (2.1 ng/l) compared to STZ alone (0.2ng/l).
Conclusion: Collectively, these findings showthat the ABZ aqueous bark extract
enhanced cell viability and insulin secretion of BRIN BD11 cells induced with STZ.
This indicates that the ABZ bark extract may potentially work as anatural antihyperglycaemic agent.
68 | MGC10
Poster Board 55
ID 086
Yield Performance of Selected Introduced Banana Cultivar in East
Coast Peninsular Malaysia
Poster Board 57
ID 091
Morphological Characterization of Averrhoa carambola Accessions at
MARDI Kluang
Umikalsum Mohamed Bahari,
Bahari, Suhana Omar and Mohd Asrul Sani
Horticulture Research Center, MARDI HQ
Email: [email protected]
1
Ahmad Hafiz, B.1, Abd Rahman, M.2,
Horticulture Research Centre, MARDI Kluang Station
2
Horticulture Research Centre, MARDI
Email: [email protected]
ABSTRACT:
ABSTRACT:
Seven introduced banana varieties supplied by the International Network for the
Improvement of Banana and Plaintain (INIBAP) were evaluated for their yield
performance (bunch weight, number of hands, number of fruits, plant height and
girth) as well as 4 popular local varieties under commercial growing management
in MARDI Jerangau, Terengganu. There were evaluated in 2 categories which
were cooking type (FHIA 21 and FHIA 25) and fresh consumption (Bita-3, GCTCV
106, GCTCV 119, GCTCV 247 and William). Local check for cooking type was
pisang Tanduk while pisang Berangan Intan and pisang Montel was for fresh
types. The experiment was conducted in Randomized Complete Block Design
(RCBD) with 4 replicates. Among the cooking bananas, FHIA 25 had the highest
bunch weight of 30.7kg with the mean of 25.3kg. The local cultivar, pisang
Tanduk had a relatively lower production than the introduced varieties. For fresh,
pisang Montel variety had the highest bunch of weight of 25.5kg with the mean of
22.6kg while GCTCV 106 had mean of 18.8kg. However there were no significant
difference between pisang Montel and GCTCV 106. Pisang Embun and cv Rose
were planted as reference clone for Fusarium wilt.
Characterization of morphological characters is one of the breeding procedures to
evaluate the existing germplasm for future breeding work of starfruit. A total of
102 accessions of Averrhoa sp. was collected throughout Malaysia and
introduced from other countries. The objective of this work was to characterize
starfruit accessions at MARDI germplasm based on morphological traits for their
variation. As a start only twenty two accessions were used for this study and
twenty traits (12 quantitative and 8 qualitative) were recorded from 2011 to 2012.
Result from cluster analysis using twelve quantitative traits shows that the 22
accessions were classified into four major groups. Quantitative traits of fruit
quality were characterized by mean difference. It can be concluded that genetic
diversity of starfruitgermplasm were exist and can be classified based on plant
morphological characteristic for future breeding objectives.
69 | MGC10
Poster Board 58
ID 092
Evaluation and Selection of Red Blush Mango Progenies
Poster Board 59
ID 093
Discovery of Genes Involve in Alkaloid Biosynthesis Pathway of
Tongkat Ali Root.
Mohd Azhar Hassan1, Johari Sarip2, Nor Hanis Aifaa Yusoff1 and Suhanna
Ahmad2
1
Horticulture Research Centre, MARDI Bukit Tangga Station
2
Horticulture Research Centre, MARDI
Email: [email protected]
Norlia, B.,
B., Nor Hasnida, H., Norwati, A., Mohd Rosli, H. & Norwati, M.
Forest Research Institute Malaysia(FRIM)
Email: [email protected]
ABSTRACT:
ABSTRACT:
Mango can be classified into 3 groups based on the skin color of its ripe fruit,
which are green, yellow and red-blush. Red-blush skin is considered a necessity
in mangoes for the USA and European markets, even though the quality maybe
inferior to those non-showy cultivars. While in Malaysia and Asia markets, green
and yellow mangoes are very popular while the reddish is very rarely seen. SB003
and SB019 are progenies which are developed via open-pollinated mango
crossing approach. In this approach, strawberry mango variety was used as a
maternal parent. Red-blush skin color and few other good quality characters make
strawberry mango as a good parent but unfortunately it is not adapted to local
environment hence being a poor yielder. The fruit size is also very small and below
market demand. SB003 and SB019 are Malaysia’s first mango progenies with
beautiful red blush skin and orange flesh, high yielding, medium fruit size (350450 g), oval-shaped fruit, sweet-scented, less fibrous, less juicy, sweet (18-20%)
and bit sour taste, excellent flavor, high Vitamin C content, slight tolerance to
anthracnose infection, no IFR incidence and a possibility of dwarf plant. However,
Genotype x Environmental study has to be carried out before they can be launched
and recommended for commercial cultivation.
Tongkatali is indigenous to South-East Asian countries and the most popular
medicinal plant in Malaysia.The plant extract, especially roots have been widely
used in traditional medicines for its antimalaria, anti-pyretic, antiulcer, cytotoxic
and aphrodisiac properties. Wide range of chemical compounds have been
isolated and characterized from root of tongkatali,among which the alkaloids and
quassinoids form a major portion. Alkaloids isolated from root of tongkatali has
been reported posses cytotoxic effects. The alkaloids such as canthin-6-one
alkaloids and β-Carboline alkaloids have been isolated from root of tongkatali. In
compliment to chemical finding,we carried out molecular study on tongkatali root
throughtranscriptome analysis using next generation DNA sequencing
technology.DNA sequencing of tongkatali roots from 10 - year- old tree using
Illumina sequencing technology, produced more than 41 million sequencing reads,
while de novo assemblies yielded 44,855 unigenes. Gene ontology (GO) through
Blast2GO has categorised the transcripts into 16 groups based on biological
process level 2. The main categories were metabolite process which involved a
total of 11,542 unigenes(23%).The KyotoEncyclopedia of Genes and Genomes
(KEGG)pathways database generated for 138 metabolic pathways, among them
three were the biosynthesis of alkaloids related, which were Indol,Isoquinoline
and; tropane, piperidine and pyridine alkaloid biosynthesis. In total 20 genes
encodes for different enzymes, which involve in the pathways were identified to
express in root of tongkatali.
Keywords: Tongkatali, transcriptome, alkaloids, Illumina sequencing technology
70 | MGC10
Poster Board 60
ID 095
Studies on Heterosis in Brinjal (Solanum
(Solanum melongena L.) for Yield and
Its Components
Suhana, O.1, Abdul Rahman, M.1 and Mohamad, O.2
1
Horticulture Research Centre, Ibu Pejabat MARDI, Persiaran MARDI-UPM
2
Faculty of Plantation and Agrotechnology, UiTM
Email: [email protected]
ABSTRACT:
Five hybrids derived from crossing of five selected varieties without reciprocal
were evaluated at MARDI Research Plot in Serdang. The objective of this study
was to select the best hybrids for yield and its components based on heterosis
value. Data were recorded on yield and its components that are time to flowering,
plant height, fruit number per plant, fruit weight, fruit length, fruit circumference
and yield per plant. Result showed that there is significant different from all the
parameters studied as shown by ANOVA table. All traits shown low to intermediate
heterosis as compared to mid-parent and best-parent. As compared to midparent, fruit weight give the highest heterosis (79.90%) followed by fruit
circumference (37.50%), yield per plant (36.24%), fruit lenght (22.54%), and fruit
number per plant (3.40%). Negative heterosis were observed for plant height (4.20%) and early flowering (-13.80%). These value reflect dwarfness and
earliness in flowering characters. The best potential hybrids is NTH08077 x
T.Telunjuk which showed significant heterosis value of three out of seven traits
studied. The hybrids need to be further evaluated before they can release for
commercial cultivation.
Poster Board 61
ID 097
Evaluation and Selection of Tomato Lines for Lowland Cultivation
Nor Hazlina, M.S.,
M.S., Sebrina Shahniza, S.,
S., Rozlaily, Z.
Horticulture Research Centre, MARDI Head Quarters, Persiaran MARDI-UPM
Email: [email protected]
ABSTRACT:
The performances of fifteen tomato improved lines from Taiwan’s AVRDC were
evaluated under Malaysian environment condition. Experiments were carried out
at MARDI Station in Serdang and Jalan Kebun. The experiments were laid out in
completely randomized block design (RCBD) with four replicates. The traits under
studies are fruit weight, fruit size, fruit colour, fruit taste and fruit yield. The
incidence of bacterial wilt on the plants was also taken. Results showed that all
the traits, the fruit characteristics and fruit yield were significantly different among
the lines. In term of plant growth performance, nine lines did not growing well and
four died at early stage of planting. Only two lines performed well and showed low
incidence of bacterial wilt caused by Ralstonia solanacearum. These lines will
further be tested and evaluated together with the local tomato varieties to find the
best potential variety for the low land cultivation.
Key words:
words Brinjal, heterosis, yield, yield components
71 | MGC10
Poster Board 62
ID 099
Poster Board 63
ID 100
Complete Chloroplast Genome Sequence of an Important Timber
Tree Shorea leprosula (Dipterocarpaceae)
Comparative Performance of Nigerian X Avros, Cameroon X Avros
and Zaire X Avros Genetic
Gen etic Materials Planted on Inland Soils
Kevin Kit Siong Ng1, Soon Leong Lee1, Chin Hong Ng1, Lee Hong Tnah1, Chai
Ting Lee1&Kentaro Shimizu2
1
Genetics Laboratory, Forest Research Institute Malaysia
2
Institute of Evolutionary Biology & Environmental Studies, University of Zurich,
Winterthurerstrasse 190, CH-8057 Zurich, Switzerland.
Email: [email protected]
Nor Azwani Abu Bakar,
Bakar , Mohd Din Amiruddin, Noh Ahmad, Norziha Abdullah
and Rajanaidu Nookiah
Malaysia Palm Oil Board
ABSTRACT:
Dipterocarpaceae is one of the most important timber families in Southeast Asia.
To further our understanding on the molecular ecology and evolution of this
important timber family, we assembled the complete nucleotide sequence of the
chloroplast genome from Shorea leprosula. The chloroplast genome of S.
leprosula is 151,150 base pairs (bp) in length, and is composed of a large single
copy (LSC) of 83,518bp, a small single copy (SSC) of 19,328bp, and two identical
inverted repeat (IR) regions of 24,152bp each. The genome contains 116 unique
genes, of which 21 genes are duplicated in the IRs. Compared to the chloroplast
genomes from other dicots plants, S. leprosula chloroplast genome showed a high
degree of similarity of the overall structure, gene organization and gene content.
Furthermore, the sequences of the genes showed high degrees of identity at the
DNA and amino acid levels.
ABSTRACT:
The study aimed at comparing the performance of Nigerian (NGA) x AVROS,
Cameroon (CMR) x AVROS and Zaire (ZRE) x AVROS genetic materials, planted on
inland soils, in MPOB Keratong. The progenies were planted in a randomized
complete block design (RCBD) with two replications. Analysis of variance (ANOVA)
revealed that both NGA x AVROS and ZRE x AVROS crosses were not significantly
different for fresh fruit bunch (FFB) yield but highly significant for bunch number
(BNO) and average bunch weight (ABWT). However, ANOVA for CMR x AVROS
showed that the crosses only highly significant for FFB but not for the other yield
components. For fruit components, ANOVA showed highly significant difference
for mesocarp to fruit (M/F), shell to fruit (S/F), and oil to dry matter (O/DM)
indicating there was high genetic variation for these characters. For palm height,
NGA x AVROS and CMR x AVROS crosses showed significant different with mean
palm height of 2.46 and 2.38 m, respectively. Progeny PK 2005 from NGA x
AVROS gave the lowest palm height (2.08 m) with mean height increment of 0.34
m yr-1, lower than the current planting material (0.45 m yr-1). Generally, the
performance of the ZRE x AVROS crosses was better for FFB yield and its
components. NGA x AVROS and CMR x AVROS crosses on the other hand showed
higher potential for bunch quality characters.
Key words: germplasm; performance and oil palm
72 | MGC10
Poster Board 64
ID 108
Poster Board 65
ID 109
Correlation Analysis on Agronomic Characters in F1 Population
Derived from a Cross of Pongsu Seribu 2 and MR 264
Molecular Assessment of Functional Fragrant Trait among Traditional
Rice Cultivar in Sabah, Malaysia
Malaysi a
Nor’Aishah H. 1, Abdul Rahim H. 2, Mohd Rafii Y. 3, Norain M.N. 2,
Nur Izzah
Izzah J. 5
1
Faculty of Applied Science, Universiti Teknologi MARA
2
Division of Agrotechnology and Bioprocess, Agency Nuclear Malaysia
3
Institute of Tropical Agriculture, Universiti Putra Malaysia
5
Faculty of Science Computer and Mathematic, Universiti Teknologi MARA
Naransa Limpot,
Limpot, Kok Song Lai and Chee How Teo*
Agro-Biotechnology Institute, Malaysia (ABI)
Ministry of Science, Technology and Innovation Malaysia (MOSTI)
E-mail: [email protected]
E-mail: [email protected]
ABSTRACT:
Agronomic characters play a vital role in grain yield performance. However, the
information related to the relationships between agronomic characters and grain
yield in Malaysia are particularly very limited. Therefore, this study was conducted
to determine the correlation between grain yield performance with nine (n=9)
agronomic characters namely plant height, panicle length, total grain number,
filled grains per panicle, grain length, number of tillers, flag leaf area, flag leaf
width and 1000-grains weight. Twenty (n=20) F1 population derived from a cross
of Pongsu Seribu 2 and MR 264 were used and were grown at Malaysian Nuclear
Agency Greenhouse, Bangi. Result of correlation analysis revealed a positive and
significant at (p ≤ 0.01) relation between 1000-grains weight with total grains
number (r = 0.647), filled grains per panicle (r = 0.603), grain length (r = 0.834),
flag leaf area (r = 0.701) and flag leaf width (r = 0.894). However, the negative
(inverse) correlation was observed between panicle length with total grain number,
number of tiller and filled grain per panicle. This study indicated that selection
based on total grains number, filled grains per panicle, grain length and flag leaf
area will be highly effective for yield improvement in rice breeding program.
ABSTRACT:
Fragrant trait in rice is caused by a single recessive gene fgr on chromosome 8.
This trait is one of the most valuable traits in grain quality and more appealing to
consumers. Fragrant rice is selling with high price in local market especially in
Sabah, Malaysia. This study aimed to assess the fragrant trait among the
traditional rice cultivar in Sabah by using molecular marker, a simple and
inexpensive method for distinguishing between fragrant and non-fragrant trait in
local germplasm. A total of 104 Sabah traditional rice cultivar obtained from
MARDI GenBank and several places in Sabah, with MR219, MRQ74 and MRQ76
which were representative of the Malaysia non-fragrant and fragrant rice
respectively were used as control in the study. Perfect marker method using
primers External Sense Primer (ESP), Internal Fragrant Antisense Primer (IFAP),
Internal Non-fragrant Sense Primer (INSP) and External Antisense Primer (EAP)
was performed on genomic DNA extracted from these cultivars. Of 104 rice
cultivars assessed, 40 were homozygous fragrant, 55 were homozygous nonfragrant and 9 were found to be heterozygous non-fragrant. The data indicate the
successfully used of the perfect marker to distinguish fragrant and non- fragrant
in Sabah rice cultivar. This study will allow identification of fragrant rice cultivar for
further modern breeding program
Keywords: Agronomic characters, correlation, MR 264, Pongsu Seribu 2, Yield
performance
73 | MGC10
Poster Board 66
ID 110
Poster Board 67
ID 111
Towards Genetic Engineering of Rice Resistant against Golden Apple
Snail (Pomacea canaliculata)
Characterization of Jatropha curcas L. Accessions through Genetic
and Field Evaluations
Norsharina Md Saad,
Saad, Chee How Teo, Kok Song Lai and Norihan Mohd Saleh
Agro-Biotechnology Institute,
Email: [email protected]
Hanafi, N.M., Moktar, Z., Chong, M.F, and Saleh, N.M
Agro-Biotechnology Institute, Malaysia
Email: [email protected]
ABSTRACT:
ABSTRACT:
The golden apple snail (Pomacea canaliculata) is a serious pest on rice (Oryza
sativa) and native aquatic plant throughout South East Asia. To date, it is
estimated that more than 20,000 ha of rice area are being infested with the snail
and the infested areas are increasing at an alarming rate. The damage can range
between 30% to complete devastation of the newly emerging rice seedling (under
direct sowing) or transplanted rice seedlings. Field studies have also shown that
the invasive snail disrupts the functioning of natural ecosystems by altering
aquatic plant composition. The prototypic cyclotide (Kalata B1), isolated from the
African plant Oldenlandia affinis (Rubiceae), have been reported to exhibit
molluscicidal activities against golden apple snails (Pomacea canalicuata). Given
their naturally high mollucicides activities against golden apple snail, and the
successful report on the introduction of Oak1 gene into non-cyclic production
plant, there is a possibility to generate transgenic rice that capable to produce
cyclotides protein against the golden apple snail. In this study, the performance of
the Oak1 gene was evaluated in Malaysian Rice MR219 cultivar via
Agrobacterium mediated transformation. A cDNA fragment encoding Oak1 gene
was amplified using gene specific primers and cloned into pCAMBIA1301 vector
under the control of maize Ubiquitin promoter. The expression construct was
transformed into rice embryogenic callus. Putative transformation was subjected
to PCR screening and Southern blot analysis to confirm the present of the Oak1
gene. Real-time PCR was carried out to determine the Oak1 gene expression
profile. Finally, the developed transgenic rice line expressing Oak1 gene was
tested on golden apple snail by artificial feeding for the effectiveness of Oak1
gene.
Jatropha curcas species is a perennial, monoecious shrub, and widely distributed
in the tropics. J. curcas, a member of the Euphorbiaceae family can grow under
marginal soil condition. However, the productivity of fruit set and crude Jatropha
oil (CJO) production is not optimum under this condition. The importance of
biofuel is undeniable and the jatropha plant serves as a potential renewable
energy crop. However, poor agronomic practices, lack of superior genetic material
and unsynchronized fruiting and ripening still remains a bottleneck for this crop.
Thus, there is a need to perform a standardized field evaluation and
characterization of this energy crop. Generally, yield productivity and quality of the
plant are affected by several factors such as nutrient availability in the soil, climate
and planting system. Small scale field evaluation was conducted to select the best
accession of Jatropha curcas under marginal soil condition using Randomized
incomplete block design. A total of 66 Jatropha accessions were evaluated based
on number of fruits and CJO yield obtained. Standardized agronomic practices
were applied throughout the field trials. Physical traits such as number and weight
of fruit per tree and per bunch and height of tree were collected and analyzed
using two-ways ANOVA. In addition, fingerprinting analyses were conducted using
two dominant markers, Randomly Amplified Polymorphic DNA (RAPD) and Intersimple Sequence Repeats (ISSR), to determine the genetic variation among the
accessions of Jatropha curcas. MEGA version 5 software (Tamura et. Al 2007)
was used to score the PCR amplified fragments and deduce the phylogenetic
relationship among the accessions. The phylogenetic tree generated shows that
the 68 accessions were grouped into five different clusters (UPGMA tree with
1000 bootstrap value) using Nei & Li algorithm (1978), implemented in the
software Free Tree (Pavlicek et al. 1999). Top five (5) accessions were selected
for further field evaluation at different agro climatic condition based on fruit yield
and CJO production.
74 | MGC10
Poster Board 68
ID 005
Mutation in Both LDLR Gene and APO BB-100 Gene among Malaysian
Familial Hypercholestrolemic Patients
Alyaa AlAl- Khateeb1*, Mohd Sapawi Mohamed2,
Zurkurnai Yusof 3, Bin Alwi Zilfalil4
1
Faculty of Medicine, Universiti Teknologi MARA (UiTM)
2
Hospital Sultanah Nur Zahirah, Kuala Terengganu
3
Department of Medicine, School of Medical Sciences, Universiti Sains Malaysia
4
Human Genome Centre, School of Medical Sciences, Universiti Sains Malaysia
Email: [email protected]
ABSTRACT:
Familial hypercholesterolemia and familial defective apolipoprotein-100 are
autosomal dominant genetic diseases mainly caused by defects in the low-density
lipoprotein receptor gene and apolipoprotein B-100 gene, respectively.The
objective of this study is to carry out a genetic analysis of bothlow density
lipoprotein receptor gene andapolipoprotein B-100 gene among Malaysian familial
hypercholestrolemic patients.For genetic analysis a group of 155 familial
hypercholesterolemic patients were recruited from Cardiology Clinic, Hospital
University Sains Malaysia, Kelantan state. The patients were collected according
to Simon Broome Register Criteria for familial hypercholesterolemia diagnosis. The
promoter region, exon 2-15 of low-density lipoprotein receptor gene and parts of
exon 26 and 29 of apolipoprotein B-100 gene were screened by Denaturating
High Performance Liquid Chromatography. For large rearrangements detection of
low density lipoprotein receptor gene, Multiplex Ligation-dependent Probe
Amplification analysis was used. Out of 155 recruited patients, 12 (7.7%) subjects
were carriers of mutations in both low-density lipoprotein receptor gene and
apolipoprotein B-100 gene. Eight (5.6%) patients were carriers of two low-density
lipoprotein receptor mutations, while 10 (6.4%) patients were carriers of two
apolipoprotein B-100 gene mutations. In conclusion, a combined mutation is
present among Malaysian familial hypercholestrolemic patients.
Poster Board 70
ID 032
Preliminary Study of Syzygium samarangense Flower Development
Muhammad Afiq Bin Tajol Ariffin1* and Abd. Rahman Milan2
Horticulture Research Centre,MARDI Bukit Tangga Station, Kedah,
2
Horticulture Research Centre, MARDI Serdang, Selangor.
Email: [email protected]
1
ABSTRACT:
Syzygium samarangenseis a tropical fruit plants which commonly known as wax
apple. It is widely cultivated in Asian countries and being exported extensively by
countries such as Taiwan and Thailand. Although this fruit is so popular in Taiwan
and Thailand; there is no details report on flower development of the crop.
Information from this study is so important for plant botanist and breeder to
perform further study related to this species. This study was carried out from April
to Jun 2013, on a red fruit type S. samarangense cultivar with age of about four
years old in MARDI Bukit Tangga Station, Kedah, Malaysia. Nine inflorescences of
flower buds with three to nine flower buds in each inflorescence were observed
every day, except on raining day. They were observed until the flower developed
into mature and ripe fruit. Measurement of flower diameter and length, changes in
their physical appearance, and photos were recorded. In this preliminary study,
there were nine stages of flower and fruit development observed for S.
samarangense. Three stages occurred before flower anthesis and six stages
occur from flower anthesis until fruit matured and ripe. Total period for all stages
were 46-54 days.
75 | MGC10
Poster Board 71
ID 079
Poster Board 72
ID 088
Construction and Overexpression of Chalcone Synthase (CHS) Gene
from Boesenbergia rotunda in Bacterial Expression System
Chromosome Doubling In A. Malaccensis through In Vitro
Polyploidization
The Ser Huy1, NurNadiah Roslan2,Nurfairuz Abdul Latif1, Norzulaani Khalid1,
2
and Zulqarnain Mohamed1,2
1
Centre for Research in Biotechnology for Agriculture, University of Malaya
2
Unit of Genetics and Molecular Biology, Institute of Biological Sciences, University
of Malaya
Email: [email protected]
A.R. Siti Suhaila1,4*, N. Mohd. Saleh2,4, M. Norwati
Norw ati1, M.C. Mahani3, H. Siti
Salwana1, P. Namasivayam4, K.I. Kandasamy5, H. Nor Hasnida1, I. Haliza1, A.
Nazirah1, Y. Muhd. Fuad1
1
Forest Research Institute Malaysia (FRIM) 2Agro-Biotechnology Institute3School of
Environmental and Natural Resource Sciences, Faculty of Science and Technology,
UniversitiKebangsaan Malaysia (UKM) 4Department of Cell and Molecular Biology,
Faculty of Biotechnology and Biomolecular Sciences, Universiti Putra Malaysia
(UPM) 5Malaysian Biotechnology Corporation Sdn. Bhd
Email: [email protected]
ABSTRACT:
Fingerroot(Boesenbergia rotunda) is a monocot plant from Zingiberaceae family,
and it has been used as food or spice and herbal plant in traditional medicinal for
over 2000 years. Recently, the contents of its rhizome extract had been studied,
and findings showed that they contained anti-cancer, anti-microbial, anti-viral and
anti-inflammatory properties. The compounds generally found in rhizome extracts
are flavonoids, such as chalcones, flavonols, anthocynins, stilbenes and other
derivatives. These compounds are plant secondary metabolites synthesized or
derived from the flavonoid biosynthesis pathway by a number of enzymes. In most
plants, chalcone synthase (CHS) is one of the key enzymes to initiate the flavonoid
biosynthesis pathway. CHS is a plant-specific polyketide synthase, which forms
chalcone by the condensation of one molecule of 4-coumaroyl CoA with three
malonyl CoA. In our previous studies, we had isolated two and/or more sequence
variants of CHS gene from different parts of B. rotunda. These sequence variants
shared 96-99% similarity at nucleotide level and 93-99% similarity at amino acid
level. In order to study the enzyme functionality among the sequence variants of
CHS gene, two were chosen and cloned into a bacterial expression system, based
on the preliminary results of CHS expression profile in B. rotunda. The expression
of CHS variants were detected in Western blots using anti-MBP monoclonal
antibody. MBP is maltose-binding protein, which serves as fusion tag for
downstream purification. Optimisation of culture conditions in order to obtain large
yield of B. rotunda CHS variants for downstream purification and enzyme assay
are currently ongoing.
ABSTRACT:
The used of antimitotic agents to induce chromosome doubling had been
successfully applied in many crops for decades. The plant produced (called
polyploids) are mostly superior compared to their diploid counterparts and
selected by breeders as planting stock. The successfulness of producing
polyploids is determined by many factors such as concentrations, exposure time,
explants and species. This study investigated the capacity of the antimitotic
agents (colchicine and trifluralin) in inducing chromosome doubling of
Aquilaramalaccensis using shoot tip and nodal segment in vitro explants. Flow
cytometric analyses, chromosome number and stomatal size were used to
evaluate the optimal concentration of each antimitotic agent for polyploidization.
This study reported that concentrations as well as exposure time were significant
parameters. Trifluralin at 0.1 mM resulted in the highest percentage of
polyploidization, followed by colchicine treatment of 1 mM. The maximal exposure
time tested (120 hours) resulted in a significant increase in polyploidization by
trifluralin and colchicines. Additionally, the antimitotic agents reacted differently
towards different explants. Nodal segments showed higher ploidy level changes in
comparison to shoot tip. The chromosome number for diploid (2n = 14) and
tetraploid (4n = 28) was confirmed through optimized root tip squashing
technique. The stomatal size was observed to be larger than diploid, 33.26+0.6
and 23.14+0.5, respectively. These plants are being grown in greenhouse in
order to test their potential for use in breeding programme.
Keywords: A. malaccensis, shoot tip, nodal segment, antimitotic agents, polyploid
76 | MGC10
Poster Board 73
ID 083
Poster Board 74
ID 050
Isolation of Partial Phosphate SynthaseSynthase-Like Gene from Root of
of
Tongkat Ali
(Eurycoma longifolia)
Gene Polymorphisms of ProPro- and AntiAnti -Inflammatory Cytokines
Increase the Risk of Gastric Cancer in Helicobacter pylori Infected
Subjects
Zahidah Zafhian*,
Zafhian*, Norlia Basherudin, Nor Hasnida Hassan and Norwati
Muhammad
Forest Research Institute of Malaysia (FRIM)
Email: [email protected]
Akbar Oghalaie1, Samaneh Saberi1, Yeganeh Talebkhan1, Maryam
Maryam Esmaili1,
Maryam Bababeik1, Parisa Hassanpour1, Shaghik Barani1, Sana Eybpoosh2,
Afshin Abdirad3, Mahmoud Eshagh Hosseini4, Mohammad Ali Mohagheghi5
and Marjan Mohammadi1*
1
HPGC Group, Medical Biotechnology Department, Biotechnology Research Center,
Pasteur Institute of Iran,2Research Center for Modeling in Health, Institute for
Future Studies in Health, Kerman University of Medical Sciences, Kerman, Iran,
3
Cancer Institute, Tehran University of Medical Sciences, 4Gastroenterology
Department, Amiralam Hospital, Tehran University of Medical Sciences, 5Cancer
Research Center, Tehran University of Medical Sciences Tehran, Iran.
Email: [email protected]
ABSTRACT:
Eurycoma longifolia or commonly known as tongkat ali, belongs to the family of
Simaroubacea. It is traditionally used throughout South East Asia as herbal
medicine for the treatment of malaria, ulcer, fever and male fertility problems.
Tongkat Ali produces a large amount of secondary metabolites such as alkaloids,
flavonoids, phenols and lignans which required 3-deoxy-D-arabino-heptulosonate
7-phosphate (DAHP) synthase enzyme for their biosynthesis. DAHPsynthase is an
enzyme that involve in the first step of Shikimate pathway by catalyzes the
condensation of phosphoenolpyruvate (PEP) and erythrose 4-phosphate (E4P) to
form DAHP and inorganic phosphate. In order to understand the impact of DAHP
synthase enzyme in biosynthesis of secondary metabolites in Tongkat Ali, we
isolate the genes encoding forDAHP synthase from root of 10 - year old using
transcriptome analysis followed by RACE cDNA Amplification. Primers specific to
Tongkat Ali DAHP synthase were design based on the cDNA sequence generated
from transcriptome data analysis. Out of 9 primers screened, 2 primers
designated as TAPS F1 and TAPS R3 showed amplification products and were
selected for RACE PCR. The amplified fragments was about 1 kb and cloned into
pCR®2.1 plasmid vector and were subsequently sequenced. The sequences
showed that the size of amplified cDNA was 1492 bp and potentially encoded for
278 amino acids. BLASTX analysis showed that the cDNA was 87%, 85% and
84% identical to phosphate synthase genes of Theobroma cacao,Arabidopsis
thaliana and Fagus sylvatica respectively.
Key words:Eurycoma
longifolia, phosphate synthase, cDNA, RACE PCR
words:
ABSTRACT:
Background: Gastric adenocarcinoma, particularly of the intestinal subtype, is
believed to develop pursuant to pre-neoplastic histologic changes, which originate
from gastric inflammation. Immune regulation involves a homeostasis between Thelper 1 and 2 activities. IL2 is normally produced by Th1 cells and IL4 and IL10
represent Th2 cytokines. These cytokines are critical mediators of the Th1/Th2
balance implicated in the process of inflammation-mediated gastric
carcinogenesis. The aim of this study was to evaluate the functional gene
polymorphisms in these cytokines in association with gastric cancer.
Methods: Promoter polymorphisms in IL2 G-384T, IL4 T-590C and IL10 G1082A, C-819T and C-592A were studied by PCR-RFLP and ARMS-PCR method
in a case-control study comprising of 411 gastric cancer, 523 ulcer/cancer-free
endoscopic patients and 610 unselected healthy individuals. Serum H. pylorispecific IgG antibodies were measured by ELISA. Demographic and life style data
were collected through patient interviews. Unconditional logistic regression model
adjusting for age, gender and ethnicity was used to estimate odds ratio and the
corresponding 95% confidence intervals.
Results: We found that, I G-1082A (GA and AA) and I T-590C (TC and CC)
carriers were at 2.3 (OR=2.8, 95%CI=1.1-6.8) and 2.9 (OR=2.9, 95%CI=1.65.3) folds increased risk of gastric cancer respectively. IL2 G-384T (GT and TT)
carriers who also carried the IL4 T-590C (TC and CC) SNP and were seropositive
for H. pylori were at a significant risk of five (OR=5.0, 95%CI=1.3-19.5) folds.
This was further amplified for those who had a family history of GC (OR=8.4,
95%CI=1.1-61.2).
Conclusion: Our results indicate that assessment of functional single nucleotide
polymorphisms in the anti- and pro-inflammatory cytokines in association with
other convincing risk factors such as H. pylori infection can help identify high risk
patients and devise follow up plans for monitoring potential development of early
gastric cancer and medical interventions.
77 | MGC10
Poster Board 75
ID 054
Helicobacter pylori BabA Genotype, Phenotype and Function
Poster Board 76
ID 113
MorphoMorpho-Physiological Responses of Strawberry Genotypes
Genotyp es under
Different Drought Stress Conditions
Samaneh Saberi1,
Saberi1, Yeganeh
Yeganeh Talebkhan1, Maryam Esmaili1, Akbar Oghalaie1,
Parisa Hassanpour 1, Maryam Bababeik1, Shaghik Barani1, Azin Nahvijou2,
Afshin Abdirad3, Mahmoud Eshagh Hosseini4, Mohammad Ali Mohagheghi2
and Marjan Mohammadi1*
1
HPGC Group, Medical Biotechnology Department, Biotechnology Research Center,
Pasteur Institute of Iran, 2Cancer Research Center, Tehran University of Medical
Sciences, 3Cancer Institute, Tehran University of Medical Sciences,
4
Gastroenterology Department, Amiralam Hospital, Tehran University of Medical
Sciences, Tehran, Iran.
Email: [email protected]
ABSTRACT:
Introduction: BabA is one of Helicobacter pylori (Hp) outer membrane proteins,
which attaches to human Lewis b surface epitopes and is mainly responsible forits
colonizing capacity. The aim of this study was to investigate the status of
HpbabA/babB genes and their association with BabA protein expression and
function.
Methods: Presence of babA and babB genes was investigated by PCR on
156fresh single colonies isolated from Iranian patients. Hp strains were
categorized as those: #1) with no detectable babA or babB sequences at A or B
locus; #2) with one copy of either babA or babB (at A or B locus); #3) with one
copy of babA and one copy of babB (at A and B loci); #4) with both babA and
babB sequences at either or both loci (chimeric forms). Possessions of these
genotypes were evaluated in reference to BabAprotein expression by
immunoblotting and Lewis b (Leb) binding functional assay.
Arash Nezhadahmadi1‫٭‬, Golam Faruq1, and Kamaludin A Rashid2
1.
Institute of Biological Sciences, University of Malaya
2.
Center for Foundation Studies of Science, University of Malaya
Email:[email protected]
ABSTRACT:
Strawberry (Fragaria ananassa.L.), as a member of the Rosaceae family, is one of
the most important crops cultivated worldwide. The expansion of strawberry
culture in the world for its considerable fresh fruits and nutritive values.
Unfortunately, drought limits the production of this imperative crop. This study was
conducted in order to investigate morphological and physiological responses of
three strawberry varieties in water deficit conditions. Plants were treated with
three soil moisture levels including 25% (severe stress), 50% (mild stress), and
75% (normal irrigation) and the experiment was lasted for 2 months as a duration
of stress to get proper observations of plants to drought stress. The experiment
was performed in controlled and natural environments (Glasshouse of the
University of Malaya and Cameron Highlands). It was observed that plants height,
leaf area, specific leaf area (SLA), leaf number,chlorophyll content, relative water
content (RWC), fruit yield, fruit weight, fruit transverse diameter, fruit vertical
diameter were decreased significantly (P≤0.05)with each decrease in soil
moisture content and increase in duration of stress in both environments. In
contrast, plants in natural condition (Cameron highlands) demonstrated normal
growth compared to the controlled condition in both stressed and non-stressed
treatments.Significant differences (P≤0.05) were observed between the varieties
and different growing conditions in chlorophyll content, biomass production and
relative water content (RWC).
Results: In 66.7% and 70.1% of Iranian Hp strains babA and babB sequences
were detected respectively. The above-mentioned 4G categorization of bab
genotyping closely correlated with protein expression (R=0.45, P=0.0001) and
Leb binding (R=0.26, P=0.004). Protein expression was significantly different
between groups #1 vs. #3 and #4 as well as #2 vs. #3 and #4 (P<0.0001). The
binding capacity was also significantly different between groups #1 vs. #3 and #2
vs. #3 (P<0.05). BabAprotein producers in particular, high producers, were
mostly isolated from the lower (antrum/pylorus) gastric locations (R=0.24,
P=0.009). Similarly, most Leb binding strains were isolated from the same
locations (R=0.25, P=0.003), which also represented atrophic changes (R=0.3,
P=0.04).
Conclusion: Bab A/B 4G genotyping method correlates with BabA protein
expression and Leb binding capacity of Hp strains. This genotyping method can
predict the phenotypic and functional status and pre-neoplastic histologic changes.
78 | MGC10
Poster Board 77
ID 115
Aquilaria
Poster Board
78 malaccensis Shoot RegenerationRegeneration- Using Different ID 116
GenomeGenome-Wide Analysis of CytosineCytosine- DNA Methylation, the
Transcription Regulation and Genes Expression in Oryza sativa for
Salt and Drought Stress
Fiaz Ahmad1,*, Ji Huang1, HongHong- Sheng Zhang1
State key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing
Agricultural University,
E-mail: [email protected], [email protected]
ABSTRACT:
Cytosine-DNA Methylation is also playing an essential epigenetic transcriptional
regulatory role in plants against abiotic stresses like salt and drought. Here we
analyzed whole genomeMeDIP-Seq read in CpGIsland, upstream2k, five-UTR,
CDS, Intron, three-UTR and in downstream2k of multi samples of japonica rice
under conserved conditions. For each class of Peaks, two samples were merged
as candidate different methylation regions (DMRs); and for each candidate DMR,
the number of reads of each sample was 35 (p-value<10e-5).To get true bed_up
and bed_downDMRS, thereads were assessed with chi-square statistics and FDR
statistics and for the validation of DMR we applied BS-sequencing. Overall, we
find that the chromosomal distribution pattern of methylated DNA in three samples
is similar to the heterochromatin distribution pattern on rice chromosomes.
Similarly, the upstream, CDS and downstream of drought stressed genome get
the highest level of Methylation and reduced the level of transcription to regulate
the stress as compared to salt stressed genome that is in contrast to the first.
Finally on the behalf of MeDIP-Gene chip hybridization, we find 33,009 regulatory
expressed genes. Based on the signal intensities of gene chip microarrays, the
expressed genes were divided into five groups: lower, low, medium, high and
higher. Finally we isolated the patentable genes for further phenotypic analysis.
Combinations of BAP and NAA
Nursaadiah,
Nursaadiah, S.,
S., LesleyLesley- Geoffy, A.S., Awal, A. and Shamsiah, A.
Faculty of Plantation and Agrotechnology, Universiti Teknologi MARA
Email: [email protected]
ABSTRACT:
Aquilaria malaccensis is commonly known as agarwood belongs to the family of
Thymelaeaceae. It is a commercially important plant due to its valuable aromatic
compound. The Aquilaria plants is facing serious depletion due to over exploitation
for its precious agarwood which is the source of expensive oil used in the
production of high grade perfumes as well as in medicines. Clonal regeneration is
necessary to overcome the problems of high demand for the planting materials of
A. malaccensis and also risk of extinction. Here an attempt was to develop shoot
via tissue culture approaching using stem and shoot tip as explants. Healthy and
sterilized explants were placed on the MS media containing BAP (0.1mg/l,
0.2mg/l and 0.3mg/l) and NAA (0.2mg/l, 0.4mg/l and 0.6mg/l) in various
combinations. The maximum number of shoot regeneration was observed on MS
media containing 0.3mg/l BAP and 0.6mg/l NAA with the average of 3.80 shoots
formation and multiplication. The shoot regeneration will increase the chances of
genetic improvement of A. malaccensis through biotechnological ways such as
genetic transformation and in vitro cell line selections.
Keywords: Aquilaria malaccensis,
malaccensis , In vitro regeneration, BAP, NAA, shoots
regeneration.
Key words:
words MeDIP-Gene chip, DNA methylation/demethylation, abiotic
stresses,Oryza sativa.
79 | MGC10
Poster Board 79
ID 117
Genetic Variants in the HERHER-2/neu Gene and Risk of Breast Cancer.
Awatif Siddig1, Adem Abdu2 , Kamal Hammed3 and Mohamed Abdelrahim
Osman4
1
Faculty of Medical laboratory Technology, Sudan University for Science and
Technology, Sudan.2Department of Pharmacology, Faculty of Medicine and Health
Sciences, UAE University, United Arab Emirates. 3Department of Surgery, Faculty
of, Medicine, Khartoum University Sudan.4 University of El Imam El-Mahdi Sudan.
Email: [email protected]
Poster Board 80
ID 067
Association of Metallothionein Gene Mt1a (Rs11076161) and Mt2a
(Rs10636)
10636) Gene Polymorphisms with Type 2 Diabetes Mellitus among
(Rs
Malay Ethnics
Norsakinah Mohammad Osman1, Ali Etemad1, Vasudevan Ramachandran2 and
Patimah Ismail1*
1
Genetic Research Group, Department of Biomedical Science, Faculty of Medicine
and Health Sciences, Universiti Putra Malaysia
2
Institute of Gerontology, Universiti Putra Malaysia
Email: [email protected]
ABSTRACT:
ABSTRACT:
Background:
Background Genetic alterations of the proto-oncogene human epidermal growth
factor receptor (HER-2/neu) have been shown to induce malignant transformation
and metastasis. Genotyping studies have addressed the association of codon 655
Isoleucine to Valine polymorphism located in the transemembrane coding region,
and the risk of breast cancer, but the results are inconsistent. The present study
investigated the association of HER-2/neu Ile655Val polymorphism and the risk of
breast cancer in Sudanese population; in addition the joint effect of HER-2/neu
variants and our previously reported ESR1C325G polymorphism were tested for
their association with breast cancer risk.
Methods: Candidate single nucleotide polymorphism (SNP) in HER-2/neu
Ile655Val SNPs [db SNP rs1136200] gene was genotyped in breast cancer
patients and in healthy controls that were randomly selected from the same age
group as the patients. Genotyping was performed using a high throughput allelic
discrimination method using Real-Time PCR and data on clinical features and
demographic details were collected. Associations between genotype and breast
cancer were assessed by means of logistic regression.
Results: The Prevalence of Val/Val genotype was similar in patients of breast
cancer and control subjects. In comparison with the Ile/Ile genotype, the Ile/Val
had a borderline significantly (p=0.06) higher risk of breast cancer (OR= 2.95,
95% CI 0.97-8.96). Regarding the genotypic and allelic frequencies stratified by
age and menopausal status there were no significant associations. A significantly
higher risk of breast cancer was observed among homozygous carrier of ESR1325
CC genotype and heterozygous carrier of HER-2/neu655 Ile/Val genotype (P=0.05,
adjustedOR (95% CI) = 4.9 (1.0-24)).
Conclusion: The association of HER-2/neu Ile655Val polymorphism and risk of
breast cancer was borderline significant with the heterozygous carrier being at
higher risk. However the frequency of different polymorphic variants varies with
the ethnicity. Our study demonstrated, that a significant gene-gene interaction
between ESR1325C (previouslyreported) and HER-2/neu 655Ile/Val
variantsmayjointly contribute to a higher risk of breastcancer.
Type 2 diabetes mellitus (T2DM) is a complex metabolic disorder characterized by
the presence of high glucose in blood caused by insulin resistance and
insufficiency due to deterioration of β-cell Langerhans function. T2DM is
commonly caused by the combination of inherited genetic variations as well as
lifestyle factors. Metallothionein (MT) is a known cysteine-rich protein responsible
in zinc homeostasis which is important in insulin signaling and secretion as well
as protection of our body from reactive oxygen species (ROS). The objective of
this study was to investigate the association of MT1A and MT2A gene
polymorphisms between T2DM and control subjects among Malay ethnic group. A
total of 150 T2DM and 120 healthy individuals of Malay ethnicity were recruited.
Genomic DNA was extracted from buccal cells and amplified for MT1A and MT2A
loci; the 347bp and 238bp banding patterns were respectively amplified by PCR.
The PCR products were digested with Mlucl and Tsp451 restriction enzymes
respectively and restricted fragments lengths of (158/189/347bp) and
(103/135/238bp) respectively. There was a significant difference observed
between diabetic and control subjects for age, body mass index, systolic blood
pressure, blood glucose level, haemoglobin, low density lipoprotein, total
cholesterol and family history with T2DM (P<0.05) except high density lipoprotein
and diastolic blood pressure. The genotype frequency for AA, AG and GG of MT1A
polymorphisms was 72.7%, 22.7% and 4.7% in cases, and 15%, 55% and 30%
in control subjects respectively. As for MT2A, genotype frequency of GG, GC and
CC was 42.7%, 27.3% and 30% in cases, and 5%, 40% and 55% for controls
respectively. Both polymorphisms showed significant difference between the
groups with (P<0.05) by Post-Hoc test. These MT1A and MT2A polymorphisms
may therefore be reliable molecular markers to distinguish T2DM subjects from
healthy individuals in Malay ethnic group.
80 | MGC10
ID 001
The Presence of Calcium Oxalate Styloids in Pandanaceae
Eshak, Z., Mohsin,
Mohsin, H. F. &Abdul
&Abdul Wahab, I.
Faculty of Pharmacy, UniversitiTeknologi MARA
Email: [email protected]
ABSTRACT:
The presence of calcium oxalate crystals (CaC2O4.H2O) in plants were discussed in the literatures. In this study,the crystals were extracted from the natural Pandanus
samples. This genus belongs to the Pandanaceae family, which consists of three other genera, including Sararanga Hemsl., Freycinetia Gaidich and Martellidendron.
Most Pandanus are likely to be found in tropical and subtropical regions, where they prefer to grow in coastal or dry habitat. Here, the oxalates’ photomicrographs are
presented, following the advanced resolution analyses by using scanning electron microscopy (SEM). The crystals hold a significant attribute for guiding plant
taxonomists and archaeologists in the investigation of sustainable species. From a review, this stable mineral exists in higher plant species and commonly consists of five
basic morphological types; (1) needle-shaped raphides, (2) rectangular or pencil-shaped styolids, (3) mace-head-shaped aggregates called druses, (4) block-shaped
aggregates called crystal sand, and (5) variously shaped prisms. Their size and appearance can differ within and between the plant families. However in the
Pandanaceae family, the needle-shaped raphides are mostly viewed. The other morphological type of crystalline called styloid, is now mentioned from an unidentified
species of the Pandanus genus. Previously, it is reported in two known Pandanus and one Freycinetia species. The size of these crystals is definitely smaller, when
compared to the mega-styloids. It is hoped that this information could assemble the chemotaxonomical and pharmacognostical significance of the underutilized
Pandanus species. Finally, this microscopic screening could support the point that the crystals’ distinctiveness are probably under the plant genetic control.
Keywords:
Keywords oxalate, Pandanus, plant genetics, microscopy
INTRODUCTION
The occurrence of calcium oxalate crystals (CaC2O4.H2O) in plants were discussed in detail by Prychid, C. J. et. al. (1999) and Crowther, A.(2009a & 2009b).In this
study,the crystals were extracted from the natural Pandanus samples. This genus belongs to the Pandanaceae family, which consists of three other genera, including
Sararanga Hemsl., Freycinetia Gaidich and Martellidendron. Most Pandanus are likely to be found in tropical and subtropical region, where they prefer to grow in coastal
or dry habitat. Here, the oxalates’ photomicrographs are presented, following the advanced resolution analyses by using scanning electron microscopy (SEM). The
crystals hold a significant attribute for guiding plant taxonomists and archaeologists in the investigation of sustainable species. From a literature review, this stable
mineral exists in higher plant species and commonly consists of five basic morphological types; (1) needle-shaped raphides, (2) rectangular or pencil-shaped styolids, (3)
mace-head-shaped aggregates called druses, (4) block-shaped aggregates called crystal sand, and (5) variously shaped prisms (Fig. 1). Their size and appearance can
differ within and between the plant families. However in the Pandanaceae family, the needle-shaped raphides are mostly viewed (Crowther, A. 2009a and 2009b) with
the aid of the technology in microscopy.In this paper, the other type of the crystalline called styloid is mentioned, from an unidentified species of the Pandanus genus.
Previously, it has been reported in P. gasicus(Prychid, C. J. et. al. 1999), P. odoratissimus (Ariffin, S. A. et. al. 2012) and one Freycinetia javanica species (F.javanica)
(Prychid, C. J. et. al. 1999).
MATERIALS AND METHOD
The wild Pandanus sample for this work was collected from its natural, urban habitat (Fig. 2). Fresh materials were taken from Shah Alam, Selangor DarulEhsan,
Malaysia, in December 2011. Experiments were performed with specimens collected before this study and labeled as unidentified Pandanus by the author (IAW). The
plant leaves were carefully cleaned to remove any possible external contamination (Baran, E. J. et. al. 2010). They were dried, deposited at the faculty and were given
voucher specimen number (PPAS122011). The Pandanus were kept at the Faculty of Pharmacy, UiTMPuncakAlam, for future reference.
The calcium oxalate crystals wereextracted based on methodologies, adapted from Crowther, A. (2009a, b). The dried leaves were firstly cut into smaller pieces. The
samples were macerated in 70% ethanol. Then, the ethanolic suspensions were agitated. The aliquots were transferred to the microscope slides and allowed to airdry.
The specimens were examined by using Leica Microsystems Confocal Laser Scanning Microscopy (CLSM, laser beam = 532 nm), complemented with JEOL JSM-6701F
Scanning Electron Microscopy (SEM). All SEM analysis was carried out using an acceleration voltage of 5 kV.
81 | MGC10
Raphide bundle, needle-shaped crystals from
grape leaves.
Solitary styloids within a cellin Freycinetia (left) and
Liliaceae species (right).
Purified crystal sand from
Wigginsia species.
Druses from weed leaf (Abutilon
species).
Twinned prismatic crystals from the seed coat of
bean (Phaseolus species).
Figure 1:The characteristic morphologies of calcium oxalates from selected plants (sources: Monje, P. V. et. al. 2002; Prychid, C. J. et. al. 1999; Webb, M. A. 1999).
Figure 2: The unknown Pandanus species, which is found by the roadside (left). The four-fold spiny leaves and multicarpel fruit are descriptive of a Pandanus (right).
82 | MGC10
ULTS AND DISCUSSION
From the CLSM photomicrograph in Fig. 3, the leaves contained single calcium oxalate raphide. It was observed as an acicular crystal, having the shape of a narrow,
long and pointed needle. In addition, a styloid, was also observed (Fig. 3). It was detected as rectangular crystals, some having small extensions around their four
edges.Within the interior of a plant cell, the styloids tend to be solitary (Prychid, C. J. et. al. 1999), unlike the needles that can be found in bundles. It is likely that this
sample might contain stacks of raphides (Fig. 4), as discovered earlier from other Pandanus (Ariffin, S. A.et. al. 2012).
The dimensionof the styloids is definitely smaller, when compared to the elongated or uncommonly large-size crystals called mega-styloids(Table 1), for example from
the Melastomataceae family (terWelle, B. J. H. et. al. 1977). Figure 5 is among the first displays of Pandanus’ styloid via SEM from our laboratory. The solitary styloid
was only 4.46 μm x 7.92 μm (Fig. 6). Meanwhile, the broken styloid was found to be 6.20 μm x 7.70 μm. Mega styloids have not yet been discovered from any
Pandanus. It was suggested that the mega-styloid appear to be a constant and characteristic feature, rather than an accidental phenomenon of any traumatic origin due
to some kind of plant injury (terWelle, B. J. H. et. al.1977 and Richter, H. G. et. al. 1987).
Figure 3: The photomicrograph viewed from CLSM (scale bar = 25 μm), showing a raphide (left) and a styloid (right).
Figure 4: The photomicrograph viewed from SEM (scale bar = 10 μm), showing a single (left) and a stack of calcium oxalate needles (right).
Figure 5: The photomicrograph viewed from SEM (scale bar = 10 μm), showing a solitary (left) and a broken calcium oxalate styloid(right).
83 | MGC10
Table 1: The dimensions of the calcium oxalate crystals (Source: terWelle, B. J. H. et al. 1977).
Plant family
The dimensions of the calcium oxalate crystals
Euphorbiaceae
Lauraceae
Celastraceae
75 x 10 μm to 118 x 18 μm
13 x 3 μm to 18 x 4 μm
40 x 10 μm to 63 x 10 μm
336 - 448 µm
36-52 µm
8 µm
5 µm
(i)
(ii)
Figure 6: Diagram of the general comparison of morphological features for a calcium oxalate crystal, visible by SEM, showing (i) two wedged-like terminations of a megastyloid from Melastomataceae [6] and (ii) a styloid from Pandanus.
CONCLUSION
For the moment, the phytochemical investigation of this plant is underway. It is hoped that this information could assemble the chemotaxonomical and
pharmacognostical significance of the underutilized Pandanus species. Finally, this microscopic screening could support the point that the crystals’ distinctiveness are
probably under the plant genetic control.
ACKNOWLEDGEMENT
We would like to thank Ministry of Higher Education (MOHE) and UiTM for the support.
REFERENCES
Ariffin, S. A., Mohsin, H. F., Eshak, Z. and Abdul Wahab, I. (2012). Crystalline Calcium Oxalate in Pandanus Odoratissimus.International Journal on Advanced Science
Engineering Information Technology, 2 (4), pg. 24 – 26.
Baran, E. J., González-Baró, A. C., Ciciarelli, M. M. andRolleri, C. H. (2010).Characterization of biominerals in species of Canna (Cannaceae).Biol. Trop. (Int. J. Trop.
Biol.), 58 (4), 1507-1515.
Crowther, A. (2009a). Re-viewing raphides: Issues with the identification and interpretation of calcium oxalate crystals in microfossil assemblages, in A. Fairbairn and S.
O’Connor (eds), Proceedings of the 2005 Australasian Archaeometry Conference, Terra Australis, 28, 105 – 118, published by ANUE Press, The Australian National
University, Canberra, Australia.
Crowther, A. (2009b). Morphometric analysis of calcium oxalate raphides and assessment of their taxonomic value for archaeological microfossil studies, in
Archaeological Science under a Microscope [Electronic Resource]: Studies in Residue and Ancient DNA Analysis in Honour of Thomas H. Loy / editors, Michael
Haslam [et al.]. Terra Australis, 30, 102 – 128, published by ANUE Press, The Australian National University, Canberra, Australia.
Monje, P. V. and Baran, E. J. (2002). Characterization of Calcium Oxalates Generated as Biominerals in Cacti. Plant Physiology, 128, 707–713.
Prychid, C. J. andRudall, P. J. (1999).Calcium Oxalate Crystals in Monocotyledons: A Review of their Structure and Systematics. Annals of Botany, 84, 725-739.
Richter, H. G. and Schmitt, U. (1987).Unusual Crystal Formations in the Secondary Xylem of CosmocalyxSpectabilisStandl.(Rubiaceae).IAWA Bulletin, 8 (4), 323 – 329.
84 | MGC10
terWelle, B. J. H. and Mennega, A. M. W. (1977). On The Presence Of Large Styloids In The Secondary Xylem Of The Genus Henriettea (Melastomataceae). IAWA
Bulletin, 2, 31-35.
Webb, M. A. (1999). Cell-Mediated Crystallization of Calcium Oxalate in Plants.Plant Cell, 11, 751-761.
85 | MGC10
ID 004
Improvement of Simple Mismatch Primers to Differentiate between HGGT Gene of Elaeis guineensis and Elaeis oleifera at
the Promoter Region by PCR
Mas Muniroh Mohd Nadzir1, *Siti Nor Akmar Abdullah1,2, Adriaan (W)Van Heusden3
1. Department of Agriculture Technology, Faculty of Agriculture,Universiti Putra Malaysia
2. Laboratory of Plantation Crops, Institute of Tropical Agriculture, 43300 Universiti Putra Malaysia
3. Wageningen University and Research Centre
Email: snaa[email protected]
ABSTRACT:
Palm oil contains the highest tocotrienol content as compared to other oil crops. The enzyme involves in catalyzing the first important step of tocotrienol biosynthesis is
homogentisategeranylgeranyltransferase (HGGT). Two important oil palm species, the African oil palm (Elaeis guineensis Jacq.) and Latin American oil palm (Elaies
oleifera Cortez), reveal high variability in tocotrienol content and thus HGGT gene is a potential candidate for marker development for nutrient rich oil. One of the fastest
and cheapest ways to develop marker and fingerprint is by using Allele-Specific PCR (AS-PCR). In AS-PCR a single mismatch nucleotide is introduced right before the
single nucleotide polymorphism (SNP) site for better specificity; however, three possible mismatches can be produced and each of them will produce different result.
Which nucleotide to use for better specificity is still in question. In this study, molecular marker using simple mismatch primer method was designed at the SNP located
at the promoter region of the oil palm HGGT gene which is specific to E. guineensis and E. oleifera species. Two types of primers were designed with different
penultimate base pairing and destabilization strength. Both primer sets were tested on 37 of E. guineensis accessions and 37 E. oleifera accessions, and analysis was
done based on banding patterns produced on the agarose gel. The result shows that primer set with guanine (G) mismatch (132GFG and 132GFO) produced bands when
tested on both species whereas primer set with cytosine (C) mismatch (132CFG and 132CFO) only produced bands at specific species thus showing the highest
specificity to discriminate the HGGT gene between the two species. This finding is beneficial for developing simple and cost-effective markers in crop improvement for
marker assisted selection.
Introduction
Tocotrienols are member of the vitamin E family and discriminated from tocopherols by their unsaturated isoprenoid side chain (Theriault et al. 1999). They are present in
a limited number of plant species and vegetable oils, and palm oil contains higher amount of tocotrienolsthan other vegetable oils (Sundram et al. 2003; Sen et al.
2007; Ghanegaonkar et al. 2012). Recently, many studies have shown the beneficial health effects of tocotrienols compared to tocopherols. Tocotrienols promote
apoptosis and hinder generation of cancer cells (Aggarwal et al. 2010), inhibit tumor growth (Patel et al. 2011), acquire neuroprotective, anticancer, cholesterol lowering
property and anti-inflammatory activity (Sen et al. 2007; Aggarwal et al. 2010). The beneficial effects of tocotrienols on humans demonstrate the importance of in depth
study of the gene responsible with tocotrienol production.
Homogentisate geranylgeranyl transferase (HGGT) catalyzes the first committed step in the tocotrienol biosynthesis. HGGT decarboxylates and condensates prenyl group,
geranylgeranyldiphosphate (GGDP), to homogentisate (HGA) and produces 2-methyl-6-geranylgeranyl-benzoquinol (Hunter and Cahoon 2007). The importance of HGGT
gene for tocotrienol production was demonstrated by Cahoon et al. (2003)when transgenic Arabidopsis thaliana transformed with HGGT gene from barley induced
tocotrienols production resulting ina 15 fold increase in the total vitamin E in the transformed plant leaves. Tocotrienolwere not present in the leaves of non-transformed
plants. Besides transformation, gene manipulation using molecular marker approach is a fast and sustainable way to detect plants with high tocotrienol content and
could be used for crop improvement.
Allele-specific primer-polymerase chain reaction (ASP-PCR) using the mismatch primer method is a fast, cost-effective method for the detection of SNPs (Muneta et al.
2012). Mismatch primers simplify and speed up the process of screening for SNPs in genetic materials as it only uses PCR method without any involvement of restriction
enzymes (Nakamura et al. 2007; Muneta et al. 2012). However, which nucleotide gives the best specificity is still in question as there are three possible nucleotide
mismatches and each of them give different results based on their destabilization strength. In this study, mismatch primer method was designed at the SNP located at
the promoter region of the oil palm HGGT gene which is specific to E. guineensisand E. oleiferaspecies. Two types of primers were designed with different penultimate
base pairing and destabilization strength based on Liu et al. (2012) and Bui and Liu (2009) previous reports. Mismatch primers with the best specificity was successfully
developed and could be used to differentiate the HGGT gene the both species.
86 | MGC10
Materials and Method
Plant material and DNA isolation.
Spear leaves and first leaves of 37 E. guineensis accessions and 37 E. oleifera accessions were collected from MPOB Research Station, Kluang, Johor. Genomic DNA
was extracted using the modified CTAB method by Doyle and Doyle (1990).
Primer design
Mismatch primers were designed based on the SNP locations that differentiate between E. guineensis and E. oleiferaat the HGGT promoter region. Forward primers were
designed 18 to 23 nucleotides in length ending with the SNP location, and a single nucleotide mismatch was introduced replacing the original nucleotide right before the
polymorphic nucleotide. Two different forward primers were designed one for each species ending with the SNP location. A single reverse primer was designed using
Primer3 software (http://frodo.wi.mit.edu/) to be used with both primers. Primers were chosen according to the following parameters; (i) length between 18 mer to 30
mer (optimal 25 mer), (ii) melting temperature (Tm) between 50 °C to 70 °C (optimal Tm 60 °C) if applicable, (iii) G+C content between 40 to 70% (optimal 50 %) if
applicable, and product size range between 100 bp to 250 bp .
PCR reaction
PCR reaction was set up in a final volume of 25 µl by adding 12.5 µl of DreamTaq DNA Polymerase (Thermo Scientific, USA)(5 U/ul), 1 µl of forward primer (10 µM), 1 µl
of reverse primer (10 µM) and 1 µl of genomic DNA added to the PCR reaction. The reaction was heated at 94 °C for 5 min followed by amplification for 35 cycles at 94
°C for 45 seconds and annealing temperature of 58°C for 45 seconds and the extension at 72 °C for 1 minute followed by a final extension at 72 °C for 10 minutes.
Forward primers used were 132GFG and 132GFO with guanine (G) mismatch and 132CFG and 132CFO with cytosine (C) mismatch. All of these forward primers were
paired with the common reverse primer 132R 37 and they were tested against E. guineensis accessions and 37 E. oleifera accessions. PCR products were separated on
a 1 % (w/v) agarose gel at 80 v and 80 min to check for the specificity of the primers. The two mismatch primers were tested on the two species, and analysis of the
primer specificity was done based on the banding pattern shown on the gel.
Results and Discussion
When primers 132GFG and 132GFO were tested on E. guineensis and E. oleifera templates, respectively, clear single bands were produced (Fig. 2 and Fig. 3). When
primer 132GFG was tested against E. oleifera templates; however, faint bands were produced (Fig. 2) and the same occurred when primer 132GFO against E.
guineensis templates. This shows that the nucleotide mismatch does not give high specificity to discriminate the species at the SNP location. The terminal mismatches
(TG, CA) have weak destabilizing strength, thus it requires penultimate with strong destabilization strength (Fig. 1). However, the base pairing TG at the penultimate site
has weak destabilizing strength as well thus resulted the faint bands (Liu et al. 2012).
Figure 1: Illustration of the development of E. guineensis and E. oleifera mismatch primers. The species sequences are shown on top with the terminal
ending bolded and underlined. (1) The 132GFG and 132CFG primers are designed complementary to the E. guineensis template with the exception of the
penultimate nucleotide indicated with
with the G/C before the terminal ending. (2) 132GFO and 132CFO primers are designed complementary to the E. oleifera
template as (1). (3) Both E. oleifera primers paired against E. guineensis template and the terminal mismatch (TG) is indicated in the bracket.
bracket. (4) The same
thing repeated with both E. guineensis primers tested against E. oleifera template to determine the terminal mismatch (CA).
87 | MGC10
Figure 2:i) and ii)Primer pair 132GFG and 132R tested against 37 E. guineensis accession templates. iii) and iv) Primer pair 132GFG and 132R tested against
37 E. oleifera accession templates.
Figure 3: i) and ii) Primer pair 132GFO and 132R tested against 37 E. guineensis accession templates. iii) and iv) Primer pair 132GFO and 132R tested
against 37 E. oleifera
oleifera accession templates.
Base pairings that produce maximum destabilizing strength with thymine are cytosine (CT) and thymine (TT) (Bui and Liu 2009). When the experiment was repeated
using primers 132CFG and 132CFO on E. guineensis and E. oleifera templates, respectively, clear single bands were produced (Fig. 4 and Fig. 5). Furthermore, when
primer 132CFG against E. oleifera templates and primer 132CFO against E. oleifera templates were used, no bands were produced. The primer sets have higher
specificity in discriminating the HGGT gene of the species compared to the previous ones. This finding shows that simple mismatch primer method can be used to
discriminate SNP and will be beneficial for marker assisted selection. However, the development of the primers has to be based on several conditions like the primer
length, the G/C content, the destabilization strength of the terminal and penultimate, and the annealing temperature to get the desirable products. From our experience,
mismatch primer can be designed at the AT-rich region, thus makes it more advantageous than other markers. Furthermore, E. oleifera has low oil yield but higher
vitamin E (700-1500 ppm) as compared to E. guineensis (600 – 1600 ppm) (Jalani et al. 1997), thus the development of this marker could be beneficial for marker
assisted selection in the future.
88 | MGC10
Figure 4: i) and ii) Primer pair 132CFG and 132R tested against 37 E. guineensis accession templates. iii) and iv) Primer pair 132CFG and 132R tested
against 37 E. oleifera accession templates.
Figure 5: i) and ii) Primer pair 132CFO and 132R tested against 37 E. guineensis accession templates. iii) and iv) Primer pair 132CFO and 132R tested
against 37 E. oleifera accession templates.
Conclusion
Simple mismatch primer is a cost-effective, fast, reproducible, and reliable method for SNP fingerprinting. It has several advantages over other markers and can be used
for high-throughput applications and for large scale screening. This is the first study that shows the application of simple mismatch primer to detect and discriminate
SNP at the promoter region of the gene.
Acknowledgement
We thank the Malaysian Palm Oil Board (MPOB) for providing the oilpalm germplasm materials as well as the HPLC data of the vitamin E content of the E. guineensis
individuals. Special thanks go to MarhalilMarjuni from MPOB with your assistance while getting the samples and information.
89 | MGC10
References
Aggarwal BB, Sundaram C, Prasad S, Kannappan R (2010) Tocotrienols, the vitamin E of the 21st century: its potential against cancer and other chronic diseases.
Biochemical pharmacology 80 (11):1613-1631
Bui M, Liu Z (2009) Simple allele-discriminating PCR for cost-effective and rapid genotyping and mapping. Plant Methods 5 (1):1
Cahoon EB, Hall SE, Ripp KG, Ganzke TS, Hitz WD, Coughlan SJ (2003) Metabolic redesign of vitamin E biosynthesis in plants for tocotrienol production and increased
antioxidant content. Nature Biotechnology 21 (9):1082-1087
Doyle JJ, Doyle JL (1990) Isolation of plant DNA from fresh tissue. Focus 12:13-15
Ghanegaonkar S, Conrad J, Beifuss U, Sprenger GA, Albermann C (2012) Towards the in vivo production of tocotrienol compounds: Engineering of a plasmid-free
Escherichia coli strain for the heterologous synthesis of 2-methyl-6-geranylgeranyl-benzoquinol. Journal of Biotechnology 164 (2):238-247.
doi:10.1016/j.jbiotec.2012.08.010
Hunter SC, Cahoon EB (2007) Enhancing vitamin E in oilseeds: unraveling tocopherol and tocotrienol biosynthesis. Lipids 42 (2):97-108
Jalani BS, Cheah SC, Rajanaidu N, Darus A Improvement of palm oil through breeding and biotechnology. In: 88th American Oil Chemists Society (AOCS) Annual Meeting
and Expo, Seattle, Washington, WA, USA, May 11 – 14 1997.
Liu J, Huang S, Sun M, Liu S, Liu Y, Wang W, Zhang X, Wang H, Hua W (2012) An improved allele-specific PCR primer design method for SNP marker analysis and its
application. Plant Methods 8 (1):34
Muneta Y, Minagawa Y, Kusumoto M, Shinkai H, Uenishi H, Splichal I (2012) Development of allele-specific primer PCR for a swine TLR2 SNP and Comparison of the
frequency among several pig breeds of Japan and the Czech Republic. Journal of Veterinary Medical Science 74 (5):553-559
Nakamura A, Furuta T, Shirai N, Sugimoto M, Kajimura M, Soya Y, Hishida A (2007) Determination of mutations of the 23S rRNA gene of Helicobacter pylori by allele
specific primer‐polymerase chain reaction method. Journal of gastroenterology and hepatology 22 (7):1057-1063
Patel V, Rink C, Khanna S, Sen CK (2011) Tocotrienols: The lesser known form of natural vitamin E.
Sen CK, Khanna S, Roy S (2007) Tocotrienols in health and disease: The other half of the natural vitamin E family. Molecular Aspects of Medicine 28 (5–6):692-728.
doi:10.1016/j.mam.2007.03.001
Sundram K, Sambanthamurthi R, Tan YA (2003) Palm fruit chemistry and nutrition. Asia Pacific Journal of Clinical Nutrition 12 (3):355-362
Theriault A, Chao J-T, Wang Q, Gapor A, Adeli K (1999) Tocotrienol: a review of its therapeutic potential. Clinical Biochemistry 32 (5):309-319. doi:10.1016/s00099120(99)00027-2
90 | MGC10
ID 006
Comparative Genomic Approach for Identifying Novel Imprinted Genes Involved in the Nasopharyngeal Cancer Pathogenesis
Ashley E.
E.R. Soosay
Department of Paraclinical Sciences, Faculty of Medicine & Health Sciences, Universiti Malaysia Sarawak
Email: [email protected]
ABSTRACT:
Genomic imprinting is an epigenetic chromosomal modification that enables parent-of-origin allele specific gene expression. Deregulation of imprinted genes leads to the
genesis of cancer and genetic disorders. Nasopharyngeal carcinoma (NPC) is common in southern Asia. Epstein-Barr virus has been implicated with NPC. Environmental
factors such as dietary consumption of salted food and genetic susceptibility play pivotal roles in NPC pathogenesis. Juxtapositioning data from reported NPC
genetic/cytogenetic studies and known/predicted human imprinted genes has identified genes which may be involved in NPC pathogenesis. Our screening has identified
chromosome 14q32 as a pertinent region for NPC pathogenesis. A well defined imprinted domain DLK1-DIO3 is located within chromosome 14q32. This region contains
53 microRNAs and 38 C/D-box small nucleolar RNAs. Small regulatory RNAs controlled by genomic imprinting have been implicated in cancer. Retrotransposon-like 1
(Rtl1) located within this region is a retrotransposon-derived imprinted gene implicated in hepatocarcinogenesis. Therefore, characterization and analysis of imprinted
segment on 14q32 will elucidate the biological role of the imprinted microRNAs and genes. Our novel screening approach has successfully identified an imprinted
domain on chromosome 14q32 which may be involved in the genesis of NPC.
Introduction
Nasopharyngeal carcinoma (NPC) is the fourth most common cancer among Malaysian and the third most common cancer among males in Malaysia. Nasopharyngeal
cancer exhibits a strong male preponderance. The Chinese were found to have a higher incidence rate compared to other races. The age-standardized rate for Chinese
males is 10.9 cases per 100,000, followed by Chinese females with 3.5, Malay males with 3.0 and Indian males with 1.1 (Omar & Tamin, 2011). Sarawak is the only
state in Malaysia where the NPC is the most common cancer among males and the fifth most common cancer among females. This unusual pattern of incidence
compared to other states in Malaysia may be attributed by the high incidence of NPC among a distinct ethnic group known as the native Bidayuh(Devi, Pisani, Tang, &
Parkin, 2004). The age-standardized rate for Bidayuh males is 143.3 cases per 100,000 and the Bidayuh females is 111.4 cases per 100,000. However, the prevalence
of NPC among the Chinese in Sarawak is still high with the age-standardized rate of 115.4 cases per 100,000 in Chinese males and 103 cases per 100,000 for Chinese
females. NPC is a squamous-cell carcinoma arising from the epithelial cells of the nasopharynx(Zhou et al., 2007). NPC is endemic in many geographical regions,
including Southern China and South East Asia.
NPC is a complex disease caused by a multistep carcinogenesis process involving the oncogenic gamma-herpes virus Epstein-Barr virus (EBV) chronic infection (Daker et
al., 2008), genetic susceptibility and environmental factors. Environmental factors in the form of carcinogens such as polycyclic hydrocarbons, nitrosamines and
ingestion of food high in salts contribute to the genesis of cancer of nasopharynx(Yoshizaki et al., 2011; Zhou et al., 2007). In Malaysia the incidence of nasopharyngeal
cancer increases with age. The peak age-specific incidence rate was in the 65-75 age groups. The majority of nasopharyngeal cancer was detected at stage III (33.3%)
and IV (32.3). The percentage of the cancer detected at stage I and II was 34.4% (Omar & Tamin, 2011). Therefore, screening for NPC may be useful for early detection
of the cancer.
Chromosomal abnormality powers the proliferation of tumour cells. Studies have demonstrated a high frequency of allele loss at chromosome 1, 3, 9, 11, 12 and 14
(Zhou et al., 2007). Aneuploidy is a common feature of epithelial cancers (Thiagalingam et al., 2001). Loss of part of chromosome either the terminal or interstitial
deletion is a ubiquitous characteristic of tumorigenic cells. One of the pivotal reasons for these types of abnormality to occur in tumour cell is because of the advantage it
renders to the proliferating cell (Pavelka et al., 2010). If tumour suppressor genes are present anywhere within the lost regions of chromosomes, it will be deleted from
the cell and if the remaining allele is either genetically or epigenetically inactivated then the cell will be completely void of the tumour suppressor gene. This will lead to
abnormal growth control (Jones & Laird, 1999; Knudson, 1978). On the other hand, losses and gains of chromosomal regions may have the capacity to alter patterns of
gene expression. These alterations may contribute to the hallmarks of cancer including self sufficiency in proliferative signals, insensitivity to growth suppressors,
resisting apoptosis, inducing angiogenesis, limitless replicative potential and activating tissue evasion & metastasis (Hanahan & Weinberg, 2000, 2008). Chromosome
losses and gains are driven by a chromosomal instability that persists throughout the lifetime of tumour cells (Thiagalingam et al., 2001).
The hunt for putative tumour suppressor genes (TSGs) for NPC have located few candidates and they exhibit tumour-specific promoter methylation. These candidates are
BLU and RASSF1A at 3p21, CADM1/TSLC1 at 11q23.1, THY1/CD90 at 11q22.3, CDH1 at 16q22.1, RASAL1, ADAMTS18 and CDH13 at 16q23 (Cui et al., 2008).
These limited findings suggest that additional candidate TSGs are yet to be identified for NPC. Using reported loss of heterozygosity, homozygous deletion, microcell
mediated chromosome transfer data and other genetic/cytogenetic data, the present study aims to identify a region of interest that may harbour a putative genomically
imprinted gene pertinent to the pathogenesis of NPC.
91 | MGC10
Genomic imprinting is an epigenetic chromosomal modification that enables an allele specific gene expression (monoallelic expression). In a normal person, on an
imprinted locus, only one allele is actively transcribed and expressed. The other allele is epigenetically silenced (Hamed, Ismael, Paulsen, & Helms, 2012). The copy that
is silenced is dependent on parent-of-origin. If a gene is maternally imprinted then the maternal allele is silenced and the paternal copy is active. A paternally imprinted
gene refers to the silencing of the paternal allele and activation of the maternal copy. This regulation of proper parent-of-origin gene expression can be abnormal in some
cancers due to epigenetic modifications. This abnormality in some cancers may lead to loss of imprinting (LOI). LOI is the loss of monoallelic expression, resulting in
either biallelic expression or silencing of imprinted genes. Genomic imprinting is a normal process in a normal individual but deregulation of imprinted genes may lead to
genesis of cancer and genetic disorders (Benetatos, Hatzimichael et al., 2012; Benetatos, Voulgaris, & Vartholomatos, 2012; Feinberg & Tycko, 2004; Girardot, Cavaille,
& Feil, 2012). Parent-of-origin effect is found in complex conditions such as Alzheimer disease, autism, bipolar disorder, diabetes, male sexual orientation, obesity,
schizophrenia and cancer, which indicates that imprinted genes, may be involved in their aetiology(Wilkins & Haig, 2003).
This study aims to identify novel human imprinted genes which may be involved in NPC pathogenesis, by using comparative genomics and functional genomics
approaches. The objectives of the study are to identify the region of interest pertinent for nasopharyngeal carcinoma on the human genome through analysis of reported
genetic/cytogenetic data and to investigate the presence of putative imprinted genes in the identified region of interest through comparative genomic analysis using
syntenic approach. This study has successfully identified one region on human chromosome 14q by using this approach. There are potential candidate genes in this
region that may be involved in NPC. This method has the potential to identify other chromosomal hotspots for NPC in order to identify imprinted genes pertinent to NPC
pathogenesis.
Materials & Methods
Identification of region of interest on human genome pertinent to NPC
Published data on genetic and cytogenetic analysis of NPC was re-analysed to identify critical chromosomal region pertinent to NPC (Mutirangura, 1998; Shao, 2002 and
Cheung, 2009). These reported genetic and cytogenetic data facilitated the identification of the region of interest on the human genome (Cui et al., 2008). For this
purpose www.ncbi.nlm.nih.gov was used extensively.
LOH and genomic imprinting genes database
The region of interest on the human genome pertinent to NPC was amalgamated with genomic imprinting genes database. Geneimprint.com database and several
published articles were used extensively as sources for genomic imprinting genes database. The published articles are Nikaido, et. al., 2003; Luedi, et. Al., 2005; Luedi,
et. al., 2007 and Silva-Santiago, et. al., 2012.
Physical map construction
The database at http://www.geneimprint.com/site/genes-by-species, and Ensembl database (http://asia.ensembl.org/index.html) were referred to form a physical map of
the region of interest using Sequencher 5.1 software. Polymorphic microsatellite markers (PMSM) were verified from UniSTS database
(http://www.ncbi.nlm.nih.gov//unists/). Genomic DNA sequence was downloaded from the Ensembl database and imported into Sequencher 5.1.
Results
The comparative genomic approach to identify imprinted genes involved in NPC has been a successful endeavour. The analysis of the human genome has located many
hotspots for NPC. Using previously published data on allelic imbalance, microcell mediated chromosome transfer and homozygous deletion mapping; this study has
located several regions on the human chromosome that may harbour genes pertinent to genesis of NPC.
In particular, the analysis of the human chromosome 14 shows that chromosome 14q harbours high allelic imbalance. PMSMs at human chromosome 14q32 were
frequently lost in loss of heterozygosity analysis. Table 1 shows the PMSM that were frequently lost at chromosomal segment 14q32.
Using comparative genomic analysis human chromosome 14q32 is found to be syntenic to a segment of chromosome 12F1 of the mouse genome. Within this segment
of the chromosome 12 on the mouse genome there is a well-defined imprinted region known as Dlk1-Dio3. Table 2 shows the relevant genes that are putatively
imprinted at chromosomal segment 14q32. Figure 1 shows the physical map indicating the position of the PMSM and the pertinent genomically imprinted genes at
14q32. All PMSMs were correctly placed on the physical map. All alignments showed 100 % alignment.
Discussion
Loss of heterozygosity study on human autosomes using NPC samples have revealed that chromosome arms 1p, 2p, 3p, 3q, 4q, 5q, 8p, 9p, 9q, 11p, 11q, 13q, 14q
and 19q to harbour high allelic loss (Mutirangura, 1998; Shao, 2000; Shao, 2001; Shao, 2002 and Cheung, 2009). Among these high allelic imbalance regions, only
chromosome 3, 9 and 11 involve both arms of the chromosomes. Chromosomal segment 14q is one of the few regions where there is more than one minimal allelic loss
region reported (Mutirangura, 1998; Shao, 2000; Shao, 2001; Shao, 2002 and Cheung, 2009).
92 | MGC10
LOH at chromosome 14q32 has been shown to be related to the development of several forms of cancer, including meningioma (Zhang, 2010), renal-cell carcinoma
(Alimov, 2004), neuroblastoma (Gattolliat, 2011), gastrointestinal tumour (Dai, 2005), hepatocellular carcinoma (Luk, 2011), osteosarcoma (Kelly, 2013), uterine
carcinosarcoma (Devor, 2012), melanoma (Zehavi, 2012) and ovarian tumour (O’Connell, 1999).
Chromosomal deletion fine mapping of 14q delineates four critical regions pertinent to NPC at 14q11.2-q12, 14q12-q13, 14q23-24.3, 14q32 (Mutirangura, 1998;
Shao, 2002; Cheng, 2003; Dodd, 2006; Cheung, 2009; Cheung, 2011 and Huang, 2012). The role of imprinted genes in cancer (Lobo, 2008; Lee, 2012; Girardot,
2012 and Zhou, 2010) and chromosomal aberration such as LOH a common genetic alteration in epithelial solid tumours are well established. Genomic imprinting is an
exception to Mendelian genetics in that imprinted genes are expressed monoallelically (Hagan, 2009). Therefore genomically imprinted gene has only one actively
transcribed allele. If chromosomal aberration destroys the actively transcribed allele, the cell will be void of the genomic imprinted transcript. This inherent property of
imprinted genes makes them vulnerable and may involve in the genesis of tumour cells.
This study illustrates the power of data mining in combining the published results on genetic/cytogenetic data on allelic imbalance study with genomic imprinting gene
database. Among the four critical regions on chromosome 14 chromosomal segment 14q32 is of interest due to the presence of an imprinted domain DLK1-DIO3.
DLK1-DIO3 is an imprinted domain in human (Zhao, 2010; da Rocha, 2008). This domain contains three imprinted protein-coding genes, DLK1, RTL1 and DIO3. These
three genes are expressed from the paternally inherited chromosome.The DLK1-DIO3 domain also contains a noncoding RNA, Maternally Expressed Gene 3
(MEG3)/Glycosyltransferase type 2 (GTL2) which is exclusively expressed from maternal allele. Interestingly, the noncoding RNA gene contains microRNAs and/or small
nuclear RNAs within its introns. MEG3/GTL2 is implicated in many cancers (Zehavi, 2012). In total this imprinted domain at chromosome 14q32 contains 53 microRNAs
and 38 C/D-box small nucleolar RNAs (Girardot, 2012).
Expression of imprinted genes can go awry in cancer by many different mechanisms. These alterations could include changes in the germ line, aberration in the
imprinted domain, modifications around the imprinted gene and loss of maintenance of normal imprinting (Feinberg, 1999). Separation in the germ line of an imprinted
gene from an imprinting control center will render the cell loss of parent of origin expression. Aberrations in the imprinting domain may include alterations in a cis-acting
at distant regulatory sequence and alterations of locally cis-acting regulatory sequences, such as DNA methylation and histone modifications. Modifications around the
imprinted gene such as physical changes in or near the sequence of a gene itself will render it nonimprintable. Loss of development and tissue-specific trans-acting
modifiers, such as transcription factors that maintain normal imprinting in cells, may alter the parent of origin expression.
The juxtapositioning of the allelic imbalance data with the genomic imprinted genes data has enabled us to implicate chromosomal segment 14q32 in NPC. This work
has narrowed down the candidate areas for further studies. This novel method described may augment the discovery of pertinent genomic imprinted genes involved in
the pathogenesis of NPC. In conclusion this study provides supporting evidence that allelic imbalance at chromosomal segment 14q32 and the presence of imprinted
domain within this region indicates that this locus may play a vital role in the genesis of NPC.
Acknowledgement
This work was funded by Faculty of Medicine & Health Sciences, Universiti Malaysia Sarawak (UNIMAS).
References
Alimov, A., Sundelin, B., Wang, N., Larsson, C., &Bergerheim, U. (2004). Loss of 14q31-q32.2 in renal cell carcinoma is associated with high malignancy grade and
poor survival. Int J Oncol, 25(1), 179-185.
Benetatos, L., Hatzimichael, E., Londin, E., Vartholomatos, G., Loher, P., Rigoutsos, I., et al. (2012). The microRNAs within the DLK1-DIO3 genomic region: involvement
in disease pathogenesis. Cell Mol Life Sci.
Benetatos, L., Voulgaris, E., &Vartholomatos, G. (2012). DLK1-MEG3 imprinted domain microRNAs in cancer biology. Crit Rev Eukaryot Gene Expr, 22(1), 1-15.
Cheng, Y., Ko, J. M., Lung, H. L., Lo, P. H., Stanbridge, E. J., & Lung, M. L. (2003). Monochromosome transfer provides functional evidence for growth-suppressive
genes on chromosome 14 in nasopharyngeal carcinoma. Genes Chromosomes Cancer, 37(4), 359-368.
Cheung, A. K., Ko, J. M., Lung, H. L., Chan, K. W., Stanbridge, E. J., Zabarovsky, E., et al. (2011). Cysteine-rich intestinal protein 2 (CRIP2) acts as a repressor of NFkappaB-mediated proangiogenic cytokine transcription to suppress tumorigenesis and angiogenesis.ProcNatlAcadSci U S A, 108(20), 8390-8395.
Cheung, A. K., Lung, H. L., Ko, J. M., Cheng, Y., Stanbridge, E. J., Zabarovsky, E. R., et al. (2009). Chromosome 14 transfer and functional studies identify a candidate
tumor suppressor gene, mirror image polydactyly 1, in nasopharyngeal carcinoma. ProcNatlAcadSci U S A, 106(34), 14478-14483.
Cui, Y., Ying, Y., van Hasselt, A., Ng, K. M., Yu, J., Zhang, Q., et al. (2008). OPCML is a broad tumor suppressor for multiple carcinomas and lymphomas with frequently
epigenetic inactivation. PLoS One, 3(8), e2990.
da Rocha, S. T., Edwards, C. A., Ito, M., Ogata, T., & Ferguson-Smith, A. C. (2008). Genomic imprinting at the mammalian Dlk1-Dio3 domain. Trends Genet, 24(6),
306-316.
Dai, Y. C., Ho, C. L., Tsai, Y. C., Hsu, Y. H., Chang, Y. C., Liu, H. S., et al. (2005). Allelic loss of 14q32 in the pathogenesis of gastrointestinal and ampullary
malignancies: mapping of the target region to a 17 cM interval. J Cancer Res ClinOncol, 131(2), 94-100.
Daker, M., Bhuvanendran, S., Ahmad, M., Takada, K., &Khoo, A. S. (2008). Deregulation of lipid metabolism pathway genes in nasopharyngeal carcinoma cells. Mol
Med Report.
93 | MGC10
Devi, B.C., Pisani, P., Tang, T.S., &Parkin, D.M. (2004).High incidence of nasopharyngeal carcinoma in native people of Sarawak, Borneo Island. Cancer Epidemiol
Biomarkers Prev, 13(3), 482-486.
Devor, E. J., JN, D. E. M., Ramachandran, S., Goodheart, M. J., & Leslie, K. K. (2012). Global dysregulation of the chromosome 14q32 imprinted region in uterine
carcinosarcoma. ExpTher Med, 3(4), 677-682.
Dodd, L. E., Sengupta, S., Chen, I. H., den Boon, J. A., Cheng, Y. J., Westra, W., et al. (2006). Genes involved in DNA repair and nitrosamine metabolism and those
located on chromosome 14q32 are dysregulated in nasopharyngeal carcinoma. Cancer Epidemiol Biomarkers Prev, 15(11), 2216-2225.
Feinberg, A. P., &Tycko, B. (2004).The history of cancer epigenetics. Nat Rev Cancer, 4(2), 143-153.
Feinberg, A.P. (1999). Imprinting of a genomic domain of 11p15 and loss of imprinting in cancer: an introduction. Cancer Res, 59(7 Suppl), 1743s-1746s.
Gattolliat, C. H., Thomas, L., Ciafre, S. A., Meurice, G., Le Teuff, G., Job, B., et al. (2011). Expression of miR-487b and miR-410 encoded by 14q32.31 locus is a
prognostic marker in neuroblastoma. Br J Cancer, 105(9), 1352-1361.
Girardot, M., Cavaille, J., &Feil, R. (2012). Small regulatory RNAs controlled by genomic imprinting and their contribution to human disease. Epigenetics, 7(12), 13411348.
Hagan, J. P., O'Neill, B. L., Stewart, C. L., Kozlov, S. V., & Croce, C. M. (2009). At least ten genes define the imprinted Dlk1-Dio3 cluster on mouse chromosome 12qF1.
PLoS One, 4(2), e4352.
Hamed, M., Ismael, S., Paulsen, M., & Helms, V. (2012). Cellular functions of genetically imprinted genes in human and mouse as annotated in the gene ontology. PLoS
One, 7(11), e50285.
Hanahan, D., & Weinberg, R. A. (2000).The hallmarks of cancer. Cell, 100(1), 57-70.
Hanahan, D., & Weinberg, R. A. (2008). Hallmarks of cancer: the next generation. Cell, 144(5), 646-674.
Huang, B., Zhang, L., Yan, J., Liang, Q., & Fang, Y. (2001).[Fine mapping of the loss of heterozygosity for chromosome 1pter-p36.11 in nasopharyngeal
carcinoma].Zhonghua Bing Li XueZaZhi, 30(2), 110-113.
Jones, P. A., & Laird, P. W. (1999). Cancer epigenetics comes of age. Nat Genet, 21(2), 163-167.
Kelly, A. D., Haibe-Kains, B., Janeway, K. A., Hill, K. E., Howe, E., Goldsmith, J., et al. (2013). MicroRNA paraffin-based studies in osteosarcoma reveal reproducible
independent prognostic profiles at 14q32. Genome Med, 5(1), 2.
Knudson, A.G., Jr. (1978). Retinoblastoma: a prototypic hereditary neoplasm. SeminOncol, 5(1), 57-60.
Lee, J. T. (1435). Epigenetic regulation by long noncoding RNAs. Science, 338(6113), 1435-1439.
Lobo, I. (2008).Genomic imprinting and patters of disease inheritance. Nature Education., 1(1).
Luk, J. M., Burchard, J., Zhang, C., Liu, A. M., Wong, K. F., Shek, F. H., et al. (2011). DLK1-DIO3 genomic imprinted microRNA cluster at 14q32.2 defines a stemlike
subtype of hepatocellular carcinoma associated with poor survival. J BiolChem, 286(35), 30706-30713.
Luedi, P.P., Hartemink, A.J., &Jirtle, R.L. (2005).Genome-wide prediction of imprinted murine genes. Genome Res, 15(6), 875-884.
Luedi, P.P., Dietrich, F.S., Weidman, J.R., Bosko, J.M., Jirtle, R.L., &Hartemink, A.J. (2007).Computational and experimental identification of novel human imprinted
genes. Genome Res, 17(12), 1723-1730.
Mutirangura, A., Pornthanakasem, W., Sriuranpong, V., Supiyaphun, P., &Voravud, N. (1998). Loss of heterozygosity on chromosome 14 in nasopharyngeal
carcinoma.Int J Cancer, 78(2), 153-156.
Nikaido, I., Saito, C., Mizuno, Y., Meguro, M., Bono, H., Kadomura, M. (2003).Discovery of imprinted transcripts in the mouse transcriptome using large-scale expression
profiling. Genome Res, 13(6B), 1402-1409.
O'Connell, P., Fischbach, K., Hilsenbeck, S., Mohsin, S. K., Fuqua, S. A., Clark, G. M., et al. (1999). Loss of heterozygosity at D14S62 and metastatic potential of breast
cancer. J Natl Cancer Inst, 91(16), 1391-1397.
Omar, Z. A., &Tamin, N. S. I. (2011).NCR Report 2007, Ministry of Health, Malaysia.
Pavelka, N., Rancati, G., Zhu, J., Bradford, W. D., Saraf, A., Florens, L., et al. (2010). Aneuploidy confers quantitative proteome changes and phenotypic variation in
budding yeast. Nature, 468(7321), 321-325.
Shao, J., Li, Y., Wu, Q., Liang, X., Yu, X., Huang, L., et al. (2002). High frequency loss of heterozygosity on the long arms of chromosomes 13 and 14 in nasopharyngeal
carcinoma in Southern China. Chin Med J (Engl), 115(4), 571-575.
Shao, J. Y., Huang, X. M., Yu, X. J., Huang, L. X., Wu, Q. L., Xia, J. C., et al. (2001). Loss of heterozygosity and its correlation with clinical outcome and Epstein-Barr
virus infection in nasopharyngeal carcinoma.Anticancer Res, 21(4B), 3021-3029.
Shao, J. Y., Wang, H. Y., Huang, X. M., Feng, Q. S., Huang, P., Feng, B. J., et al. (2000). Genome-wide allelotype analysis of sporadic primary nasopharyngeal
carcinoma from southern China.Int J Oncol, 17(6), 1267-1275.
Silva-Santiago, S. C., Vasconcelos, E. J. R., Oliviera, D. M., Pacheco, A. C., Silva, M. F., Rocha, T. C. L., et. al. (2012). The human imprintomevl.O: Over 120 imprinted
genes in the human genome impose a major review on previous censuses, bibm, pp.1-5, 2012 IEEE International Conference on Bioinformatics and
Biomedicine, 2012
Thiagalingam, S., Laken, S., Willson, J. K., Markowitz, S. D., Kinzler, K. W., Vogelstein, B., et al. (2001). Mechanisms underlying losses of heterozygosity in human
colorectal cancers.ProcNatlAcadSci U S A, 98(5), 2698-2702.
Wilkins, J. F., & Haig, D. (2003). What good is genomic imprinting: the function of parent-specific gene expression. Nat Rev Genet, 4(5), 359-368.
Yoshizaki, T., Ito, M., Murono, S., Wakisaka, N., Kondo, S., & Endo, K. (2011).Current understanding and management of nasopharyngeal carcinoma.AurisNasus Larynx,
39(2), 137-144.
Zehavi, L., Avraham, R., Barzilai, A., Bar-Ilan, D., Navon, R., Sidi, Y., et al. (2012).Silencing of a large microRNA cluster on human chromosome 14q32 in melanoma:
biological effects of mir-376a and mir-376c on insulin growth factor 1 receptor.Mol Cancer, 11, 44.
94 | MGC10
Zhang, X., Gejman, R., Mahta, A., Zhong, Y., Rice, K. A., Zhou, Y., et al. (2010). Maternally expressed gene 3, an imprinted noncoding RNA gene, is associated with
meningioma pathogenesis and progression. Cancer Res, 70(6), 2350-2358.
Zhao, L. X., Zhao, G. P., & Zhou, H. M. (2010). [Review on the genomic imprinting at the mammalian DLK1-DIO3 cluster.]. Yi Chuan, 32(8), 769-778.
Zhou, X., Cui, J., Macias, V., Kajdacsy-Balla, A. A., Ye, H., Wang, J., et al. (2007).The progress on genetic analysis of nasopharyngeal carcinoma.CompFunct Genomics,
57513.
95 | MGC10
Table 1: Loss of Heterozygosity data for NPC tumours obtained from previously published results.
a
Mutirangura, 1998; b Shao, 2002 and c Leung, 2009.
Polymorphic
Microsatellite Marker
Chromosomal
Location
Marker
Type
LOH (%)
D14S51a
14q32
Intergenic
38
D14S65
14q32
Intragenic
37
14q32
Intergenic
58
D14S1426
14q32
Intergenic
47
c
D14S985
14q32
Intragenic
47
D14S985b
14q32
Intragenic
24
D14S1051c
14q32
Intragenic
67
b
D14S267a
c
Table 2: Imprinted genes located at human chromosome 14q32. Proof of the imprinting status is given in the discussion.
Chromosomal
Location
Imprinting
Status
Gene
Alternative name
RP11RP11359N5.1
-
14q32
Unknown
DEGS2
-
14q32
Unknown
DLK1
DLK, FA1, ZOG, pG2, PREF1, Pref-1
14q32
Paternal
MEG3
GTL2, FP504, prebp1, PRO0518, PRO2160, FLJ31163, FLJ42589
14q32
Maternal
RTL1
PEG11
14q32
Paternally
DIO3
D3, 5DIII, TXDI3, DIOIII
14q32
Unknown
96 | MGC10
Figure 1:
1 The segment of human chromosome 14q32 aligned toRP11-359N5.1, Delta(4)-desaturase, sphingolipid 2 (DEGS2), Delta-like 1 homolog (Drosophilla) (DLK1),
Maternally expressed gene 3 (non-protein coding) (MEG3),Retrotransposon-like 1 (RTL1) and Deiodinase, iodothyronine type III (DIO3) genes. The polymorphic
microsatellite markers (PMSM) D14S51, D14S65, D14267, D14S1426 and D14S985 corresponding forward and reverse primers are also shown in the diagram. All
gene and PMSM are indicated at the left of the diagram. The lower rectangle box indicates distance in bases. The diagram was generated via Sequencer 5.1.
97 | MGC10
ID 011
Fruit Quality Evaluation of Tissue CultureCulture-Derived Mangosteen (Garcinia
(Garcinia mangostana L.) at Kuala Kangsar, Perak.
Mohd Asrul, S.,
S., 1Sarip, J., 2, Mohd Shaib, J., 3
1Horticulture Research Centre, MARDI Station Bukit Tangga.
2Horticulture Research Centre, MARDI Headquarters
3Seed Unit, MARDI Headquarters
E-mail: [email protected]
ABSTRACT:
The fruit quality evaluation of tissue culture-derived mangosteen was done at MARDI Station Kuala Kangsar for 2012 fruiting season. Fruit quality characters such as fruit
weight, flesh weight, fruit diameter, fruit length, skin thickness, number of pulps, number of seeds and total soluble solids content were collected and analysed in
comparison with seed-derived mangosteen. Establishment of this research plot was completed in 1999 with four treatments in five replicates. The study showed that
there were highly significant differences (P<0.01) among all studied characters except for skin thickness, number of seeds and total soluble solids content. Tissue
culture-derived Mesta performed better than other treatments i.e. seed-derived mesta, tissue culture-derived mangosteen and seed-derived mangosteen. However,
further evaluation is needed to observe the existence of tree-to-tree variation.
INTRODUCTION
Mangosteen (Garcinia mangostana L.) has been hailed as ‘the queen of tropical fruits’ and also known as one of the tropical fruits that could reproduce the offspring
through apomictic process. Apomictic processes occur in the ovule without fertilization resulting in the progenies that are genetically the exact copies of female plant
(Mansyah E. et al. 2005). This lack of variation results in difficulty in producing outstanding varieties. With the exception of one tree growing along the road in UluKundor,
Kuala Linggi, Negeri Sembilan (Idris and Rukayah 1987), all known mangosteen trees in Malaysia are female. Under such circumstances, varietal improvement through
normal hybridization is practically not possible (Meloret al. 2008).
Te-chato (1998) reported there appear to be no distinct cultivars of mangosteen and there are no records of attempts being made to improve the cultivars. However,
Poerwantoet al. (2008) reported that elucidation of genetic variability in mangosteen population to improve mangosteen could be conducted through direct selection from
the field population. Indonesia has released a new mangosteen variety named Wayanasa through direct selection from Purwakarta Regency (Center for Tropical Fruit
Studies 2004). Malaysia in 1990s has registered, by Malaysia Department of Agriculture, two varieties of mangosteen namely GA1 and GA2. Both varieties were also
obtained from direct selection from the field.
Mangosteen is already a crop of exquisite flavour and beauty, however today’s demand for profitability in cultivation and harvest of crops implicates a risk that this unique
fruit may gradually disappear from the market (Ramageet al. 2004). Efforts to further develop mangosteen to facilitate more economical and efficient production of this
fruit should therefore be considered by cultivators of mangosteen in Malaysia as well as other countries. Traditional plant breeding, e.g. interspecific hybridization
(Richards, 1990) in mangosteen has proven to be difficult and could possibly be assisted by biotechnological approaches such as improved protocols for regeneration in
tissue culture (e.g. Goh et al., 1994; Normah et al., 1995, Te-chato& Lim, 1999, 2000). Some efforts are now being made to improve mangosteen. The present paper
describes the first part of this investigation, namely selection of good fruit quality from somaclonalmesta and mangosteen in term of their mean fruit quality
characteristics.
MATERIALS AND METHOD
There are existing tissue cultured mangosteen plots at Bukit Tangga and Kuala Kangsar which were planted in year 1998 and 1999. Data from Kuala Kangsar will be
reported in this paper. The selected clones are mesta and mangosteen, both with tissue culture-derived and seed-derived giving four total number of treatment. A total
of 12 plants per replication, for five replications were planted using randomized complete block design (RCBD). Planting of individual trees was done with a plant hole of
60cm x 60cm x 60cm and plant distance of 6m x 6m. The standard agronomic practices as recommended by MARDI were followed (Mohd Khalid and Rukayah, 1993).
The fruits were harvested at the stage of maturity, determined by the change in colour from pale green to purple. Ten fruits from each tree were evaluated. They were
evaluated for fruit weight, flesh weight, fruit diameter, fruit length, skin thickness, number of pulps, number of seeds and total soluble solids content (TSS). TSS were
determined directly from each sample by using refractometer (Atago PEL-1, Japan) at room temperature and expressed as ⁰Brix.
RESULTS AND DISCUSSION
DISCUSSION
The analysis of variance for comparison between tissue culture-derived and seed-derived mesta and mangosteen for fruit weight, flesh weight, fruit diameter, fruit length,
skin thickness, number of pulps, number of seeds and TSS revealed that there were significantly different at p≤0.01 on most fruit parameters measured in the
study.Exceptions wereskin thickness, number of seeds and TSS (Table 1). This indicates that there are variations in the population for further exploration in mangosteen
improvement.
98 | MGC10
Means of fruit weight, flesh weight, fruit diameter, fruit length and number of pulps in four treatments of mesta and mangosteen are shown in Table 2. Tissue culturederived mesta seems to be the heaviest with 109.12g, followed by seed-derived mesta (96.57g), tissue culture-derived mangosteen (90.71g) and seed-derived
mangosteen (85.29g). Tissue cultured-derived trees tended to produce bigger fruits than the seed-derived trees, presumably due to somaclonal variation (Mohd Asrulet
al. 2011). The pattern of having bigger fruit size by tissue culture-derived mesta and mangosteen as compared to seed-derived of the same fruits was quite consistent
with the fact that tissue culture plants often show robust growth performance. This may be attributable to the phenomenon of habituation, whereby cultures exposed to
high concentrations of plant growth regulators during the TC propagation phase, continues to manifest the growth-promoting effects of the PGR thereafter. This
phenomenon can be genetic or epigenetic in nature (George, 1993). For the number of pulps, there was not clearly different between tissue culture-derived and seedderived. However, significantly different was observed between mesta and mangosteen for both types of propagation technique.
Heavier fruit frequently related to the bigger fruit size. Tissue culture-derived mesta recorded the highest number for both fruit diameter and fruit length followed by
seed-derived mesta, tissue culture-derived and seed-derived mangosteen. The trend appears to be the same for flesh weight. Tissue culture-derived mesta gave the
biggest reading for flesh weight followed by seed-derived mesta, seed-derived mangosteen and tissue culture-derived mangosteen.
The differences observed between seed-derived and tissue culture-derived mesta and mangosteen maybe due to several reasons.Mangosteen appears unique in that
reproduction is solely via apomixis. Obligate agamosperms are known to persist without substantial genetic recombination. Nevertheless, genetic variability does exist to
some extent in several obligate apomicts (Richards, 1986).
However, environmental or cultural factors rather than genetic differences were considered the main contributor responsible for phenotypic variation within the population.
Ramageet al. (2004) suggested that defining the best agronomic practices is vital for mangsteen improvement and could result in potential non-genetic gains such as
early fruiting and improved yields. Already, several growers in Australiahave reported noticeable improvements in fruit yields and tree performance in response to
modified cultural practices (e.g. pruning techniques and shading of the trees). Hence these may account for the reported minor dissimilarities between mangosteen trees
and mangosteen plantations, and not genetic factors.
Garcinia mangostanaare polyploids with apparently non-uniform chromosome numbers. Different chromosome counts (2n = 76, 96, 88–90, 110–120) have been
reported, but due to difficulties in counting the numerous small chromosomes it has been suggested that this inconsistency is primarily due to inaccuracy (Richards,
1990). If the counts are correct, then chromosomal instability may be a contributing factor to the variation observed between tissue culture-derived and seed-derived
trees. As such, results from this study should be considered preliminary until definitive cytological analysis as well as DNA fingerprinting can be performed on the
population.
CONCLUSION
From the results obtained in this study, tissue culture-derived mangosteen and mesta tree produced bigger fruit size compared to seed-derived tree. There was no
significant difference observed between TSS content of those treatments. However, a few years of observation is needed to confirm that those somaclonal variations
obtained from tissue culture of mangosteen and mesta are stable and also have great fruit quality for commercialization. Expansion of this study to include cytological
analysis of accessions and DNA fingerprinting is warranted and would provide an important basis in improving mangosteen.
ACKNOWLEDGEMENT
The authors are grateful to the Ministry of Science, Technology and Innovation (MOSTI), Science Fund Project (06-03-08-SF0293) for financial support. We wish to thank
Mr. Abdul Khalid Mohamed for his technical assistance. Appreciation is extended to Deputy Director and Director of Horticulture Research Centre, Malaysian Agricultural
Research & Development Institute (MARDI) for supporting this project.
REFERENCES
Center for Tropical Fruits Studies. 2004. Annual report of national strategic research initiative 2004. Ministry of Research and Technology, Republic of Indonesia.
George, E.F. 1993. Plant Propagation by Tissue Culture. Part 1, The Technology, Exegetics Ltd, Edington, England.
Goh, C.J., P. Lakshmanan& C.S. Loh, 1994.High frequency direct shoot bud regeneration from excised leaves of mangosteen (Garcinia mangostanaL.). Plant Sci 101:
173–180.
Mansyah, E., P. J., Santoso, and M., Jawal Anwarudin Syah. 2005. Genetic variation of mangosteen (Garcinia mangostana L.) derived from polyembryonic seed-based
on RAPD markers. In: Proc. of the 6th National Congress on Genetics, 12-14 May 2005, Kuala Lumpur, Malaysia.
Melor, R., Chong, S.T., Khalid, M.Z and Masri, M. 2008. Mangosteen (Garcinia mangostana). In: Breeding Horticultural Crops @ MARDI. Pp 155-173. MARDI, Serdang.
Mohd Asrul, S., Sarip, J., Mohd Shaib, J., and NorHanis Aifaa, Y. 2011. Performance of tissue culture-derived mangosteen (Garcinia mangostana) at Bukit Tangga,
Kedah. In: Proc of 9th Malaysia Genetics Congress, 28-30 September 2011, Kuching, Sarawak, Malaysia.
Mohd Khalid, M.Z. and Rukayah, A. 1993.Penanaman Manggis. Institut Penyelidikan dan KemajuanPertanian Malaysia, Kuala Lumpur.
Normah, M.N., A.B. Noor-Azza& R. Aliudin, 1995. Factors affecting in vitro shoot proliferation and ex vitro establishment of mangosteen. Plant Cell, Tissue Organ Cult
43: 291–294.
Poerwanto, R., Efendi, D., Sobir and Suhartanto, R. 2008. Improving Productivity and Quality of Indonesian Mangosteen. In: Proc. XXVII IHC-S2 Asian Plants with Unique
Hort. Potential Eds.-in-Chief: Donglin Zhang et al. Acta Hort. 769, ISHS 2008
99 | MGC10
Predier, S., FasoloFabbriMalavasi, F. Passey, A.J., Ridout, M.S. and James, D.J. 1989.Regeneration from in vitro leaves of ‘Conference’ and other pear cultivars
(Pyruscommunis L.). J. f Horticultural Science 64: 553-559.
Richards, A.J., 1986. Agamospermy. In: Plant Breeding Systems, pp. 403–456. George Allen &Unwin, London.
Richards, A.J., 1990. Studies in Garcinia, dioecious tropical forest trees: the origin of the mangosteen (G. mangostanaL). Bot J Linn Soc 103: 301–308.
Sanada, T. 1986. Induced mutation breeding in fruit trees: resistant mutant to black spot disease of Japanese pear. Gamma Field Symposia 25: 87-108.
Te-chato, S. 1998. Recent potential in the biotechnology of mangosteen II: Cultivar improvement. Songklanakarin J. Sci. Technol. 20(3):285-293
Te-chato, S. & M. Lim, 1999. Plant regeneration of mangosteen via nodular callus formation.Plant cell, tissue organ cult 59: 89–93.
Te-chato, S. & M. Lim, 2000. Improvement of mangosteenmicropropagation through meristematic nodular callus formation from in vitro-derived leaf explants. SciHortic
86: 291–298.
Table 1: Mean squares from ANOVA for fruit weight, flesh weight, fruit diameter, fruit length, skin thickness, number of pulps, number of seeds and TSS of four
treatments of mesta and mangosteen.
Sources
df
Fruit Weight
(g)
Flesh Weight
(g)
Fruit Diameter
(cm)
Fruit Length
(cm)
Skin Thickness
(cm)
No. of Pulps
TSS
(°Brix)
No. of Seeds
Rep
Treatments
4
3
138.67
4094.13**
63.45
1087.36**
0.34**
0.41**
0.19
14.52**
0.33
0.24
0.69
3.86**
0.57
0.34
10.58
2.03
Error
Total
12
19
174.35
44.98
0.09
0.16
0.34
0.51
0.40
1.57
97.62
13.53
33.94
19.75
5.64
5.17
6.03
6.69
0.71
83.33
6.15
11.62
0.74
86.25
18.53
6.77
Mean
CV
** Significantly different at p≤0.01
Table 2: Means of fruit weight, flesh weight, fruit diameter, fruit length and number of pulps in four treatments of mesta and mangosteen.
Fruit Weight
Flesh Weight
Fruit Diameter
Fruit Length
Treatment
(g)
(g)
(cm)
(cm)
Seed-derived Mangosteen
85.29c
30.03bc
5.55b
5.33c
Tissue culture-derived
90.71bc
27.87c
5.59b
5.31c
Mangosteen
Seed-derived
96.57b
32.75b
5.59b
6.23b
Mesta
Tissue culture-derived Mesta
109.12a
40.14a
5.77a
6.58a
Means within a column with the same letters are not significantly different at p≤0.05 according to DMRT
100 | MGC10
No. of Pulps
5.80b
5.77b
6.26a
6.44a
ID 012
Molecular Phylogeny of Malaysian Primates Inferred from mtDNA Cytochrome Oxidase II Gene
1
Millawati Gani,
Gani, 2Noor Aisyah A. Rahim and 3M. T. Abdullah
Department of Zoology, Faculty Resource Science and Technology,Universiti Malaysia Sarawak
Email: [email protected]
ABSTRACT:
In Malaysia, there are 21 described primate species which consist of five families and all of them are under protected three laws in Sarawak, Sabah and Peninsular
Malaysia. Although, there are studies on primates done in Malaysia but none of them are conducted in detail investigation on molecular ecology. For this study, three
types of sample which are blood, tissues and fecal were collected and preserved in both buffer form and dried forms. A total of 57 individuals comprised of 12 species
were sequenced using COII mtDNA gene with 780 base pair in length to determine their phylogenetic relationship and genetic variation. Two methods of phylogenetic
trees were constructed which are Neighbour-joining (NJ) and Maximum Parsimony (MP). The results showed both trees form a monophyletic tree and the resulted in
similar statistically supported clades with minimal change in branching order. However, there are some unresolved relationships among the Malaysian primates for this
study due to lower bootstrap value represents and lack of sample size.
Keyword:Malaysia,
primates, phylogenetic, mtDNA, COII gene
Keyword:
Introduction
Malaysian primates are facing a critical declining in population number due to the habitat destruction such as logging, illegal trade, hunting, forest clearing and land
conversion to plantations and human settlement. Due to habitat disturbance and destruction, there are some Malaysian primates becoming pest to human residence
which causes human-primate conflict such as Macaca fascicularis(Long-tailed Macaque). According to IUCN red list, Presbytis chrysomelas (Borneon banded langur) is
listed as critically endangered species that only can be found at Batang Saribas, Sarawak with very low number of individual. Another six primates which four from them
are all Malaysian gibbon are listed as endangered species which are Nasalis larvatus (Proboscis Monkey), Pongo pygmaeus (Bornean Orangutan), Hylobates agilis (Darkhanded Gibbon), Hylobates lar (white-handed Gibbon), Hylobates muelleri (Bornean Grey Gibbon), and Symphalangus syndactylus (Siamang). A total of seven species are
vulnerable, four are near threatened, two species are least concern and a Trachypithecus villosus (Griffith's Silver Langur) was not available in IUCN red list status.
There are lack studies and information of molecular ecology for Malaysian primates. Basically, more study done focused on their ecological, morphological and behaviour
which is not in molecular level.Another line of indication to elucidate the phylogenetic relationship is molecular techniques. Md. Zain et al., (2010) stated that the
application of phylogenetics is important to improve the systematic classification of Malaysian primates.Most of previous study on molecular work focused on macaque,
leaf monkey and a little study on gibbon. Furthermore, Md. Zain et al., (2010) stated that the relationship of Presbytis and Trachypithecus are still remaining unclear.
In this study, we focused on phylogenetic relationship of Malaysian primate amplified using Cytochrome Oxidase II mtDNA gene which aims to obtain the genetic data to
determine the phylogenetic relationship among Malaysian primate and their genetic variation. COII mtDNA gene was chosen for this study. COII had known as the third
largest component of cytochrome c oxidase complex. COII has evolved more rapidly in the primate than non-primate lineage. The evolution rates of COII are believed to
be significantly higher than for COI and it has been successfully conducted with mammals.
Materials and Methods
A total of 155 individuals consist of 16 primate species were collected throughout Malaysia based on the distribution and the availability of primate species as shown in
Figure 1 below.
101 | MGC10
3
1
5
4
7
2
6
Figure 1. Maps show the type locality of primate samples collected in Malaysia. 1 – Sabah; 2 – Sarawak; 3 – Pulau Pinang; 4 – Kedah; 5 – Perak; 6 – Melaka; 7 –
Selangor. Map modified from Dalet (2010b)
Three kinds of samples were collected namely fecal, blood and tissue which collected from 22 of sampling locations which includes wild, captive and urban area. Out of
155 samples, 92 were blood samples, 47 were feces samples whereas 16 were from tissue samples. The method how to collect blood and tissue samples is the
targeted primates were tracked and were tranquilized using zoletil (5mg/kg; 100mg/ml). Blood samples were taken from the blood veins using capillary tubes and then
stored in 10ml BD Vacutainer® K2E 18.0mg tubes while for the tissues samples were collected from muscle and liver tissue only for targeted species. Fecal samples
were collected by tracking the primates by finding their feeding or sleeping area and searching for the dropping from the primates. Fresh fecal samples were stored in
ice in the field and immediately stored in -80˚C after sampling.
Genomic DNA from 155 samples consist of 16 species of Malaysian primate was successfully extracted. Blood samples were extracted using the QIAmp DNA Blood Mini
Kit (Qiagen, Cat.No. 51104) and QIAmp DNA Investigator Kit (Qiagen, Cat. No. 56504) while from the fecal samples was extracted using QIAmp DNA Stool Mini Kit
(Qiagen, Cat.No. 51504).Total genomic DNA was extracted from tissue using C-TAB protocol (cetyl-tri-methyl ammonium bromide).
Cytochrome Oxidase II (COII) of the mtDNA gene was amplified by PCR. Amplification was performed using 25 µl total volume per reaction with 5 µl of 5X Colorless
GoTaq Flexi Buffer, 1.5 µl of MgCl2 (25 mM), 0.5 µl dNTP mix, 1.0 µl of each primer forward and reverse, 14.8 µl of ddH2O, 1.0 µl of DNA template and 0.2 µl Taq
polymerase. The oligonucleotide COII primers sequence used is L7553 (5'-AACCATTTCATAACTTTGTCAA-3’)and H8320 (5'-CTCTTAATCTTTAACTTAAAAG-3’). The
temperature profile for 35 cycles was pre-denaturation (94°C for 3 minutes), denaturation (94°C for 1 minute), annealing (45-55°C for 1 minute), extension (72°C for 70
seconds), post-extension (72°C for 9 minutes) and soak (4°C). The purified PCR products were sent to the private laboratory (First Base Company Sdn. Bhd.) for DNA
sequencing.A total of 60 individuals were successfully sequenced the DNA.
The result of 57 DNA sequenced used to construct phylogenetic analysis by using Chromas Pro program version 1.5 (MacCarthy, 1998), CLUSTAL X program version
1.81 (Thompson et al., 1997), Molecular Evolutionary Genetic Analysis (MEGA) version 5.05 (Kumar et al., 2007) and Phylogenetic Analysis Using Parsimony (PAUP)
version 4.0b10 (Swofford, 2001).In this study, Galeopterus variegatus was used to indicated the outgroup of the phylogenetic tree generated which obtained from the
GenBank with the accession number JN800721.1
Result and Discussion
Amplification products of 780 base pair were obtained for COII gene fragments. Sequence analysis indicated that of the 708 is variable site within COII while 56
characters resulted in the conserved site and 554 found in parsimony informative. Nucleotide frequencies also analysed with the highest percentage of nucleotide
frequencies were indicated by Cytosine (C) with the record of 30.33% while the lowest nucleotide composition was shown by Guanine (G) which indicated 14.23%.
Thymine (T) and Adenine (A) were recorded to have 25.63% and 29.82% nucleotide composition respectively.
102 | MGC10
Analysis of the pairwise genetic distance which computed between group mean distance using Kimura-2-parameter of COII mtDNA gene for 13 species including
outgroup species. The highest average occurs between Macaca fascicularis and Presbytis femoralis which indicated 70.5%. However, the lowest divergence between
the primate species was modelled by two individuals of Hylobates agilis and Hylobates lar with the genetic distance 0.41% indicating that these two species were closely
related to each other.
Figure 1: Scores on the branches refer to >50% of bootstrap values from neighbour-joining (1st score) and maximum parsimony (2nd score); -- indicates to no support
value based on 780 base pair sequenced from 13 species of 58 individuals including Galeopterus variegates as an outgroup.
103 | MGC10
A comprehensive phylogenetic relationship of Malaysian primate based on 780 bp (after alignment the original ~850 bp COII gene) in 57 individuals consist of 12
species with Galeopterus variegates as an outgroup for this study. Based on Figure 2, the tree showed all in this study are monophyletic for NJ and MP trees. There are
all five families in primate of Malaysia represent in the tree which are Group 1; Cercopithecidae, Group 2; Tarsiidae, Group 3; Lorisidae, Group 4; Hylobatidae, and Group
5; Homonidae. In both NJ and MP tree showed slightly the same topologies and all the species are group in their own family clade with respect to Galeopterus
variegates as an outgroup. The NJ tree gave the most resolved topology based on observed by the higher bootstrap values (>70%).
Group 1 is formed of Pongo pygmaeus species and they are sister taxa with family Hylobatidae with high bootstrap value 90% which congruent with previous study by
Perelman et al. (2011) reported in their phylogenetic tree, Pongo is a sister clade with Hylobates and Symphalangus. Group 2, the clade showed Hylobates agilis
(ZM005) was separated from his species clade andwas clade together with representativeS of Hylobates larwith low of bootstrap value. However, according to the lower
bootstrap showed they are not having strong relationship with each other and the branch might be changed if there has an additional individual for this group.
Group 3 showed a family Cercopithecidae which formed a group of leaf monkey (group 3a) and macaque group (group 3b). Both NJ and MP do not strongly resolve the
position of Nasalis larvatus in group 3a. Four individuals of Nasalis larvatus (PRP0005, PRP0008, PRP009 and PRP0013) was separate distinctly with two individuals
(PRP0211 and PRP0214) which these two individuals joined together with Presbytis femoralis. Although the position of Nasalis larvatus in both trees is problematic and
the phylogenetic position is remaining unclear, the leaf monkey clade was almost resolved by both trees analyses by quite high bootstrap values support. In this study,
with the high 86% bootstrap value support the Presbytis was form a distinct single clade which not branching in a single clade of Trachypithecus. Although Presbytis
femoralis only represented by a single sample but it is showed Presbytis and Trachypithecus are sister taxa and tree topologies clearly indicate that Presbytis and
Trachypithecus formed their own distinct monophyletic clade with bootstrap values strongly support the topologies obtained.
Group 3b showed a macaque group which formed of Macaca nemestrina and Macaca fascicularis. There are showed strong relationship between individuals in the
macaques group with present a high bootstrap values in both NJ and MP trees. Group 4 was formed from two Malaysian primate family which are family Lorisidae and
family Tarsiidae which present a species of Nycticebus coucang and Tarsius bancanus, respectively. Previous study by Hayasaka et al. (1988) has been reported that the
tarsier is more closely related to lemur than prosimians, then, it showed tarsier is the closest to lemur which chose as an outgroup among species used in this study.
Conclusion
For the conclusion, the tree showed mtDNA COII gene strongly support that the five family of Malaysian primate. The tree topology formed a monophyletic clade in all
both NJ and MP trees analysis. The constructed tree showed that the bootstrap value support the Presbytis was form a distinct single clade which not branching in a
single clade of Trachypithecus and formed their own distinct monophyletic clade. For further studies, more samples should be used because it is important to generate
more reliable results in molecular phylogeny of Malaysian primates.
Acknowledgement
The authors thank to other members of Primate Genome Project Mohd Hanif Ridzuan Mat Daud, Nur Aida Md Tamrin, Jeffrine Rovie Ryan Japning, Mohamad bin Kombi,
Ho Licia, Sarina Mat Yasin and Madinah Adrus for their helps, hard work and assistance throughout this study. We also thank to Faculty Resource Science and
Technology, Universti Malaysia Sarawak for providing facilities, logistic and administrative support. Our gratitude also goes to the Science Officer of Faculty Resource
Science and Technology, Wahap bin Marni for always accompanied to do work sampling. This study was fully supported by Primate Genome Project Grant awarded to
Prof. Dr. Mohd Tajuddin Abdullah.
References
Abdullah, M.T. (2011). Ecology, Population Genetics and Predictive Modeling of sympatric Primates in
Malaysia. Research Proposal.Universiti Malaysia Sarawak.
Dalet, D. (2010b). Map of Malaysia. http://d-maps.com/m/malaisie/malaisie14.gif. Downloaded 13 March 2013.
Hayasaka, K., Gojobori, T.,& Horai, S. (1988).Molecular Phylogeny and Evolution of Primate Mitochondrial DNA.Mol. Biol. Evol. 5(6):626-644.
Kumar, S, Tamura, K, Dudley, J., & Nei, M.,(2007). MEGA4: Molecular Evolutionary Genetic Analysis
(MEGA) Software Version 4.0. Molecular Biology and Evolution24:1596-1599.
McCarthy, C. (1997). CHROMAS version 1.45 program. Schools of Health Science, Griffith University, Gold Coast Campus, Queensland, Australia.
Md-Zain, B. M., Mohamad, M., Ernie-Muneerah, M. A., Ampeng, A., Jasmi, A., Lakim, M. & Mahani
M.C. (2010).Phylogenetic relationship of Malaysian Monkeys, Cercopithecidae, based on Cytochrome c sequence.Genetics and Molecular Research 9 (4):
1987-1996 (2010).
Perelman, P., Johnson, W. E., Roos C., Seuanez, H. N., Horvath, J. E., Moreira, M. A., Kessing, B.,
104 | MGC10
Pontius, J., Roelke, M., Rumpler, Y., Schneider, M. P. C., Silva, A., O’Brien, J., & Pecon-Slattery, J. (2011).A Molecular Phylogeny of Living Primates.PloS
Genetics. Volume 7: Issue 3/e1001342.
Posada, D. & Crandall, K.A. (1998). Modeltest: testing the model of DNA substitution. Bioinformatics,
14 (9): 817-818.
Rambarack, R. & Deeley R. G. (1987).Structure and Evolution of Primate Cytochrome c Oxidase Subunit II Gene.The Journal of Biological Chemistry.
Ronquist, F. & Huelsenbeck, J. P. (2003).MrBayes v.3.1.2. Retrieved March 18, 2011, from
http://mrbayes.sourceforge.net/index.php.
Sibley, C.G. & Ahlquist, J.E.(1990). Phylogeny and Classification of Birds.A Study in Molecular Evolution.Yale University Press, New Haven and London.
Sterner, K. N., Raaum, R. L., Zhang, Y. P., Stewart, C. B. & Disotell, T. R. (2006). Mitochondrial Data
Support an Odd-nosed Colobine Clade. Molecular Phylogenetic and Evolution 40 (2006) 1-7.
Swofford, D. L. (2001).PAUP*.Phylogenetic Analysis Using Parsimony (*and Other Methods).Version 4.
Sinauer Associates, Sunderland, Massachusetts.
Tamura, K., &Nei, M. (1993). Estimation of the number of nucleotide substitutions in the control region of
mitochondrial DNA in humans and chimpanzees. Molecular Biology and Evolution 10,
10 512-526.
Thompson, J. D., Gibson, T. J. & Plewniak, F. (1997).The Clustal X Windows Interface: Flexible
Strategic for Multiple Sequence Alignment Aided by The Quality Analysis Tools.Nucleic Acid Res 24: 4876-4882.
Won, Y. J. & Hey, J. (2005). Divergence Population Genetics of Chimpanzee.Society for Molecular
Biology and Evolution. Vol 2:297-307.
105 | MGC10
ID 013
Comparative Study on the Genetic Diversity of Proboscis Monkey (Nasalis larvatus) from Selected Populations in Malaysian Borneo
Licia. Ho1 and MT. Abdullah1
Department of Zoology, Faculty of Resource Science and Technology, Universiti Malaysia Sarawak,
Email: [email protected]
1
ABSTRACT:
Proboscis Monkey, Nasalis larvatus is a large and sexually dimorphic non-human primate that specifically belongs to subfamily Colobinae. These monkeys are endemic
to the island of Borneo and classified as Totally Protected Animals under Wild Life Protection Ordinance Sarawak due to often deforestation and land conversion that had
highly restricted their nature habitat. Primate studies available mainly focus on their living behaviors or diet, with fewer study focus on their genetic diversity, especially in
Sarawak. This research study is aim to examine the genetic diversity of N. larvatus population from Sarawak and Sabah using D-loop control region segment. Noninvasive sampling was applied in this study by collecting fecal as the major samples source. Out of a total of 62 fecal samples, 29 unique haplotypes were identified.
Eighteen haplotypes were discovered from the Sarawak and 14 haplotypes were from Sabah populations. Three haplotypes were shared within population from Sarawak
and Sabah. Population from Sarawak retained higher haplotypes diversity and nucleotide diversity compared to Sabah population.
Keywords:
Keywords genetic diversity, proboscis monkey, D-loop control region, haplotype, Sarawak
Introduction
The Proboscis Monkey (Nasalis larvatus) is classified under Order Primates; Family Cercopithecidae and Subfamily Colobinae (Wilson & Reeder, 2005). Proboscis
monkeys are endemic to the island of Borneo, and were popularly known as Orang Belanda or Rasong to the local communities. Proboscis monkeys are largely restricted
at lowland coastal rainforests that includes mangrove, peat swamp forests, stunted swamp forest, rubber forests, limestone hill forests, nipa swamps, nibong swamps,
tropical heath forests and steep cliffs (Kawabe & Mano, 1972). However, the populations trend of this species are gradually decreased mainly due to land conversion for
agricultural activities especially oil palm plantation and logging (Bennett, 1988; Meijaard & Nijman, 2000). Hence, the proboscis monkeys are now listed as endangered
on the IUCN Red List of Threatened Species (Meijaard & Supriatna, 2013) and Appendix I of CITES (UNEP-WCMC, 2003).
Currently, there are only five recorded sites in Sarawak where proboscis monkey can be found namely Bako National Park, Maludam National Park, Kuching Wetland
National Park, Samunsam Wildlife Sanctuary and the Kuala Lawas Forest Reserve. Salter and Mackenzie (1985) estimated only about 2000 individuals are found in
Sarawak. Few studies on population estimation had been conducted particularly in Bako National Park. In Bako National Park, Salter and Mackenzie (1981) estimated a
population of about 106 to 144 individuals; while Zaini et al. (2004) and Zaini and Illias (2005) estimated 275 and 111 individuals, respectively. Salter and Mackenzie
(1985) pointed out that proboscis monkeys occupy a wide but discontinuous range in Sarawak, with three or more subpopulations with little or no interchange.
Furthermore, most studiesmainly focus on their living behaviors or diet, with fewer studies focusing deep into their genetic information. Therefore, the genetic diversity of
proboscis monkeys throughout Sarawak is poorly understood.
In this study, a partial segment of the mitochondrial DNA (mtDNA) D-loop control region was sequenced from six populations of N. larvatus from Bako National Park,
Kuching Wetland National Park, Maludam National Park,Sukau Kinabatangan, Klias River and Labuk Bay. The aim of this study is to examine genetic diversity within
populations from Sarawak and Sabah.
Materials and Methods
Non-invasive genetic sampling was applied in this study by collecting fecal samples. Sampling for proboscis monkeys was started at December 2011 until February
2013. Most of the surveys were conducted early in the morning at 0600 hr or late afternoon and later late in the evening about 1900 hr. At all sites except Bako National
Park, searches for proboscis monkeys were conducted by boat survey along the riverside as the boat passed. Once a group of proboscis monkey was encountered,
observation was carried out in a distance and approach slowly to that area after they had moved away. Fresh fecal was normally found underneath roosting trees, which
was then put into a collection bottle, labeled and stored in -800C freezer. At Bako National Park, fecal samplings were mostly conducted along the existing trails and the
landward edges of mangrove areas.
All fecal samples were extracted by using QIAamp DNA Stool Kit (Qiagen GMBH, Germany) using described protocol by Goossens, et al. (2005). A total of 62 fecal
samples were collected; Bako National Park (N= 28), Kuching Wetland National Park (N= 3), Maludam National Park (N= 3), Sukau Kinabatangan (N= 11), Klias River
(N= 9), and Labuk Bay (N= 8). All fecal samples were successfully been sequenced the partial D-loop control region segment by using primers NL2F (5’ACCCAACACCCAAAATTG-3’) and NL2R (5’-TAAGAACCAGATGTCCGT-3’) (Munshi-South & Bernard, 2011). Polymerase chain reaction was performed with a total
reaction volume of 25 ul, and the reaction conditions consisted of pre-denaturation at 940C for 5 min, followed by 35 cycles of denaturation at 940C for 1 min, annealing
at 49.20C for 1 min, primer extension at 720C for 1 min, and a final extension at 720C for 5 min. Only forward sequences were sequenced in this study.
106 | MGC10
Multiple alignments of the edited sequences were performed using the CLUSTAL X 1.81 program (Thompson et al., 1997). The genetic diversity measures from all six
populations in Sarawak and Sabah were estimated based on the number of haplotypes, haplotype diversity (h), nueleotide diversity (π), and nucleotide divergence, (Dxy),
by using DNASP 5.0 (Rozas et al., 2003). In order to test the neutrality of mutation, Tajima’s, D (Tajima, 1989) and Fu’s, Fs(Fu, 1997) were calculated using 10 000
coalescent simulations in DNASP to calculate the significance. Lastly, a median-joining haplotype network was generated by using NETWORK 4.5 (Bandelt et al., 1999).
Results
We successfully sequenced the control region segment for all 62 fecal samples with total of 471 base-pairs (bp), where 61 variable sites and 29 unique haplotypes were
identified (Table 1). Eighteen haplotypes were discovered from the Sarawak and 14 haplotypes were from Sabah populations. Three haplotypes were shared within
population from Sarawak and Sabah.
Table 1: Genetic diversity of proboscis monkey from the populations of Sarawak and Sabah based on mtDNA control region segment.
Population
N
S
H
h
π
K
D
FS
Bako NP
28
51
15
0.926
0.019
9.003
-1.233
-0.943
Kuching Wetland NP
3
17
2
0.667
0.024
11.333
Maludam NP
3
18
2
0.667
0.026
12.000
Sukau Kinabatangan
11
15
5
0.764
0.014
6.327
1.044
2.600
Klias River
9
13
6
0.833
0.010
4.778
-0.005
-0.103
Labuk Bay
8
9
4
0.750
0.006
3.071
-0.564
1.053
Total Sarawak samples
34
55
18
0.931
0.022
10.246
-0.925
-1.321
Total Sabah samples
28
21
14
0.918
0.013
6.146
0.493
-1.836
Total Sarawak and Sabah samples
62
61
29
0.956
0.027
12.519
-0.227
-2.961
*N= sample size,S= number of segregating sites,H= number of haplotypes,h= haplotype diversity, π= nucleotide diversity, K= average number of nucleotide differences,
D= Tajima’s statistic (Tajima, 1989), FS= Fu’s statistic (Fu, 1997).
Bako NP revealed the highest haplotype diversity (h= 0.926) followed by Klias River (h= 0.833). The lowest haplotype diversity was revealed by both Kuching Wetland NP
and Maludam NP (h= 0.667). In contrast, the highest nucleotide diversity was detected from Maludam NP (π= 0.026), followed by Kuching Wetland NP (π= 0.024). Test
of neutrality were not significant for any of the populations. However, neutrality test for both population of Kuching Wetland NP and Maludam NP were not calculated due
though insufficient samples size.
Based on the median-joining network, there are two major clustering of haplotypes that separatespopulations from Sarawak (Haplo-group 1) and Sabah (Haplo-group 2).
Thirteen out of 15 Bako NP haplotypes (H1- H4, H6- H9, H11-H15) were found in one cluster, and each one of the Kuching Wetland NP (H23) and Maludam NP (H19)
haplotype was clustered into the Haplo-group 2 Sabah. However, one haplotype was found shared between three populations, Maludam NP, Sukau Kinabatangan, and
Klias River (H19). The genetic linkage between the two haplo-groups was deviated from H13 of the Bako population by 12 mutational steps from the Klias River, Sabah
populations. Within haplo-group 1, all Sarawak haplotypes differ from the Bako NP (H13) with a maximum of 10 mutational steps. Within haplo-group 2, the Sabah
haplotypes differ from Klias River (H27) with a maximum of four mutational steps.
107 | MGC10
Haplo-group 2- Sabah
Haplo-group 1Sarawak
Figure 1: Median-joining network of 29 proboscis monkey mtDNA control region haplotypes from Sarawak and Sabah, Malaysia.
Each circle represents a unique haplotype coloured according to its presence in Bako NP (purple), Kuching Wetland NP (pink),
Maludam NP (orange), Sukau Kinabatangan (black), Klias River (green), and Labuk Bay (yellow). The diameter of circles
corresponds to the haplotype frequency and the smallest circles represent singletons. Two major clusters of haplotypes were
identified.
Discussion
Based on the 29 haplotypes discovered in this study, a total of 18 haplotypes were distributed within Sarawak populations (Bako NP, Kuching Wetland NP, and Maludam
NP), leaving 14 haplotypes from Sabah populations (Sukau Kinabatangan, Klias River, and Labuk Bay) (Table 1). The small number of haplotypes found from both
Kuching Wetland NP and Maludam NP might due to the insufficient number of samples size.
In this study, sharing of haplotypes was found between populations from Kinabatangan and Klias River, which is similar to the funding from Munshi-South and Bernard
(2011). According to their point of view, the proboscis monkey within Klias Peninsula was exhibited little mitochondrial structure, where migration of female were once
occurred in recent times between two large Klias subpopulations. But interestingly, the population from Maludam NP Sarawak was also found sharing to the same
haplotype with population Kinabatangan and Klias. This suggested that the proboscis monkey populations may once be concentrated into this island during the late
Pleistocene epoch in some 2 mya to the last glacial maximum. An alternative scenario is that, given that proboscis monkey live in mangroves which near the coast, the
historical connection of forest between Sarawak and Sabah had facilitated the movement of proboscis monkey.
On the other hand, the distribution of haplotypes found in both populations from Sarawak and Sabah were shown correlated with geography in median-joining network
(Figure 1). Previous studies conducted by Rosenblumet al. (1997), they found out that the dispersal of Macaca nemestrina was from the south China/ Thailand to
Peninsular Malaysia and the Sunda Shelf. Thus, if proboscis monkey also follow the similar dispersal trend,the extreme climatic changes during Pleistocene (Voris, 2000;
Meijaard, 2003), with maximum sea level lowering of 200m (Heaney,1986),most probably the proboscis monkey could have dispersed upward to Sabah.
In conclusion, further detailed analysis and expanded samples size throughout populations from both Sarawak and Sabah could be use to further test on the Pleistocene
Refugia Theory.
108 | MGC10
Acknowledgments
Warmest thanks to Universiti Malaysia Sarawak (UNIMAS), Faculty of Resource Science and Technology for the administrative support. I would like to thank Mr. Wahap
Marni and Mr. Safri for field assistance and Prof. Dr. Mohd Tajuddin Abdullah for his constant support and helpful comments on this manuscript. Besides, special thanks
to Sarawak Forestry Department and Sarawak Forestry Corporation for issued research permit (NCCD.907.4.4(Jld.8)-50) for this project. This project was funded by
National Malaysian Genomics Resource Centre Berhad (MGRC) and Malaysia Toray Science Foundation (MTSF).
References
Bennett, E. L. (1988). Proboscis monkey and their swamp forests in Sarawak.Oryx22
22(2):
22 69-74.
Fu, Y.X. 1997. Statistical tests of neutrality of mutations against population growth, hitchhiking and background selection. Genetics, 147:
147 915- 925.
Heaney, L. R. (1986). Biogeography of mammals in SE Asia: Estimates of rates of colonization, extinction and speciation. Biological Journal of the Linnean Society28
28:
28
127-165.
Kawabe, M. & Mano, T. (1972). Ecology and behavior of the wild proboscis monkey ,Nasalis larvatus (Wrumb) in Sabah, Malaysia. Primates13
13:
13 213-228.
Meijaard, E., & Nijman, V. (2000).Distribution and conservation of proboscis monkey (Nasalis larvatus) in Kalimantan, Indonesia.Biological Conservation92
92:
92 15-24.
Meijaard, E. (2003). Mammals of south-east Asia islands and their Late Pleistocene environments.Journal of Biogeography, 30:
30 1245-1257.
Mejiaard, E. & Supriatna, J. (2013).Nasalis larvatus. IN: IUCN Red List of Threatened Species. 2013th ed. IUCN, Gland, Switzerland. Retrieved August 21, 2013, from
http://www.iucnredlist.org
Munshi-South, J. & Bernard, H. (2011).Genetic diversity and distinctiveness of the proboscis monkey (Nasalis larvatus) of the Klias, Peninsula, Sabah, Malaysia.Journal
of Heredity102(3)
102(3):
102(3) 342-346.
Rosenblum, L. L., Jatna, S. & Don, J. M. (1997). Phylogeographic analysis of pigtail macaque populations (Macaca nemestrina) inferred from mitonchondrial DNA.
American Journal of Physical Anthropology104
104:
104 35-45.
Salter, R. E. & MacKenzie, N. A. (1985).Conservation status of the proboscis monkey in Sarawak.Biology Conservation33
33:
33 119-132.
Tajima, F. 1989. Statistical method for testing the neutral mutation hypothesis by DNA polymorphism.Genetics.123
123:
123 585–595.
Thompson, J. D., Gibbon, T. J., & Plewniak, F. (1997). The CLUSTAL X window interface:flexible strategies for multiple sequence alignment aided by the quality analysis
tools. Nucleic Acid Research, 24,
24, 4876-4882.
UNEP-WCMC (2003). UNEP-WCMC Species Database: CITES-Listed Species. United Nation Environment Programme (UNEP)- World Conservation Monitoring Centre
(WCMC). Retrieved August 26, 2013, from http://sea.unep-wcmc.org
Voris, H. K. (2000). Maps of Pleistocene sea levels in Southeast Asia: shorelines, river systems and time durations. Journal of Biogeography, 27:
27 1153- 1167.
Wilson, D. E., & Reeder, D. M. (2005).Mammal Species of the World. A Taxonomic and Geographic Reference (3rded.). Johns Hopkins University Press.
Zaini, M.K., Aban, S., Ilias, A., Sogod, G., Zakeria, M.K.,Jomis, A., & Aris, J. 2004. Laporan Kajian Orang Belanda (Nasalis larvatus) di Taman Negara Bako.Bako
National Park.Protected Areas and Biodiversity Conservation (PABC). Sarawak Forestry Corporation, Kuching. 16p
Zaini, M. K., Ilias, A. 2005. Survei Taburan Orang Belanda (Nasalis lavartus) di Taman Negara Bako. Bako National Park, Protected Areas and Biodiversity Conservation,
Sarawak Forestry Corporation, Kuching, 10 p
109 | MGC10
ID 015
16S rDNA Analysis of Phosphate Solubilizing Bactria Isolated from the Rubber Tree Hevea brasiliensis
Moritz Ivo Will1, *Halimi Mohd Saud1
Department of Agriculture Technology, Faculty of Agriculture, Universiti Putra Malaysia
Email: [email protected]
1
ABSTRACT:
Plant growth promoting bacteria (PGPB) are currently under focus to improve plant nutrition, phytohormone production, and prevent plant diseases. The para rubber tree
(Hevea brasiliensis) is one of Malaysia’s important plantation tree crops. Studies revealing its microbial diversity are currently lacking and much more study has to be
done to obtain a full understanding of its genetic function to improve its management practices. Out of 273 isolated bacteria from the rhizopsphere of Hevea brasiliensis,
24 PGPB which were previously identified as producers of phytohormones and plant nutrient promoters were sampled and identified with 16S rRNA method. Blasted
sequencing results obtained with BLAST® showed that all identified bacteria belong to the phylum of proteobacteria with 18 isolates belong to the class of
betaproteobacteria and 6 isolates to gammaproteobacteria. All betaproteabacteria were members of the genus of Burkholderia with species of B arboris, B. cepacia, B.
cenocepacia, B. metallicaand B. seminalis. The gammaproteobacteria were identified as Acinetobacter calcoaceticus and A. venetianus, Enterobacter aerogenes and E.
asburia, and Erwinia tasmaniensis. These findings are beneficial for the development of a multifunctional biofertilizer in natural rubber production.
Introduction
The term biofertilizer refers to bacterial inoculants which are applied to plants with the purpose of improving nutrient availability towards host plants. The application of
biofertilizers is conducted in a broad array of disciplines like agriculture, bioremediation, silviculture and others. Phosphate solubilizing bacteria (PSB)represent a
subdomain of biofertilizers with the use of making unavailable phosphorus reserves in the planting substrate plant available. A standard experimental approach to detect
PSB is the screening of soil and rhizosphere samples (Goldstein & Krishnaraj, 2007).Studies by other researchers showed that Proteobacteria are an important major
group representing PSB (Pérez et al., 2007; Ramani, 2011).
The rubber tree(H. brasiliensis) is considered as a major industrial plantation tree crop in Malaysia. However, no known study is currently describing PSB isolated from its
rhizosphere. This studygives a first insight and providesfundamental research for the basis of future research.
The problem of identifying soil bacteria is in the obstacle that the majority of 90 to 99% of all species are not cultivable with conventional methods. A successful
approach ofidentifying bacteria from environmental samples was shown by using molecular methods. The synthesis of protein is occurring in every vital cell; therefore
ribosomal RNA (rRNA) fragments are great regions to measure similarities. Each sequence consists of data about the genetic distance among species. 16S rRNA
sequencesare commonly used to identify bacterial populations. Key conditions of the RNA fragments are appearance in all organisms, alike in function and the sequence
needs to adapt on genetic changes. Ribosomal RNA is fulfilling all these conditions and furthermore is available in the large quantities (Hautefort & Hinton, 2002).
Specific and universal primers are needed to have complementary bases with as much taxa as possible. Unfortunately these set of primers are not available.Matching to
one universal primer seems to be impossible due to a relatively short conservation status of only about 10% of all bases in the 16s rRNA gene. Furthermore, these bases
are not contiguous located on the strand and smaller than 10 bases per string. The arrangement of a primer is an agreement among different primer features like
complementarities, guanine/cytosine (GC) ratio and others (Azziz et al., 2011).
Accordingly, most if not the entire 16S rDNA-libraries do not fully embody their target microbial communities. Repeating PCR reactions with several partly varying primers
may considerably lower the bias and improve certainty of having the right prokaryotic organisms (James, 2010).Therefore, certain dispositions remain unavoidable when
undertaking 16S rRNA characterizations. This arises from inconsistencies among different bacterial groups and the relatively short fragment of the whole genome which
is used and regarded as only about 0.05%. This short sample size prevents any further physiological studies (Krishna et al., 2006). In this study PSB isolated from the H.
brasiliensissoilwere identified with 16S rRNA sequences.
Materials and Method
Bacteria sample
A total of 22 previously isolated PSBfrom the Rubber Research Institute Malaysia (RRIM) in Sungai Buloh, Selangor were used in this study.
DNA Extraction and PCR
Single bacterial colonies were collected from nutrient agar plates and cultured 24h in LB broth for subsequent DNA extraction. The extraction was performed with a
genomic DNA extraction kit from YEASTERN BIOTECH CO., LTD. The extracted and purified DNA was stored at -20°C until polymerase chain reaction (PCR) amplification
was carried outwith 16S rRNA primers. The universal forward primer 27F, 5’ AGAGTTTGATCMTGGCTCAG 3’ and reverse primer U1492R, 5’ GGTTACCTTGTTACGACTT
110 | MGC10
3’ were used for all 22 isolates(Benito et al., 2004).The PCR was performed according to DreamTaq DNA Polymerase protocol from Thermo Scientific. The PCR product
was subsequently used for gel electrophoresis on 1% agarose gels at 80V for 80 minutes.
Sequencing
The amplified bands were extracted with a QIAquick Gel Extraction Kit(Qiagen) and concentration and purity was tested with a NanoDrop 2000 device from Thermo
scientific. Each sample was sent for sequencing to 1stBase, Seri Kembangan.The sequencing results were analyzedby observing the chromatogram peaks using the
Sequence Scanner version 1.0 (http://en.bio-soft.net/dna/ss.html). The contigs were aligned using BioEdit Sequence Alignment Editor version 7.1.9
(http://www.mbio.ncsu.edu/BioEdit/bioedit.html) to get the scaffold. The bacterial strains were identified online with the Basic Local Alignment Search Tool (BLAST) from
the National Center for Biotechnology Information (NCBI) (http://blast.ncbi.nlm.nih.gov/Blast.cgi).
Results and Discussion
All DNA samples were successfully extracted from each bacterial isolate, which was shown by the results of the PCR amplification. Strong bands were observed on both
gels (Figure 1).
Figure 1:16S rDNA PCR products of isolate 1 to to 22
Most of the sequences acquired from 1stBase yielded in roughly 1500 bp (data not shown) after alignment with BioEdit. The lowest yielding sequence yielded in 1091 bp
(data not shown). All 22 sequences displayed94% (or higher) query coverage and anE-value of 0.0 for the highest ranked result.It was shown that all PSB belonged to
the major group of Proteobacteria. Two classes were distinct, namely the Betaproteobacteria and Gammaproteobacteria. The Betaproteobacteria were solely comprised
of the Burkholderiaceae family, while the Gammaproteobacteria consist of members from the Enterobacteriaceae and Moraxellaceae families. The majority of 16 bacteria
belonged to the genus Burkholderia with the species B. cepacia, B. cenocepacia, B. arboris and B. seminalis. The members of the Enterobacteriaceae were represented
by three isolates from the genus Enteriobacterwith two species of E.aerogenes and one E. asburiae. One single isolate also a member of the Enterobacteriaceae was
identified asErwinia tasmaniensis. The remaining two isolates were identified as members from the genus Acinetobacter with the species A. venetianus and A.
calcoaceticus representing themembers of the Moraxellaceae family.
Conclusion
Identification of plant growth promoting bacteria of associated host plants gives a valuable insight towards effective cropping practices which are nutrient, pest and
disease management among others.The general affinity of phosphate solubilizing bacteriabelonging towards the group of Proteobacteria was confirmed in this study.
Hevea brasiliensis was identified as a valuable hostforProteobacteria with phosphate solubilizing abilities. The large quantity of phosphate solubilizing bacteria belonging
to the genus of Burkholderia gives an incentive for future studies to develop a potential biofertilizer for H. brasiliensis with this genus.
References
Azziz, G., Bajsa, N., Haghjou, T., Taulé, C., Valverde, Á., Igual, J. M., & Arias, A. (2011). Abundance, diversity and prospecting of culturable phosphate solubilizing
bacteria on soils under crop–pasture rotations in a no-tillage regime in Uruguay. Applied Soil Ecology. doi:10.1016/j.apsoil.2011.10.004
Benito, J. M., Lovrich, G. A., Siñeriz, F., & Abate, C. M. (2004). Isolation and Characterization of Seawater Bacter. In J. F. T. Spencer (Ed.), Environmental Microbiology
(pp. 3–10). Humana Press.
Goldstein, A. H., & Krishnaraj, P. U. (2007). Isolation and characterization of mineral phosphate-solubilizing bacteria naturally colonizing a limonitic crust in the southeastern Venezuelan region. Development in Plant and Soil Science, 102, 203–213.
Hautefort, L., & Hinton, J. C. D. (2002). Molecular Methods for Monitoring Bacterial Gene Expression During Infection. In P. Sansonetti & A. Zychlinsky (Eds.), Methods in
Microbiology Vol 31. Molecular Cellular Microbiology.
James, G. (2010). Universal Bacterial Identification by PCR and DNA Sequencing of 16S rRNA Gene. In M. Schuller, T. P. Sloots, G. S. James, C. L. Halliday, & I. W. J.
Carter (Eds.), PCR for Clinical Microbiology (pp. 209–214). Dordrecht: Springer Netherlands. doi:10.1007/978-90-481-9039-3
Krishna, P., Reddy, M. S., & Satyanarayana, T. (2006). Molecular Techniques for Understanding the Microbial Community Structure in Mycorrhizosphere. In K. G. Mukerji,
C. Manoharachary, & J. Singh (Eds.), Microbial Activity in the Rhizosphere (pp. 173–198). Springer Berlin Heidelberg.
111 | MGC10
Pérez, E., Sulbarán, M., Ball, M. M., & Yarzábal, L. A. (2007). Isolation and characterization of mineral phosphate-solubilizing bacteria naturally colonizing a limonitic
crust in the south-eastern Venezuelan region. Soil Biology and Biochemistry, 39(11), 2905–2914. doi:10.1016/j.soilbio.2007.06.017
Ramani, V. (2011). Effect of pesticides on phosphate solubilization by Bacillus sphaericus and Pseudomonas cepacia. Pesticide Biochemistry and Physiology, 99(3),
232–236. doi:10.1016/j.pestbp.2011.01.001
112 | MGC10
ID 016
The Frequency of Y Alu Polymorphism (YAP) Indel in Minangkabau Malays in Peninsular Malaysia
Wan Nurhayati,
Nurhayati, W.H*., Muhd Shah Jehan, A.R*., Norhazwani, G**., Nur Azimah, O**. and Farida Zuraina, M.Y*.
*Faculty of Applied Sciences, Universiti Teknologi MARA (UiTM), 40450 Shah Alam
**Faculty of Applied Sciences, Universiti Teknologi MARA (UiTM) Cawangan Negeri Sembilan,
Email: [email protected]
ABSTRACT:
Minangkabau Malays (Melayu Minangkabau) is one of the Malay sub-ethnic groups in Peninsular Malaysia. During the late 17th and early 18th centuries, migration of
the Minangs from West Sumatra to the state of Negeri Sembilan Darul Khusus in Peninsular Malaysia took place and their descendants now form the main sub-ethnic
group in this state. The genetic polymorphism of Y chromosome at DYS 287 locus in Minangkabau Malays were analyzed. A total of 41 buccal cells from healthy
unrelated individual males from Minangkabau Malays were typed for the DYS 287. The PCR products were separated on 2% (w/v) agarose gel followed by visualisation
under UV light. Three out of 41 samples (7.32%) have shown insertion (YAP+) polymorphism, while the rest of the samples (92.68%) have shown deletion (YAP-)
polymorphism. This is the first report concerning the YAP in the Malay population in Peninsular Malysia. The valuable data obtained in this study will contribute to fill in
the gap in knowledge of YAP distribution in the Malaysian population and will allow a more continuous interpretation of the evolution of YAP.
Keywords-component; Y Alu insertion polymorphism (YAP), DYS 287, FTA, PCR, Minangkabau Malays
INTRODUCTION
The human Y chromosome is a useful marker for studies of human population genetics and has been recognized [1-3]. The non-recombining portion of human Y
chromosome has special features where it is a single haploid and involves father to son transmission only. As a consequence, the DNA sequence on the Y chromosome
preserves a unique record of mutational events that occurred in previous generations. Therefore, polymorphisms in this region have thus been proposed as tools for
investigating male-specific gene flow and for reconstructing paternal history [4].
One of the most useful and widely studied is Y-linked polymorphisms or another name is Y Alu Polymorphism (YAP) element. YAP element (DYS 287 locus) is referred to the
Alu insertion (~300bp) that is present at a specific site on the long arm of the Y chromosome, Yq11 [5]. This element is stable and originated almost 65 years ago as a
component in human DNA [6]. This type of marker has been shown to be valuable for human population studies.
The people of Minangkabau or Minang constitute the majority of the population in Negeri Sembilan Darul Khusus in Peninsular Malaysia and descendents came over from
West Sumatera Province with the capital city of Padang [7]. The Minangkabau are known for the world´s largest matrilineal social system, in which properties such as
houses and land are inherited through the female lineage. The Minangkabau have a history of migrating to Peninsular Malay during the late 17th century and 18th century.
They migrated from West Sumatera to the state of Negeri Sembilan Darul Khusus, especially in Naning, Sg. Ujong and Rembau after the fall of the Malacca Sultanate (8).
Nowadays Minangkabau features are still visible in the traditional architecture and the dialect of Malay spoken in Negeri Sembilan.
This study was conducted on the insertion and deletion of the DYS 287 element in Minangkabau Malays in Peninsular Malaysia. There is still no research carried out in
Peninsular Malaysia involving Malay sub-ethnic groups, especially in Minangkabau Malays as inferred from DYS 287 YAP. Recent studies had only focused on the Bidayuh
ethnics of Sarawak population which was conducted by [9] and also [10] on Kadazan-Dusun population from East Malaysia. These studies had shown that Bidayuh and
Kadazan-Dusun show a small percentage of the insertion DYS 287 YAP.
MATERIALS AND METHODS
A. Subpopulation samples
Ethical approval and written permission from each volunteer was obtained from the UiTM RESEARCH ETHICS COMMITTEE of the UiTM Shah Alam. Buccal cells were
collected from 41 healthy volunteers, from non-related individuals and randomly selected for this study. The Minagkabau Malays were recruited from Kampung Gagu,
Jelebu and Kampung Daching, Beranang from state of Negeri Sembilan Darul Khursus (Fig 1).
The volunteers were interviewed to ensure their family history and their family must have at least three generations who were selected (Fig 2). Those with unknown family
history, mixed marriages and consanguineous marriage were excluded from this study. Before donating a sample, each volunteer read and signed the consent form. In
favour of precise data acquisition, each volunteer filled up the questionnaire, which asked details regarding information on place of birth, ancestry of parents and
grandparents, and also current addresses.The nationalities of each volunteer were defined by the Malaysian Identity Card (MyCard) as registered with the National
Registration Department. Volunteers were photographed with digital camera in front of the volunteer. All of the photographs were stored as JPEG files.
113 | MGC10
Figure 1 Map of the geographical distribution of Minangkabau Malay individuals used in this study.
I
MM
MM
MM
MM
MM
MM
II
MM
III
Figure 2 A pedigree chart for ethnicity of an example of male representative through inclusion factor of three generation of pure Minangkabau Malays (MM)
sub-ethnic groups. Squares designate males and circles represent females. Parents are connected by a horizontal line, and vertical lines lead to
their offspring.
114 | MGC10
B. Sample collection
Sample collection began with vigorously swabbing a Sterile Foam Tipped Applicator (WHATMAN, Germany) inside a volunteer's mouth and rubbed side by side on the inner
surface of the cheek for about one minute. The foam tip was transferred to a FTA card (WHATMAN, Germany) and the colour of FTA card changed from pink to white which
indicated the presence of samples. FTA cards with whole buccal cell deposits were dried and stored at room temperature. The FTA cards were ready for further use.
C. Washing FTA Cards
A 2 mm (1/8 inch) disc of the desired sample spot was punched out by using the 2.00 mm Harris Micro-Punch® Tool (WHATMAN, Germany). The sample disc was placed
into the PCR tube. 200 µl of FTA Purification Reagent (WHATMAN, UK) was added to each PCR tube and incubated for 5 minutes at room temperature. Next, all spent FTA
purification was removed and discarded using a pipette. After that, the PCR tube was added with 200 µl of TE (10 mM Tris, 0.1 mM EDTA) buffer and incubated again for 5
minutes at room temperature. All TE buffer spent was removed and discarded using a pipette. Finally, the FTA disc was allowed to dry at room temperature for about one
hour and the FTA card disc was ready for PCR amplification.
D. PCR amplification
A complete list of the specific oligonucleotide primers are shown in Table I. PCR was performed in the total volume of 25-µl reaction which contained 2.0 mm disk
Whatman® FTA card, 2.0 µl MgCl2 (Solis Biodyne, Estonia), 0.08 mM dNTPs (Solis Biodyne, Estonia), 10x Reaction Buffer BD (Solis Biodyne, Estonia), 10mM
oligonucleotide primer (AITBIOTECH PTE LTD, Singapore) one unit of Taq DNA Polymerase (Solis Biodyne, Estonia) and double distilled water. The PCR cycling conditions
were carried out on a thermal cycler machine (Cleaver).
Each sample was subjected to an initial denaturation of 1 minutes at 94ºC followed by 35 amplification cycles of denaturation at 94ºC for 15 seconds, annealing
temperature for 30 seconds, and followed by extension at 72ºC for 1 minutes. After the final extension at 72ºC for 5 minutes, the samples were kept at 4ºC until the end
of electrophoresis set.
A 8 µl DNA was electrophoresed on 2% agarose gel containing 1.3 μl Gold View™ Nucleic Acid Stain (Lonza, USA) at 100V for about 70 minutes. PCR product was
directly visualized using the Gel Documentation System according to the manufacturer’s instructions and molecular weight was determined using a 100bp DNA ladder
(Solis BioDyne, Estonia).
TABLE I
NAME
PRIMER SETS FOR PCR AMPLIFICATION OF DYS 287 LOCUS
SEQUENCE
EXPECTED
ADAPTED
(5'-3')
PRODUCT
FROM
SIZE (bp)
DYS 287 For
CA,GG,GG,AA,GA,TA,AA,GA,A
A,TA
YAP+:455bp
YAP-:150bp [5]
DYS 287 Rev
AC,TG,CT,AA,AA,GG.GG.AT,G
G,AT
RESULTS AND DISCUSSION
Fig 3 illustrates the photograph of 2% agarose gel containing the PCR product YAP- of Minangkabau Malays while Fig 4 illustrates the photograph of 2% agarose gel
containing the PCR product YAP+ of Minangkabau Malays. The result was successfully amplified as a 150bp for YAP deletion and 450bp for YAP insertion.
The presence of positive control band was used to determine whether the PCR was successful, meanwhile the absence of a negative control band indicates that the PCR is
free from contamination. DYS 287 controls used for PCR amplification are female samples and it showed no amplification of DYS 287 Y Alu element. This states that the
female genome does not exist a Y chromosome because it is a single haploid entity that is passed from father to son only [11]. The allele frequencies distribution of the DYS
287 is reported in Table II.
115 | MGC10
Figure 3
Photograph of a 2% agarose gel containing the PCR products of Minangkabau Malays YAP-, negative control, positive control and female sample.
Lane from extreme left:
Lane 1: 100bp DNA ladder
Lane 2: Minangkabau Malays 4
Lane 3: Minangkabau Malays 7
Lane 4: Minangkabau Malays 19
Lane 5: Minangkabau Malays 24
Lane 6: Minangkabau Malays 25
Lane 7: Minangkabau Malays 27
Lane 8: Minangkabau Malays 31
Lane 9: Minangkabau Malays 30
Lane 10 Minangkabau Malays 33
Lane 11: PCR negative control
Lane 12: PCR positive control
Lane 13: DYS 287 control
Lane 14: 100bp DNA ladder
Figure 4 Photograph of a 2% agarose gel containing the PCR products YAP+ of Minangkabau Malays.
Lane from extreme left:
Lane 1: 100bp DNA ladder
Lane 2-5: No PCR product amplified
Lane 6: Minangkabau Malays 14
Lane 7: Minangkabau Malays 15
Lane 8: Minangkabau Malays 16
Lane 9-19:No PCR product amplified
Lane 20: 100bp DNA ladder
116 | MGC10
TABLE II
ALLELE FREQUENCY DISTRIBUTION DYS 287 MINAGKABAU MALAYS
Malay sub ethnic States
Districts
Total
YAP + YAP+
groups
samples
frequencies
(%)
Minangkabau Negeri
Jelebu
27
0
0.0
Sembilan
Seremban
14
3
7.3
This study has shown that the Minangkabau Malay population lacks the YAP element and only 7.3% of subjects have YAP+. Out of 41 subjects, 92.7% are YAP-. This
means their fathers did not inherit DYS 287 Y Alu Polymorphisms from their common ancestor because Alu insertion polymorphism is identical by descent [12].
A broad study of YAP insertion and deletion polymorphism in African, Europe, Asian and Oceania populations was carried out by [5]. The frequency YAP insertion
polymorphism (YAP+) was significantly higher in the African, Japan and Tibetan populations followed by the Western Eurasian population and at low frequency in some
Asian, and Oceania population [5, 13,14].
Recent study on YAP element among Ahmadiyya Muslim from Qadian, district of Punjab, Pakistan showedno presence of YAP+ [15] and similarly in a research done by
[16] where the study focused on polymorphism of Y chromosome at YAP locus among 25 ethnics groups in Yunnan China shows Primi, Tibetan, Naxi and Naxi (Mosuo) has
the highest YAP+ frequency.
In Southeast Asians, studies conducted by [13], did not find the frequency of YAP+ in any populations (108 Filipinos, 42 Indonesians, and 74 Vietnamese) except in one
Thai male sample. Previous study done by [17] also revealed similar results amongst the Southeast Asian populations (3 Cambodian, 7 Laotian, 12 Philippine, 1 Thai and 3
Vietnamese).
Until now, there is still no research carried out in Southeast Asian population involving ethnic group except Malaysia. In the case of DYS 287 among Malaysian population
has been done by [9] in Kadazan-Dusun ethnic of Sabah population and recently, a local study conducted by [10] in Bidayuh ethnic of Sarawak population. The results
obtained show a small percentage of presence of YAP+ in only 14.4% of Bidayuh and 2% in Kadazan-Dusun.
The results obtained in this study on Minangkabau Malay subjects support the study conducted by [5] and [15] which concludes that most among Asian populations lack
the YAP+ with the exception of the Japanese and Tibetan population. At this moment, it is not very clearly defined why the YAP element has this characteristics distribution
high around Africa, Central Asia and East Asia.
Further studies examining more Malay sub-ethnic groups will provide a better understanding of the pattern of DYS 287 Y Alu polymorphisms in Peninsular Malaysia.
ACKNOWLEDGMENT
This study was supported by Excellent Fund (RIF) granted to Universiti Teknologi MARA (UiTM) (600-RMI/DANA 5/3/RIF (393/2012).
REFERENCES
J. Ge, B. Budowle, J. V. Planz, A. J. Eisenberg, J. Ballantyne, and C. Ranajit, "US forensic Y-chromosome short tandem repeats database. Elseviar," Elseviar, vol.
12, pp. 289-295, 2010.
2] A. Z. Nadia, P. Maria, B. Vincenza, G. Viola, A. H. Mohammed, H. K. Baharak, O. Anna, T. Antonio, S. S-B. Augusta, and S. Ornella, “In search of the genetic
footprints of Sumerians: a survey of Y-chromosome and mtDNA variation in the Marsh Arabs of Iraq,” BMC Evolutionary, Biology, vol. 11(288), pp. 1-46, 2011.
3] D. Primorac, D. Marjanović, P. Rudan, R. Villems, and P. A. Underhill, "Croatian genetic heritage: Y-chromosome story," Croatian Medic. Journal, vol. 52(3), pp.
225-234, 2011.
4] N. Mizuno, T. Kitayama, K. Fujii, H. Nakhara, K. Yoshida, S. Kazumasa, Y. Naoto, N. Minoru and K. Kentaro, "A forensic method for the simultaneous analysis of
biallelic markers identifying Y chromosome haplogroups inferred as having originated in Asia and the Japanese archipelago," Forensic Science International
Genetics, vol. 4, pp. 73-79, 2011.
5] M. F. Hammer, "A Recent Insertion of an Alu Element on the Y Chromosome Is a Useful Marker for Human Population Studies," Molecular Biology Evolution, vol.
11(5), pp. 749-761, 1994
6] M. Tripathi,U. K. Cauhan, P. Tripathi, and S. Agrawal, "Role of Alu element in detecting population diversity," International Journal Human Genetic, vol. 8(1&2), pp.
61-74, 2008.
7] M. A. Azima, "Masalah dan cabaran tanah adat Minang di dunia Melayu dan Indonesia, Malaysian Journal of Society and Space, vol. 5(1), pp. 69-78, 2009.
8] H. H. Haji-Tajuddin, I. Suhaiza, and A. Robiah. Malaysia Negara Kita. MDC Publisher, Kuala Lumpur: Malaysia.2009, pp. 157.
9] R. Vasudevan, C. P. N. Fatihah, and I. Patimah, "Analysis of three polymorphisms in Bidayuh ethnic of Sarawak population," African Journal of Biotecnology, vol.
10(22), pp. 4544-4549, 2011.
1]
117 | MGC10
10] L. H. Lian, and C. L. Koh, "Genetic Polymorphism of two chromosome markers (DYS287 and DYS385) in Kadazan-Dusun population samples from East Malaysia,"
Malays Applied Biology, vol. 35(1), pp. 37-42, 2006.
11] C. A. Tilford, T. Kuroda'Kawaguchi, H. Skaletsky, S, Rozen, L. G. Brown, R. Michael, D. M. John, W. Kristine, S, Mandeep, A. K. Tamara, H. W. Robert, and C. P.
David, "A physical map of the human Y chromosome," Nature, vol. 409, pp. 943-945, 2011.
12] P. Naris, S. Elma, K. Belma, K-P. Lejla, L. Lejla, T. Una, and H. Rifat, "Polymorphic Alu insertions in human populations of Bosnia and Herzegovina," Annals of
Human Biology, vol. 40(2), pp. 181-185, 2013.
13] A. Spurdle, M. F. Hammer, and T, Jenkins, "The Y Alu polymorphisms in Southern Asia populations, and its relationship to other Y specificpolymorphisms,"
American Journal of Human Genetics, vol. 54, pp. 319-330, 1994.
14] Hammer. H, and Horai, S. "Y Chromosomal DNA variation and the peopling of Japan," American Journal Human Genetics, vol. 56, pp. 951-962, 1995.
15] Badaruddoza, A. J. S. Bhanwer, M. Rambani, R. Singh, K. Matharoo, and R. N. K. Bamezai, "Study of YAP element among and endogamous human isolate in
Punjab," International Journal Human. Genetic, vol. 8(3), pp. 269-271. 2008.
16] Honng. S, Yongli. D, Weixiang. L, Jie. Y, Kaiyuan. L, Ruiguang. Z, and Chunjie, X. "The geographical polymorphism of Y chromosome at YAP locus among 25
ethnic groups in Yunnan, China," Science in China, vol. 46(2), pp. 135-140, 2003.
17] C. M. Bravi, G. Bailliet, V. L. Martínez-Marignac, and N. O. Bianchi, "Tracing the original and geographic distribution of an ancestral form of the modern human Y
chromosome," Revista Chilena de Historia Natural, vol. 74, pp. 139-149.
118 | MGC10
ID 022
Individual Identification Database of Kempas in Malaysia
Lee C.T.1*, Tnah, L.H. 1, Lee S.L. 1, Ng, K.K.S. 1, Ng, C.H. 1, Diway, B. 2, Eyen, K3.
1
Genetic Laboratory, Forest Research Institute Malaysia,
2
Sarawak Forestry Corporation, Forest Research Centre
3
Forest Research Centre, Forestry Department
Email: [email protected]
ABSTRACT:
DNA marker technology offers a tool to combat illegal logging activities by providing means to trace the geographic origins of stolen logs or match an alleged stolen log
to its stump. Studies have demonstrated the feasibility of using DNA markers for timber tracking and forensic forestry investigations. As in the case of human forensics,
the establishment of individual identification database is essential for the statistical evaluation of genetic evidence in a court case. At the Forest Research Institute
Malaysia, DNA profiling database have been established for two important timber species, namely Chengal and Ramin. Here we report the DNA profiling database for
another indigenoustimber species, Koompassia malaccensis. Locally known as kempas, K.malaccensis is one of the major commercial timber species in South-East Asia,
of the Family Leguminosae. A total of 1467 K. malaccensis samples collected from 56 locations all over Malaysia were genotyped using nine polymorphic microsatellite
markers or short tandem repeats (STRs). Forensic parameters and the allele frequencies for each locus were estimated, with the minimum allele frequency adjusted to
5/2n. Assuming independence between alleles and loci, the theoretical 9-locus STR profile estimates can range from 7.8631x10-9 to 7.5240x10-48. Based on the results
of STRUCTURE analyses, the individual identification database can be further divided into local databases, namely East Malaysia, West Malaysia and Peat Swamp Ecotype.
From the assignment tests, the mean proportion of baseline individuals correctly assigned to respective subgroups was 99.2%. Hence, the DNA database established for
K. malaccensis is not only useful for individual identification, but also enables geographic traceability of its wood to a certain extent.
INTRODUCTION
Illegal logging is one of the main causes of deforestation. It is a global issue that needs to be addressed urgently as it poses a threat to the sustainable forest
management. DNA marker technology offers a solution in the form of tools for verification, and in the context of enforcement, provide a means to establish link between
the alleged timber sources to the actual geographical origin. Studies have demonstrated the feasibility of using DNA markers for timber tracking and forensic forestry
investigations (Tnah et al. 2009 & 2010, Lowe et al. 2010, Jolivet&Degen 2012, Degen et al. 2012). At the Forest Research Institute Malaysia, DNA databases have
been established for two important timber species, namely Chengal and Ramin. This project aimed to establish individual identification database for another
importanttimber species,Koompassia malaccensis.
Locally known as Kempas, it is one of the major commercial timber species traded in Malaysia and South-East Asia (Soerinegara&Lemmens 1994). It belongs to the
family Leguminosae (Fabaceae), subfamily Caesalpinioideae. In Peninsular Malaysia, kempas was one of the top five sawn timber species exported from January till
November 2010, with a volume of 31 631 m3 valued at RM24.19 mil (Malaysian Timber Industry Board 2011).
MATERIALS AND METHODS
A total of 1467 Kempas samples from 56 locations throughout Malaysia (Table 1) were analysed in this study. The samples from Peninsular Malaysia were from a
previous project. Sampling for this project mainly covered Sabah and Sarawak. Leaf or inner bark samples were collected and stored in silica gel prior to DNA extraction.
The total DNA was extracted using the cetyltrimethyl ammonium bromide (CTAB) method (Murray & Thompson 1980) with modification.
119 | MGC10
Table 1 Sampling locations of the 56 Koompassia malaccensis populations throughout Malaysia with respective sample sizes for the microsatellite analysis.
No.
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
Location
KohMoi
CebarBesar
UluMuda
TelukBahang
Air Cepam
PondokTanjong
UluKenas
Pangkor Selatan
Chikus
SKarangA
SKarangB
RMusa
Kuala Langat
Klau
Semangkok
Lentang
Bukit Lagong
KemasulTambahan
Sungai Lalang
Pasoh
Sungai Menyala
Sungai Udang
GunungBasur
Ulu Sat
Pelagat
HuluBesut
GunungRabong
Ulu Galas
UluJelai
Jerangau
Bukit Bandi
Som
Bukit Kuantan
Pekan
Nenasi
Resak
Air Hitam
Labis
Endau Rompin
Mersing
LenggorA
LenggorB
Panti
Maludam
Kubah
Semengoh
Batang Ai
Mukah
Amang
Putai
Population Code
1
2
3
4
5
6
7
8
9
10
11*
12*
13*
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34*
35*
36*
37*
38
39
40
41
42
43
44*
45
46
47
48
49
50
120 | MGC10
State
Kedah
Kedah
Kedah
Pulau Pinang
Perak
Perak
Perak
Perak
Perak
Selangor
Selangor
Selangor
Selangor
Selangor
Selangor
Selangor
Selangor
Selangor
Selangor
Negeri Sembilan
Negeri Sembilan
Negeri Sembilan
Kelantan
Kelantan
Kelantan
Kelantan
Kelantan
Kelantan
Pahang
Terengganu
Terengganu
Pahang
Pahang
Pahang
Pahang
Pahang
Johor
Johor
Pahang
Johor
Johor
Johor
Johor
Sarawak
Sarawak
Sarawak
Sarawak
Sarawak
Sarawak
Sarawak
Sample size
21
16
10
18
18
33
17
36
19
34
18
13
42
13
15
18
41
21
38
40
38
38
20
40
22
36
10
26
23
37
42
18
20
38
37
12
62
30
26
24
39
25
25
30
22
16
34
20
30
48
51
Niah
52
Lambir
53
Nalumad
54
Sepilok
55
KebunCina
56
Mount Andrassy
* denotes population of peat swamp habitat
51
52
53
54
55
56
Sarawak
Sarawak
Sabah
Sabah
Sabah
Sabah
25
17
10
17
18
11
All the samples were subjected to short tandem repeats (STR) analysisaccording to Lee et al. (2009), using nine STR loci developed by Lee et al. (2006), namely
Kma011a, Kma127, Kma096, Kma082, Kma172a, Kma147, Kma026, Kma109 and Kma057.From the genotypic data, DNA database for individual identification of
Kempas was established, adopting the approach by Tnah et al. (2010). The forensic parameters and allele frequencies for each locus were estimated to characterise the
individual identification database. The minimum allele frequencies were adjusted to 5/2n for further calculation of profile frequency.
Based on the allele frequency distributions of the candidate populations, it is possible to test whether an individual with a particular STR profile is likely to originate from a
given population through assignment tests (Paetkau et al. 1995, Piry et al. 2004). In this study, we performed assignment tests for the three subgroups: East Malaysia,
West Malaysia and Peat Swamp Ecotype, divided via the STRUCTURE analysis(Pritchard et al. 2000).
RESULTS AND DISCUSSION
Individual Identification Database
The forensic parameters for each locus based on the overall samples from Malaysia are given in Table 2. Considering the allele frequencies present in the database for
the entire Malaysia (with the minimum allele frequency adjusted to 5/2n), as well as independence assumption between alleles and loci, the theoretical 9- locus STR
profile estimates can range from 7.8631x10-9 to 7.5240x10-48. This implies that the possible most common STR profile occurs with a frequency of 7.8631x10-9 or one in
127,180,000 trees. Hence, the STR profiling database is useful for individual identification in the case of illegal logging involving K. malaccensis species in Malaysia. The
effects of population differentiation and inbreeding will be incorporated into the calculation of random match probability.
Table 2 Forensic parameters for the nine short tandem repeat loci based on 1467 individuals of Koompasia malaccensis in Malaysia.
A
Ho
He
PIC
MP
PD
Kma011a
19
0.657
0.723
0.685
0.116
0.884
Kma127
22
0.847
0.887
0.876
0.025
0.975
Kma096
17
0.623
0.778
0.746
0.085
0.915
Kma082
30
0.800
0.884
0.874
0.026
0.974
Kma172a
17
0.403
0.674
0.620
0.187
0.813
Kma147
29
0.692
0.835
0.816
0.061
0.939
Kma026
25
0.704
0.835
0.817
0.051
0.949
Kma109
18
0.739
0.850
0.833
0.047
0.953
Kma057
34
0.503
0.757
0.736
0.118
0.882
A: Number of alleles; Ho: observed heterozygosity; He: expected heterozygosity; polymorphism information content. PIC: polymorphic information content;
MP: matching probability; PD: power of discrimination.
Based on the results of STRUCTURE analysis, the individual identification database can be further divided into three local databases, namely East Malaysia, West Malaysia
and Peat Swamp Ecotype (Figure 1). The evaluation of the conservativeness of the combined database were carried out. From the assignment tests, the mean proportion
of baseline individuals correctly assigned to respective subgroups was 99.2% (East Malaysia: 98.7%; West Malaysia: 99.4% and Peat Swamp Ecotype: 99.5%).
121 | MGC10
Figure 1 The individual
identification database can be
further divided into three local
databases, namely East
Malaysia (green), West Malaysia
(red) and Peat Swamp Ecotype
(blue), based on the results of
STRUCTURE analysis.
CONCLUSION
The DNA database established for Kempas will be useful for individual identification in forensic casework. It can also be applied for geographic traceability, in other words,
kempas wood from East Malaysia can be distinguished from those ofWest Malaysia and/or of peat swamp habitat, and vice versa, subject to the feasibility of DNA
extraction from the particular wood sample(s).
ACKNOWLEDGEMENT
This study was funded by the Ministry of Agriculture and Agro-based Industries Malaysia (Project No. 05-03-10-SF1033). We thank Ramli P, Ghazali J, Yahya M, Yasri B,
Rosman I, Rantai J, Jumian J, Chang AB, Sawai P, Andy S, Dino J, Mariam D, Nurul Hudaini M, Sharifah T & Suryani CS for field/technical assistance. The cooperation
from the Forest Department of Peninsular Malaysia and respective State Forest Department is much appreciated. We are also indebted to RimbunanHijau, Golden Cash
Harvest Sdn. Bhd. and Jaya Tiasa Holdings for their logistic supports during our sampling trips at their logging camps.
REFERENCES
Degen B, Ward SE, Lemes MR, Navarro C, Cavers S &Sebbenn AM. 2012. Verifying the geographic origin of mahogany (Swietenia macrophylla King) with DNAfingerprints. Forensic Science International: Genetics 7: 55–62.
Jolivet C &Degen B. 2012. Use of DNA fingerprints to control the origin of sapelli timber (Entandrophragma cylindricum) at the forest concession level in
Cameroon.Forensic Science International: Genetics 6:487–493.
Lee CT, Lee SL, Faridah QZ, Siraj SS, Ng KKS, Norlia B & Mat-Isa MN.2006. Isolation and characterization of microsatellite markers in Koompassia malaccensis
(Leguminosae), an important tropical timber species. Molecular Ecology Notes 6:1198-1201.
Lee CT. 2009. Development of Microsatellite Markers and Genetic Diversity Assessment of Kempas (Koompassia malaccensis, Leguminosae) in Peninsular Malaysia.
Ph.D. Thesis. UPM.
Lowe AJ, Wong KN, Tiong YS, Iyerh S & Chew FT. 2010. A DNA method to verify the integrity of timber supply chains; confirming the legal sourcing of merbau timber
from logging concession to sawmill. SilvaeGenetica 59: 263–268.
Malaysian Timber Industry Board. 2011. Statistics of Peninsular Malaysia: export of sawntimber (by major species). http:// www.mtib.gov.my. Accessed on 2 August
2011.
Murray M & Thompson WF. 1980. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Research 8: 4321–4325.
Pritchard JK, Stephens M & Donnelly PJ. 2000. Inference of population structure using multilocus genotype data. Genetics 155: 945–959.
Soerinegara I, Lemmens RHMJ (Eds). 1994. Plant Resources of South-East Asia 5 (1) Timber Trees: Major Commercial Timbers. Bogor, Indonesia. Pudoc Scientific
Publishers, Wageningen.
Tnah LH, SL Lee, KKS Ng, N Tani, B Subha& YO Rofina. 2009. Geographical traceability of an important tropical timber (Neobalanocarpusheimii) inferred from
chloroplast DNA. Forest Ecology and Management 258: 1918–1923.
Tnah LH, SL Lee, KKS Ng, QZ Faridah& IH Faridah. 2010. Forensic DNA profiling of tropical timber species in Peninsular Malaysia. Forest Ecology and Management 259:
1436–1446.
122 | MGC10
ID 023
Assessment of Variability of CameroonCameroon -based Biparental dura x pisifera Oil Palm Genotypes for Oil Quality Traits and ]
Interrelationships among Traits
BeyegueBeyegue- Djonko H 1, 2; Kushairi A.3; Rajanaidu N.3&Jalani B.S.2
: Faculty of Agronomy & Agricultural Sciences (FASA), University of Dschang
2
: Faculty of Science & Technology, UniversitiSains Islam Malaysia (USIM)
3
: Malaysian Palm Oil Board (MPOB)
Email: [email protected]
1
ABSTRACT:
An oil palm population made of thirteen dura(D) x pisifera (P)biparental genotypes resulting from intra and intercrosses from five dura mother palms from Cameroon and
two pisifera palms, one from Cameroon (CMR) and the other from the Democratic Republic of the Congo (DRC),were field tested for their oil quality trait profiles in a trial
planted at the Malaysian Palm Oil Board Research Station in Keratong (Pahang).The aim was to study the variation among genotypes for fatty acid content, iodine value
and carotene content, and phenotypic correlations among traits. Oil quality profiles were determined using gas chromatography for fatty acid composition (FAC) and
iodine value (IV), and mass spectrophotometry for carotene content (CC). The analysis of variance revealed significant differences among genotypes for all oil quality traits.
Genetic parameters indicated that there were prospects for improvement of performance of genotypes though selection. The magnitudes of genotypic coefficient of
variation (GCV), phenotypic coefficient of variation (PCV) and the broad-sense heritability estimates revealed that improvement of the FAC, IV and CC profiles was
achievable through selection. Genotypes scored remarkably high CC as compared to commercial D x P planting materials with ranging between 500 ppm and 700 ppm,
and could be useful for enhancingthe existing breeding populations. The genotypes CMR x CMR outperformed genotypes CMR x DRC for IV translating thus the higher
combining ability of Cameroon pisifera palm over its counterpart from the DRC for imparting higher unsaturation to mesocarp oil.The correlation analysis indicated that
that selection for high C16:0 would mean indirectly selecting for low IV, whereas selection for high C18:1 would mean selecting for higher IV. The significant positive
correlation between C18:0 and C18:1 contents indicated that selecting for high C18:1 would indirectly select for high C18:0. In the same vein, selecting for higher
C18:0 would indirectly mean to select for lower C16:0 (r=-0.59) and higher IV meaning higher unsaturation.A negative significant correlation was also found between
C16:0 and C18:1 (r=-0.81). The study is a contribution to the evaluation of oil palm germplasm collected by the Malaysian Palm Oil Board worldwide.
Key words:
words Oil palm, assessment, variability, interrelationships, oil quality traits, fatty acids, iodine value, carotene content, gas chromatography, mass
spectrophotometry.
1. INTRODUCTION
Oil palm (Elaeis guineensis Jacq.) is the leading oil crop in the global economy of vegetable oils and fats. The demand for edible vegetable oils is expected to double from
present yearly consumption of around 120 million tonnes to 240 million tonnes by 2050, based on projected per capita consumption and population growth (Corley,
2009). More efficient and productive ways to cultivate oil palm are being investigated including the development of high-yielding planting materials and implementation
of best management practices in plantations (Jalani et al., 2002; Basiron&Simeh, 2005; Kushairi et al., 2011; Rajanaidu et al., 2011)
The fatty acid profile plays a significant role in both the nutritional properties and end-use functionality of edible plant oils. Despite claims relating palm oil to health
hazards, there is more compelling evidence showing that oil palm is one of the world's healthiest vegetable oils. The effect of saturated fatty acids on human metabolism
was investigated and it well established palmitic acid (C16:0) tends to raise LDL-cholesterol whereas stearic acid (C18:0) has neutral effect (Minihane& Harland 2007).
Moreover, the mesocarp of oil palm is abundant in carotenoids and crude palm oil is the richest dietary source of provitamin A (Sambanthamurthi et al., 2000;
Solomons& Orozco, 2003). Recent medical studies have shown that palm oil, particularly virgin or red palm oil, can protect against many common health problems
(Bruce Fife, 2007).
Besides interest for yield and morpho-physiolocial phenotypic traits which are routinely screened in breeding programmes, there is a growing interest in modifying
physic-chemical profiles of palm oil to secure higher income and profits. Increasing the proportion of oleinfraction in palm oil is one avenue in this direction (Corley &
Tinker, 2003). Palm oil from Elaeis guineensis contains less unsaturated fatty acids and incidentally a lower iodine value (IV) as compared to palm oil from Elaeis
oleiefara, which is more similar to olive oil in terms of chemical composition (Murphy, 2007).
This paper aims to study the Cameroon-based dura x pisifera oil palm population with a special interest on fatty acid profiles, iodine values and carotene contents of the
13 biparental genotypes deriving from the Malaysian Palm Oil Board’s oil palm germplasm collection. The fatty acid profile of palm oil is based on contents in lauric acid
(C12:0), myristic acid (C14:0), palmitic acid (C16:0), palimoleic acid (C16:1), stearic acid (C18:0), oleaic acid (C18:1), linoleic acid (C18:2), linolenic acid (C18:3) and
arachidic acid (C20:0). The objectives are (1) to study the extent of variability among the genotypes under testing for fatty acid composition (FAC), iodine value (IV) and
carotene content (CC) of oils; (2) to study the inheritance patterns of oil quality traits; (3) to compare the combining ability of the two pisifera palms for FAC, IV and CC of
oils; and (4) to study the correlations among all oil quality trait.
123 | MGC10
2. MATERIALS AND METHODS
2.1. Materials
The 13 tenera oil palm genotypes under testing are biparentaldura x pisfera progenies obtained by crossing selected parent palms from Cameroon (CMR) and the
Democratic Republic of Congo (DRC/ex-Zaire). Five dura oil palms from CMR germplasm were crossed with two pisifera parent palms, one from the DRC and the other
from CMR (Rajanaidu, 1994; Rafii et al., 2000; Kushairi et al. 2011).
The trial was planted in 1996 at the experimental field of MPOB research station, Keratong (Latitude 2°47´02.20´´N, Longitude 102°56´05.82´´E), Pahang, Malaysia
consisting mainly of weathered soils, predominantly of Rengam Series category which correspond to Ultisols in the USDA taxonomy system (Soil Survey Staff, 2010).
Keratong is characterized by an average rainfall of about 2500 mm/yr. Rainfall are evenly distributed all-year-round to the convenience of oil palm.
2.2. Methods
2.2. Experimental design
The trial was planted in 1996 at the experimental field of MPOB research station, Keratong (Latitude 2°47´02.20´´N, Longitude 102°56´05.82´´E), Pahang, Malaysia. The
13 biparental genotypes were planted in a randomized complete block design (RCBD) replicated twice. Each block was made of 13 plots, with each plot planted with 16
palms from each genotype. The palms were laid out in an equilateral triangular pattern with a distance between any two adjacent palms of 8.84 m, corresponding to a
planting density of 148 palms/ha. The husbandry of plots was carried out according to the standards in use at MPOB (PORIM, 1995; MPOB, 2005).
2.2.3. Sampling of palms and processing of fresh fruit bunches
Bunches of palms deriving from the thirteen biparentaldura x pisifera genotypes under investigation in Trial 0.350, at MPOB research Station, Keratong, were sampled
from July 2011 to December 2012. Harvested fresh fruit bunches (FFB) collected in the field were carefully tagged individually and bagged separately before being
transferred to the laboratory. Once in the laboratory, the bunch was processed according to standard procedures at MPOB (MPOB, 2005)
2.2.4. Determination of Fatty Acid Composition and Carotene Content
Fatty acid methyl esters (FAMEs) of the samples were prepared according to the standard procedure applied at MPOB (MPOB, 2005). About 0.05 g of the oil was
dissolved in 0.95 ml hexane and 0.5 ml sodium methoxide. The reaction mixture was placed in a 2-ml vial then shaken vigorously in a vortex mixer. The clear, separated
methyl ester layer was dried with anhydrous sodium sulphate prior to injection into the gas chromatograph for analysis.
Analyses of fatty acid composition (FAC) of oil samples were carried out in glass columns (1.8 m long and 3 mm internal diameter) using the Perkin Elmer® Clarus® 500
Gas Chromatograph in the laboratory facility at MPOB Research Station, Kluang, Pahang, Malaysia. The identity of fatty acids was established by comparing their
retention times with authentic standards. Calibration was established with standard mixtures of methyl esters. The column temperature was maintained at 180°C while
the injection and detector temperatures were both 220ºC. Helium gas was used as the carrier at a flow rate of 40 ml/min. Data output from the system was in the form
of chromatograms showing peaks for the individual fatty acids. For the percentage of each fatty acid, a data integrator converted the area under each peak to a
percentage of the total area under all the peaks.
The iodine value (IV) of palm oil samples was determined by fitting the unsaturated fatty acid components obtained from gas chromatography profiling into a formula as
given in Equation [1].
IV (cg/g) = (0.8601*C18:1) + (0.1732*C18:2) + (2.616*C18:3) + (0.9504*C16:1) [1]
The carotene content was determined using a spectrophotometer at MPOB Research Station Kluang, Johor. Samples were duly prepared at the laboratory at MPOB
Research Station, Keratong, and then sent to Kluang station for the determination of carotene content. The measurement was taken at 446 nm of the absorbency of a
homogenized and diluted sample, using 1 cm quartz cuvettes. The 2,2,4-trimethylpentane was used as the reagent to dilute the oil samples. Normally, the colour of the
diluted oil is brighter so that the absorbance at 446 nm is within Beer’s Law. In general, all tests must be carried out within the confines of the Law, as outside of it
makes the results inaccurate.
124 | MGC10
2.2.5. Statistical Analyses
The analysis of variance was performed to test the statistical significance of the effects considered according to the fitting model: Yijl = µ + Gi + Rj + GxRij + Ɛijl[2];
Where, Yijl is the lth observation on the ith genotype in the jth replication; µ is the population mean; Gi is the effect of the ith genotype; Rj is the effect of the jth replication;
G*Rij is the interaction of the ith genotype with the jth replication; and Ɛijl is the random error or residual or the deviation of Yijl from its expectation.
The coefficient of Variation (CV), phenotypic coefficient of variation (PCV), genotypic coefficient of variation (GCV), intra-class correlation (t) and broad-sense heritability
(H2) were determined for each character based on the components of variance for the effects considered in the statistical model (Singh &Chaudhary, 1985; Falconer &
Mackay, 1996).
Statistical analyses were performed using the statistical analysis system (SAS) software package version 9.2 (SAS Inst. Inc, 2010). The procedure GLM assisted in
performing the analysis of variance to test the significance of effects considered in models [1] and compute the components of variances and correlation coefficients
among traits with appropriate procedures.
3. Results and Discussion
3.1. Variability among Genotypes for Oil Quality Traits
Significant differences (P<0.01) among genotypes were detected for all oil quality traits (Table 1). The genotype-by-replication interaction effect was non-significant for
all traits. The replication effect was non-significant for all oil quality traits. A significant difference (P<0.05) was observed between the two pisifera male parental palms
tested for all quality traits except C14:0, C18:2 and CC.The micro-environmental variation or residual variance component accounted for a large part to the total variance
for all oil quality traits (σ2W>60%). The largest genotypic variance contribution was recorded by C16:0 (32.68%) which also showed the lowest residual variance
contribution (64.36%) to the total variance. The genotypic contribution was also noticeable for C18:0 (68.37%) and C18:3 (74.40%), which also associated relatively
lower contributions of residual variance to the total variance, 68.37% and 74.40% respectively.
The fatty acid profiles found in this study were consistent with the patterns described in the literature for guineensis palm oil (Clegg, 1973; Purseglove, 1975; Kifli, 1981;
Weiss, 1983; Rajanaidu et al., 2000). The results confirmed that palmitic acid (C16:0) and oleic acid (C18:1) were the two major fatty acid components representing
40.82% and 42.26% of the total FAC respectively. The total saturated fatty acids and unsaturated fatty acids over genotypes amounted 48.00% and 52% respectively,
which is agreement with the 50:50 ratio reported in the literature (Salhunkhe et al., 1992; Rajanaidu et al., 20000; Basiron, 2005). The ranges of fatty acid fractions
and iodine value (IV) of sampled palms over genotypes were in agreement with findings from previous studies on palm oil profiling (Kifli, 1981). The carotene content (CC)
showed a wider variation with values surpassing the range of 500 - 700 ppm commonly reported for the dura x pisifera planting materials. In effect, the mean CC values
of genotypes varied from 964.37 ppm (PK 1668) to 1551.32 ppm (PK 1840) and the range of scores for individual palms was 357.03 - 2226.26 ppm.
The large variability of fatty acid profiles, iodine values and carotene contents observed among the genotypes under testing was consistent with the polygenic nature of
these traits. Previous studies on comparison of genotypes for oil quality traits reported large variability in these attributes of palm oil (Basiron, 2005; Ekpa et al., 2006).
The significant differences among Cameroon-based dura x pisifera biparental oil palm genotypes under investigation indicate the presence of genetic variability in the
material used and provide a good opportunity for oil quality trait improvement.
125 | MGC10
Table 1: Mean square and variance components estimates for oil quality traits
Source of Variation/Item
Replication (R)
Genotype (G)
G*R
Contrast
Male pisifera parent
df
C14:0
(%)
0.03ns
0.50**
0.07ns
C16:0
(%)
2.57ns
72.87**
8.55ns
C16:1
(%)
0.00ns
0.02**
0.00ns
Mean square and variance component
C18:0
C18:1 (%)
C18:2
C18:3
(%)
(%)
(%)
1.075ns
24.05ns
19.55**
0.00ns
59.49**
51.13**
5.44**
0.02**
1.88ns
10.51ns
2.44ns
0.00ns
C20:0
(%)
0.01ns
0.15**
0.01ns
IV (cg/g)
CC (ppm)
1
12
12
C12:0
(%)
0.00ns
0.00**
0.00ns
11.47ns
24.48**
3.86ns
501398.55ns
594766.41**
115376.71ns
1
0.00**
1.98**
269.44*
0.03*
16.29**
242.71**
1.02ns
0.07**
0.15**
148.59**
268663.26ns
0.01
0.03*
1.70
16.29**
9.78
242.71**
2.39
1.02ns
0.00
0.07**
0.01
0.15**
4.52
148.59**
133729.34
268663.26ns
0.00
(11.7
2)
0.00
(0.00)
0.00
(0.41)
0.00
(87.8
8)
17.98
53.12
0.07
0.12
0.52
(29.10)
2.02
(18.77)
0.12
(4.90)
0.00
(23.03)
0.00
(6.87)
0.83
(16.45)
19027.20
(13.99)
0.00
(0.00)
0.05
(2.54)
1.21
(68.37)
0.05
(0.51)
0.17
(1.60)
8.50
(79.12)
0.10
(3.87)
0.01
(0.40)
2.23
(90.83)
0.00
(0.00)
0.00
(2.57)
0.00
(74.40)
0.00
(0.00)
0.00
(1.55)
0.01
(91.58)
0.05
(1.00)
0.00
(0.00)
4.14
(82.55)
2608.00
(1.92)
0.00
(0.24)
114007.30
(83.85)
35.79
18.86
1.10
5.84
25.09
6.90
2.92
42.26
14.19
16.11
1.49
9.25
31.04
13.05
0.05
0.39
14.81
22.65
0.11
0.46
22.52
3.81
2.04
53.47
21.35
26.18
337.90
1290.88
*
Error
CMRxCMR vs. CMRxDRC
328
1
0.00
0.00**
17.43
1.98**
6.95
269.44*
σ2G
0.00
(11.77)
2.60
(32.68)
σ2R
0.00
(0.00)
0.00
(0.00)
0.00
(88.23)
0.02
(21.9
0)
0.00
(0.00)
0.00
(0.00)
17.22
(78.1
0)
26.54
29.13
0.25
0.85
*
σ2G*R
σ2W
r2
CV (%)
Root MSE
Mean
*
17.62
39.71
0.01
0.03
0.00
(0.00)
0.24
(2.97)
5.12
(64.36)
38.96
5.54
2.26
40.82
: significant at P<0.05; **: Significant at P<0.01; ns: non- significant
C12:0 =Lauric acid; C14:0=Myristic acid; C16:0=Palmitic acid; C16:1=Palmitoleic acid; C18:0=Stearic acid; C18:1=Oleic acid;
C18:2=Linoleic acid; C18:3=Linolenic acid; C20:0=Arachidic acid
3.2. Estimation of Genetic Parameters
The marked superiority of PCV over GCV estimates for all oil quality traits investigated, as presented in Table 2, were a clear indication of high influence of environmental
factors in the phenotypic values recorded by genotypes and individual palms within genotypes (Jawahar& Sharma, 2006). According to Deshmukh et al. (1986),
phenotypic and genotypic coefficient of variation greater than 20% are considered high, whereas values less than 10% are to be low and values between 10 and 20% as
medium. Accordingly, characters which showed high PCV values were C16:1 (56.51%), C12:0 (42.30%), C14:0 (32.99%) and CC (28.29%) while C16:0 96.91%),
C18:1 (7.73%) and IV (4.17%) recorded the lowest values. Medium GCV values were observed for C16:1 (19.35%), C14:0 (15.44%) and C12:0 (14.51%) and the
lowest for C18:3, C20:0, C16:0, C18:2, C18:1 and IV (<10%).
Estimates of genotypic variance and heritability provide useful guidelines for answering many questions which arise in a plant breeding programme (Dudley et al., 1969).
The information on variability and heritability of characters is essential for identifying characters amenable to genetic improvement through selection (Vidya et al., 2002).
Thus, oil quality traits IV, C18:1, C18:3, C14:0, C18:0 and C16:0 which showed moderated to high broad-sense heritability could be considered to have a higher
amenability to improvement through selection as compared to C18:2 and C20:0 which scored the lowest heritabilities. Although the genotypic coefficient of variation
expresses the extent of genetic variability present in the genotypes for various traits, it does not provide full scope to assess the variation that is heritable. Heritable
variation is useful for permanent genetic improvement (Singh, 2000). The most important function of the heritability in the genetic study of quantitative characters is its
predictive role to indicate the reliability of the phenotypic value as a guide to breeding value (Dabholkar 1992; Falconer & Mackay 1996).
3.3. Performance of Genotypes for Oil Quality Traits
The mean phenotypic values of genotypes for C16:0 varied from 38.066% (PK 1944) to 43.427% (PK 1668) with a range for individual palms of 31.97 - 47.17%, and
an overall mean of 40.82%. These results are similar to those found by Noh et al. (2002) when evaluating oil palm germplasm for Angola for oil quality traits. An
126 | MGC10
assessment of commercial dura x pisifera materials for C16:0 profiles reported mean progeny values ranging from 41.8% to 46.8% (Tan & Oh, 1981), which expressed
a lower variability as compared to the current Cameroon-based oil palm genotypes.
Oleic acid (C18:1) is the monounsaturated fatty acid the most represented in palm oil (Clegg, 1973; Weiss, 1983). The mean scores of genotypes for C18:1 varied from
39.920% (PK 1668) to 44.881% (PK 1957) within the range for individual values of 34.08% - 51.64% and an overall mean of 42.26%. These results are comparable to
those obtained by Noh et al. (2002) in the study of fatty acid profiles of the Angolan oil palm germplasm. Early studies also reported similar results (Clegg, 1973;
Purseglove, 1975; Weiss, 1983; Maiti et al, 1988; Rajanaidu et al., 2000). The linoleic content of genotypes varied from 8.568% (PK 1676) to 10.054% (PK 1721)
within a range of 0.09% - 13.94%, with an overall mean of 9.25%. Tan & Oh (1981) reported similar values for the commercial D x P materials investigated whereas
Noh et al. (2002) found higher estimates for linoleic acid content and a wider range for individual values. Linoleic acid is a significant contributor to the oil IV and higher
contents in this fatty acid are nutritionally desirable.
The mean carotene content of genotypes varied from 964.37 ppm (PK 1668) to 1551.32 ppm (PK 1840) within the range of 357.03 ppm - 2226.26 ppm. The mean CC
values scored by genotypes were higher than the values usually reported for D x P materials with values included between 500 and 700 ppm (Kifli, 1981; Rajanaidu&
Tan, 1983; Kushairi et al., 2011). Choo et al. (1989) reported Carotene contents of 997 ppm for dura, 673 ppm for tenera and 428 ppm for pisifera respectively, which
were superseded by the material currently investigated. The study conducted by Noh et al. (2002), reported higher carotene contents for Angolan oil palm germplasm
which ranging from 211 ppm 10 2604 ppm, with progeny mean values varying from 409 ppm to 1280 ppm. The current materials present high prospects with regard to
carotene content, and may be introgressed in breeding populations developed for high carotene content palm oil. Almost all genotypes genotypes could be considered
based on the criterion of CC > 1000 ppm (Kushairi et al., 2011).
The IV expresses the level of unsaturaion of palm oil oil. The fatty acid fractions contributing to the IV include palmitoleic, oleic, linoleic and linolenic acid contents. The
mean scores for IV index varied from 51.769cg/g (PK 1668) to 55.504 cg/g (PK 1944). It is worth noting that genotypes from crosses CMR x DRC predominantly
outperformed genotypes from CMR x CMR for C16:0, and conversely, genotypes from the latter group were superior to those of the former for C18:1 and IV with few
exceptions in the ranking.The results on IV profiles were in agreement with the reports from Rajanaidu& Tan (1983) and Noh et al., (2002). The IV scores of genotypes
and individual palms were aligned to common values found in oil palm genotypes which are exploited commercially (Rajanaidu et al, 2000).
The relatively high level of palmitate (>40%) provides a degree of stability to the palm oil that makes it suitable for high temperature frying applications (Broun et al.,
1999; Murphy, 2007). The approximately 40% oleate and 10% linoleate of palm oil has been shown to lower total serum cholesterol, responsible for the movement of
cholesterol within the bloodstream, by lowering the level of the low-density lipoprotein cholesterol (LDL) (Sundram et al., 2003). Furthermore, the high level of the
desirable high-density lipoprotein cholesterol (HDL) associated with the removal of cholesterol from the bloodstream, has been proven to protect against heart diseases
(Sundram, 1997; Pedersen et al., 2005). Besides the nutritional benefit, the increasing demands from oleochemical industries have prompted efforts from breeding to
increase oleate content and diversify the offer of products and by-products from oil palm cultivation (Norden et al., 1987; Kushairi et al, 2011).
The comparison of the two sets of crosses revealed a significant superiority of crosses CMR x CMR for C18:0, C18:1 and IV over CMR x DRC. The opposite was
observed for C12:0, C16:0, C16:1, C18:3 and C20:0 whereby CMR x DRC outperformed CMR x CMR. Differences were observed among the two groups for C14:0,
C18:1 and CC, but these were not revealed significant. The superimposition of the comparison of means of genotypes over that of both set of crosses could allow
inferring the superiority of genotypes CMR x CMR for IV, meaning higher unsaturation or rather less saturation, to the high combining ability of the Cameroon pisifera
parent palm for that component.
3.4. Correlation Analysis among Oil Quality Traits
The highly negative significant correlations between C16:0 and C18:0 (r= -0.57), C16:0 and C18:1 (r= -0.81), and C16:0 and IV (r= -0.70) were compelling indications
that an increase in palmitic acid content would contribute to lower the unsaturation level by reducing substantially the content in oleic acid (C18:1) (Table 2). Similar
results were reported by Mohd Din (1999) and Noh et al., (2002). Selection of genotypes associating high contents of unsaturated fatty acid with high stearic acid
content (C18:0) with low palmitic acid content (C16:0) would contribute to increase the iodine value and the market value of palm oil produced.
Despite the strong negative association found between C18:1 and C18:2 (r= -0.68) selection for high C18:1 would tend to increase the IV value (r=0.46). Correlations
studies among fatty acid contents in groundnut (Arachishypogeae) reported a negative association between oleic acid content and linoleic acid content (Nordenet al.,
1987; Moore &Knauft, 1989; Mercer et al.,1990), since linoleic acid is produced from the conversion of oleic acid (Mozingo& Steele, 1982). Thus, selection for high
oleic/linoleic ratio was relatively straight forward because selection of genotypes with high oleic acid would result in lower levels of linoleic acid. But the negative
correlation between C18:1 and C18:2 was a major obstacle to resolve in order to achieve a faster unsaturation level, which would mean obtaining a larger fraction of
liquid oil fraction (Noh et al., 2002).
The correlation analysis indicated that selection for high C16:0 would mean indirectly selecting for low IV, whereas selection for high C18:1 would mean selecting for
higher IV. None of C16:0 and C18:1 could be used for indirect selection for CC since the correlations between the formers with the latter were non-significant. The
significant positive correlation between C18:0 and C18:1 contents indicated that selecting for high C18:1 would indirectly select for high C18:0. In the same vein,
127 | MGC10
selecting for higher C18:0 would indirectly mean to select for lower C16:0 (r=-0.59) and higher IV or higher unsaturation level (Arasu, 1985; Mohd Din, 1999; Noh et al;
2002).
Table 2: Correlation coefficients for oïlquality traits
Trait
C14:0
0.73**
C16:0
0.55**
0.68**
C16:1
0.15**
0.14*
0.31**
Oil quality trait and Pearson’s correlation coefficien
C18:0
C18:1
C18:2
C18:3
C20:0
-0.30**
-0.47**
0.11ns
-0.11*
0.08ns
-0.37**
-0.64**
0.22**
-0.06ns
0.20**
-0.57**
-0.81**
0.27**
-0.35**
0.09ns
-0.46**
-0.15**
0.12*
-0.31**
0.04ns
0.20**
-0.14*
0.50**
-0.04ns
**
ns
-0.68
0.09
-0.17**
0.01ns
0.14*
0.14*
C12:0
C14:0
C16:0
C16:1
C18:0
C18:1
C18:2
C18:3
C20:0
I.V.
CC
*: significant; **: highly significant (P<0.01); ns: non- significant
I.V.
-0.46**
-0.55**
-0.70**
-0.03ns
0.10ns
0.44**
0.36**
0.17**
-0.03ns
CC
0.18**
0.14*
0.03ns
-0.02ns
0.04ns
-0.03ns
-0.05ns
0.08ns
0.25**
-0.10ns
4. CONCLUSION
Significant variability in fatty acid composition, iodine value and carotene content was detected among the thirteen Cameroon-based dura x pisifera oil palm genotypes.
Genetic parameters indicated that there were prospects for improvement of performances of genotypes though selection. The magnitudes of genotypic coefficient of
variation (GCV), phenotypic coefficient of variation (PCV) and the broad-sense heritability estimates revealed that improvement of the fatty acid, iodine value and carotene
content profiles was achievable through selection. Genotypes scored remarkably high carotene contents (CC) as compared to CC of the commercial D x P planting
materials which lie within the range 500 ppm to 700 ppm, and could advantageously be explored for enrichment of existing breeding populations. The genotypes CMR x
CMR outperformed genotypes CMR x DRC for IV translating thus the higher combining ability of Cameroon pisifera palm over its counterpart from the DRC for imparting
higher unsaturation level to palm oil. The correlation analysis indicated that selection for high C16:0 would mean indirectly selecting for low IV, whereas selection for high
C18:1 would mean selecting for higher IV. The significant positive correlation between C18:0 and C18:1 contents indicated that selecting for high C18:1 would indirectly
select for high C18:0. In the same vein, selecting for higher C18:0 would indirectly mean to select for lower C16:0 (r=-0.59) and higher IV meaning higher unsaturation
level of palm oil.
ACKNOWLEDGEMENTS
The authors are grateful to the Director-General of MPOB for the permission to publish this paper. The commitment of the staff of MPOB Kluang and Keratong Research
Stations for data collection and processing is highly acknowledged. The assistance of Assoc. Prof. Dr. M. A. Rafii in data analyses is gratefully acknowledged. The lead
author gratefully acknowledges the sponsorship by the Government of Malaysia under the auspices of Malaysian International Scholarship (MIS) programme for his
graduate studies in Malaysia.
REFERENCES
Amri, I.N. 2011. The Lauric (Coconut and Palm Kernel) Oils. In: Gunstone, F. (ed.). Vegetable Oils in Food technology: Composition, Properties and Uses. pp. 169-197.
Arasu, N.T. 1985. Genetic variation for Fatty Acid Composition in the Oil Palm (Elaeis guineensisJacq.). (PhD Thesis). University of Birmingham, UK.
Basiron, Y. & M.A. Simeh. 2005. Vision 2020 - The Palm Oil Phenomenon. Oil Palm Industry Economy Journal. Vol. 5 (2): p. 10.
Basiron, Y. 2005. Chapter 8: Palm Oil. In: Shahidi, F. (ed.). Bailey’s Industrial Oil and Fat Products, Sixth Edition, Six Volume Set. New Jersey: John Wiley & Sons Inc. pp.
333-429.
Broun, P., S. Gettner& C. Momerville. Genetic Engineering of Plant Lipids. Annual Review of Nutrition. Vol. 19. pp. 197-216.
Bruce Fife, N.D. 2007. The Palm Oil Miracle. Colorado: Piccadilly Books Ltd. 191 p.
Cahon, E.B., T.E. Clemente, H.G. Damude and A.J. Kinney. 2009. “Modifying Vegetable Oils for Food and Non-food Purposes”. In Vollmann, J. & I. Rajcan (ed.).
Handbook of Plant Breeding-Oil Crop. Springer Science + Business Media, LLC, London, New York. PP. 31-56.
Canapi, C.E., Y. T. V. Agustin, E. A. Moro, Jr. EconomicoPedrosa& M. L.J. Bendano. Coconut Oil. 2005. In: Shahidi, F. (ed.). Bailey’s Industrial Oil and fat Products, Sixth
Edition, Volume1. Edible Oil and Fat Products: Chemistry, Properties, and Health Effects. Wiley-Interscience, Publisher. pp. 123-147.
128 | MGC10
Choo, Y.M., S.C. yap, A.S.H. Ong, C.K. Oii and S.H. Goh. 1989. “Palm Oil Carotenoids”. Proceedings of the 1989 PORIM International Palm Oil Congress – Chemistry
and Technology. Bangi, Malaysia: PORIM. pp. 42-47.
Clegg, A.J. 1973. Composition and Related Nutritional and Organoleptic Aspects of Palm Oil. J. Am. Oil Chem. Soc. Vol. 50. (8): pp. 321-324.
Comstock, R.E & H.F. Robinson. 1952. Genetic Parameters, their Estimation and Significance. Proceedings of the Sixth International. Grasslands Congress. pp. 284-291.
Corley, R.H.V. 2009. How Much Palm Oil Do We Need? Environmental Science & Policy, Vol. 12. pp. 134-139.
Corley, R.H.V. & P.B. Tinker. 2003. The Oil Palm. 4th Edition. World Agricultural Series. Oxford: Blackwell Publishers Ltd.
Dabholkar, A.R. 1992. Elements of Biometrical Genetics. New Deli: Concept Publishing Company. p. 431.
Deshmukh, S.N., M.N. Basu, & P.S. Reddy. 1986. Genetic Variability, Character Association and Path Coefficient of Quantitative Traits in Virginia Bunch Varieties of
Groundnut. Indian J. Agric. Sci.Vol. 56. pp. 816-821.
Dudley, J.W. & R.H. Moll. 1969. Interpretation and Use of Estimates of Heritability and Genetic Variances in Plant Breeding. Crop Science. Vol. 9. pp. 257-262.
Dyer, J.M. & R.T. Mullen. 2005. Development and Potential of Genetically Engineered Oilseed Crops. Seed Science Research. Vol. 15. pp. 255-267.
Ekpa, O.D., E.P. Fubara& F.N.I. Morah. 2006. Variation in Fatty Acid Composition of Palm Oils from Two Varieties of the Oil Palm (Elaeis guineensis). Journal of the
Science of Food and Agriculture. Vol. 64 (2): pp. 483-486.
Falconer, D.S. & T.F.C. Mackay, 1996. Introduction to Quantitative Genetics. 4th Edition. Harlow, England: Longman Group Ltd. p. 464.
Hayati, A., R. Wickneswari, I.Maizura& N. Rajanaidu. 2004. Genetic Diversity of Oil Palm (ElaeisguineennsisJacq.) Germplam Collections from Africa: Implications for
Improvement and Conservation of Genetic Resources. Theor. Appl. Genet. Vol. 108. pp. 1274-1284.
Idris,A.S., A. Kushairi, S. Ismail & D. Ariffin. 2004. Selection for Partial Resistance in Oil Palm Progenies to Ganoderma Basal Stem Rot. Journal of Oil Palm Research. Vol.
16. (2): pp. 12-18.
Jalani, B. S., Y. Basiron, A. Darus, K. W. Chan, & N. Rajnaidu. 2002. Prospects of Elevating National Oil Palm Productivity: a Malaysian Perspective. Oil Palm Industry
Economic Journal. Vol. 2. (2): P. 9.
Johnson, H.W., H.F. Robinson & R.E. Comstock.1955. Estimation of Genetic and Environmental Variability in Soybean. Agronomy Journal Vol.47. pp. 314-318.
Kifli, H. 1981. Studies on Palm Oil with Special Reference to Interesterification. (PhD Thesis). University of St. Andrews, United Kingdom. pp. 209.
Kularatne, R.S. 2000. Assessment of Genetic Diversity in Natural Oil palm (Elaeis guineensisJacq.) Using Amplified Length Polymorphism Markers. (PhD Thesis).
UniversitiKebangsaan Malaysia.
Kushairi, A., A. Mohd Din and N. Rajanaidu. 2011. Oil Palm Breeding and Seed Production. In Basri, M. W., Y.M. Choon& K.W. Chan (ed.). Further Advances in Oil palm
research (2000-2010) Volume1. Bangi, Malaysia: Malaysian Palm Oil Board (MPOB). pp. 47-99.
Maiti, S., M.R. Hedge& S.B. Chattopaghyay. 1988. Handbook of Annual Oilseed Crops. New Delhi: Oxford & IBH Publishing Co, Pvt. Ltd. p. 325.
Mercer, L. C., J.C. Wynne & C.T. Young. 1990. Inheritance of Fatty Acid Content in Peanut Oil. Peanut Science. Vol.17. pp. 17-21.
Minihane, A.M. & J.I. Harland. 2007. Impact of Oil Used by the Frying Industry on Population Fat Intake. Crit. Rev. Food Sci. Nutr. 47: 287-297.
Mohd Din, A. 1999. Genetic Variation for Yield, Bunch Components and Vegetative Traits in Oil Palm (Elaeis oleifera) and Interspecific Hybrids. (PhD Thesis). Bangui:
UniversitiKebangsaan Malaysia. p. 229.
Moore, K. M. & D.H. Knauft. 1989. The Inheritance of High Oleic Acid in Peanut. Jounal of Heredity. Vol. 80. pp. 252-253.
MPOB. 2005. MPOB Test Methods. Bangi, Malaysia: Malaysian palm Oil Board (MPOB). p. 414.
Murphy, D. J. 2007. Future prospects for oil palm in the 21st century: Biological and related challenges. European Journal of Lipid and Technology. Special Issue: Palm
Oil. Vol. 109 (4). pp. 1296-1306.
Noh, A., N. Rajanaidu, A. Kusahiri, M.Y. Rafii, A. Mohd Din, Z.A. Mohd Isa & G. Saleh. 2002.Variability in Fatty Acid Composition. Iodine Value and Carotene Content in
the MPOB Oil palm germplasm Collection from Angola. Journal of Oil Palm Research. Vol. 14. (2): pp. 18-23.
Norden, A. J., D. W. Gorbet, D. A. Knauft& C. T. Young. 1987.Variability in Oil Quality among Peanut Genotypes in the Florida Breeding Program. Peanut Science. Vol. 14
(1). pp. 7-11.
Pedersen, J.I., H. Muller, H. Selfjeflot& B. Kirkhus. 2005. Palm Oil versus Hydrogenated Soybean Oil: Effects on Serum Lipids and Plasma Haemostatic Variables. Asia
Pacific Journal of Clinical Nutrition. vol. 14. (4). pp. 348-357.
Purba, A.R., J.L. Noyer, L. Baudouin, X. Perrier, S. Hamon& P.J.L. Lagoda. 2000. A New Aspect of Genetic Diversity of Indonesian Oil Palm (EIaeis guineensisJacq.)
Revealed by Isoenzyme and AFLP Markers and Its Consequences for Breeding. Theor. Appl. Genet. Vol. 101. pp. 956-961.
Purseglove, J.W. 1975. Tropical Crops: Monocotyledons 479-510. London: English Language Book Society & Longman.
129 | MGC10
Rafii, M.Y., N. Rajanidu, A. Kushairi, B.S. Jalani, B.S. & A. Mohd Din. 2000. “Evaluation of Cameroon and Zaire Oil Palm Genetic Materials”. Proceedings of the
International Symposium on Oil Palm Genetic Resources and Utilization. Bangi, Malaysia: MPOB. pp. G1-G34.
Rajanaidu, N. & B.K. Tan. 1983. Variability of Fatty Acid Composition (FAC) within Bunches in the Oil Palm Elaeis guineensis. Oleagineux, Vol. 38. (1). pp. 581-584.
Rajanaidu, N., A. AzisAriffin, B.J. Wood & S. Sarjit. 1988. Ripeness Standards and Harvesting Criteria for Oil Palm Bunches. Proceedings of the 1987 International Oil
Palm Conference on Progress and prospects.Bangi, Malaysia: PORIM. pp. 224-230.
Rajanaidu, N. 1994. PORIM Oil Palm Gene Bank: Collection, Evaluation, Utilization and Conservation of Oil palm Genetic Resources. Malaysia: PORIM. p. 19.
Rajanaidu, N., A. Kushairi& C.K. Weng. 2011. Oil Palm Biomass: Its Genetic Variability, Certification and Sustainability. In Mohd Basri, W., C.Y. May & C.K. Weng (ed.).
Further Advances in Oil Palm Research (2000 – 2010). Bangi, Malaysia: Malaysian Palm Oil Board. p. 28-46.
Rajanaidu, N., A. Kushairi, M.Y. Rafii, A. Mohd Din, I. Maizura& B.S. Jalani. 2000. Oil Palm Breeding and Genetic Resources. In: Basiron, Y., B.S. Jalani& K.W. Chan
(ed.). Advances in Oil Palm Research. Bangi, Malaysia: Malaysian Palm Oil Board (MPOB). pp. 171-237.
Salunkhe, D.K., J.K. Chavan, R.N. Adsule& S.S. Kadam. 1992. World Seeds. Chemistry, technology and Utilization. New York: Van Nistrand Reinhold. p. 544.
Sambanthamurthi, R., K. Sundram& Y. Tan. 2000. Chemistry and Biochemistry of Palm Oil. Progress in Lipid Research. Vol. 39, pp. 507-558.
SAS Institute Inc. 2010. SAS/STAT® 9-22. User’s Guide. Cary, NC: SAS Institute Inc.
Sharma, J.R. 2006. Statistical and biometrical Techniques in Plant Breeding. New Delhi: New Age International (P) Ltd., Publishers. p. 432.
Sundram, K. 1997. Modulation of Human Lipids and Lipoproteins by Dietary Palm Oil and Palm Olein: a Review. Asia Pacific Journal of Clinical and Nutrition. vol. 6. (1).
pp. 12-16.
Sundarm, K., R. Sambanthamurthi& Y. Tan. 2003. Palm Fruit Chemistry and Nutrition. Asia Pacific Journal of Clinical and Nutrition. vol. 3. (3). pp. 355-362.
Singh R.K. & B.D. Chaudhary. 1985. Biometrical Methods in Quantitative Genetic Analysis. New Delhi: Kalyani Publishers. p. 318.
Singh, P. & S.S. Narayanan. 1993. Biometrical Techniques in Plant Breeding. New Delhi: Kalyani Publishers. p. 182.
Soil Survey Staff. 2010. Keys to Soil Taxonomy 11th Edition. Washington, DC: USDA-Natural Resources Conservation Service.
Southworth A, R.H.V. Corley, J.J. Hardon& B.J. Woods.1976, Harvesting. Oil Palm Research. Amsterdam: Elsevier. pp. 469-477.
Tan, B.K. & C.H. Oh. 1981. Malaysian palm Oil Chemical and Physical Characteristics. PORIM technology. No. 3. pp. 5.
Vidya, C., S.K. Oommen& K. Vijayaraghava. 2002. Genetic Variability and Heritability of Yield and Related Character in Yard Long bean. J. Trop . Agric., Vol. 40. pp. 1113.
Vollmann, J. and I. Rajcan. 2009. Oil Crop Breeding and Genetics. In Vollmann, J. and I. Rajcan (ed.), Handbook of Plant Breeding - Oil Crop. Springer Science +
Business Media, LLC, London, New York. pp. 1-30.
Weiss, T.J. 1983. Food Oils and Their Uses, 2nd Edition. Westport, Conn.: The AVI Publishing Co., Inc. p. 310.
130 | MGC10
ID 026
Genetic Identification of Wild Aromatic Tropical Orchid (Aerides) using Inter Simple Sequence Repeat Marker:
A Breeding Strategy for Conservation
Sivanaswari, C.1 ,Thohirah, L.A.2, Abdullah, N.A.P. 2, and Fadelah, A.A. 1.
1
Horticulture Research Centre, MARDI, Serdang
2
Department of Crop Science, Faculty of Agriculture, Universiti Putra Malaysia
Email: [email protected]
ABSTRACT:
Aerides odorata, Aerides odorata var. Yellow, Aerides quinquevulnera var. Calyana, Aerides flabellata and Aerides houlletiana are five wild and endangered tropical orchid
species with immense floricultural traits. Comparative study using PCR based marker, ISSR, were performed to access the genetic variation among these aromatic
orchids. Among 15 ISSR primers tested, 14 primers showed reproducible bands. 71 bands out of 75 bands were polymorphic. A. odorata and A. odorata var. Yellow with
A. flabellata and A. houlletiana were closest genetically. While, A. quinquevulnera var. Calyana was found to be most genetically diverse as compared to the other four
species. Physical clustering of the loci present in the species were identified. Loci comparison proved unique relationship through ISSR amplification where there were
some specific locus present in specific species while some loci found in two and more species. Presence and absence of fragments will be used for identifying species.
An understanding of species relationship is prerequisite for the effective utilization of the genetic variation available to a breeder.
INTRODUCTION
Aerides odorata, Aerides odorata var. Yellow, Aerides quinquevulnera var. Calyana, Aerides flabellata and Aerides houlletiana are rare and endangered vandaceous
orchids with immense floricultural traits. All of these orchids have an attractive fragrance. They are wild, vastly distributed in Malaysia and have not been commercially
cultivated. Genetic studies in conservation biology have been the subject of considerable discussions and have increasingly been emphasized because assessment of the
level and distributions of genetic diversity within species may not only contribute to knowledge of their evolutionary history and potential, but is also critical for their
conservation (Hamrick and Godt, 1996; Frankham et al., 2002). Although many studies have been carried out on orchids, very little is known about their levels and
patterns of genetic variation, particularly at DNA level (Parab and Krishnan, 2008). Nevertheless, genetic studies of Aerides species are poorly represented in the
literatures although efforts have been made in recent decades toward this direction (Ackerman and Ward, 1999; Wong and Sun, 1999; Alexandersson and Agren, 2000;
Ehlers and Pedersen, 2000; Sun and Wong, 2001; Li et al., 2002; Forrest et al., 2004 and Hollingsworth et al., 2004). Understanding the genetic resources and
diversity is fundamental for the improvement of hybrid of the genus Aerides through breeding. ISSR-primers have been widely used for DNA fingerprinting and assessing
genetic diversity in closely related germplasm (Charters et al.,1996 and Blair et al., 1999). They are highly polymorphic DNA markers. The consistency and reliability
make this type of molecular marker particularly suitable for evaluating genetic diversity and phylogeny among plant species and populations (Weber 1990 and
Zietkiewicz et al., 1994). Genetic diversity analysis and assignment of cultivars to heterotic groups would provide valuable information for plant breeding programmes. To
develop a strategy for the conservation and sustainable utilization of this species, and to advance understanding of the genetic distance of this species, the genetic
characterization of these five Aerides species using the ISSR technique were investigated. The objectives of this study was aimed at evaluating the genetic relationship
and detecting the genotypic polymorphisms between A. odorata, A. odorata var. Yellow, A. quinquevulnera var. Calyana, A. flabellata and A. houlletiana using ISSR
markers.
MATERIALS AND METHODS
Leaves of A. odorata, A. odorata var. Yellow, A. quinquevulnera var. Calyana and A. flabellata and A. houlletiana were used to extract the DNA.
DNA extraction: The DNA was isolated using a modified CTAB (cethythrimethyl ammonium bromide) method (Edwards et al., 1991). For each accession, about 5g of
leave tissue was ground to a fine powder using liquid nitrogen, which was then suspended in 20 mL of extraction buffer (20 mM EDTA at pH 8.0, 100 mM of Tris-HCl at
pH 8.0, 1.5 M NaCl, 2% CTAB and 1% β-mercaptoethanol). The suspension was mixed well, incubated at 60°C for 45 minutes, followed by chloroform; isoamyl alcohol
(24:1) extraction and precipitated with 0.6 volume of isopropanol at -20°C for one hour. The DNA was pelleted down by centrifugation at at 12,000 rpm for 10 minutes
and was then suspended in TE buffer (10mM of Tris-HCl and 1mM of EDTA at pH 8.0). The DNA was purified from RNA and proteins by adding 800 mL of cold 100%
isopropyl alcohol, followed by centrifugation at 8,000 g for 5 min. Pellets were washed with 400 mL of 70% isopropyl alcohol. After drying, pellets were resuspended in
150 mL TE buffer (10 mMTris-HCl, pH 8.0; 1 mM EDTA and 50 mg/mL RNAse (Sambrook, 1989) and its concentration was estimated by nanodrop 2000 (Thermo Fisher
Scientific Inc.).
ISSR amplification: Fourteen ISSR primers were used as consumed by Kishor and Devi (2009). The ISSR reaction was carried out in a 25-μL reaction volume containing
1 μL genomic DNA, 2X DreamTaqTM Green PCR Master Mix (Fermentas International, Inc.) with 1 μMoligodeoxynucleotide of each primer pairs. Amplification was
performed in a thermal cycler (Bio-Rad Laboratories, Inc.) for total of 40 cycles after an initial denaturation of the template DNA at 94°C for 3 min. Initial denaturation
was followed by 10 cycles of 94°C for 40 s, touch-down one-degree decrease in annealing temperature starting at 7°C above Tm for each primer for 30 s and 72°C for
1 min. This was followed by 30 cycles of 95°C for 40 s, last annealing temperature for 30 s (Table 1) and 72°C for 1 min and a final ex­tension of 72°C for 10 min. The
131 | MGC10
amplification products were analyzed on a 2% agarose gel with a 100-bp DNA ladder (N3231S, Biolabs, Inc.). The gel was stained by ethidium bromide, visualized under
ultraviolet light and photographed using a gel documentation system (ChemilImagerTM Gel Doc., AlphaInnotech Corporation, CA, USA).
Data analysis: ISSR amplified fragments named by primer code and molecular weight (bp) were scored as band present (1) or absent (0) for each DNA sample. By
comparing the banding patterns of genotypes for a specific primer, genotype-specific bands were identified. Faint or unclear bands were not considered. The binary data
generated were used to estimate levels of polymorphism by dividing the polymorphic bands by the total number of scored bands. Dendrogram was constructed by using
the unweighted pair group method with arithmetic average (UPGMA) with NTSYS to show a phonetic representation of genetic relationships as revealed by the similarity
coefficient.
RESULTS AND DISCUSSION
In this study, fourteen showed reproducible and clear bands among the total of fifteen ISSR primers tested. The banding patterns are shown in figure 1. From the fifteen
ISSR primers tested (Table 1), they generated a total 165 ISSR fragments, an average of 5.36 bands per primer. It was evident that 71 bands out of 75 bands were
polymorphic with the mean of 5.07 bands per primer (Table 1). The percentage of polymorphism of the samples are all above 66% with an average of 93.46%. Ten
primers (UBC 827, UBC 807, UBC 811, UBC 873, UBC 810, UBC 825, UBC 826, RAMP TAG, RAMP GAC, ISSR 9 and ISSR 14) showed highest polymorphism at 100%
in their banding pattern, while the lowest was in UBC 808 and UBC 889 at 66.7% (Figure 6-8). The ISSR derived data were used to calculate the genetic identities. The
genetic similarity co-efficient varied from 0.1667 to 0.4717 (Table 2). Simple matching coefficient method was used to construct dendogram (Figure 2). The species
studied were grouped into three groups. The first cluster formed between A. odorata and A. odorata var. Yellow at 47%. A. flabellata and A. houlletiana formed the
second cluster at 67% similarity, while A. quinquevulnera var. Calyana formed the third cluster. Among the five species studied,A. odorata and A. odorata var. Yellow
with A. flabellata and A. houlletiana were closest genetically. Mean while A. quinquevulnera var. Calyana was found to be the most genetically diverse as compared to
the other four species. A unique relationship has been identified between the species involved in this study based on amplified fragment generated through use of ISSR
assay. There were some specific loci were identified which represents the species and uniquely associated with that particular species, whereas, some were invariably
present in all the species under assay (Table 3). Nine specific loci of A. odorata were found in this study at 450bp, 600bp, 980bp and 1100bp by ISSR 9, 750bp by UBC
811 and UBC 810, 550bp by RAMP GAC, 1200bp by UBC 825 as well as at 950bp by UBC 826. A. odorata var. Yellow were found to produce six specific loci amplified
fragment analysis which were at 500bp generated by RAMP GAC, 1300bp by UBC 811, 750bp and 1000bp by UBC 873, 1100bp by UBC 810 and also at 950bp by
RAMP TAG. Three unique loci were found in A. quinquevulnera var. Calyana, at 650bp generated by RAMP GAC, 170bp by 810 and 880bp by UBC 827. However only
single specific locus was found in A. flabellata and A. houlletiana, which were at 600bp and 820bp respectively, generated by RAMP GAC. Interestingly, UBC 808, UBC
809, UBC 889 and UBC 826 amplified the loci of 1150bp, 500bp, 380bp and 500bp, and 750bp respectively which were present in all the species studied, A. odorata,
A. odorata var. Yellow, A. flabellata, A. houlletiana and A. quinquevulnera var. Calyana. However, it was more interesting to know that, there were few specific loci which
amplified by two or multiple number of species. It was found that, A. odorata and A. odorata var. Yellow had twelve loci amplified by ISSR primers used in this study.
They were at 800bp generated by ISSR 9, 600bp and 700bp by UBC 807, 1450bp by UBC 873, 650bp, 850bp and 1050bp by RAMP TAG, 910bp and 1000bp by UBC
827, 350bp and 650bp by UBC 825 as well as at 850bp by UBC 826. This proves the similarity found in dendrogram (Figure 9) constructed where A. odorataand A.
odorata var. Yellow were grouped in same cluster which is cluster 1. Similarly, seven common loci were found in A. flabellata and A. houlletiana, which were at 850bp
generated by UBC 811, 900bp by UBC 809, 230bp by UBC 810, 460bp and 700bp by RAMP TAG, 420bp by UBC 825 and also at 650bp by UBC 826 as both these two
species were clustered in second cluster. There are also three and more species were sharing common loci as in Table 3. Based on the observation presented in table 3,
it can be concluded that, genetic association of A. odorata and A. odorata var. Yellow were predominant in comparison to all the other genotypic association studied.
Whereas, A. quinquevulnera var. Calyana has minimal association with other species under study. It has been reflected in the cluster diagram where A. quinquevulnera
var. Calyana found to be the most imprecisely related species.The present study also indicates that the ISSR is sufficiently informative and powerful to access genetic
variability of these species of Aerides. ISSR, being a multi-locus marker with the simplest and fastest technology, have been successfully employed for determination of
inter-species genetic diversity in several plant species (Malviya and Yadav., 2010 and Gupta et al.,2010).
132 | MGC10
Table 1 : Primer sequences, amplified bands, polymorphic bands and percentage of polymorphism in ISSR analysis.
Amplified
bands
Polymorphic
bands
%
polymorphism
5'-ACA CAC ACA CAC ACA CG-3'
5
5
100
UBC 825
5'-ACA CAC ACA CAC ACA CT-3'
4
4
100
3
UBC 826
5'-ACA CAC ACA CAC ACA CC-3'
4
4
100
4
UBC 810
5'-GAG AGA GAG AGA GAG AT-3'
8
8
100
5
UBC 809
5'-AGA GAG AGA GAG AGA GG-3'
4
3
75
6
UBC 873
5'-GAC AGA CAG ACA GAC A-3'
5
5
100
7
UBC 889
5'-DBD ACA CAC ACA CAC AC-3'
6
4
66.7
8
UBC 808
5'-AGA GAG AGA GAG AGA GC-3'
3
2
66.7
9
UBC 807
5'-AGA GAG AGA GAG AGA GT-3'
4
4
100
10
UBC 811
5'-GAG AGA GAG AGA GAG AC-3'
4
4
100
11
RAMP TAG
5'-TAG AGA GAG AGA GAG AGA G-3'
8
8
100
12
RAMP GAC
5'-GAC AGA CAC ACA CAC ACA C-3'
5
5
100
13
ISSR 14
5'-TG TG TGTGTGTGTGTG G-3'
8
8
100
14
ISSR 9
5'- AGA GAG AGA GAG AGA GGT-3'
7
7
100
Total
75
71
1308.4
Mean
5.36
5.07
93.46
No
Primers
Sequence 5' to 3'
1
UBC 827
2
Table 2: Matrix of Nei’s genetic similarity (above diagonal) and distance (below diagonal) among Aerides odorata var. Yellow (Y), Aerides odorata (W),
Aerides flabellate (F), Aeridesquinquevulnera var. Calyana (Q) and Aerides houlletiana (H) analyzing 75 ISSR loci.
Y
W
F
Q
Y
1.0000
W
0.4717
1.0000
F
0.1786
0.2545
1.0000
Q
0.2549
0.1964
0.2558
1.0000
H
0.1667
0.2167
0.6667
0.3182
133 | MGC10
H
1.0000
Figure 1 :Agarose gel electrophoresis of ISSR fragments of Aerides odorata var. Yellow (Y), Aerides odorata (W), Aerides flabellata (F), Aerides
quinquevulnera var. Calyana (Q) and Aerides houlletiana (H) showing polymorphic bands generated by primers ISSR 9, RAMP GAC, ISSR 14, UBC 827,
UBC 825, UBC 826, UBC 808, UBC 807 UBC 811, UBC 809 UBC 873, UBC 889, UBC 810 and RAMP TAG. Lane M– 100 bp ladder.
134 | MGC10
Figure 2: Dendrogram showing the genetic relationships between Aerides odorata var. Yellow (Y), Aerides odorata (W), Aerides flabellate (F), Aerides
quinquevulnera var. Calyana (Q) and Aerides houlletiana (H), using UPGMA method, obtained from ISSR markers. The scale is based on Dice similarity
coefficient. Similarity scale is indicated on the bottom of the dendrogram.
135 | MGC10
Table 3 : Comparison of loci amplified by different ISSR primers using Aerides odorata var. Yellow (Y), Aerides odorata (W), Aerides flabellata (F), Aerides
quinquevulnera var. Calyana (Q) and Aerides houlletiana (H)
136 | MGC10
ID 030
In Silico Analysis on the ßß -Defensin Functional Gene in Human and Primates
Zahirunisa Abd Rahim*1, Suhaili Abu Bakar 1, Yuzine Esa2, Ahmad Hata Ahmad Rasit3 & Mohd Tajuddin Abdullah4
Molecular Biology and Bioinformatics Unit, Department of Biomedical Science, Faculty of Medicine and Health Sciences, Universiti Putra Malaysia
2
Department of Aquaculture, Faculty of Agriculture, Universiti Putra Malaysia
3
Faculty of Medicine and Health Sciences, Universiti Malaysia Sarawak
4
Department of Zoology, Faculty of Resource Science and Technology, Universiti Malaysia Sarawak
Email: [email protected]; [email protected]
1
ABSTRACT:
ß-defensin gene is a functional gene that is found in various parts of the mammalian genome especially in the innate and adaptive immune system and act as moderator
in the reproductive functions. Therefore, disruption of beta defensins gene in primates and human could relate to disease-associated risks. Although many studies
conducted on the evolution of beta defensins gene, the evolutionary dynamics of this functional gene in primates and human have not been resolved. In silico human and
primate genomics were analysed to identify the evolutionary divergence within the functional gene ß-defensin in the two mammalian groups. A total of 101 in-groups
were studied comprising of 22 human sequences (Homo sapiens) while another 79 sequences of primates (Pan troglodytes, Pongo Pygmaeus, Macaca fascicularis and
Hylobates lar). All of the sequences were obtained from GenBank. From this, 22 ß-defensin subtypes were aligned and further constructed into evolutionary phylogeny.
The 22 subtypes were located on chromosome 7, 8, 12, 17, 18, 20 and 21 from either the short arm or long arm of the chromosomes. From the 707 nucleotides
analysed, 68 are conserved and 639 are variables. The parsimony informative sites comprises of 478 bases. Neighbor joining phylogeny constructed shows a
paraphyletic topology. The most basal clade was defined by DEFB129 subtypes while the most distant neighbor belongs to DEFB105. The phylogeny also defines eight
monophyletic groups. The topology feature specialised grouping according to the ß-defensin subtypes but do not discriminate the host of the functional gene. The human
and primates host cluster randomly in their respective ß-defensin subtypes group. However, DEFB119 for Homo sapiens transcript variant 3 and 4 show clustering with
the DEFB120 subtypes. Nonetheless, they still group as sister clade. Most studies found that the beta defensin gene is a species specific paralogous group gene given
by the conserved synteny within the common ancestors. This In silico analysis, however, shows higher variables in nucleotide composition and feature negative selection
of the ß-defensin gene. Thus, it is important to constantly evaluate the evolutionary relationship for better understanding of the ß-defensin gene selection.
Keywords: In silico, ß-defensin, human, primates
Introduction
Defensins are grouped into a family of peptides that play an important role in the innate immune response which reveals a broad spectrum of antimicrobial activities
against bacteria and fungi (Del Pero et al., 2002). Three families of mammalian defensins (e.g. in chromosomes 7, 8, 11, 12 and 20) have been identified including
alpha-defensins, beta-defensins and theta-defensins, presumably derived from a common ancestral defensins (Das et al., 2010). The ability of defensins in becoming
the antimicrobial agents to most gram negative and gram positive bacteria as well as other fungi and viruses makes it beneficial to study the construction of the
defensins gene. Most defensins are two exon genes that contain a pattern of six conserved cysteine residues. The alpha and beta are distinguishable by the spacing and
connectivity of the conserved cysteine residues within the mature peptide (Radhakrishnan et al., 2005; Ganz, 2003). From UCSC genome browser, the entire genes
(alpha and beta defensins choromosome 8p23.1) on Homo sapiens spanned about 2Mb.
β-defensin contribute to mucosal and epithelial defense, also acting as signal molecules for cellular components of innate and adaptive immunity (Crovella et al., 2005).
Beta defensin plays a major role in innate and adaptive immune systems through chemoattraction of dendritic cells, memory T cells (Yang et al., 1999), and human
neutrophils (Niyonsaba et al., 2004). β-defensin are increasingly known as mediators of reproductive functions. A study conducted on rats featured a model predicted by
their expression primarily in the male reproductive tract where it started to inhibit the spermatozona recognition and binding (Tollner et al., 2004). Disruption of βdefensin gene in human has implicated various human diseases (Radhakrishnan et al., 2005). β-defensin gene is an important gene element that should be present in
the mammalian genome. Thus, it is important to constantly evaluate this functional gene ability in the mammalian species especially primates as they are the closest
relative to human.
Many studies have been conducted on the host defense peptide of beta defensins gene family in primates. β-defensin gene from type 1 to 4 had been well characterised
by previous authors (Radhakrishnan et al., 2007; Crovella et al., 2005; Boniotto et al., 2003). As mentioned by Crovella et al. (2005), the β-defensin type 4 is uniquely
found in primates and not in other mammalian species. Most studies found that the β-defensin gene is a species specific locus gene given by the conserved synteny
within the common ancestors (Schutte et al., 2002). Patil et al. (2005) used a computational analysis identify the complete β-defensin repertoire in human, chimpanzee,
mouse, rat and dog. They also found species specific paralogous groups. Four different β-defensin clusters exist in the rodent and dog genomes while there are five
clusters occur in human genome form by the long and short arm of chromosome 20.
137 | MGC10
Most primates show negative selection in their β-defensin gene as compared to other mammalian species (Semple et al., 2005). Positive selections were only located
from beta defensin gene of primates and rodents based on the divergence of the gene some 90 million years ago (Semple et al., 2005). Recent positive selection in
primate lineages was detectable only in the divergence of Cercopithecus aethiops (Vervet monkey) DEFB106 and DEFB107 orthologues. Recently in primates, positive
selection of β-defensin gene seem to focus on the diversification of DEFB104 and DEFB108, a putatively primate specific pair of sister genes (Semple et al., 2006).
Although many studies had been conducted in enlightening the β-defensin functional gene in mammals, there are still arguments whether this functional genes appears
in species-specific locus on the chromosomes in the primates. Additionally, previous studies had listed the β-defensin are a species specific paralogous group while
some others refer to it as the ortholog group. Thus, it is important to resolve this problem by studying the comparative genomic of the β-defensin gene in primates with
comparison to human genome.
Given the fact that the β-defensin evolution began before fish-mammalian divergence, Radhakrishnan et al. (2007) found out that β-defensin primate-specific gene
(DEFB120 and DEFB121) shows split up from the rodent defensins some 91 million years ago and extended with alternative spliced transcription and a pseudogene of
DEFB122p to split into human specific β-defensin gene approximately 23 million years ago. This finding highlighted the evolutionary dynamics of the β-defensin gene in
primate and human respectively.
Radhakrishnan et al. (2005) had reported earlier that five β-defensin gene in human was detected in chromosome locus 20q11.1 (DEFB119-DEFB123). Sequences of
the five macaque orthologs were obtained and expression patterns of the genes (from male reproductive tract regulated by androgens) were analysed in humans and
macaque by semi quantitative reverse transcription polymerase chain reaction. Evolutionary analyses suggest that this cluster originated by a series of duplication and
positive selection and diversification of the gene may be due to reproduction specialisation and co-evolution of the host/parasite mechanism. Although many studies are
conducted on β-defensins, the evolutionary dynamics of this functional gene in primates or human have not been resolved.
Materials and Method
All the sequence data used in the analysis were downloaded from GenBank database available at www.ncbi.nlm.nih.gov/genbank. The downloaded sequences were
aligned using clustal X program version 1.81. All further evolutionary analysis was conducted using Mega 5 (Tamura et al., 2011). The nucleotide composition and
genetic distances was estimated and neighbor-joining (1000 replication) tree was constructed.
Results and Discussion
A total of 101 in-groups was studied comprising 22 human sequences (Homo sapiens) while 79 sequences were that of primates (Pan troglodytes, Pongo Pygmaeus,
Macaca fascicularis and Hylobates lar) with the outgroup Canis lupus (DEFB 124). The In silico analysis includes 22 ß-defensin subtypes namely DEFB 105, DEFB103,
DEFB3, DEFB104, DEFB107, DEFB136, DEFB137,DEFB1, DEFB4, DEFB120,DEFB119, DEFB135, DEFB132, DEFB133,DEFB125, DEFB126, DEFB127, DEFB128,
DEFB129, DEFB118, DEFB106 and DEFB123. The 22 subtypes were located on chromosome 7, 8, 12, 17, 18, 20 and 21 from either the short arm or long arm of the
chromosomes.
From the 707 nucleotides analysed, 68 are conserved and 639 are variables. The parsimony informative sites comprises 478 bases. Neighbor joining phylogeny
constructed shows a paraphyletic topology. The most basal clade was defined by DEFB129 subtypes while the most distant neighbor belongs to DEFB105. The
phylogeny also defines eight monophyletic groups. The first monophyletic cluster is given by the DEFB129. The next consist of DEFB106 and DEFB123 followed by
another group of DEFB118. The third monophyletic group shows sister cladding of DEFB127 and DEFB128 followed by DEFB126, DEFB125, DEFB132 and DEFB133
cluster. Another monophyletic group consists of DEFB119, DEFB120, DEFB1 and DEFB4. DEFB135 and DEFB137 form independent clade. The eighth monophyletic
group was shown by the DEFB107, DEFB136 and DEFB104 which are sister clade to DEFB3, DEFB103 and DEFB105.
The nucleotide composition is given by 26% Thymine (T), 22.1% cytosine (C), 30.3% adenine (A) and 21.6% guanine (G). The codon usage is given in average of 94
codons. The nucleotide divergence range from 0.00 to 8.63. The nucleotide divergence is very low within the same ß-defensin subtypes comparing the distance
between human and primates. DEFB106 is observed to have the same haplotype (0.00) in divergence between human and primates. This topology finding is in contrast
to the species specific groups in ß-defensins gene found by previous authors (Patil et al., 2005).
The topology feature specialised grouping according to the ß-defensin subtypes but do not discriminate the host of the functional gene. The human and primates host
cluster randomly in their respective ß-defensin subtypes group. However, DEFB119 for Homo sapiens transcript variant 3 and 4 show clustering with the DEFB120
subtypes. As DEFB120 is known to be the primate specific defensins, the mixed grouping with DEFB119 trancript variant 3 and 4 is not likely to occur. However, the
grouping could be due to the restricted region analysed in DEFB119 that focuses only on transcript variant 3 and 4. Thus, this phylogeny features a biased in the clading
as neighbor-joining topology takes mostly on the distance analysis where the parameters discriminate the similarities and differences of the nucleotide sequence
compositions (Saitou and Nei, 1985). Nonetheless, DEFB119 still group as sister clade to the remaining DEFB119 subtypes.
Most studies found that the ß-defensin gene is a species specific paralogous group gene given by the conserved synteny within the common ancestors (Belov et al.,
2007; Patil et al., 2005; Schutte et al., 2002). However, this In silico analysis shows higher variables in nucleotide composition of the ß-defensin gene. This could be
due to the robust data used in the analysis. Although the In silico analysis signifies higher variables, all the ß-defensin type was proven to share conserved synteny within
138 | MGC10
the common ancestor when blast to human chromosome 8p (Whitington et al., 2008). This In silico analysis also feature negative selection as featured by previous
authors (Semple et al., 2006; Semple et al., 2005) though some have reported positive selections displayed by primate lineages (Hollox and Armour, 2008).
Conclusion
The In silico analysis successfully highlighted the necessary information on the evolution of the ß-defensins gene in human and primates within the selcted subtypes.
However, this analysis is insufficient to emphasise the evolution of ß-defensins and that further analysis of all the ß-defensins gene in human and primates should be
conducted to review the most recent evolutionary dynamics in the ß-defensins gene.
139 | MGC10
Figure 1. Evolutionary relationships of taxa
The evolutionary history was inferred using the
Neighbor-Joining method [1]. Branches corresponding
to partitions reproduced in less than 50% bootstrap
replicates are collapsed. The percentage of replicate
trees in which the associated taxa clustered together in
the bootstrap test (1000 replicates) is shown next to
the branches [2]. The evolutionary distances were
computed using the p-distance method [3]
Codon
positions
included
were
1st+2nd+3rd+Noncoding. All positions containing
gaps and missing data were eliminated. Evolutionary
analyses were conducted in MEGA5.
[1]Saitou and Nei (1987)
[2]Felsenstein (1985)
[3]Nei and Kumar (2000)
140 | MGC10
Acknowledgement
This study is funded with FRGS/ST03(03)/964/2013(05) grant lead by MTA as part of the robust study on Identification and Characterization of the β-Defensin CNV
Genes in the Genome of Selected Primates in Sarawak. This study would not be possible without various administrative and financial supports from Universiti Putra
Malaysia and Universiti Malaysia Sarawak (UNIMAS). We wish to express our sincere gratitude to all colleagues for their constructive comments and assistance
throughout the documentation. ZAR postgraduate study is supported by MyBrain15.
References
Belov, K., Sanderson, C., Deakin, J., Wong, E., Assange, D., McColl, K., Gout, A., de Bono, B., Barrow, A. and Speed, T. (2007). Characterization of the opossum
immune genome provides insights into the evolution of the mammalian immune system. Genome Research, 17: 982–991.
Boniotto, M., Tossi, A., Del Pero, M., Sgubin, S., Antcheva, N., Santon, D., Masters, J. and Crovella, S. (2003). Evolution of the beta defensin 2 gene in primates. Genes
and Immunity, 4: 251 – 257.
Crovella, S., Antcheva, N., Zelezetsky, I., Boniotto, M., Pacor, S., Falzacappa, M. V. V. and Tossi, A. (2005). Primate beta defensins-structure, function and evolution.
Current Protein and Peptide Science, 6: 7 – 21.
Das, S., Nikolaidis, N., Goto, H., McCallister, C., Li, J., Hirano, M. and Cooper, M. D. (2010). Comparative genomics and eevolution of alpha defensin multigene family in
primates. Molecular Biology Evolution, 27(10): 2333 – 2343.
Del Pero, M., Boniotto, M., Zucon, D., Cervella, P., Amarosa, A. S. A and Crovella, S. (2002). Beta defensin gene 1 variability among non-human primates.
Immunogenetics, 53: 907 – 913.
Felsenstein J. (1985). Confidence limits on phylogenies: An approach using the bootstrap. Evolution 39:783-791.
Ganz, T. (2003). Defensins: antimicrobial peptides of innate immunity. Nature Reviews Immunology, 3: 710–720.
Nei M. and Kumar S. (2000). Molecular Evolution and Phylogenetics. Oxford University Press, New York.
Niyonsaba, F., Ogawa, H. and Nagaoka, I. (2004). Human beta-defensin-2 functions as a chemotactic agent for tumour necrosis factor-alpha-treated human neutrophils.
Immunology, 111: 273–281.
Patil, A. A., Cai, Y., Sang, Y., Blecha, F. and Zhang, G. (2005). Cross-species analysis of the mammalian beta-defensin gene family: presence of syntenic gene clusters
and preferential expression in the male reproductive tract. Physiology and Genomics, 23: 5–17.
Radhakrishnan, Y., Fares, M. A., French, F. S. and Hall, H. S. (2007). Comparative genomic analysis of a mammalian beta defensins gene cluster. Physiological
Genomics, 30: 213 – 222.
Radhakrishnan, Y., Hamil, K. G., Yenugu, S., Young, S. L., French, F. S. and Hall, S. H. (2005). Identification, characterization and evolution of primate beta defensins
gene cluster. Genes and Immunity, 6(3): 203 – 210.
Saitou N. and Nei M. (1987). The neighbor-joining method: A new method for reconstructing phylogenetic trees. Molecular Biology and Evolution, 4:406-425.
Schutte, B. C., Mitros, J. P., Bartlett, J. A.,Walters, J. D., Jia, H. P.,Welsh, M. J., Casavant,T. L. and McCray, P. B. Jr. (2002). Discovery of five conserved beta -defensin
gene clusters using a computational search strategy. Proceedings of the National Academy of Sciences U.S.A, 99: 2129–2133.
Semple, C. A., Gautier, P., Karen, Taylor. and Julia, R. D. (2006). The changing of the guard: Molecular diversity and rapid evolution of β-defensins. Molecular Diversity,
10: 575 – 584.
Semple, C. A., Maxwell, A., Gautier, P., Kilanowski, F. M., Eastwood, H., Barran, P. E. and Dorin, J. R. (2005). The complexity of selection at the major primate betadefensin locus. BMC. Evolution Biology, 5: 32.
Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M. and Kumar, S. (2011) MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood,
Evolutionary Distance, and Maximum Parsimony Methods. Journal of Molecular Biology and Evolution. 28(10): 2731– 2739.
Tollner, T. L., Yudin, A. I., Treece, C. A., Overstreet, J. W. and Cherr, G. N. (2004). Macaque sperm release ESP13.2 and PSP94 during capacitation: the absence of
ESP132 is linked to sperm-zona recognition and binding. Molecular Reproduction Development, 69: 325–337.
Whitington, C. M., Papenfuss, A. T., Bansal, P, Torres, A. M., Wong, S. W. and Belov, K. (2008). Defensins and the covergent evolution of platypus and reptile venom
genes. Genome Research, 18: 986 – 994.
Yang, D., Chertov, O., Bykovskaia, S. N., Chen, Q., Buffo, M. J., Shogan, J., Anderson, M., Schroder, J. M., Wang, J. M., Howard, O. M. and Oppenheim, J. J. (1999).
Beta-defensins: linking innate and adaptive immunity through dendritic and T cell CCR6. Science 286: 525–528.
141 | MGC10
ID 031
Molecular Phylogenetics of the Sole Sweet TasteTaste-Specific Receptor Gene TAS1R2 in Primates
1,2 ,*
Nur Aida Md Tamrin1,2,*
Mohd HanifRidzuan Mat Daud1,2, Ramlah Zainuddin3, Yuzine Esa4 and Mohd Tajuddin Abdullah1,*
1
Department of Zoology, Faculty of Resource Science and Technology, Universiti Malaysia Sarawak
2
Malaysia Genome Institute, Ministry of Science Technology and Innovation
3
Centre for Pre-University Studies, Universiti Malaysia Sarawak
4
Department of Aquaculture, Faculty of Agriculture, Universiti Putra Malaysia
Email: [email protected], [email protected]
ABSTRACT:
Taste perception is an essential component that provides valuable dietary and sensory information, which is crucial for the survival of animals. Since the discovery of the
vertebrate taste receptor genes, genetic studies of taste perception have been conducted in a number of species for bitter taste receptors. However, similar studies for
sweet taste receptors are very scarce especially the one that include Bornean endemic primates, Nasalis larvatus (Proboscis Monkey) and Pongo pygmaeus (Bornean
Orang Hutan). We provide an attempt to investigate the phylogenetic relationship and pattern of the sole sweet taste-specific receptor gene Tas1r2 in 20 primate species,
one of the most diverse groups of mammals in terms of diet, starting from specialist folivores and frugivores to omnivores. Phylogenetic analyses ofTas1r2 gene using
four methods, namely neighbour-joining, maximum parsimony, maximum-likelihood and Bayesian resulted in similar statistically supported clades with minimal change
in branching order. The analyses discovered that there are three monophyletic groups with respect to the outgroup which consists of apes (lesser and greater apes), old
world monkey and new world monkey. The study successfully elucidates the evolution and phylogenetic relationship of Tas1r2 gene in primates. Although the gene can
be considered as conserved gene, the variable nucleotides give enough information to separate the primate into their taxonomic group and their diet preferences.
However, more studies on the gene functionality should be carried out to gain more understanding about the gene function in primates.
Keywords: Primates, phylogenetics, sweet taste,Tas1r2 gene
INTRODUCTION
The sense of taste is an important component of an animal’s fitness. Taste helps animals to decide whether the foods are beneficial for them to ingest or whether they
are dangerous and should be rejected. Doubtless, taste evolved to ensure animals choose the appropriate foods for their survival. Taste sensations can be divided into
five basic elements: sweet, umami, bitter, salty and sour (Kinnamon and Margolskee, 1996; Lindemann, 1996). Bitter and sour tastes usually warn against toxins food
sources while salty taste detects sodium and other minerals that are needed by animals. Sweet and umami tastes allow the recognition of diets with nutrious
carbohydrates and proteins, respectively (Bachmanov and Beauchamp, 2007).
Sour and salty tastes are conferred by taste receptor cells using ion channels whereas sweet, umami and bitter are G protein-coupled receptors (GPCRs) (Lindemann,
1996; Bachmanov and Beauchamp, 2007). GPCRs consist of two families: Tas1rs and Tas2rsthat function as sweet/umami and bitter taste receptors, respectively (Zhao
et al., 2003). The Tas1r gene repertoire is small compared to Tas1r2 gene with only three genes in most mammal studies: Tas1r1, Tas1r2 and Tas1r3(Zhao et al.,
2010). Tas1r1 and Tas1r2 are both coexpressed with Tas1r3, Tas1r1 + Tas1r3 functions as the umami taste receptor while Tas1r2 + Tas1r3 functions as the sweet
taste receptor (Li et al., 2002). Thus, Tas1r2 is likely the sole sweet-specific taste receptor.
The evolution of Tas1r is poorly studied and characterised compared to the evolution of Tas2r because the sweet and umami tastes are believed to be conserved among
species due to the genes are regarded as necessary for nutrient uptake (Shi and Zhang, 2006). However recently, a few studies had proved that Tas1r genes undergone
major mutation that brings new insights towards the evolution and function of the gene. For examples, Tas1r1 is pseudogenized in the giant panda (Li et al., 2010),
Tas1r2 is inactivated in the cat family Felidae (Li et al., 2005) and Tas1r2 is pseudogenized in vampire bats (Zhao et al., 2010). Therefore, Tas1r gene repertoire is not
as conserved as previously thought. To examine the evolution of Tas1r2 gene, it is preferable to examine relatively closely related species that nonetheless have diverse
dietary preferences.
In an effort to obtain deeper understanding of phylogenetic relationship in primates sweet taste perception, we have performed this study of molecular phylogenetics for
Tas1r2 gene. We choose primates because they have a huge diversity in their diets, including gums, shoots, leaves, plants, fruits, nectars, insects, invertebrates, small
mammals and amphibians (Bennett and Gombek, 1993; Boonratana, 1993; McNeilage, 2001; Nurcahyo, 2001; Swedell, 2002). For simplicity, we classify primates into
four main dietary groups: frugivores, folivores, omnivores and exudativores + gummnivores. We discuss possible ecological factors influencing the evolution of Tas1r2.
142 | MGC10
MATERIALS AND METHOD
Polymerase Chain Reaction and DNA Sequencing
The genomic DNAs of primate species were isolated from bloodsamples using the Qiagen DNA Blood Mini kit. Based on an alignment of currently available Tas1r2
sequences of human and rhesus macaque, we designed a pair of primers (E6F: 5’-GTAGCCCTGGATCATGCTGT-3’ and E6R: 5’-GCCTTGGTTTCCTCATCTGTG-3’) to
amplify ~816 nucleotides of the sixth exon of Tas1r2 from primates. The polymerase chain reaction (PCR) were performed using the GoTaq® Flexi DNA polymerase PCR
kit (Promega Co.) in a 25 µl reaction containing genomic DNA (15 ng/µl), 10 mM of each primers, 25mM of MgCl2, 10mM of deoxynucleoside triphosphates, 5X reaction
buffer and 1.25 U of Taq DNA polymerase. PCRs were conducted under the following thermal profile: 3 minutes of initial denaturation at 95˚C, 30 cycles of denaturation
at 94˚C for 30 seconds, annealing at 62˚C for 1 minute, extension at 72˚C for 2 minutes, and followed by a final extension at 72˚C for 8 minutes. PCR products were
examined on 1% agarose gels.
Positive DNA products were purified by centrifugation using Promega Wizard SV Gel and PCR Clean Up System (Promega Co.) and sequenced at First Base Co. (Selangor,
Malaysia) using the ABI PRISM® 377 DNA Sequencer with the BigDye® Terminator v3.0 Cycle Sequencing kit. Each PCR product was sequenced from both directions to
validate the results.
Evolutionary Analyses
The CHROMAS (version 1.45) (McCarthy, 1997) software was used to observe and read nucleotide bases of DNA sequences before further analysis. The multiple
alignments of the nucleotide sequences were done by using CLUSTAL W program (Higgins et al., 1994), later checked manually by eye. Phylogenetic analyses were
performed using Molecular Evolutionary Genetic Analysis (MEGA) 5.10 (Tamura et al., 2011) software while Bayesian method was constructed in MrBayes (Huelsenbeck
and Ronquist, 2001). For Tas1r2 data set, neighbour-joining (NJ), maximum-parsimony (MP), maximum-likelihood (ML) and Bayesian methods were used to infer
phylogenies. Out of 56 evolutionary models, Modeltest 3.7 (Posada and Crandall, 1998) showed that Hasegawa-Kishino-Yano (HKY) model of substitution, with
allowance for gamma (G) distribution of rate variation best fit the data. This model was used in maximum-likelihood and Bayesian methods. Maximum-parsimony
analysis was performed using heuristic searches, 10 random additions of taxa and tree-bisection-reconnection (TBR) as the branch-swapping algorithm. Pairwise genetic
distances matrix between and within species were calculated using Kimura two-parameter (K2P) model (Kimura, 1980) that was applied in MEGA 5.10 (Tamura et al.,
2011).
RESULTS AND DISCUSSION
Aligned sequences of 816 bprepresenting 88% of the total length of the sixth exon Tas1r2 gene (931 bp) were used in the estimation of genetic distance and
phylogenetic reconstruction. Out of the 816 bp nucleotides, 599 characters are invariant or conserved (73.4%), 217 characters showed variable sites (26.6%) with 100
variable characters being parsimony-uninformative sites and the remaining 117 characters of parsimony-informative sites. Including the outgroup, 17 informative
characters are at 1st codon positions, 30 characters at 2nd codon positions and 70 characters at 3rd codon positions. Parsimony analysis generated a single most
parsimonious tree length of 289 with consistency index (CI) of 0.7541 and retention index (RI) of 0.9442. Maximum likelihood analysis resulted in a single optimal tree (Ln likelihood=3590.56574) while Bayesian analysis with 50% majority rule consensus resulted in statistically supported clades (Figure 1).Including the outgroup, the
average base frequencies used in the analyses are thymine (T) with 16.4%, cytosine (C) with 23.7%, adenine (A) with 24.4%, and guanine (G) with 35.5%. The highest
frequency of nucleotide found is G nucleotide, whereas T nucleotide has the lowest frequency, which showed the characteristic of anti-T bias. Genetic distance within
and among each lineage was calculated by Kimura two-parameter (Kimura, 1980) according to the grouping assignment in phylogenetic trees (Table 1).
All the phylogenetic topologies revealed three strongly supported monophyletic groups with respect to the outgroup.The primate species grouped accordingly into apes
(including human), old world monkey and new world monkey. The grouping is congruent with previous study by Perelman etal. (2011) based on 54 nuclear gene regions
with 34, 927bp nucleotide sequences.Genetic divergence of 7.8 – 12% separated the new world monkey lineage (Group 1), containing genus Saimiri and Callithrixfrom
the other primates in this study.
Species from the genus Nasalis,Trachypithecus,Erythrocebus,Papio and Macacaare clustered in the old world monkey lineage (Group 2) with 99% support. In this major
group, two clades are apparent with strong support. Nasalis and Trachypithecus formed one clade while Erythrocebus, Papio and Macaca formed another, both with 99 100% support. Although N. larvatus and T. cristatusare the old world monkeys, they do not share the same diet as the other old world monkeys in the lineage. Both
species are specialistfolivores and feed on fruits to a lesser extent (Boonratana, 1993; Caton, 1999). Because of this difference, they are more commonly found in the
middle canopy of the forest, leaving the higher branches to primates with a more frugivores diet (Harding, 2010).Both species can be found in the same habitat type of
mangrove swamps and some other swamp forest region that are nearby the coastal areas and rivers (Bennett and Gombek, 1993). The habitats provide the same type of
food resources. These shared diet and habitat types contribute themto be closely related compared to other old world monkeys as displayed in the phylogenetic tree.The
other species in the old world monkey lineage inthe phylogenetic tree, which is maintained by 99% bootstrap support, are all omnivores although a few (M. mulatta and
M. arctoides) are primarily frugivores. These species feed on a variety of foods including invertebrates, small vertebrates and plants (Kummer, 1968; Lindburg, 1971;
Isbell, 1998; Swedell, 2002).
Apes (Group 3) are the largest primates containing two families of extant species, namely, Hylobatidae (lesser apes) and Hominidae (greater apes). P. pygmaeus is the
most basal for this lineage with100% support. From the phylogenetic tree, human sweet taste receptor Tas1r2 gene is monophyly with Pan troglodytes and
143 | MGC10
Gorillagorilla(100% bootstrap support). These species are omnivores but P. troglodytes and G. gorilla prefer ripe fruits and plants above all foods (McNeilage, 2001). This
might due to the competition and availability of food resources in their habitats of which human have the accessibility to find meat. Genus Hylobates,Symphalangus and
Nomascus(lesser apes) are monophyletic with 98% bootstrap value. From the taxonomic perspective, these three genera are closely related and it is congruent with
previous studies (Perelman et al., 2011)that they are being monophyletic. From the diet perspective, these genera are mainly frugivores herbivores (although some may
feed on insects in a very small amount occasionally) and spend most of their time in the forest canopy searching for food (Rowe, 1996; Nurcahyo, 2001).
CONCLUSION
The study successfully elucidates the evolution and phylogenetic relationship of Tas1r2 gene in primates. Although the gene can be considered as conserved gene (small
genetic distance value between species), the variable nucleotides give enough information to separate the primate into their taxonomic group and their diet preferences.
However, more studies focusing on the function of the gene should be carried out to prove whether the variations in the nucleotides affect the functionality of the gene.
Table 1.Estimates
of evolutionary divergence (%) using Kimura two-parameter model based on Tas1r2 gene sequences. Distance values within (boldface type along
1.
diagonal) and among species of primates are shown. n = sample size of each species. NA = not available.
144 | MGC10
Figure 1.Bayesian
phylogram of 50% majority-rule consensus tree inferred from aligned 816bp sweet taste receptor Tas1r2 gene sequences in exon 6. The pylogram
1.
consists of 20 primate species with M. lucifugus as an outgroup. Scores on the branches refer to bootstrap support values (1, 000 iterations) from NJ (1st score), MP (2nd
score), ML (3rd score) and Bayesian posterior probabilities (4th score).
145 | MGC10
ACKNOWLEDGEMENT
This study would not be possible without various administrative and financial supports from Universiti Malaysia Sarawak (UNIMAS). We would like to show our
appreciation to Malaysia Genome Institute for providing excellent facilities for laboratory work and their team’s expertise especially to Dr. Nurul Yuziana Mohd Yusof and
Ms. Halimah Alias. We thank the Sarawak Forestry Corporation and Sarawak Forestry Department for granting permission to conduct wildlife research in national parks in
Sarawak under the State Wild life Protection Rules 1998. Ourgratitude also goes to the Department of Wildlife and National Parks for collaborating with our team to
various field trips in Peninsular Malaysia including zoos. We wish to express our sincere gratitude to the members in the Department of Zoology for their hard work and
assistance throughout this study. NAMT postgraduate study is supported by MyBrain15 and part of the data collection and laboratory analyses using the Proboscis
Genome Project Grant lead by MTA.
REFERENCES
Bachmanov A. A. and Beauchamp G. K. (2007) Taste receptor genes.Annual Review of Nutrition27
27:
27 389-414.
Bennett E. L. andGombek F. (1993) Proboscis monkeys of Borneo. Koktas Sabah Berhad, Ranau.
BoonratanaR. (1993) The ecology and behaviour of the proboscis monkey (Nasalis larvatus) in the lower Kinabatangan, Sabah. PhD dissertation, Mahidol University.
Caton J. M. (1999)Digestive strategy of the Asian colobine genus Trachypithecus. Primates 40:
40 311-325.
Harding L.E. (2010) Trachypithecuscristatus (Primates: Cercopithecidae). Mammalian Species 42 (1): 149-165.
Higgins D., Thompson J. and Gibson T. (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positionspecific gap penalties and weight matrix choice.Nucleic Acids Research.22
22:4673-4680.
22
Huelsenbeck J. P. and Ronquist F. (2001) MrBayes: Bayesian inference of phylogeny. Bioinformatics17
17:
17 654-755.
Isbell L. A. (1998) Diet for a small primate: insectivory and gummivory in the (large) patas monkey (Erythrocebuspatas). American Journal of Primatology 45 (4): 10982345.
Swedell L. (2002) Ranging behavior, group size and behavioral flexibility in Ethiopian Hamadryas baboons (Papiohamadryashamadryas). Folia Primotal73
73:95-103.
73
Kimura M. (1980) A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular
Evolution16
16:
16 111-120.
Kinnamon S. C. and Margolskee R. F. (1996) Mechanisms of taste transduction.Current Opinion inNeurobioly6
6: 506-513.
Kummer H. (1968) Social organisation of Hamdryas baboons. A field study. Karger, and University Press, Basel and Chicago.
Li R, Fan W., Tian G. et al. (123 co-authors). (2010) The sequence and de novo assembly of the giant panda genome. Nature463
463:
463 311-317.
Li X., Li W., Wang H. et al. (11 co-authors) (2005) Pseudogenization of a sweet receptor gene accounts for cats’ indifference toward sugar.PloS Genetic1
1: 27-35.
Li X., Staszewski L., Xu H., Durick K., Zoller M. and Adler E. (2002) Human receptors for sweet and umami taste. Proceedings of the National Academy of Science
USA99
99:
99 4692-4696.
Lindburg D.G. (1971) The rhesus monkeys in north India: an ecological and behavioural study. In: Rosenblum, LA (ed.) Primate Behaviour: Developments in the field and
laboratory research. Academic Press, New York, vol.1, pp. 83–104.
Lindemann B. (1996) Taste reception.Physiological Reviews76
76:
76 718-766.
McCarthy C. (1997) CHROMAS version 1.45 program.Schools of Health Science, Griffith University, Gold Coast Campus, Queensland, Australia.
McNeilage A. (2001) Diet and habitat use of two mountain gorilla groups in contrasting habitats in the Virungas. In: Robbins M. M., Sicotte P, Stewart K. J.,
(eds.) Mountain gorillas: three decades of research at Karisoke. Cambridge (England): Cambridge University Press. pp. 265–92.
Nurcahyo A. (2001) Daily ranging, home-range, foods, feeding and calling in Siamang (Hylobatessyndactylus).In WCS-IP 2001.Bukit Barisan Selatan National Park in
Space and Time.2000 -2001 Research Report. WCS-IP/ PHKA, Bogor. 35-52. (In Indonesian)
Perelman P., Johnson W. E., Roos C.et al. (11 co-authors).(2011) A molecular phylogeny of living primates.PLoS Genetic7(3): e1001342.
Posada D. and Crandall K. A. (1998) Modeltest: Testing the model of DNA substitution. Bioinformatics14: 817-818.
Rowe N. (1996) Pictorial Guide to the Living Primates.Pogonias Press, East Hampton, New York.
Shi P. and Zhang J. (2006) Contrasting modes of evolution between vertebrate sweet/umami receptor genes and bitter receptor genes.Molecular Biology and
Evolution23
23:
23 292-300.
Tamura K., Peterson D., Peterson N., Stecher G., Nei M. and Kumar S. (2011) MEGA5: Molecular Evolutionary Genetics Analysis using maximum likelihood, evolutionary
distance, and maximum parsimony method. Molecular Biology and Evolution28
28:
28 2731-2739.
Zhao G. Q., Zhang Y., Hoon M. A., Chandrashekar J., Erlenbach I., Ryba H. J. and Zuker C. S. (2003) The receptors for mammalian sweet and umami taste. Cell115
115:
115
255-266.
Zhao H., Zhou Y., Pinto C. M., Charles-Dominique P., Galindo-Gonzalez J., Zhang S. and Zhang J. (2010) Evolution of the sweet taste receptor gene Tas1r2 in bats.
Molecular Biology and Evolution27
27(11):
2642-2650.
27
146 | MGC10
ID 032
Preliminary Study of Syzygium samarangense Flower Development
Muhammad Afiq Bin Tajol Ariffin1* and Abd. Rahman Milan2
Horticulture Research Centre, MARDI Bukit Tangga Station, Kedah,
2
Horticulture Research Centre, MARDI Serdang, Selangor.
Email: [email protected]
1
ABSTRACT:
Syzygium samarangense is a tropical fruit plants which commonly known as wax apple. It is widely cultivated in Asian countries and being exported extensively by
countries such as Taiwan and Thailand. Although this fruit is so popular in Taiwan and Thailand; there is no detailreport on flower development of the crop. Information
from this study is important for plant botanist and breeder to perform further study related to this species. This study was carried out from April to Jun 2013, on a red
fruit type S. samarangense cultivar with age of about four years old in MARDI Bukit Tangga Station, Kedah, Malaysia. Nine inflorescences of flower buds with three to
nine flower buds in each inflorescence were observed every day, except on raining day. They were observed until the flower developed into mature and ripe fruit.
Measurement of flower diameter and length, changes in their physical appearance, and photos were recorded. In this preliminary study, there were nine stages of flower
and fruit development observed for S. samarangense. Three stages occurred before flower anthesis and six stages occur from flower anthesis until fruit matured and ripe.
Total period for all stages were 46-54 days.
Introduction
Syzygium samarangense is a tropical fruit plants which commonly known as wax apple. It can be found growing or cultivated at East Asian region such as Taiwan,
Indonesia and Malaysia. It has berry fruit with oblong or bell-shaped and the colour is either white to greenish white to pink, red, maroon or dark purple (Lim, 2012). S.
samarangense fruit is commonly consumed fresh. Besides its juicy and sweet taste, it also has antioxidant compounds. Production of wax apple in large scale can
generate high income to a country as evidenced by Taiwan which successfully generated production value of wax apple at $189 million US dollars in 2006 by production
at 7031 hectares land (Shu et al., 2006).
Flower is a main plant reproductive system and an important part for fruit production. It is important to have information on stages and period of flower and fruit
development for efficient crop management and improvement of the plant. Farmer can have proper plan for fruit production and researcher especially plant breeder can
use the information to design suitable method in the breeding program.
This preliminary study was performed to observe different stages in flower and fruit development of S. samarangense.
Materials and Methods
This study was carried out at MARDI Bukit Tangga Station located in Bukit Kayu Hitam, Kedah, Malaysia on April-Jun 2013. The plot was located at zone 1 base on
Agro-ecological zone in Malaysia, which is a clear and regular dry season regions (Nieuwolt et al., 1982).
In this study, observation was done on flower and fruit inflorescence of four year old plants. During the observation, nine inflorescences of flower buds with three to nine
flower buds in each inflorescence were labelled. They were observed every day except raining days. Measurement of flower diameter and length, changes in their
physical appearance, and photos were recorded. The observation was performed until fruits developed from flowering to matured and ripe. The fruits were matured when
their colour changes into dark red and ripe about a week after.
Results and Discussion
There were nine stages of flower and fruit development observed for S. samarangense as shown in Table 1. The development started with emergent of flower bud from
branch or between leave stalks and end when fruit become matured and ripe. Total period from flower initiation until fruit mature was approximately 46-54 days. The
stages were slightly different from observation on S. pycnanthum flower and fruit development by Mudiana and Ariyanti (2010). In their study, they observed ten stages
of flower and fruit development and flower blooming stage was divided into three different stages which were stage of flower start to bloom (2-3 days), stage of early
blooming (1 day) and stage of flower perfectly bloom (1-2 days). In our observation on S. samarangense, the blooming stages were all grouped in only one stage
because all of the stages occur in a very short period of about 1- 2 days and the different stages during flower blooming cannot be observed and differentiate clearly. In
addition, S. pycnanthum had longer flower and fruit development which was 80-89 days. It is assumed that their different is caused by their different genetic constituent.
In each flower inflorescence there were more than two flowers observed. It ranges from one to seven flowers per inflorescence. However, not all of the flowers
successfully developed into fruit. Some of them shed before anthesis and some of them shed after anthesis or during fruit development process. This situation also
147 | MGC10
happened to S. pycnanthum. According to Gomes da Silva and Pinheiro (2009), this situation occur because of limiting factors occurred during each stage of the process.
In this study, the factors could be unsuccessful pollination process, extreme weather such as heavy raining or other internal or external factors.
Development of S. samarangense flower and fruit was initiated with development of less than 0.5 cm diameter of flower bud with a shape like crab eye. As the flower
bud developed and increase in size it became an obovoid shape until anthesis. Then, the fruit starts to develop when the receptacle becomes swollen, and finally it
developed into a mature fruit shape. Fruit shape for the studied S. samarangense mixed between pyriform-shaped and bell-shaped. The production of mixes shape fruit
probably occurred due to cross-pollination from other nearest S. samarangense cultivar or can also occur because of its specific character which can produce both
shapes of fruit. Further study need to be done to clarify on this situation.
During anthesis phase, S. samarangense produce flower with white dense stamens and fragrant odour. The flower was complete flower, with both stamen and pistil on
the same flower. Anthesis phase for S. samarangense only took about one to two days. Pollination could successfully occur within this period whether by self-pollination
or cross pollination. There was a high probability of self-pollination to occur because it had numerous dense stamens surrounding pistil with their height nearly similar to
the pistil. This can make pollen easily transferred to stigma on the same flower. However, self-compatibility study should be performed to justify on it. Normally, after
anthesis and all stamens fall off, the flower start to develop into fruit and pistil starts to dry and fall off. This situation could be explained as pollination has successfully
occurred. However, there was one flower which was observed to develop into fruit but with pistil still attached to the flower and not become dry and fall off until the fruit
changing colour to red. This probably happened because of internal factors of the flower. However, further study needed to find specific factors that cause this situation.
Meanwhile, in order to have a good quality fruit and prevent immature fruit abortion in this study, flower with swollen receptacles was covered with paper bag to prevent
from fruit fly attack. Without proper bagging, fruit fly would oviposit eggs into S. samarangense fruit and the larvae produced will damage the fruit flesh.
Conclusion
There were nine stages of flower and fruit development for S. samarangense. Three stages occurred before flower anthesis and six stages occur from flower anthesis
until fruit matured and ripe. Total period for all of the stages were 46-54 days.
References
Gomes da Silva, A. L. and Pinheiro, M. C. B. (2009). Reproductive success of four species of Eugenia L. (Myrtaceae). Acta Botanica Brasilica, 23(2): 526-534.
Lim, T.K. (2012). Syzygium samarangense. In: Edible Medicinal and Non-medicinal Plants: Volume 3, Fruits. (Lim, T. K., ed.). Springer Science+Business Media: Berlin.
778-786.
Mudiana, D. and Ariyanti, E. E. (2010). Flower and fruit development of Syzygium pycnanthum Merr. & L.M. Perry. Biodiversitas. 11: 124-128.
Nieuwolt, S. (1982). Climate and Agricultural Planning in Peninsular Malaysia. Special Report No. ASAS-01-83. MARDI. 139 pp.
Rai, I. N., Poerwanto, R., Darusman, L. K., and Purwoko, B. S. (2006). Changes of gibberellin and total sugar content in flower developmental stages of mangosteen.
Hayati, 13(3): 101-106. [Indonesia].
Shu, Z. H., Meon, R., Tirtawinata, and Thanarut, C. (2006).Wax apple production in selected tropical Asian countries. Acta Horticulturae, 773: 161-164.
148 | MGC10
Table 1. Stages of flower and fruit development of S. samarangense
Stage
1
Picture
Description
Stage of early flower development.
Flower bud emerged from branch or
between leave stalks.
Period: 12-19 days
Stage
6
2
Calyx begin to open and reveal the
whitish colour of corolla
Period: 2-9 days.
7
Early fruit structure developed
with swollen receptacle and
calyx.
Period: 2-7 days.
3
Calyx is open widely. Corolla is
widely exposed.
Some flower buds were observed
with pistil present at cracks between
corollas.
Period: 1-2 days
8
Fruit colour change from greenish
to pale red.
Period: 3-10 days.
4
Flower anthesis.
Period: 1-2 days.
9
Fruit colour change from pale red
to dark red. Fruit become mature
and begin to ripe.
Period: +/- 7 days.
5
All stamens and corolla fall off.
Period: 6-15 days
Notes: Line bars in picture represent 10 mm.
149 | MGC10
Picture
Description
Pistil become dry and fall off.
Reddish patch was observed on
calyx. Receptacle becomes
swollen.
Period: 5-15 days.
ID 033
Evolution of Opsin Genes in Primates
Mohd HanifRidzuan Mat Daud1, Nur Aida Md Tamrin1, Yuzine Esa2, Ramlah Zainuddin1, 3 and Mohd Tajuddin Abdullah1
1
Department of Zoology, Faculty of Resource Science and Technology, Universiti Malaysia Sarawak,
2
Faculty of Agriculture, Universiti Putra Malaysia
3
Centre of Pre-University Studies, Universiti Malaysia Sarawak
Email: [email protected]; [email protected]
ABSTRACT:
Genetics of colour vision provide important insight in evolution of gene and population genetics. Old world monkey, apes and also human have trichromatic color vision,
which enable them to fully discriminate the visible light spectrum. Primates were sampled from selected areas in Peninsular and Malaysia Borneo to distinguish genetic
variation in different geographical locations. Three sets of gene namely Short wave sensitive (SWS), Medium wave sensitive (MWS) and Long wave sensitive (LWS)opsin
genes were sequenced. SWS is encoded by autosomal gene in seventh chromosome while MWS and LWS opsin genes are located head to tail tandem array on X
chromosome.Sequence data were analysed by using Neighbour-joining, Maximum Parsimony, Maximum Likelihood and Bayesian methods. The phylogenetic tree
inferred by four methods produced almost similar tree topologies with some changes in branching positions. The genetic distances between primate’s species ranged
from 1.20% to 10.30%. We found that there is a pattern of mutation in the sequence among inter and intraspecies of human, great apes, lesser apes and old world
monkey.This research provides information on the evolution of color vision genes among the primates and variations in primate colour vision.
Keywords: opsin genes; primates; phylogeny; evolution
Introduction
Overview of Primate and their Phylogenetic Relationship
The order of primates iscan be divided into two main groups, simians (including human, great apes, lesser apes and monkeys) and prosimians (lemurs, lorises and
tarsiers). Genetic relatedness of a species can be presented by using phylogenetic tree analyses.Monkeys represent the largest groups of primates and divided into New
World monkeys(NWM) and Old World monkeys (OWM). NWM can be found in southern Mexico and Central and South America while OWMare native to Africa and
Asia.NWM consist of five families, namely, Callitrichidae, Cebidae, Aotidae, Pitheciidae and Atelidae.There are 19 species comprises of five families of primates in
Malaysia (Payne et al., 2005; Francis et al.,2008). The Lorisidae and Tarsiidae are nocturnal while the other families of primates are diurnal.Study by Tan et al. (2005)
suggests that the ancestral primates were diurnal and nocturnality have evolved several times in the prosimian and this is supported by the distribution pattern of the
MWS and LWS opsin genes among primates.
Colour Vision in Primate
Retina contains two types of photoreceptor cells, namely, cones and rods. Cones responsible in distinguishcolour while rods important in night vision.Rods can function
in less intense light and more sensitive to light compared to cones cell while rods are responsible for night vision. Likewise, cones are less sensitive to light compared to
rods.There are three types of opsins, which are Short Wave Sensitive (SWS or ‘blue’), Middle Wave Sensitive (MWS or ‘green’) and Long Wave Sensitive (LWS or
‘red’).SWSis encoded by autosomal gene in seventh chromosome. Meanwhile, MWS and LWSOpsins genes are located head to tail tandem array on X chromosome
(Nathans et al.,1986).Each photoreceptor cell has a specific range of wavelength, SWS is sensitive to light at ~420 nanometers (nm), MWS is at ~534 nm and LWS is at
~564 nm.
In human, there is one copy of LWS gene and several copies of MWS gene resulted from gene duplication. Gene duplication events probably occurred after the
separation of NWM and OWM approximately 40 million years ago (mya) (Hunt et al., 1998). Howler monkey is the only NWM that is uniform trichromat. The MWS and
LWS differ in three significant places in the amino acid sequence, in the position 180, 277 and 285 (Yokoyama and Yokoyama, 1996). Generally, OWM have trichromatic
colour vision while the NWM have dichromatic colour vision.Trichromatic vision means the ability of the eyes to detect three different colour wavelengths that are blue,
green and red. On the other hands, dichromatic vision means the ability of eyes to detect two different colour wavelengths. Ecological studies suggest that trichromats
primate may have advantage in foraging to choose ripe fruit and unripe fruit (Mollon, 1991).
In this paper, we address the evolutionary of Opsin genes and phylogenetic relationship among primates and compare the nucleotide sequence of MWS gene of OWM,
Hominid and NWM.
150 | MGC10
Materials and Methods
Primate DNA samples
Research permission and permit were obtained and granted from the local authorities.Lists of species and the IUCN status are presented in Table 1. Samplings were
conducted in selected areas in Sarawak, Sabah and Peninsular Malaysia. Sampling also conducted in several zoos in Malaysia. Blood samples were collected from a
total of 10 species of Malaysian primates. Genomic DNA was extracted from blood samples using QIAamp Blood Mini Kit following manufacture’s protocol.
Table 1. List of primate species used in this study and the IUCN status
Family
Cercopithecidae
IUCN
Status*
Species name
Common name
Trachypithecuscristatus(Raffles, 1821)
Nasalis larvatus(Wurmb, 1787)
Macacafascicularis(Raffles, 1821)
Macacanemestrina(Linnaeus, 1766)
Macacaarctoides(I. Geoffroy, 1831)
Silvered langur
Proboscis monkey
Long-tailed macaque
Pig-tailed macaque
Stump-tail Macaque
NT
EN
LC
VU
VU
HylobatesmuelleriMartin, 1841
HylobatesagilisF. Cuvier, 1821
Hylobateslar(Linneaus, 1771)
Symphalngussyndactylus(Raffles, 1821)
Nomascusleucogenys(Ogilby, 1840)
Borneon gibbon
Agile gibbon
White-handed gibbon
Siamang
White-cheeked gibbon
EN
EN
EN
EN
CR
Pongopygmaeus(Linnaeus, 1760)
PongoabeliiLesson, 1827
Orang-utan
Sumatran orang-utan
EN
CR
Hylobatidae
Pongidae
Callitrichidae
Callithrixjacchus(Linnaeus, 1760)
Common marmoset
LC
*CR=critically endangered; EN=endangered; LC=least concern; VU=vulnerable; NT=near threatened; LC=least concern.
Amplification of Opsin Genes
In this study, approximately 1,500bpregions of intron 1, exon2 and intron 2 of MWSgene were amplified from samples of primates.Specific forward and reverse PCR
primers were designed based on Human MWS gene (GenBank Accession number NG_011606). List of primer sets used in this study: forward, 5’CACCATGCCCAGCTTCTAGG-3’; reverse, 5’- CAGGCCCCTTCTTGTCTGAG-3’. PCR were carried out in volume of 25 ul containing Taq polymerase, 5x buffer, 10
mMdNTPs, 10 mM forward and reverse primer respectively and 10 ng of primates genomic DNA. Distilled water was used as the template in negative control reaction.
The cycling parameters used re as follows: initial denaturation for 3 minutes at 95oC followed by 35 cycles of 94oC for 30 seconds, 62oC for 1 minutes and 72oC for 2
minutes and a final extension at 72oC for 15 minutes. PCR product were analysed on 1% agarose gels electrophoresis in 1x TAE buffer. Electrophoresis was run for 45
minutes at 90 volts. The gel was then visualized under ultraviolets (UV) transluminator and photograph was taken for references. PCR products that produce single and
bright bands were purified and send for sequencing. Purification was done using Wizard SV Gel and PCR Clean Up System (Promega, USA). Purified samples were then
sent to a private laboratory (First Base, Selangor) for sequencing in both directiona, with forward and reverse primer. The sequencing was run using ABI prism TM Big
dye TM terminator cycle sequencing Ready reaction kit version 3.1 or using the ABI PRISM  377 DNA Sequencer with the BigDye Terminator v3.0 Cycle Sequencing
Kit by using ABI 3730 XL capillary DNA sequencer.
DNA Sequencing Analyses/ Phylogenetic Analyses
Consensus sequence for each individual were generated and extracted from sequence in forward and reverse direction by using Geneious version 6.1.6.Chromas version
1.45 (McCarthy, 1996) was used to display DNA sequences and the sequence alignment were done using CLUSTAL X version 1.8 (Thompson et al., 1997). Aligned
sequences were blasted in the GenBank for species conformation.Phylogenetic Analysis Using Parsimony (PAUP) version 4.0 beta (Swofford, 1998) and MrBayes
(Huelsenbeck and Rosquist, 2001) software were used to construct four phylogenetic trees. The former was used to construct a Neighbor Joining (NJ), a maximum
parsimony (MP) and a maximum likelihood (ML) while the latter was used to construct a Bayesian tree. Bootstrap method for NJ tree analysis was conducted in PAUP
software with 1000 replicates. The clustering of NJ was performed using Kimura 2 Parameter (K2P) model (Kimura, 1980). MP analysis used Hasegawa, Kishino and
Yano 85 (HKY 85) evolutionary model (Hasegawa et al., 1985). ML tree analyses were performed using best-fit evolutionary model selected by Akaike Information
Criterion (AIC). Parameter value for ML and Bayesian tree analysis was set to HKY+I+G modes. On the other hand, sequence divergence analysis was estimated using
K2P (Kimura, 1980) model. The tree was saved and visualised using the Treeview software (version 1.6.6).
151 | MGC10
Results and Discussion
In this study, interspecific relationship and genetic variations of primates based on MWS opsin gene were examined. A total of 14 species comprising 24 individuals of
primates were used in this study. Four species of primates, namely, Pongo abelii, Homo sapiens, Nomascus leucogenys and Callithrix jacchus were downloaded from
GenBank and included in the analysis for comparison.In the sequence alignment analysis, there were patterns of mutations. There are deletion and insertion in the exon
2 region in OPN1MW sequences among inter and intra species of human, great apes, lesser apes and old world monkey. The first two gaps (9-nucleotide deletion and
40-nucleotide deletion) are unique to human and great apesrespectively. The third gaps (2-nucleotide deletion) are shared between lesser apes. Meanwhile the last two
gaps were shared between humans, great apes and lesser apes (one 1-nucleotide deletion and one 19-nucleotide deletion respectively).These produce a frame shift and
introduces premature stop codons. Figure 1 below shows phylogenetic relationship of primates based on MWS opsin gene.
Figure 1.Bayesian phylogram of 50% majority-rule consensus tree inferred from aligned MWS gene sequence. The phylogram consist of 14 species of primates.
In phylogenetic tree analysis, two genes partition were created which are the exon and intron. An independent phylogenetic analysis was conducted for each partition of
exon and intron. Table 2 shows summary of variation along the MWS sequence across species. Separate phylogenetic analyses of these data partitions are generally
concordant. Phylogenetic tree inferred from four analyses, namely, NJ, MP, ML and Bayesian methods produced almost similar tree topologies with some changes in
branching positions. The phylogeny is highly resolved, with bootstrap value of 90-100%.Genetic distances between primate’s species in this study generated by using
the Kimura-2-parameter algorithm ranged from 1.20% to 10.30%. Meanwhile, genetic distance between individuals of same species ranged from 0.30% to 1.40%.
Highest genetic distance is between C. jacchus and M. fascicularis with 10.30%.
152 | MGC10
Table 2. Summary of variation along the sequence across species
Locus
Intron 1
Exon 2
Total character examined
660
297
Constant character
501
252
Variable character
141
45
Parsimony-informative character
73
26
% Parsimony-informative character
11.1
8.6
Intron 2
568
383
143
71
12.5
Tree topologies were divided into three major groups (Figure 1). The arrangement of primate species was supported and shows similar topologies with known primate
tree topologies by Perelman et al. (2011). The OWM, namely, M. fascicularis, M. nemestrina, T. cristatusand N. larvatus are in Group 1.The Subgroup 1
(Cercopithecinae) and Subgroup 2 (Colobinae) was estimate to split approximately 23.5 mya (Chatterjee et al., 2009). Meanwhile, the Hominoid (Group 2) can be further
divided into three subgroups that include human, great apes and lesser apes. In the primates opsin gene phylogenetic analyses, human shown to be closely related to P.
abelii and P. pygmaeus with 2.10% and 2.40% genetic distance respectively.Human which is in subfamily Hominae is split between subfamily Ponginae approximately
15.1 mya (Chatterjee et al., 2009). All the 13 species inGroup 1 and Group 2 have a trichromatic vision.The NWM, C. jacchus is in the Group 3. C. jacchus show
polymorphism for MWS to LWS cones pigment (Dulaiet al., 1999). All male will be dichromatic meanwhile some female will have trichromatic vision. This species
estimated to split with Group 1 and Group 2 approximately 44.8mya (Chatterjee et al., 2009).
Conclusion
Current phylogenetic tree analyses have successfully shows the evolutionary pattern among 14 primates’ species based on the MWSopsin gene and mostly supported
with high bootstrap value for intraspecies relationship. This shows an evidence of Opsin gene (MWS) useful in inferring molecular phylogenetic relationships of
primates.Additional individuals and complete list of primate species in Malaysia might assist in better understanding and strong evolutionary relationship of primates.
Acknowledgments
This works was supported by a grant from the Proboscis Genome Project lead by Prof. Dr. Mohd Tajuddin Abdullah. We thank Sarawak Forestry Corporation and
Sarawak Forestry Department for permission to conduct wildlife research in national park of Sarawak. We thank JefferineRovie Ryan Japning, MadinahAdrus, Licia Ho,
MillawatiGani, Sarina Mat Yasin and WahapMarnifor the DNAsample of primates. We also thank Malaysian Genome Institute, Bangi for providing laboratory facilities.
References
Chatterjee HJ, Ho SY, Barnes I and Groves C (2009).Estimating the phylogeny and divergence times of primates using a supermatrix approach.BMC Evolutionary
Biology.9: 259.
Dulai, K. S., von Dornum, M., Mollon, J. D., &Hunt, D. M. (1999).The evolution of trichromatic color vision by opsin gene duplication in New World and Old World
primates.Genome Research 9,629-38.
Francis, C. M. (2008). A field guide to the mammals of Southeast Asia: Thailand, Peninsular Malaysia, Singapore, Myanmar, Laos, Vietnam and Cambodia. New Holland
Publishers, London.
Hasegawa, M., Kishino, H. and Yano, T. (1985).Dating the human-ape split by a molecular clock of mitochondrial DNA.Journal of Molecular Evolution, 22: 160-174.
Huelsenbeck, J. P. and Ronquist, F. (2001).MrBayes: Bayesian inference of phylogeny. Biometrics, 17754-17755.
Hunt D.M., Dulai K.S., Cowing J.A., Julliot C., Mollon J.D., Bowmaker J.K., Li W.-H., Hewett Emmett D.(1998) Molecular evolution of trichromacy in primates. Vision
Research. 38: 3299–3306.
Kimura, M. (1980).A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotides sequence.Journal of Molecular
Evolution, 16: 111-120.
Mollon, J. D. 1991. Uses and evolutionaryorigins of primate colour vision. In: Evolution of the Eye and Visual System (Ed. by J. R. CronlyDillon& R. L. Gregory), pp.
306e319. London: Macmillan.
McCarthy, C. 1996: Chromas. Version 1.45 – Southport.
Nathans J., Thomas D., Hogness D.S.(1986) Molecular genetics of human color vision: The genes encoding blue, green and red pigments. Science 232:193–203.
Payne, J., Francis, C. M. and Phillips, K. (2005). A field guide to the mammals of Borneo. The Sabah Society and WWF Malaysia, Kota Kinabalu.
Perelman P, Johnson WE, Roos C, Seuánez HN, Horvath JE, et al. (2011) A Molecular Phylogeny of Living Primates.PLoS Genetic 7(3): e1001342.
doi:10.1371/journal.pgen.1001342
Swofford, D. L. (1998).PAUP*.phylogenetic analysis using parsimony (*and other methods) Version 4. Sinauer Associates, Massachusetts.
Tan Y, Yoder AD, Yamashita N, Li WH. 2005. Evidence from opsin genes rejects nocturnality in ancestral primates. Proceedings of the National Academy of Science USA.
102:14712–14716
Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The CLUSTAL X windows interface. Flexible strategies for multiple sequence alignment
aided by quality analysis tools.Nucleic Acids Res. 25 (24), 4876– 4882.
Yokoyama, S. and R, Yokoyama. 1996. Adaptive evolution and photoreceptors and visual pigments in vertebrates. Annual review of ecology system. 27: 543-567.
153 | MGC10
ID 034
Flower Biology Study for Future Breeding of Jackfruit
Noor Baiti,
Baiti, A. A1, Maimun, T2. and Rozlaily, Z.2
1. Horticulture Research Centre, MARDI Kluang Station, Johor
2. Horticulture Research Centre, MARDI Headquarters, Serdang
Email: [email protected]
ABSTRACT:
Jackfruit (Artocarpus heterophyllus) or locally known as nangka has become a popular tropical fruit in Malaysia and it has being grown for commercial production for
local and export market. However with the limited number of varieties available for cultivation and the issues of bacterial wilt disease and ‘karat buah’ attacking the
present varieties, limit the expansion of the cultivation area. Hybridization could become one of the important way in developing improve variety of jackfruit. In able to
ensure the success rate of hybridization process, the flowering behavior of jackfruit cultivated under Malaysian tropical climate was studied. Observation was carried out
on anther dehiscence and flower anthesis on five different jackfruit varieties of 10 years old age. The male flower starts to dehisce in the afternoon and reached
maximum at 4 p.m. whereby the female flowers anthesis commenced for five days where the peak time was between the third to fifth days depending on the variety. It
was also found that the time of pollination could affect the fruit shape. This information is important to determine time setting to conduct crossing activity.
INTRODUCTION
Jackfruit (Artocarpus heterophyllus Lam.) is believed to be indigenous to the rainforests of the Western Ghats of India. It belongs to the family of Moraceae and most of
the family members are trees or shrubs and all contain latex. It is the most widely grown fruit crop in the Philippines and Thailand and also one of the popular fruit in
India, Bangladesh and Sri Lanka. Other common edible species in the same family are chempedak (A. champeden), breadfruit (A. altilis) and tarap (A. odoratissimus).
There has been an increased interest in jackfruit as a commercial crop and the plant established well under Malaysian climate (Maimun & Siti Hawa, 2008). Jackfruit is
becoming one of the popular and important fresh fruit in our country covering 3,359 ha and producing 19,934 MT in 2009. It also expected to be increased up to about
28,000 MT (MOA, 2010). Malaysian jackfruits are exported mainly to Singapore, United Kingdom, Hong Kong and Netherland (Maimun & Abd. Rahman, 2005). It was
reported that jackfruit could be improved through hybridization (Abd. Razak & Zainal Abidin, 2001). Many problems were encountered in the growing of jackfruit and the
most serious are the bacterial wilt and ‘karat buah’ that currently limit expending area of jackfruit for the existing clones: Mastura, Tekam Yellow and Mantin.
Scientific information regarding floral biology of jackfruit is meagre. Details knowledge in floral biology is required for breeding purposes. Floral biology information
determines actual time setting for crossing activities and fruits shape performances. However details of the flowers structure and biological studies of jackfruit
understanding their individual functions during the process of fruit setting will assist cultivar improvement and yields. Synchronize of fruit maturity can be also optimized.
Hence, the objectives of these studies are to describe the floral biology of jackfruit especially to determine the peak time of anther dehiscence and flower anthesis of
jackfruit in Malaysia.
MATERIAL AND METHOD
This study was conducted at the jackfruit research plot, MARDI Kluang Station, Johor, Malaysia. Five jackfruit varieties (Mastura, Kuning Mantin, CJ3, CJ5 and CJ6) were
used in jackfruit flower biology study. 5 spikes of male flower for 4 plants per each variety were selected randomly and labelled from the emergence time of filaments
and anthers out of the perianth. Percentage of anther area that covered with 25%, 50%, 75% and 100% of pollen were recorded at hourly intervals starting from 8.00
a.m to 4.00 p.m. Period of flower anthesis was considered between the emergence of stigma from the spike and the time when stigma started withering. 3 spikes of
female flowers from 4 plants per each variety were selected randomly and labelled from the first day of protruding pistils till the last day of stigma withering and became
brown. This was recorded by everyday observation with the help of a magnifying glass (Mannan et al. 1990).
154 | MGC10
RESULTS
Table 1:
1 Mean squares from ANOVA for anther dehiscence in jackfruit
___________________________________________________________________________
Source
df
Anther dehiscence
___________________________________________________________________________
Rep
3
142.36ns
Time
8
11612.85**
Clone
4
100.69ns
Time x Clone
32
75.30ns
Error
132
73.71
Total
179
__________________________________________________________________________
Mean
60.14
CV
14.28
___________________________________________________________________________
** = significantly different at p < 0.01
ns
= not significantly different
Table 2:
2 Mean of anther dehiscence at hourly interval in jackfruit
___________________________________________________________________________
Time
Means of anther dehiscence (%)
___________________________________________________________________________
8.00 a.m
27.50a
9.00 a.m
30.00a
10.00 a.m
47.50b
11.00 a.m
52.50bc
12.00 a.m
55.00c
1.00 p.m
70.00d
2.00 p.m
75.00d
3.00 p.m
85.00e
4.00 p.m
98.75f
___________________________________________________________________________
Means with the same letter are not significantly different (p < 0.05)
Table 3:
3 Mean squares from ANOVA for flower anthesis in jackfruit
__________________________________________________________________________
Source
df
Flower anthesis
___________________________________________________________________________
Rep
3
97.15ns
Day
6
10160.39**
Clone
4
202.00ns
Day x Clone
24
896.72ns
Error
102
30.94
Total
139
___________________________________________________________________________
Mean
63.21
CV
8.80
___________________________________________________________________________
** = significantly different at p < 0.01
ns
= not significantly different
155 | MGC10
Table 4:
4 Mean of flower anthesis by day in jackfruit
___________________________________________________________________________
Day
Means of flower anthesis (%)
___________________________________________________________________________
1
41.50e
2
62.75c
3
82.30b
4
87.20a
5
81.90b
6
59.25d
7
27.55f
_______________________________________________________________________
Means with the same letter are not significantly different (p < 0.05)
A
B
(A)
(B)
(C)
C
Figure 1: Stages of anther dehiscence in jackfruit:
Anther dehiscence forms the emergence of filaments and anthers on male spike.
Anther fully dehiscence with yellow pollen.
After dehiscence, it turns black, mould, and drop.
B
A
(A)
(B)
(C)
C
Figure 2: Stages of Flower anthesis in jackfruit:
Flower anthesis from the emergence of stigma on the female spike.
Flower anthesis at the peak time of protruding pistils.
Stigma started withering and becoming brown the entire spike.
DISCUSSION
Analysis of variance showed that there is highly significant different (p < 0.01) in time of anther dehiscence (Table 1). Anther started to dehisce in the afternoon at 1 p.m.
until the evening at 4 p.m. The study was also indicated that anther dehiscence reached maximum point at 4 p.m with 98.75% (Table 2). The emergence of anther on
the smooth surface of staminate spike (Figure 1: A-C) occurred during the day of 8 a. m. - 4 p.m. as well as 27.5% to 98.75%, respectively. Minimum emergence of
anther during the day was observed early in the morning at 8 - 9 a.m. (27.5% - 30%) and thereafter increased gradually having peak during 3 - 4 p.m. (85% - 98.75%).
Dehiscence of anther also occurred during the day as well as night to the extent of 83.33% and 16.67%, respectively as reported by Mannan et al. (2006). Mannan et
al. (2006) finding was really helped on understanding floral biology of off-season jackfruit germplasms at Bangladesh. His studies mentioned that a large number of
anthers (14.6%) emerged on the surface of the spike during 2 - 4 p.m while it was lowest (9.3%) during 6 - 8 a.m. It showed that the right time of anther dehiscence
was almost in the evening as the peak hour at 4 p. m.
Besides, analysis of variance also showed that there are highly significant differences (p < 0.01) at the day of flower anthesis (Table 3). There were interactions between
days and clones indicating that the day of flower anthesis are affected by the genetic variations among them. Jackfruit flowers started to anthesis from the 1-7 days
which was most of the flowers covered with stigma emergent since the inflorescence is opened. This emergence of stigma was occurred on the surface of female spike
for a week as well as the receptivity period of stigma varied from that period for further pollinating activities as mentioned by Mannan et al. (1990). The maximum period
156 | MGC10
of protruding pistils from the protrusion of stigma on female spike was ranged from 3-5 days with 82.3%, 87.2% and 81.9% respectively (Table 4). Although the rate
has a peak point (87.2%) at day 4 but then it decreased to the minimum point (59.25%) at day 6 and decreased gradually up to 27.55% at day 7 before withering and
stigma started to brown the entire spike (Figure 2: A-C).
CONCLUSION
The results of this study provide some basic information on the floral biology of jackfruit in Malaysia. The study revealed that the pistils of female flowers more protruded
for a period of four to five days, while the male flowers highly dehisce their pollen for one and half days only. Therefore, this study suggests the best optimum pollination
period is between days 4 - 5 in the evening where both of anther dehiscence and flower anthesis are at the peak time. Further study on pollen viability and stigma
receptibility will be done to complete the information of jackfruit flower biology in Malaysia.
ACKOWLEDGEMENT
ACKOWLEDGEMENT
The authors are grateful to those who have directly and indirectly contributed to this study especially to jackfruit staffs at MARDI Kluang Station. This study was funded by
MARDI Short Term Grant (JP-RH0401-0108).
REFERENCES
Abd. Razak, S. & Zainal Abidin, M. 2001. A case study of jackfruit. Paper presented at Seminar on Potentials of The Fruit Industry, Sarawak.
Maimun, T. & Abd. Rahman, M. 2005. Fruit quality evaluation of jackfruit at MARDI Kluang, Johor. Proceeding of Horticulture Technical Meeting at Sandy Paradise Hotel,
Penang. 27 - 30 June 2005.
Maimun, T. & Siti Hawa, J. 2008. Jackfruit (Arthocarpus heterophyllus). In Breeding Horticulture Crop, MARDI: 119 - 132.
Mannan, M. A., Haque, M. A. & Hossain, M. A. 1990. Studies on floral biology of jackfruit (Artocarpus heterophyllus Lam.). Bangladesh J. Agri 15(4): 233-238.
Mannan, M. A., Ashraful Islam, K. M., Islam, M. R. & Khan, S. A. K. U. 2006. Floral biology of off-season jackfruit in South-West region of Bangladesh. Kimbia University
Studies, Special Issue (1st Research Cell Conference): 101-107.
MOA. 2010. Perangkaan Agro Makanan 2010.
157 | MGC10
ID 035
Mapping of Genes Related to Immunity in the Nasalis larvatus Genome Using Bioinformatic Approaches.
1
Aswini LeelaLoganathan,
LeelaLoganathan, 2Vijay Kumar, 3Christopher VooLok Yung, 4Kenneth Francis Rodrigues
Biotechnology Research Institute, University Malaysia Sabah, Jalan UMS
Email: [email protected]
ABSTRACT:
Nasalis larvatus (Proboscis Monkey) also known locally as Bekantan/Bayau are endemic to the island of Borneo. Its habitat loss has resulted in severe decline in endemic
population and listed as Appendix I by the Convention on International Trade in Endangered Species (CITES). This research will focus on characterizing the genes linked
to immunity and host defence which are the Major histocompatibility complex (MHC) present in the Nasalis larvatus genome. The MHC contains the most diverse genes
in vertebrates which plays an essential role in-host defence, kin recognition and mate choice. The aim of this study is to assess the genes related to immunity in the
Nasalis larvatus and gather novel data that can benefit in clinical studies and eventually enable effective conservation measures to be taken to protect the Nasalis
larvatus in its natural habitats. In order to achieve this, the Nasalis larvatus DNA was amplified using phi29. Polymerase chain reaction (PCR) primers were designed from
the MHC genes of Non human primate obtained from EST. The primers were used to independently amplify and sequence each DNA segment. Amplification reactions
were performed in a 96-well microtiter-plate thermal cycler (BIORAD). Gel extraction of the PCR product was done using QIAquick gel extraction kit (QIAGEN) while
Cloning was carried out using CloneJET PCR cloning kit (Thermo Scientific). The plasmid was purified using Gene Jet Plasmid Mini Prep Kit (Thermo Scientific). The
plasmid was then sequenced using BigDye® Terminator v3.1 cycle sequencing kit chemistry.The sequencing products were assembled and analyzed using SeqMan
(DNASTAR) software. Alignment was performed using ClustalW program in Mega 5.2. Phylogenetic tree was constructed using Mega 5.2 to study the patterns of
relationships of the immunity genes among the Nasalis larvatusand other non primates and presumed ancestors and the descendants are traced in time, by analysis of
homologous characters.
Keywords : Nasalis larvatus; Major Histocompatibility Complex; MHC; Immunity Genes Mate Choice; Kin Recognization; Evolution; Conserved;
INTRODUCTION
Nasalis larvatus
Nasalis larvatus or Proboscis monkey is endemic to Borneo, occurring in Brunei, Indonesia (Kalimantan) and Malaysia (Sabah and Sarawak). (Groves 2001). As one of the
closest living Old World Monkey to the human, it may hold some unique genes that are beneficial to both human and other non human primates. The Nasalis larvatus
populate mangrove forests along river and estuaries. (Bootratana 2000). Nasalis larvatus are folivores and frugivores. (Yeager 1989). These primate is protected from
hunting and confinement in Borneo however the deforestation of mangrove trees and both human and non human predators have limited the population. (Meijaard &
Nijman 2000a; Wang 2000).Nasalis larvatus are protected by Borneoan Wildlife Law, and are listed as Appendix I by the Convention on International Trade in
Endangered Species (CITES). (Appendix I is defined as a species threatened with extinction with trade allowed only in extreme circumstances.) They are also listed as
endangered by the International Trade in Endangered Species of Wild Fauna and Flora (IUCN). ('Endangered' is defined as an estimated 50% reduction in the population
in the next 10 years.)In order to provide effective management for this endangered species, it is necessary to characterize its population diversity in the wild as a
prerequisite to captive breeding programs. (Gron 2009).This study will help deciphering the phylogenetic order of the immunity genes-MHC of the primates and identify
the MHC genes that are highly conserved in Nasalis larvatusand eventually by taking appropriate measures these endangered species can be saved.
Major Histocompatibility Complex (MHC)
The major histocompatibility complex (MHC) is comprised of the class I, class II, and class III regions that plays a primary function in the immune response and provide an
important model in studies of primate evolution. (Vamenta et al.,2004; Knapp2005) The major histocompatibility complex (MHC) are found in all jawed vertebrates
examined to date. The MHC contains a high percentage of immune genes, specifically genes involved in antigen presentation, which are usually highly polymorphic. The
region plays a significant role in disease resistance. (Kelley et al.,2005) MHC alleles play an essential role in cellular immune responses to intracellular pathogens such
as viruses and some pathogenic bacteria. (Ouyanget al.,2008) More recent studies also sustain the argument that MHC genes influence individual odours used in kin
recognition and mate choice due to an unprecedented amount of allelic variation, or polymorphism, which allows diverse immunological and behavioural functions. MHC
polymorphism also provides a tool for discriminating between individuals of the same species. (Bonneaudet al.,2006;van Oosterhout 2009) Mate choice and Kin
recognization are one of the most important evolutionary mechanisms. Growing evidence suggested that the female primates can improve the feasibility of their offspring
by selectively choosing certain males. Genetic benefits can be achieved if the risk of genetic incongruity between maternal and paternal genomes is minimised by
avoiding mating with close kin (inbreeding avoidance), or by increasing the genetic heterozygosity or diversity within the progeny. (Schwensowet al.,2008)For these
reasons, the genes of the MHC can provide vital insight into evolutionary origins, natural selection, and behavioural ecology in humans and nonhuman primates. (Knapp
2005; Ruff et al.,2012; Kelley et al.,2005) Although nonhuman primates contribute significantly to comparative human studies, relatively little is known about the genetic
diversity and genomics underlying nonhuman primate immunity. (Vamentaet al.,2004)Recent studies provided evidence that MHC peptides serve as chemosensory
158 | MGC10
signals in the vomeronasal organ by which individual MHC genotype diversity can be used as a relatedness marker and may influence social behaviour. (Schwensowet
al.,2007) Such olfactory cues might be especially important in saving the Nasalis larvatus from extinction.To address this issue, we have sequenced 3 Major
Histocompatibility Complex genes of theNasalis larvatus.
MATERIALS AND METHODS
Targeted immunity genes of various primates (human and non human primates) were obtained from NCBI database. We used CYGWIN to convert all the FastA files to
MultifastA. Following that we run stand alone blast against the Nasalis larvatus using CLC Genomic Workbench. We choose the most relevant and most accurate hit, i.e.
e-value of 0.00 and designed the primer using Primer3 software. Primers were designed for amplifying based on conserved sequences in the primates from the
database. After that PCR amplification was performed in BIORAD Thermal Cyclers. Gel extraction was carried out using commercial kit QIAquick (QIAGEN) following
protocol by the manufacture. We carried out the cloning using CloneJET PCR cloning kit (Thermo Scientific). Subsequently we obtained the plasmid using Gene Jet
Plasmid Mini Prep (Thermo Scientific). The sequencing reaction was doneusing chain termination method and optimized protocols using the BigDye® Terminator v3.1
cycle sequencing kit chemistry. All Sequenced genes have been submitted to GENBANK, (GENEBANK Accession No:KF279639
No:KF279639 and KF279640)The
KF279640)
DNA sequences
were assembled and analyzed using SeqMan (DNASTAR) software. Alignment was performed using ClustalW program in Mega 5.2. Phylogenetic tree was constructed
using Mega 5.2 to study the pattern of relationship of the retroviral genes among the Nasalis larvatus and other primates and presumed ancestors and descendent are
traced by analysis of homologous characters.
RESULT AND DISSCUSSION
We compiled 110immunity genes from various primates from the NCBI and run a stand-alone blast against the Nasalis larvatus genome using CLC Genomic Workbench.
Out of the 110 retrovirus genes, 12 showed an e-value of 0.00 which is considered to be most relevant and accurate hits. Primers were designed from this 12 genes
using Primer3 software. PCR amplification was performed and it was proved that all 12 genes were present in the Nasalis larvatus genome. The sequencing reactions
were performed using an ABI. Once assembled and analyzed using SeqMan (DNASTAR), alignment of the sequence was performed using ClustalW program in MEGA 5.0.
Out of 12, only 3 gave expected result. The alignment from the ClustalW shows that the 4 retroviruses were highly conserved.From a total of 110 MHC genes that were
analyzed, only 3 of the results were consistent with our strict criteria for submission to the GENBANK and MHC databases. This might be due to the limited number of
clones for sequencing or any errors in polymerase chain reactions(PCR). Another possible cause was that thesequencesexpressed at lower levels in theNasalis larvatus’s
blood cells.
Phylogenetic tree was constructed and analyzed using Neigbour-Joining (NJ) and Maximum likelihood (ML) method in MEGA 5.2. Neighbor Joining (NJ) and Maximum
Likelihood (ML) are the two most commonly used method to create a phylogenetic tree. NJ is a distance based method while ML is a character based method. NJ is
very computing efficient and simulation studies show high accuracy for a phylogenetic tree while ML has nice statistic properties but is very time consuming. Our data is
also subjected to bootstrap analysis with 1000 replication to assess the strength of support for any particular clade. Bootstrapping for NJ can be done within several
minutes even the number of taxa is large. But bootstrapping for ML is not feasible due to large amount of computing time. So it is interesting to know if NJ and ML
produce different consensus trees or not. We used 9 various primates [Pan troglodytes (Chimpanzee), Pan panicus (Bonobo), Gorilla gorilla (Gorilla), Homo sapiens
(Human), Macaca mulatta (Rhesus Monkey), Pongoabelii (Sumatran Orang Utan), Pongopygmaus (Bornean orang Utan), Hylobates (Gibbon) and Macaca fuscata
(Japanese Macaque/Snow Monkey) ] Major histocompatibility complex (MHC) genes nucleotide data set as model to construct the tree to see if the MHC’s shared a
common ancestry with the Nasalis larvatus. From the NJ and ML trees created individually for the 3 MHC data, we can presume that the result shows high consistency
of conservation of the MHC genes. (See Fig. 1,2,3)
In Fig. 1 and Fig. 3, shows the tree topologies obtained from NJ analysis of the Nasalis larvatus MHC’s are highly congruent with respect to the phylogenetic position of
the Homo sapiens. While in and Fig. 2, the tree topologies suggests that the Nasalis larvatus MHC’s is highly congruent with respect to the phylogenetic position of the
Macaca fuscata. The Phylogenetic branches suggest diversity of the MHC’s in Nasalis larvatus to human. In this research the 3 detected MHC’s suggested multiple signs
long time presence of the MHC’s in the genomes even though the Nasalis larvatus split from the human lineage 25 MYA.
159 | MGC10
Figure 1:Nasalis
1:Nasalis larvatus clone 4 MHC
Figure 2: Nasalis larvatus clone 9 MHC
160 | MGC10
Figure 3: Nasalis larvatus clone 10 MHC
Figure 1,2& 3 :Bootstrapped
NJ and ML tree calculated from Kimura 2-parameter assuming that a certain fraction of sites are uniformed based on 1000 replicates
:
constructed using MEGA 5.2 with the data sets of primate nucleotides.
CONCLUSION
CONCLUSION
Phylogenetic analyses of immunity genes express the highly conserved nucleotides genes which are also endowed with conserved imperative functions. This domain is
conserved among a large series of immunity genes, and we have therefore attempted to generate phylogenetic links between the Major Histocompatibility Complex
(MHC) identified from Nasalis larvatus together with other primates which is obtained from the databases following alignments of the nucleotide sequences. This
endorsed us to unravel a conserved organization among the domains and to identify a large number of MHC’s from sequence databases. This study shows that the
MHC’s are highly conserved in Old World Monkey, i.e. the Nasalis larvatus. Overall, the accomplishment of the alignment in this study enable the identification of MHC’s
in the Nasalis larvatus, an Old World Monkey. We also could identify the similarity and diversity of the MHC’s in the primates.
Genetic and evolutionary studies of the immune response have often centered on the Major Histocompatibilty complex (MHC), comprised of the class I, class II, and class
III regions. These considerations provided motivation to better understand the genetic diversity and genomics of the immune response in Nasalis larvatus both to aid
clinical studies, as well as to advance our understanding of the evolutionary history of primates through comparative genomic analysis. (Vamentaet al.,2004)
In an attempt to gain a better understanding of the evolutionary strategies used to generate and maintain MHC variation in primates, we believe it is necessary to
evaluate MHC diversity at the genomic and haplotype, as well as the allelic level, whenever possible. (Huchardet al.,2008) Functional studies of the Nasalis larvatus
immune response can benefit from these data immediately by incorporating the new knowledge of the MHC gene content into the experimental design. These data
emphasize the need for genomic sequence data from other immune complexes within the Old World Monkey genome and from other nonhuman primates used in clinical
research. (Vamentaet al.,2004; Setchellet al.,200l)MHCgenes provide an intriguing new direction for behavioural ecology and may provide clues to important targets of
sexual selection. Understanding genetically based mating preferences can also have practical benefits, such as better management of endangered species. An
MHCcomponent should be added to studies employing other promising measures of immune response, such as ELISA detection of humoral immunity in the Nasalis
larvatus.(Zelanoet al.,2002)
ACKNOWLEDGEMENT
This project is funded bythe Ministry of Science, Technology and Innovation (MOSTI), through the Genomics and Molecular Biology R&D Initiatives Grant under the
Malaysia Genome Institute (MGI). This Project is a collective effort by the Malaysian Genome Resource Centre (MGRC), University Malaysia Sabah (UMS) and also
University Malaysia Sarawak (UNiMAS).
161 | MGC10
REFERENCES
Boonratana R. 2000. Ranging behavior of proboscis monkeys (Nasalis
Nasalis larvatus)
larvatus in the lower Kinabatangan, northern Borneo. Int J Primatol 21(3):497-518.
Bonneaud, C., Chastel, O., Federici, P., Westerdahl, H., &Sorci, G. (2006).Complex Mhc-based mate choice in a wild passerine.Proceedings.Biological sciences / The
Royal Society, 273(1590), 1111–6. doi:10.1098/rspb.2005.3325
Daza-vamenta, R., Glusman, G., Rowen, L., Guthrie, B., &Geraghty, D. E. (2004). Genetic Divergence of the Rhesus Macaque Major Histocompatibility Complex, 1501–
1515. doi:10.1101/gr.2134504.1993
Felsenstein J. (1985). Confidence limits on phylogenies: An approach using the bootstrap. Evolution39:783-791.
Gron KJ. 2009 February 25. Primate Factsheets: Proboscis monkey (Nasalis larvatus)
Conservation .<http://pin.primate.wisc.edu/factsheets/entry/proboscis_monkey/cons>. Accessed 2013 August 15.
Huchard, E., Weill, M., Cowlishaw, G., Raymond, M., & Knapp, L. a. (2008).Polymorphism, haplotype composition, and selection in the Mhc-DRB of wild
baboons.Immunogenetics, 60(10), 585–598. doi:10.1007/s00251-008-0319-x
Kelley, J., Walter, L., &Trowsdale, J. (2005).Comparative genomics of major histocompatibility complexes.Immunogenetics, 56(10), 683–95.doi:10.1007/s00251-0040717-7
Kimura M. (1980). A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular
Evolution16:111-120.
Knapp, L. a. (2005).The ABCs of MHC.Evolutionary Anthropology: Issues, News, and Reviews, 14(1), 28–37. doi:10.1002/evan.20038
Kumar S. and Gadagkar S.R. (2001). Disparity Index: A simple statistic to measure and test the homogeneity of substitution patterns between molecular
sequences. Genetics 158:1321-1327.
Meijaard, E., & Nijman, V. (2000a). Distribution and conservation of the proboscis monkey (Nasalis larvatus) in Kalimantan, Indonesia. Biological Conservation, 92(1), 15–
24. doi:10.1016/S0006-3207(99)00066-X
Meijaard, E., & Nijman, V. (2000b). Short communication The local extinction of the proboscis monkey Nasalis larvatus in Pulau Kaget Nature Reserve , Indonesia,
34(August 1999), 66–70.
Nei M. and Gojobori T. (1986).Simple methods for estimating the numbers of synonymous and nonsynonymous nucleotide substitutions. Molecular Biology and
Evolution 3:418-426.
Nei M. and Kumar S. (2000).Molecular Evolution and Phylogenetics. Oxford University Press, New York.
Ouyang, D., Xu, L., Dai, Z., Shi, H., Zhang, G., Zheng, Y., & He, X. (2008). Identification of major histocompatibility complex class I alleles in Chinese rhesus macaques.
ActaBiochimicaetBiophysicaSinica, 40(11), 919–927. doi:10.1111/j.1745-7270.2008.00474.x
Penn, D. J., & Potts, W. K. (1999). The Evolution of Mating Preferences and Major Histocompatibility Complex Genes.The American Naturalist, 153(2), 145–164.
doi:10.1086/303166
Ruff, J. S., Nelson, A. C., Kubinak, J. L., & Potts, W. K. (2012). CHAPTER 17 MHC SIGNALING DURING SOCIAL COMMUNICATION, 290–314.
Saitou N. and Nei M. (1987). The neighbor-joining method: A new method for reconstructing phylogenetic trees. Molecular Biology and Evolution4:406-425.
Schwensow, N., Fietz, J., Dausmann, K., &Sommer, S. (2007). MHC-associated mating strategies and the importance of overall genetic diversity in an obligate pair-living
primate.Evolutionary Ecology, 22(5), 617–636. doi:10.1007/s10682-007-9186-4
Schwensow, N., Eberle, M., &Sommer, S. (2008). Compatibility countsƐ: MHC-associated mate choice in a wild promiscuous primate, (December 2007), 555–564.
doi:10.1098/rspb.2007.1433
Setchell, J. M., &Huchard, E. (2010). The hidden benefits of sex: Evidence for MHC-associated mate choice in primate societies. BioEssays, 32(11), 940–948.
doi:10.1002/bies.201000066
Tajima F. (1993). Simple methods for testing molecular clock hypothesis.Genetics 135:599- 607.
Tamura K. and Nei M. (1993).Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Molecular
Biology and Evolution 10:512-526.
Tamura K., Peterson D., Peterson N., Stecher G., Nei M., and Kumar S. (2011). MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood,
Evolutionary Distance, and Maximum Parsimony Methods. Molecular Biology and Evolution 28: 2731-2739.
The Mendeley Support Team.(2011). Getting Started with Mendeley.Mendeley Desktop. London: Mendeley Ltd. Retrieved from http://www.mendeley.com
Van Oosterhout, C. (2009). A new theory of MHC evolution: beyond selection on the immune genes. Proceedings.Biological sciences / The Royal Society, 276(1657),
657–65. doi:10.1098/rspb.2008.1299
Wang, X. P., Yu, L., Roos, C., Ting, N., Chen, C. P., Wang, J., & Zhang, Y. P. (2012). Phylogenetic Relationships among the Colobine Monkeys RevisitedƐ: New Insights
from Analyses of Complete mt Genomes and 44 Nuclear Non-Coding Markers, 7(4), 1–12. doi:10.1371/journal.pone.0036274
Yeager, C. P. (1993). Conservation status of proboscis monkey groups and the effects of habitat degradation, 1989–1991.
Zelano, B., & Edwards, S. V. (2002). An MHC component to kin recognition and mate choice in birds: predictions, progress, and prospects. The American naturalist, 160
Suppl , S225–37. doi:10.1086/342897
162 | MGC10
ID 036
036
Rain--Fed Conditions
Location Effect on Heritability and Selection Response for Maturity and Yield Traits in Wheat under Rain
Dr Iftikhar Hussain Khalil
Plant Breeding and Genetics, Faculty of Crop Production Sciences, The University of Agriculture Peshawar, Pakistan
Email: [email protected]
ABSTRACT:
Wheat breeders evaluate new genotypes at several locations to ascertain their yield potential and stability before release as new cultivars. Twenty wheat genotypes were
evaluated at three locations (AUP, NIFA and CCRI) of Khyber Pakhtunkhwa province, Pakistan as independent rainfed experiments during 2011-12 using RCB design with
three replications at each location. Analysis of variance across locations revealed significant differences (P < 0.05) among wheat genotypes and locations for tillers m-2,
spike length, grains spike-1, 1000-grain weight and grain yield. Genotype × location interaction was also significant (P < 0.05) for all traits indicating differential
performance of genotypes over the three test locations. Averaged over 20 wheat genotypes, tillers m-2, spike length, grains spike-1, and grain yield were significantly
greater at AUP than the other two locations. Ranking of wheat genotypes for major yield components varied over three locations. Maximum tillers m-2 were produced by
genotype WG-08036 at AUP (421 tillers m-2), WG-08019 at NIFA (354 tillers m-2) and CT-08055 at CCRI (287 tillers m-2). More grains spike-1 were recorded for
genotype CT-08055 at AUP (80 grains spike-1), SRN-28 at NIFA (69 grains spike-1) and SRN-28 at CCRI (51 grains spike-1). Genotypes CT-08055, CT-09095 and CT09128 were top ranking for 1000-grain weight at AUP (42.9 g), NIFA (50.7 g) and CCRI (60.2 g). Genotypes SRN-55, SRN-28 and CT-09095 were high grain yielder at
AUP (7222 kg ha-1), NIFA (4756 kg ha-1) and CCRI (5859 kg ha-1). Expression of genetic variability in form of heritability and selection response also varied over the three
locations. Moderate heritability estimates (h2 = 0.43-0.71) were observed for spike length, 1000-grain weight and grain yield. Low heritability estimates (h2< 0.44) were
noticed for tillers m-2 and grains spike-1 over the three test locations. Grain yield exhibited significantly positive genetic correlation with tillers m-2 (rG=0.32, P<0.01) and
grains spike-1 (rG=0.35, P<0.01). Similarly, grain yield exhibited strong phenotypic relationship with 1000-grain weight (rP=0.44, P<0.05) and harvest index (rP=0.83,
P<0.01). Multi-location evaluation appears best strategy to select wheat genotypes with inherent ability to survive moisture stress under rainfed production environments.
INTRODUCTION
Bread wheat is a major staple crop of Pakistan. It is grown over wide range of environments. Wheat production was 23.8 million tons during 2011-12, but only 1.2
million tons were produced in Khyber Pakhtunkhwa province which is only 25% of its annual requirements (MINFA, 2011). The remaining amount is met by import either
from other provinces (Punjab) or countries of the world. High yielding wheat cultivars with improved traits are being continuously developed (Khalil et al., 2010). Newly
developed genetic material is evaluated in segregating generations (F2-F6) and lines with desired traits are selected for further evaluation in multi-year and location trials.
The selected promising lines are then tested at different locations to ascertain genotype × environment interaction effects and their stability and adaptability over
environments.
Production of wheat is constrained by drought in many regions of the world including Khyber Pakhtunkhwa province of Pakistan where 60% wheat is planted under
rainfed conditions. Severity and effects of drought vary according to the amount and distribution of rainfall, soil characteristics and genotype (Rajaram et al., 1996). An
ideal wheat genotype would produce high yields when available soil moisture is optimum and have minimal reduction in grain yield under water stress condition. Stress
tolerance of a wheat genotype is a product of many physiological and morphological characters for which effective selection criteria have not yet developed (Ludlow and
Muchow, 1990). Genetic increase in yield under less favorable and drought prone environments has been recognized to be a difficult challenge for plant breeders, while
progress in grain yield has been much higher in favorable environments (Richards et al., 2002).
This research was undertaken to investigate genotype × location interaction for yield related traits in wheat under rainfed conditions. Furthermore, heritability and
selection response for yield components were also estimated at each of the three test locations.
MATERIALS AND METHODS
A set of 20 wheat genotypes (18 lines and 2 check cultivars) was evaluated at three locations (University of Agriculture Peshawar (AUP), Nuclear Institute for Food and
Agriculture (NIFA) and Cereal Crops Research Institute (CCRI)) of Khyber Pakhtunkhwa province of Pakistan as independent experiments under rainfed conditions in
randomized complete block design replicated thrice. The experiments were planted during mid-November 2011 at each test location. A plot for each genotype consisted
of 5m long four rows with row-to-row distance of 0.30m. Recommended doze of fertilizer, irrigation and other cultural practices essential for crop management were
applied at each test location. Data was recorded on maturity and yield contributing traits viz. tillers m-2, spike length, grains spike-1, 1000-grain weight and grain yield).
This paper is focused on yield contributing traits.
Data were analyzed across the three test locations using mixed effects model to ascertain genotype × location interaction effect for each trait (Annicchiarico, 2002). The
mean squares pertaining to genotype × location interaction was used as an error term to test the significance of location and genotype main effects, while significance of
genotype × location interaction was determined by using mean squares of pool error. Since, genotype × location interaction effect was significant for most of the traits,
data were also analyzed independently for each location to compute genetic and environmental variances required for estimation of broad sense heritability and selection
163 | MGC10
response of traits. A similar selection intensity of 20% was assumed at each location, wherein i = 1.40 in formula of selection response (Fehr, 1993). Genetic and
phenotypic correlations among yield contributing traits were also computed.
RESULTS AND DISCUSSION
Analysis of variance across three locations revealed highly significant differences (P<0.01) among locations and genotypes for tillers m-2, spike length, grains spike-1,
1000-grain weight and grain yield (ANOVA not shown). Genotype × location interaction effect was also significant for all traits indicating change in raking of genotypes
over the test locations. Tillers m-2 is an important yield contributing trait and leads to increased biological and grain yield. Mean tillers m-2 ranged from 267 to 421 at AUP
for genotypes WL-0912-1 and WG-08036, 188 to 354 at NIFA for check cultivar Pirsabak-2004 and genotype WG-08019 and 225 to 287 at CCRI for genotype WG08018 and CT-08055, respectively (Table 1). Averaged across three locations, genotype CT-08055 produced maximum tillers m-2 (324). Tillers production was
maximum at AUP (330 tillers m-2) followed by CCRI (265 tillers m-2) and NIFA (257 tillers m-2). These results are supported by the findings of Hussain et al. (1997) who
reported significant differences among wheat genotype for tillers production. Moisture stress at tillering stage has been reported for reduction in tillers production which
decrease final grain yield (Hussain et al., 1997). Genetic variances for tillers m-2 were generally of lower magnitude than environmental variances at all locations (Table 3).
Broad sense heritability estimates were moderate (0.37<h2 <0.44) with selection response of 23.23 to 39.25 tillers m-2 over three locations. These results are in line
with low to medium narrow and broad sense heritability for tillers in wheat by Wajid et al. (2004).
Spike length is an important yield contributing trait and has direct contribution to grains spike-1 and grain yield. Our results are supported by findings of Khalil et al.
(2006) and Hamam et al. (2009) who have reported significant differences among wheat genotypes for spike length and its association grain yield. Mean spike length of
20 wheat genotypes ranged from 9.0 to 13.2 cm for genotypes CT-0905 and CT-08055 at AUP, 8.1 to 14.4 cm for genotypes WG-08099 and SRN-28 at NIFA and 9.2
to 11.6 cm for genotypes SRN-47 and WG-08099 at CCRI (Table 1). Across three locations, maximum spike length of 12.0 cm was recorded for genotype CT-09128.
Genetic variance was greater in magnitude than environmental variance at NIFA only, resulting in moderate heritability (0.55) along with selection response of 1.01 cm
(Table 3). In contrast, genetic variances (0.62 and 0.21) were lower than environmental variances (1.56 and 0.94) at AUP and CCRI indicating greater environmental
influence on this trait at these locations. Low heritability was observed at AUP (0.28) and CCRI (0.18) with expected selection response of 0.50 and 0.25 cm, respectively.
Haq et al. (2008) have also reported medium to high heritability for spike length in wheat populations.
Grains spike-1 is an important yield contributing trait and has direct effect on grain yield. Previously, Shoran et al. (2000) have also reported significant genetic variation
among wheat genotypes for grains spike-1. Genotype CT-08055 produced maximum (80) grains spike-1 at AUP, while SRN-28 produced more grains spike-1 at both at
NIFA (69 grains spike-1) and CCRI (51 grains spike-1). Wheat genotypes generally produced more grains spike-1 at AUP than other two locations (Table 1). Average grains
spike-1 were 63 at AUP, 47 at NIFA and 44 at CCRI. Averaged over three locations, grains spike-1 ranged from 44 to 62 for genotypes WL-08109 and SRN-28,
respectively. Low heritability was observed for grains spike-1 at AUP (0.15) and CCRI (0.22). Likewise, at NIFA genetic variance (42.50) was lower than environmental
variance (82.96) resulting in low heritability (0.34) too (Table 3). Our results are in accordance with those of Eid (2009) who reported low heritability for grains spike-1 in
wheat. The expected selection responses for grains spike-1 were 2.36, 2.80 and 4.32 at AUP, CCRI and NIFA, respectively.
1000-grain weight is the most important yield contributing trait in wheat and is considered as potential selection criteria for yield under different environments. It is
influenced by genetic as well as by environmental factors (Hamam et al., 2009). 1000-grain weight of 20 wheat genotypes averaged over three locations ranged from
38.1 to 49.2 g for genotype SRN-65 and CT-09128, respectively (Table 2). At AUP genotype CT-08055 had the maximum 1000-grain weight (42.9 g). At NIFA, 1000grain weight ranged from 32.8 to 50.7 g for genotypes SRN-65 and CT-09095, while it ranged from 41.4 to 60.2 g at CCRI for genotypes WL-0912-1 and CT-09128,
respectively. Averaged over 20 wheat genotypes, 1000-grain weight was highest at CCRI (48.6 g) followed by NIFA (39.8 g) and AUP (37.6 g). Grain weight is a vital
yield component and is more or less stable character of wheat genotypes. However, under drought this trait is adversely affected and genotypes showing good grain
weight under irrigated condition may not be able to produce grains of similar weight under drought stressed condition (Hamam et al., 2009). At NIFA and AUP, genetic
variances were higher in magnitude than environmental variances resulting in high heritability (0.71 at NIFA and 0.56 at AUP) and selection response (3.31 g at NIFA and
3.33 g at AUP) for this trait (Table 3). It shows that selection at NIFA and AUP for this trait will be more effective than at CCRI. These results are in close conformity with
the previous work of Mohsin et al. (2009) who have also reported high heritability for 1000-grain weight.
The cumulative efforts of plant breeders for improvement of different characters, in most cases, are concentrated for genetic improvement of grain yield. Grain yield of
wheat genotypes ranged from 4000 to 7222, 3877 to 4756 and 3714 to 5859 kg ha-1 at AUP, NIFA and CCRI, respectively (Table 2). Averaged across three locations,
CT-09095 was the top grain yield producing wheat genotype (5671 kg ha-1) followed by SRN-55 with averaged yield of 5619 kg ha-1. Seven of the 18-wheat lines
included in the study produced more yield than the best yielding check Pirsabak-2004. AUP was the most productive location with an average yield of 5694 kg ha-1
followed by CCRI (4846 kg ha-1) and NIFA (4280 kg ha-1). Genetic variance for grain yield was greater than environmental variance at CCRI only. Moderate heritability
was recorded for grain yield at NIFA (0.34) and AUP (0.33), while high heritability (0.64) at CCRI (Table 3). The expected selection response for grain yield was 391.64,
385.16 and 384.25 kg ha-1 at AUP, NIFA and CCRI, respectively. These results are supported by the findings of (Hamam et al., 2009) who also observed high heritability
for grain yield.
Grain yield is a complex trait and is made up of interaction between several yield components such as spikes m-2, spike length, grains spike-1and grain weight (Anwar et
al., 2007). Hamam et al. (2009) suggested that greater yield under stress was associated with total dry matter at maturity in bread wheat. Grain yield exhibited
significantly positive genetic correlation with tillers m-2 (rG=0.32, P<0.01), spikelets spike-1 (rG=0.31, P<0.01), spike weight (rG=0.27, P<0.01), grain weight spike-1
(rG=0.31, P<0.01), spike index (rG=0.23, P<0.01), grains spike-1 (rG=0.35, P<0.01) and harvest index (rG=0.83, P<0.01). Tammam et al. (2000) have also observed
164 | MGC10
positive genetic correlation of grain yield with biological yield and other yield contributing traits. Positive and significant phenotypic correlation of grain yield was observed
with spike index (rr P=0.45, P<0.05), 1000-grain weight (rr P=0.44, P<0.05) and harvest index (rr P=0.83, P<0.01).
It is concluded that wheat lines be evaluated at several diverse locations under natural moisture stress (rainfed) conditions to isolate desirable genotypes on the basis of
major yield enhancing traits viz. tillering ability, grains m-2, grain size and weight.
REFERENCES
Anniechiarico, P. 2002. Genotype × environment interaction: Challenges and opportunities for plant breeding in cultivar recommendation. FAO Plant Prod. Prot. Paper
174.
Anwar, J., M.A. Ali, M. Hussain, W. Sabir, M.A. khan, M. Zulkiffal, and M. Abdullah. 2009. Assessment of yield criteria in bread wheat through correlation and path
analysis. The J. Animal & Plant Sci. 19(4) 185-188.
Eid, M.H., 2009. Estimation of heritability and genetic advance of yield traits in wheat (Triticum aestivum L.) under drought condition. Int. J. Genet. Mol. Biol. 1(7): 115120.
Fehr, R.W. 1993. Principles of cultivar development: Vol. 1. Theory and techniques. Macmillan Pub. Co., USA.
Fisher, R.A., and J.T. Wood. 1978. Drought resistance in spring wheat cultivars. III. Yield association with morpho-physiological traits. Aust. J. Agric. Res. 30: 10011020.
Hamam, K.A., A. Sabour, and G.A. Khalid. 2009. Stability of wheat genotypes under different environment and their evaluation under sowing dates and nitrogen fertilizers
level. Aust. J. Basic Appl. Sci. 3(1): 206-217.
Haq, W.U., M.F. Malik, M. Rashid, M. Munir, and Z. Akram. 2008. Evaluation and estimation of heritability and genetic advancement for yield related attributes in wheat
lines. Pak. J. Bot. 40(4): 1699-1702.
Hussain, A., M. Maqsood, A. Ahmad, A. Wahid, and Z. Ahmad. 1997. Effect of irrigation during various development stages on yield, components of yield and harvest
index of different wheat cultivars. Pak. J. Agric. Sci. 34: 104-107.
Khalil, I.H., S.A. Jadoon, and G. Hassan. 2006. Effect of forage clipping of grain yield and associated traits in winter wheat under agro climatic conditions of Abbotabad.
Sarhad J. Agric. 22(4): 517-522.
Khalil, A.L., M.A. Sial., M.A. Arain., M.U. Dahot., M.S. Mangrio, and A.J. Pirzada. 2010. Comparative performance of wheat advance lines for yield and its associated
traits. World Appl. Sci. J. 8:34-37.
Ludlow, M.M., and R.C. Muchow. 1990. A critical evaluation of traits for improvement crop yield in water limited environments. Adv. in. Agron. 107-153.
MINFA. 2011. Agricultural Statistics of Pakistan. Ministry for Food and Agriculture, Govt. of Pak., Islamabad.
Mohsin, T., N. Khan, and F.N. Naqvi. 2009. Heritability, phenotypic correlation and path coefficient studies for some agronomic characters in synthetic elite lines of
wheat. J. Food. Agric. Environ. 7(3): 278-282.
Rajaram, S., H.J. Braun, and M. Van Ginkel. 1996. CIMMYT’s approach to breed for drought tolerance. Euphytica 92: 147–153.
Richards, R.A., G.J. Rebetzke, A.G. Condon, and A.F. van Herwaarden. 2002. Breeding opportunities for increasing the efficiency of water use and crop yield in
temperate cereals. Crop Sci. 42:111-121.
Shoran, J., A.S. Hariprasad, K. Lakshmi, V.P. Mani, and V.S. Chauhan. 2000. Association and contribution of yield attributes to seed yield in wheat under varying
environments in North Western Hills. Ann. Agric. Res. 21: 274-280.
Tamam, A.M., S.A. Ali, and E.A.M. Sayed. 2000. Phenotypic, genotypic correlation and path coefficient analysis in some bread wheat crosses. Aust. J. Agric. Sci. 3(3):
73-85.
Wajid, A., A. Hussain, A. Ahmad, A.R. Goheer, M. Ibrahim, and M. Mussaddique. 2004. Effect of sowing date and plant population on biomass, grain yield and yield
components of wheat. Int. J. Agric. Biol. 6(6): 1003-1005.
165 | MGC10
Table 1. Means for tillers m-2, spike length and grains spike-1 of 20 wheat genotypes at each test location of Khyber Pakhtunkhwa.
Trait
Tillers m-2
Location
AUP
NIFA
CCRI
All Loc
Range
267-421
188-354
225-287
232-324
Mean
330
257
265
284
Best genotype
WG-08036
WG-08019
CT-08055
CT-08055
Spike length (cm)
AUP
NIFA
CCRI
All Loc
9.0-13.2
8.1-14.4
9.2-11.6
9.3-12.0
11.0
10.5
10.3
10.6
CT-08055
SRN-28
WG-08099
CT-09128
Grains spike-1 (no.)
AUP
NIFA
CCRI
All Loc
46-80
35-69
33-51
44-62
63
47
44
51
WG-08036
SRN-28
SRN-28
SRN-28
166 | MGC10
Table 2. Means for 1000-grain weight and grain yield of 20 wheat genotypes evaluated at 3 locations of Khyber Pakhtunkhwa.
1000-grain weight (g)
Grain yield (kg ha-1)
Genotype
AUP
NIFA
CCRI
Mean
AUP
NIFA
CCRI
Mean
CT-09056
42.4
38.8
45.1
42.1
6333
4288
5240
5287
39.6
33.9
43.3
38.9
5333
4222
4085
4546
42.9
36.3
45.0
41.4
5333
4422
4692
4816
39.1
33.0
52.4
41.5
4000
3888
4992
4293
38.5
39.9
41.4
39.9
4888
4155
4596
4546
33.1
36.2
44.9
38.0
5444
4377
5100
4974
36.9
38.1
49.2
41.4
6222
4177
5196
5198
32.6
32.8
48.9
38.1
5222
4422
4425
4690
37.6
39.2
51.4
42.7
5444
4200
3788
4477
36.6
42.1
50.7
43.1
6333
3877
5192
5134
38.1
34.7
51.1
41.3
7222
4444
5192
5619
34.7
37.8
46.5
39.6
5888
4300
3714
4634
36.5
38.7
47.1
40.8
5777
4000
4440
4739
37.8
50.3
42.5
43.5
5888
4756
5507
5384
39.3
50.7
51.1
47.0
6555
4600
5859
5671
35.4
47.7
49.6
44.2
5666
4266
5185
5039
38.2
49.3
60.2
49.2
5777
4511
5329
5206
38.5
37.8
50.2
42.2
5777
4400
4874
5017
38.3
40.9
47.3
42.2
5444
4133
3877
4485
36.0
37.1
53.7
42.3
5333
4155
5637
5042
37.6
39.8
48.6
-
5694
4280
4846
-
WG-08018
CT-08055
WG-08036
WL-0912-1
SRN-47
WL-08109
SRN-65
WL-0912-4
WG-08032
SRN-55
WG-08099
SRN-37
SRN-28
CT-0905
WG-08019
CT-09128
CT-09115
Bathoor
Pirsabak-2004
Mean
LSD(5%) for location:
1.6
312
LSD(5%) for genotype:
5.5
466
LSD(5%) for genotype × location:
9.5
807
167 | MGC10
Table 3. Genetic (Vg) and environmental (Ve) variances, heritability (h2) and selection response (Re) for yield traits of 20 wheat genotypes evaluated at 3 locations of
Khyber Pakhtunkhwa.
Trait
Location
Vg
Ve
h2
Re
Tillers m-2
(no.)
AUP
NIFA
CCRI
1183.80
1806.20
1050.11
2031.10
2254.81
1620.21
0.37
0.44
0.39
23.23
39.25
28.21
Spike length (cm)
AUP
NIFA
CCRI
0.62
2.10
0.21
1.56
1.74
0.94
0.28
0.55
0.18
0.50
1.01
0.25
Grains spike-1 (no.)
AUP
NIFA
CCRI
22.09
42.50
18.55
124.04
82.86
64.33
0.15
0.34
0.22
2.36
4.32
2.80
1000-grain weight (g)
AUP
NIFA
CCRI
10.25
27.37
12.25
7.83
10.91
22.35
0.56
0.71
0.35
3.33
3.31
2.88
Grain yield
(kg ha-1)
AUP
NIFA
CCRI
317551.00
221210.3
327711.40
403606.00
433538.20
182828.80
0.44
0.34
0.64
391.64
385.16
384.25
168 | MGC10
ID 039
039
A DecadeDecade-Long Research in Clinical Genetics: A Perspective on the Autosomal Recessive Genetic Diseases in Saudi Arabia
Mohammed AlAl- Owain1,2
Department of Medical Genetics, King Faisal Specialist Hospital and Research Centre, Riyadh, Saudi Arabia, and 2Alfaisal University, College of Medicine, Riyadh, Saudi
Arabia
Email: [email protected]
1
ABSTRACT:
Background and Purpose: Saudi Arabia (KSA) has a population of 27.1 million and an overall consanguinity rate of 56%. Prevalence of many autosomal recessive
disorders is higher than other known populations. Research in clinical genetics has been fascinating in KSA culminating in the dramatic increase in mapping of various
autosomal recessive disorders.
Methods: To reflect on a decade-long research in clinical genetics with a focus on the cloning of new genes, mapping of new syndromes to specific loci, the expansion
of known phenotypes, and the description of local genetic variants in KSA.
Results: Many novel syndromes, novel genes, and delineating the phenotypes of known genetic disorders will be described depicting different genetic concepts pertinent
to this highly inbred population. Illustrative examples about founder mutations and allelic heterogeneity will be presented. The new era of molecular diagnosis, power of
homozygosity and whole exome sequencing will be discussed. Finally, challenges in genetic diagnosis facing the clinical geneticist in our society will be highlighted.
Conclusions: We have had enormous research opportunities and results in genetics in KSA paralleling the wealth of clinical findings and observations on one side, and
the power of the current molecular technologies on the other. Addressing such genetic diseases at the national level will become a cornerstone of strategic health care
initiatives in the 21st century. Promoting research, education about genetic diseases, establishment of a "national registry" and mutational database, and enhanced
healthcare access are crucial for success of any preventative campaign of genetic disorders in the country.
Key words:
words autosomal recessive disorders, Saudi Arabia, consanguinity, tribe, founder mutations, allelic heterogeneity, autozygosity, exome sequencing
Introduction
In the last decade, molecular deciphering of broad spectrum of genetic disorders has proceeded at a fast pace. A map of many genetic disorders in Saudi Arabia is
emerging. The cloning of new genes, mapping of new syndromes to specific loci, the expansion of known phenotypes, and the description of the local genetic variants
are currently progressing dramatically, thanks to a collaborative team of clinical and molecular geneticists, and genetic counselors nationwide using the most advanced
genetic technology with strong international collaboration.
Although now a modern nation state, Saudi Arabia retains many tribal customs. Structurally, the tribe is defined by common patrilineal descent through which a large
number of individuals are united (http://countrystudies.us/saudi-arabia/22.htm). The country has a population of 27.1 million according to the latest census in 2010
(http://www.cdsi.gov.sa/english/). The overall consanguinity rate is 56% according to the most recent survey. Incidence of many recessive disorders (from the newborn
screening data) is higher than other known populations HYPERLINK \l "_ENREF_20" [Moammar et al., 2010; Saadallah and Rashed 2007].
Consanguinity and novel genetic entities
Novel syndromes in Saudi Arabia
Not unexpectedly, the high incidence of consanguineous marriages in KSA has led to the emergence of novel genetic disorders inherited in an autosomal recessive
pattern HYPERLINK \l "_ENREF_2" [Al-Hassnan and Sakati 2010]. As observed by many clinical geneticists in KSA, there are sometimes wide variations in the types and
prevalence of genetic diseases seen compared with the worldwide experience. Founder mutations have been recognized in many autosomal recessive disorders, many of
which are over-represented within certain tribes. This, in fact, can distort the genetic map as a single founder mutation may be responsible for hundreds of individuals
with a single genetic condition in the country HYPERLINK \l "_ENREF_4" [Al-Owain et al., 2012]. We recently published a novel syndrome of intellectual disability,
cataract, and striatal abnormalities HYPERLINK \l "_ENREF_3" [Al-Owain et al., 2013].
Novel genes mapped in Saudi Families
The consanguineous pedigrees with large number of affected individuals with autosomal recessive conditions have led to mapping of many genes, at least in part, on
Saudi families by exploiting the powerful technologies of autozygosity mapping and exome sequencing (see below). In fact, exome sequencing technology has allowed a
paradigm shift in the field of gene mapping of recessive disorders that are too rare to be subjected to classical linkage analysis or autozygosity mapping, or in
circumstances in which the traditional gene mapping techniques are uninformative. Its mapping power in highly inbred population is augmented when combined with
autozygosity analysis (see below).
169 | MGC10
Novel Clinical observations and expansion of the phenotypes
Due to the high pace of molecular diagnosis, we have observed numerous interesting novel clinical findings in many rare genetic disorders fulfilling the expansion of the
phenotype. We recently described a family with CA8- related cerebellar ataxia expanding the neurological spectrum with cerebellar hypoplasia HYPERLINK \l
"_ENREF_17" [Kaya et al., 2011].
Dominant and recessive forms of the disease in the same family
It is not unusual in highly consanguineous countries to diagnose a traditionally well-known autosomal dominant disorder transmitted in a recessive fashion where the
parents have a heterozygous mutation in a specific gene with mild or no "phenotype," but appearing in homozygous state in their children. For example, we are
describing a recessive and dominant form of Alport syndrome due to a homozygous and heterozygous mutation in COL4A4 (Paper under review).
Founder mutations
It is not surprising that many founder mutations causing different autosomal recessive disorders have been identified in Saudi Arabian patients. Some of these founder
mutations are tribal-specific whereas, for example, G187X in SLC26A3 appears to be an Arab founder mutation causing familial chloride diarrhea HYPERLINK \l
"_ENREF_16" [Hoglund et al., 1998].
Allelic heterogeneity
Defined as having more than one mutant allele at any given locus, allelic heterogeneity plays an important role in drawing the map of genetic diseases in highly inbred
population HYPERLINK \l "_ENREF_9" [Aldahmesh et al., 2009]. After we reviewed the mutational spectrum of the common autosomal recessive genetic disorders
reported from Saudi Arabia, allelic heterogeneity was observed in most of them. On the other hand, depicting this phenomenon in very rare autosomal recessive
disorders, Aldahmesh et al [2009] exemplified Alström disease (retinal degeneration, obesity, sensorineural hearing loss, and diabetes mellitus) in which 4 different novel
mutations in ALMS1 were found among 5 patients from 4 apparently unrelated families.
Rare is common and common is rare!
As observed by many clinical geneticists in Saudi Arabia, sometimes there are wide variations in the types and prevalence of genetic diseases seen compared with the
worldwide experience. For example, while phenylalanine hydroxylase deficiency is by far the most common form of phenylketonuria in the Caucasian population, the 6pyruvoyl tetrahydrobiopterin synthase (PTPS) deficiency is fairly common in Saudi Arabia HYPERLINK \l "_ENREF_8" [al Aqeel et al., 1991]. This is because of overrepresentation of the disease due to a PTPS founder mutation in a large tribe in the country. Another example is biotin responsive encephalopathy which was mapped to
SLC19A3 in Saudi families HYPERLINK \l "_ENREF_26" [Zeng et al., 2005], yet the first two European cases with the same genetic disease were reported in 2010
HYPERLINK \l "_ENREF_15" [Debs et al., 2010].
"Double hit" Concept
When genetic diseases are highly prevalent in a population, two (or more) conditions could occur in the same individual. While there are no hard epidemiological data on
this phenomenon, over the past decade we have observed many examples of the co-occurrence of two different genetic diseases/mechanisms within the same family or
the same patient. Sickle cell anemia and glycogen storage disease type 1a were reported in the same patient [Al-Dabbagh and Sayes 2004].
The new era of molecular
molecular diagnosis
The power of autozygosity
Autozygosity refers to the homozygous state in which the two alleles are identical by descent. First suggested by Lander and Botstein [1987], autozygosity (homozygosity)
mapping relies on the likelihood of presence of pathogenic mutations in a homoallelic state HYPERLINK \l "_ENREF_19" [Lander and Botstein 1987]. Autozygosity
mapping is currently considered one of the most robust gene discovery strategies in human genetics HYPERLINK \l "_ENREF_13" [Alkuraya 2010; Woods et al., 2004].
In fact, the recent progress in gene mapping in Saudi Arabia is largely attributed to this method HYPERLINK \l "_ENREF_13" [Alkuraya 2010]. It has been shown to be
helpful in reaching a genetic diagnosis in extremely rare autosomal recessive conditions such as skin fragility disorders and hereditary hyperekplexia due to defects in the
desmoplakin HYPERLINK \l "_ENREF_6" [Al-Owain et al., 2011b] and the β subunit of the glycine receptor HYPERLINK \l "_ENREF_5" [Al-Owain et al., 2011a],
respectively.
Whole exome sequencing
Exome sequencing, the targeted sequencing of the subset of the human genome that is protein coding, has now emerged as a powerful new tool for elucidating the
genetic basis of Mendelian disorders with unknown etiology HYPERLINK \l "_ENREF_14" [Bamshad et al., 2011; Ku et al., 2012]. Its power in genetic mapping has
been shown to be substantially higher when combined with autozygosity data from consanguinous pedigrees. For example, the combined approach was successfully
utilized in searching for novel genes such as DOCK6 HYPERLINK \l "_ENREF_22" [Shaheen et al., 2011], AGK HYPERLINK \l "_ENREF_10" [Aldahmesh et al., 2012],
ADAMTS18 HYPERLINK \l "_ENREF_11" [Aldahmesh et al., 2011a], and ELOVL4 HYPERLINK \l "_ENREF_12" [Aldahmesh et al., 2011b]; and in studying genetically
heterogeneous conditions such as Leber congenital amaurosis (ALMS1, IQCB1, CNGA3, and MYO7A) HYPERLINK \l "_ENREF_24" [Wang et al., 2011], focal segmental
glomerulosclerosis (NPHP1) [Al-Romaih et al., 2011], and mitochondrial disorders [Shamseldin et al., 2012
170 | MGC10
Conclusions
The exponential increase in the power of sequencing with the whole exome sequencing and the autozygosity mapping have allowed dramatic advances in clinical
genetics in Saudi Arabia particularly in genetic disorders with autosomal recessive inheritance. We anticipate over the next few years that many novel genes will be
cloned from the Arabian Peninsula.
References
Al-Dabbagh AA, Sayes FM. 2004. Association of sickle cell anemia and glycogen storage disease type 1a. Saudi Med J 25(12):2043-2044.
Al-Hassnan ZN, Sakati N. 2010. Genetic disorders in Saudi Arabia. In: Teebi, AS. Genetic Disorders among Arab Populations, 2nd ed. Heidelberg: Springer, 2010:531574. 531-574 p.
Al-Owain M, Al-Zahrani J, Al-Bakheet A, Abudheim N, Al-Younes B, Aldhalaan H, Al-Zaidan H, Colak D, Almohaileb F, Abouzied M, Al-Fadhli F, Meyer B, Kaya N. 2013.
A novel syndrome of abnormal striatum and congenital cataract: evidence for linkage to chromosomes 11. Clin Genet 84(3):258-264.
Al-Owain M, Al-Zaidan H, Al-Hassnan Z. 2012. Map of autosomal recessive genetic disorders in Saudi Arabia: concepts and future directions. Am J Med Genet A
158A(10):2629-2640.
Al-Owain M, Colak D, Al-Bakheet A, Al-Hashmi N, Shuaib T, Al-Hemidan A, Aldhalaan H, Rahbeeni Z, Al-Sayed M, Al-Younes B, Ozand P, Kaya N. 2011a. Novel
mutation in GLRB in a large family with hereditary hyperekplexia. Clin Genet.
Al-Owain M, Wakeel S, Shareef F, Al-Fatani A, Hamadah E, Haider M, Al-Hindi H, Awaji A, Khalifa O, Baz B, Ramadhan R, Meyer B. 2011b. Novel homozygous mutation
in DSP causing skin fragility-woolly hair syndrome: report of a large family and review of the desmoplakin-related phenotypes. Clin Genet 80(1):50-58.
Al-Romaih KI, Genovese G, Al-Mojalli H, Al-Othman S, Al-Manea H, Al-Suleiman M, Al-Jondubi M, Atallah N, Al-Rodayyan M, Weins A, Pollak MR, Adra CN. 2011.
Genetic diagnosis in consanguineous families with kidney disease by homozygosity mapping coupled with whole-exome sequencing. Am J Kidney Dis 58(2):186-195.
al Aqeel A, Ozand PT, Gascon G, Nester M, al Nasser M, Brismar J, Blau N, Hughes H, Subramanyan SB, Reynolds CT. 1991. Biopterin-dependent
hyperphenylalaninemia due to deficiency of 6-pyruvoyl tetrahydropterin synthase. Neurology 41(5):730-737.
Aldahmesh MA, Abu-Safieh L, Khan AO, Al-Hassnan ZN, Shaheen R, Rajab M, Monies D, Meyer BF, Alkuraya FS. 2009. Allelic heterogeneity in inbred populations: the
Saudi experience with Alstrom syndrome as an illustrative example. Am J Med Genet A 149A(4):662-665.
Aldahmesh MA, Khan AO, Mohamed JY, Alghamdi MH, Alkuraya FS. 2012. Identification of a truncation mutation of acylglycerol kinase (AGK) gene in a novel autosomal
recessive cataract locus. Hum Mutat 33(6):960-962.
Aldahmesh MA, Khan AO, Mohamed JY, Alkuraya H, Ahmed H, Bobis S, Al-Mesfer S, Alkuraya FS. 2011a. Identification of ADAMTS18 as a gene mutated in Knobloch
syndrome. J Med Genet 48(9):597-601.
Aldahmesh MA, Mohamed JY, Alkuraya HS, Verma IC, Puri RD, Alaiya AA, Rizzo WB, Alkuraya FS. 2011b. Recessive mutations in ELOVL4 cause ichthyosis, intellectual
disability, and spastic quadriplegia. Am J Hum Genet 89(6):745-750.
Alkuraya FS. 2010. Homozygosity mapping: one more tool in the clinical geneticist's toolbox. Genet Med 12(4):236-239.
Bamshad MJ, Ng SB, Bigham AW, Tabor HK, Emond MJ, Nickerson DA, Shendure J. 2011. Exome sequencing as a tool for Mendelian disease gene discovery. Nat Rev
Genet 12(11):745-755.
Debs R, Depienne C, Rastetter A, Bellanger A, Degos B, Galanaud D, Keren B, Lyon-Caen O, Brice A, Sedel F. 2010. Biotin-responsive basal ganglia disease in ethnic
Europeans with novel SLC19A3 mutations. Arch Neurol 67(1):126-130.
Hoglund P, Auranen M, Socha J, Popinska K, Nazer H, Rajaram U, Al Sanie A, Al-Ghanim M, Holmberg C, de la Chapelle A, Kere J. 1998. Genetic background of
congenital chloride diarrhea in high-incidence populations: Finland, Poland, and Saudi Arabia and Kuwait. Am J Hum Genet 63(3):760-768.
Kaya N, Aldhalaan H, Al-Younes B, Colak D, Shuaib T, Al-Mohaileb F, Al-Sugair A, Nester M, Al-Yamani S, Al-Bakheet A, Al-Hashmi N, Al-Sayed M, Meyer B, Jungbluth
H, Al-Owain M. 2011. Phenotypical spectrum of cerebellar ataxia associated with a novel mutation in the CA8 gene, encoding carbonic anhydrase (CA) VIII. Am J Med
Genet B Neuropsychiatr Genet 156(7):826-834.
Ku CS, Cooper DN, Polychronakos C, Naidoo N, Wu M, Soong R. 2012. Exome sequencing: dual role as a discovery and diagnostic tool. Ann Neurol 71(1):5-14.
Lander ES, Botstein D. 1987. Homozygosity mapping: a way to map human recessive traits with the DNA of inbred children. Science 236(4808):1567-1570.
Moammar H, Cheriyan G, Mathew R, Al-Sannaa N. 2010. Incidence and patterns of inborn errors of metabolism in the Eastern Province of Saudi Arabia, 1983-2008.
Ann Saudi Med 30(4):271-277.
Saadallah AA, Rashed MS. 2007. Newborn screening: experiences in the Middle East and North Africa. J Inherit Metab Dis 30(4):482-489.
Shaheen R, Faqeih E, Sunker A, Morsy H, Al-Sheddi T, Shamseldin HE, Adly N, Hashem M, Alkuraya FS. 2011. Recessive mutations in DOCK6, encoding the guanidine
nucleotide exchange factor DOCK6, lead to abnormal actin cytoskeleton organization and Adams-Oliver syndrome. Am J Hum Genet 89(2):328-333.
Shamseldin HE, Alshammari M, Al-Sheddi T, Salih MA, Alkhalidi H, Kentab A, Repetto GM, Hashem M, Alkuraya FS. 2012. Genomic analysis of mitochondrial diseases in
a consanguineous population reveals novel candidate disease genes. J Med Genet 49(4):234-241.
Wang X, Wang H, Cao M, Li Z, Chen X, Patenia C, Gore A, Abboud EB, Al-Rajhi AA, Lewis RA, Lupski JR, Mardon G, Zhang K, Muzny D, Gibbs RA, Chen R. 2011.
Whole-exome sequencing identifies ALMS1, IQCB1, CNGA3, and MYO7A mutations in patients with Leber congenital amaurosis. Hum Mutat 32(12):1450-1459.
Woods CG, Valente EM, Bond J, Roberts E. 2004. A new method for autozygosity mapping using single nucleotide polymorphisms (SNPs) and EXCLUDEAR. J Med Genet
41(8):e101.
Zeng WQ, Al-Yamani E, Acierno JS, Jr., Slaugenhaupt S, Gillis T, MacDonald ME, Ozand PT, Gusella JF. 2005. Biotin-responsive basal ganglia disease maps to 2q36.3
and is due to mutations in SLC19A3. Am J Hum Genet 77(1):16-26.
171 | MGC10
Fig. 1
The geographical distribution of genetic disorders with reported founder mutations in the Saudi population. It is of note there are many founder mutations in the country
that are yet unpublished. Abbreviations; CAH: congenital adrenal hyperplasia, def.: deficiency, MCAD: Medium-chain acyl-CoA dehydrogenase.
172 | MGC10
Fig.2
A map of the common inherited metabolic disorders in Saudi Arabia. Abbreviations, def.: deficiency, HMG-CoA l: 3-Hydroxy-3-methylglutaryl-CoA, MCAD: Medium-chain
acyl-CoA dehydrogenase, MMA: Methylmalonic acidemia, MSUD: Maple syrup urine disease, PTPS : 6-pyruvoyl-tetrahydropterin synthase, VLCAD: Very long-chain acylCoA dehydrogenase.
173 | MGC10
ID 043
043
Predicting Functional Impact of a Novel Missense Mutation (p.Asn199His) in Ornithine Transcarbamylase (OTC) Gene
Ernie Zuraida A,
A Yusnita Y, Nurul FR, Ngu LH1 and Siti Azma J2
Molecular Diagnostics and Protein Unit, Specialised Diagnostics Centre, Institute for Medical Research and 1Genetics Department, Kuala Lumpur Hospital and 2Faculty of
Pharmacy, Universiti Teknologi MARA (UiTM)
Email: [email protected]
ABSTRACT:
Ornithine transcarbamylase deficiency (OTCD) is the most common inborn error of the urea cycle. The human OTC gene is located on the short arm of the X
chromosome within band Xp21.1. The gene contains 10 exons and the phenotype of OTC deficiency is extremely heterogenous. Mutation identification is a key
component and the gold standard for prenatal diagnosis and detection of female carrier. Point mutations and small deletion/insertion in the OTC gene are responsible for
the majority of cases and are specific in individual families. The aim of this study is to investigate the effect of novel missense mutation in OTC gene by using
bioinformatics approaches. The OTC gene was amplified using touchdown PCR and subsequently subjected to bidirectional sequencing. SeqScape software, SiFT,
Polyphen, Homolog, I-Mutant, homology modeling and molecular docking were used to predict the pathological effects of the mutations. Mutational analysis identified a
novel missense mutation that was detected in exon 6 at c.595A>C. This nonsynonymous substitution resulted in changed of asparagine (Asn) to histidine (His) at a highly
conserved amino acid residue 199 (p.Asn199His). This mutation was not detected in 50 healthy unrelated individuals. Further in-silico analyses predicted this mutation
to be functionally damaging. Structural modeling revealed that the wild-type residue (Asn-199) was located on the surface of the protein. The differences in physicochemical properties between the wild-type and the mutant residue could disturb the binding properties of the structure. The mutation introduces a bulky side chain
residue (His) than the wild-type residue (Asn) at this position, thus potentially disturbing multimeric interactions and most likely alteration of the protein structure. The
mutation can also affect the local stability when the neighbouring residues are in contact with the ligand. In conclusion, both in-silico and structural analysis of the
mutation revealed that novel mutation of c.595A>C (p.Asn199His) is likely to be pathogenic in OTCD disorder.
Introduction
Ornithine transcarbamylase deficiency (OTCD) (OMIM no.331250) is an X-linked inherited disorder and the most common of the urea cycle defect. The OTC gene is
located on the short arm of the X chromosome (Xp21.1), consisting of 10 exons and 9 introns [Hata et al., 1999]. The gene spans 73 kb with an open reading frame of
1062 nucleotides and containing 354 amino acids [Horwich et al., 1984]. The phenotype of OTC deficiency is extremely heterogenous [McCullogh et al., 2000]. In
hemizygous male patients, the phenotype is determined by the nature of mutation and other yet unknown factors. Whereas, the phenotype of female heterozygous for
mutant OTC allele vary from asymptomatic carrier state to overt, even fatal disease, depending on the nature of the gene mutation, on X-inactivation pattern and on the
other genes and environmental factors [Numata et al., 2010]. To date, about 341-disease-causing mutations have been described in OTC gene [Yamaguchi et al., 2006].
However, for a better understanding of the effects of mutation in the OTC gene, a structural model of enzyme is essential. Currently, 26 structures of OTCs from 10
organisms have been deposited in the Protein Database Bank (PDB) under the OTC or ornithine carbamoyltransferase names [Dutta et al., 2008]. In 1998, Shi and
colleagues have established the crystal structure of human OTCase. Therefore, study on mutation associated with OTC structure should be used as a first line
assessment of the pathogenic potential of mutation found in OTCD patients. In the present study, we have identified mutation in the OTC gene and predicted the
functional impact of the novel mutation.
Materials and Methods
DNA extraction and sequencing
Genomic DNA was isolated from peripheral blood leukocyte by using QiaAmp DNA Blood Extraction Kit (Qiagen, Valencia, USA). All of the exon-intron boundaries of OTC
gene were amplified using touchdown PCR method in thermocycler (Eppendorf, Hamburg, Germany) [Don et al., 1991]. The PCR product was purified using a QIAquick
PCR purification kit (Qiagen, Valencia, USA) and subsequently proceeded with cycle sequencing. Bi-directional sequencing was carried out using Big Dye Terminator
version 3.1 cycle-sequencing chemistries (Applied Biosystems, Foster City, USA) on a 4-channel capillary ABI 3130-Avant Genetic Analyzer. A total of 50 unrelated
healthy individuals were also screened for the same mutation in this study.
In Silico Analyses
HomoloGene program from National Centre for Biotechnology Information (NCBI) website (http://www.ncbi.nlm.nih.gov/homologene) was used to identify highly
conserved areas of a gene through a multiple sequence alignment analysis across numerous species. Several webservers such as PolyPhen-2, SiFT and I-Mutant 2.0
were used to evaluate the degree of possible functional impact of the amino acid substitutions identified in this study.
174 | MGC10
Homology modeling & Molecular Docking
A homology model of mutant OTC was constructed based on the X-ray structure of the human OTC which was obtained from the Protein Data Bank (PDB) through its
PDB ID which is 1OTH [Shi et al., 1998]. Modeller software was used to generate the homology model using standard procedure [Sali and Blundell, 1993].
Molecular docking were performed using the Autodock Vina software [Trott and Olson, 2010]. The docking protocol have four main steps: (a) ligand preparation; (b)
receptor preparation; (c) docking using a search algorithms and (d) analysis of the binding modes using a scoring function. The ligand used in this study for the molecular
docking was N-phosphonacetyl-L-ornithine (PAO). This ligand was chosen to maintain the consistency of the structure since this type of ligand is co-crystallised with the
wild-type OTC. Both the receptor protein and PAO ligand were first converted from the .pdb to the .pdbqt format using AutoDock Vina. Molecular docking was targeted at
the active site of the human OTC, using a grid box of 20,20,20 in each x,y,z dimension with the grid box x,y,z center coordinates at 45.55, 64.12 and 39.97 respectively.
Grid box location was set so that it covers important amino acids of 1OTH (Arg92, Arg141, Asn199His, Met268, Leu304, Arg330). The parameter for exhaustiveness of
AutoDock Vina was set at 50 exhaustiveness.
Result and Discussion
Mutational analysis of OTC gene in female patient revealed a heterozygous missense mutation at c.595A>C in exon 6. This mutation is predicted to cause a change from
asparagine to histidine at amino acid 199 (p.Asn199His) (Figure 1). To the best of our knowledge, this mutation has never been reported in any databases and could well
be novel. In addition, mutation in c.595A>C was not found in 100 alelles from 50 unrelated healthy individuals suggesting that this mutation is not a polymorphism.
Previous study reported an amino acid changes at the same position in neonatal and female from aparagine to serine [Tuchman, 2002] and asparagine to aspartate
[ HYPERLINK "http://www.ncbi.nlm.nih.gov/sites/entrez?cmd=Retrieve&db=PubMed&list_uids=16786505&dopt=Abstract" Yamaguchi, 2006], respectively. Amino acid
alignment of the human OTC proteins indicates that Asn-199 residue is located within a highly conserved region (Figure 2), indicating the important of this residue for
protein structure and function.
In silico analyses using PolyPhen-2 and SIFT predicted that p.Asn199His mutation is probably damaging, while I-Mutant 2.0 analysis predicted this mutation has a
possibility to decrease the stability of the protein function.
The analyses support that the His199 mutation might affect the structure of the protein.
Reliablity of crystal structure is required to build the protein structure model since it contains the majority of architectural information such as the ligand orientation, sidechain and backbone angles. For the mutant model structure, the most rational selection of template is the wild-type protein since the alteration usually differs only a few
amino acid residues. Generally, our result of visual superposition revealed mutant His-199 adopts a very similar structure with the wild type as shown in figure 3.
However, the results of the docking simulations depict that there is different spatial between the wild-type and mutant OTC with the PAO ligand. Interaction that occurred
between the wild-type with the ligand and the mutant with the ligand could give slight changes which would alter the behaviour of the protein structure. Tuchman and
colleagues (1995) reported that residue located in this location is important for assembly of the trimer. Structural analysis showed that Asn-199 that located in the
binding pocket has a direct contact with the ligand (Figure 4). Similarly as reported by Shi and colleagues (1998) observed that the carbonyl oxygen of Asn-199 forms a
hydrogen bond to the ligand and the backbone nitrogen of Ile-200. Therefore, the replacement of Asn residue with bulky His residue might causes the loss of interaction
with the ligand (Figure 5). Furthermore, the mutation of the conserved Asn-199 highly likely will also affect the protein structure stability and disturb the multimeric
interaction of the other protein domains.
In-silico and homology model are good platforms in providing a structural basis for prediction and interpreting the effects of mutation discovered in the future. These can
also be used as guidelines to manage the site-specific mutagenesis experimental.
Conclusion
In conclusion, analyses demonstrated through both bioinformatics and computational biology have revealed a novel heterozygous c.595A>C mutation (p.Asn199His) in
OTC gene is likely to be pathogenic.
Acknowledgement
The authors would like to thank the Director General of Health Malaysia for permission to present this paper. Our special thanks to Dr Shahnaz Murad, Director of IMR
and Dr Rohani Md Yasin, Head Centre of SDC for careful reading of this paper. This study was funded by Diagnostics Services from Institute for Medical Research,
Ministry of Health. We also would like to acknowledge Bioinformatics Unit, Universiti Teknologi MARA (UiTM) Malaysia for the use of the computational facilities..
175 | MGC10
References
Don, R.H., Cox, P.T., Wainwright, B.J., Baker, K and Mattick, J.S. 'Touchdown' PCR to circumvent spurious priming during gene amplification. Nucl Acids Res
1991; 19; 4008.
2. Dutta, S., Burkhardt, K., Swaminathan, G. J., Kosada, T., Henrick, K., Nakamura, H., Berman, H.M. Data deposition and annotation at the worldwide protein data
bank. Methods Mol Biol. 2008; 426: 81-101.
3. Hata, A., Tsuzuki, T., Shimada, K., Takiguchi, M., Mori, M and Matsuda, I. Structure of human ornithine transcarbamylase gene. J. Biochem. 1988; 103, 302-308.
4. Horwich, A.L., Fenton, W.A., Williams, K.R., Kalousek, F., Kraus, J.P., Doolittle, R.F., Konigsberg, W., and Rosenberg, L.E. Structure and expression of a
complementary DNA for the nuclear coded precursor of human mitochondrial ornithine transcarbamylase. Science 1984; 224: 1068-1074.
5. McCullough, B.A., Yudkoff, M., Batshaw, M.L., Wilson, J.M., Raper, S.E., and Tuchman, M. Genotype spectrum of ornithine transcarbamylase deficiency:
correlation with the clinical and biochemical phenotype. Am J Med Genet 2000; 93: 313-319.
6. Numata, S., Koda. Y., Ihara, K., Sawada, T., Okano, Y., Matsuura, T., Endo, F., Yoo, H-W., Arranz, J. A., Rubio, V., Wermuth, B., Ah Mew, N., Tuchman, M., Pinner,
J. R., Kirk, E.P and Yoshino, M. Mutant alleles associated with late-onset ornithine transcarbamylase deficiency in male patients have recurrently arisen and have
been retained in some populations. J Human Genetics 2010; 55,18-22.
7. Sali, A and Blundell, TL. Comparative protein modelling by satisfication of spatial restraints, Journal of Molecular Biology 1993; vol. 234, no. 3, pp779-815.
8. Shi, D., Morizono, H., Ha, Y., Aoyagi, M., Tuchman, M and Allewell N.M. 1.85-A resolution crystal structure of human ornithine transcarbamoylase complexed with
N-phosphonacetyl-L-ornithine. Catalytic mechanism and correlation with inherited deficiency. J Biol Chem 1998; 273: 34247-34254.
9. Trott, O and Olson A. J. AutoDock Vina: improving the speed and accuracy of docking with a new scoring function, efficient optimization and multithreading.
Journal of Computational Chemistry 2010;31: 455-461.
10. Tuchman, M., Jaleel, N., Morizono, H., Sheehy, L and Lynch, M.G. 2002.Mutations and polymorphisms in the human ornithine transcarbamylase gene. Hum Mutat
2002; 19: 93-107.
11. Tuchman, M., Morizono, H., reish, O., Yuan, X and Allewell, N.M. The Molecular basis of ornithine transcarbamylase deficiency: modelling the human enzyme and
the effects of mutations. J Med Genet 1995; 32:680-688.
12. Yamaguchi, S., Lisa, L. Brailey., Hiroki, M., Allen, E. Bale and Mendel, T. Mutation and Polymorphism in the Human Ornithine Transcarbamylase (OTC) Gene.
Human Mutation 2006; 27 (7): 626-632.
1.
176 | MGC10
a
N199
b
H199
Figure 1: DNA sequencing profiles. Electropherogram
profiles of wild type allele (a) and a heterozygous mutant
allele (b). The single nucleotide transversion at location
595bp (c.595A>C) is indicated by an arrow. The
mucleotide change is predicted to cause an amino acid
substitution of asparagine to histidine at residue 199
(p.Asn199His).
N199
Figure 2: Multiple sequence alignment of
human OTC with other species. The alignment
data show that asparagine at position 199 is
highly conserved amongs other species. The
position of the mutated residue (p.Asn199His)
is indicated by the arrow.
Figure 3: Superimposition of Asn199 (WT) with the
predicted His199 mutation. The bulky side of histidine
shows in red color while the WT shows in green color.
177 | MGC10
Figure 4: Interaction of wild-type Asn199 (cyan) with PAO ligand
(red).
Figure 5: Interaction of mutant His199 (grey) with PAO ligand
(blue).
178 | MGC10
ID 045
045
HeparinHeparin -Binding Proteins Encoded Genes Associated with Fertility in Beef Bulls
Y. J. Tan1*, C. C. Gan2, W. S. Tan2
Genetic Improvement Program, Strategic Livestock Research Centre, MARDI
2
Faculty of Biotechnology &Biomolecular Science, UPM
*Email: [email protected]
1
ABSTRACT:
Heparin is a glycosaminoglycan, which is naturally secreted in the female reproductive tract. It is believed that bulls with good fertility produce spermatozoaboundproteins with high affinity for heparin thanless fertile bulls. Heparin-binding proteins (HBP) form complexes at different affinities for heparin. Addition of heparin to
semen secreted from caudal epididymis formed complexes with sperm-bound HBP that stimulatessperm capacitation resulting in acrosome reaction.HBPsarepresent in
seminal plasma and bulls with detectable HBP in the seminal plasma have higher fertility than bulls with undetectable HBP. Thus, the objectives of this study was to
identify the HBP-encoded genes in beef bulls.
Semen samples were collected from 20four- to six-year-old Brakmas bulls.Seminal plasma HBPswere isolated andanalysed by two-dimensional sodium dodecyl sulphate
polyacrylamide gel-electrophoresis (SDS-PAGE).HBPswith approximate molecular weightsof 13-15kDa, 24-26kDa, 30kDa, and32-35kDa were observedin seminal
plasma and were sent for peptide mass fingerprinting. From the results of fingerprinting analysis,four HBP-encoded genes were identified, namelyclusterin(CLU), tissue
inhibitor of metalloproteinases (TIMP2), seminal plasma protein (BSP-30) and tissue factor pathway inhibitor 2 (TFPI). CLU-positive spermatozoa in bull semen are
potentially a better predictor of fertility than sperm motility or abnormal morphology. Besides, CLU is also a candidate gene that could serve as abiomarkersof semen
quality and fertility in stallion.The secondmost frequent hit from the search is TIMP2 gene. The present of this protein in seminal fluid associated with higher fertility of
the bulls.It was also significantly correlated to sperm progressive motility in fresh semen and sperm viability in frozen-thawed semen. Apart from that, BSP-30of
approximately 29-35kDa was detected in 2-D SDS-PAGE.This protein is likely to be the fertility-associated antigen (FAA) in bulls.
By identification of specific genes as marker, a selection pressure on fertility could be done at a day- old, prior to economic investment into the cattle herd. The benefit to
the industry will be a high-throughput protocol in identifyingbulls that should beselected as prospective sires.
Introduction
Heparin is naturally secreted in the female reproductive tract that will bind with spermatozoa-bound proteins tostimulates sperm capacitation resulting in acrosome
reaction. Bulls with good fertility produce more spermatozoa-bound proteins with high affinity for heparin than less fertile bulls (Belin et al, 1996). Sperm capacitation
and acrosome reaction are requisite events for the process of fertilization (Bredford 1983). A specific heparin-binding protein (HBP) present in bull’s seminal plasma will
combine to form complexes with heparin found in the female reproductive tract to induce capacitation (Bellin et al 1996). Bulls with detectable seminal plasma HBPs
have higher fertility than those lacking the proteins.HBPs also allow spermatozoa to respond to a challenge with lysophosphatidylcholine, which will increase the ability of
zonapellucida to bind sperm and undergo the acrosome reaction (Braundmeier& Miller 2000).Therefore, HBPsare among the candidate of protein markers to detect
fertility of individual bull (Bellin et al 1998). Previous studies conducted at the seminal protein level indicated the presence of HBPs in certain population of local beef
bulls with higher fertility (Nordin 2006; Ramakrishnan et al,2006).Thus, the aim of this study was to identify the HBP-encoded genes in HBPs-detectable Brakmasbulls.
Materials and Method
Semen samples were collected from 20 Brakmas bulls aged four to six years old. HBPswere extracted from seminal plasma as described by Bellin et al. (1994) with
some minor modifications. Extracted HBPs were lyophilized and kept at 4°C until further use.Seminal plasma HBPs for bull with HBPs-detectable and non HBPsdetectable were analysed by two-dimensional sodium dodecyl sulphate polyacrylamide gel-electrophoresis (SDS-PAGE), which separates the protein based on molecular
weight and pH. Protein spots for HBPs-detectable were identified and sent for mass spectrometry and protein mass fingerprinting. Gene(s) that encoded the seminal
plasma HBPs were then identified.
179 | MGC10
Results and Discussion
Table 1: Seminal attributes of Brakmas bulls.
Parameter
Gross motility
Colour
Motility
Morphology
Live Spermatozoa
Semen concentration
Mean
2-3
Creamy, yellowish, or whitish
65 +12.3131%
88+6.931%
73+12.8594%
5.75 × 108 - 2.00 × 109
Brakmas bulls (n=20) were raised in a semi-intensive management system at the Muadzam Shah MARDI Research Station, Pahang. The bulls were in good physical
conditionsand semen quality (Table 1). Matured four- to six-old-year bulls were selected to minimize variation in sperm qualities, as very young bulls tend to have higher
percentage of motility and sperm abnormality compared to matured bulls (Tan et al, 2009).
Figure 2: Two-dimensional SDS PAGE of purified Heparin Binding Proteins (HBPs) of B7564 in three technical replications. (H1-H4 indicates protein spots of 32-35kDa;
H5-H8 indicates protein spots of 30kDa; H9-H13 indicates protein spots of 24-26kDa; H14-H15 indicates protein spots of 13-15kDa)
A total of 60 % of the bulls had detectable seminal plasma HBPs. These findings were slightly different from the 75% of bulls with detectable HBPs as reported from
previous finding (Nordin, 2006;Ramakrishnan et al 2006).
In the 2-D SDS-PAGE analysis, HBPs with approximate molecular weights of 13-15kDa, 24-26kDa, 30kDa and 32-35kDa were observed (Figure 2). The results of the
DNA fingerprinting (SEQUEST) and denovo sequencing (PEAK Studio 5.3) in IPI-BOVINE, Swissprot, and NCBI database identifiedfour genes that encoded HBPs. Clusterin
(CLU) gene is one of the candidate markers in this study. From the literature reviews, Clusterinis potentially a better predictor of fertility than sperm motility or abnormal
morphology (Ibrahim et al 2000). Besides, CLU is also a candidate gene that could serve as a biomarker of semen quality and fertility in stallion (Novak et al 2010).
The second most frequent hit from the search is Tissue inhibitor of metalloproteinases (TIMP2) gene. Previous report showed that the present of this proteinin seminal
fluid associated with higher fertility in the bulls (Ax 2008) while it was significantly correlated to the sperm progressive motility in the fresh semen and sperm viability in
frozen-thawed semen (Asadpour et al 2007).A study showed that bulls with TIMP2 positive in seminal plasma had 13% higher pregnancy ratesthan TIMP2 negative bull.
Apart from that, Seminal plasma protein (BSP-30) also detected in approximately 29-35kDa in 2D SDS-PAGE. This protein is likely to be the Fertility associated antigen
(FAA) in bulls and is a potential fertility marker in this study.
180 | MGC10
The extension of this research is to find the single nucleotides polymorphisms (SNP) from the differential expression of HBP encoding genes from the DNA samples.
Therefore, selection pressure on fertility could be done on a day old calves. The benefit to the industry will be high-throughput protocol to identifyanimals that should be
selectedas prospective sires.
Conclusion
The potential fertility genes identified in this study can be used in developing marker assisted selection (MAS) molecular markers in selecting potential sires for breeding
purposes. The MAS for fertility can be used for bull selection at a younger ages.So, a selection pressure on fertility can be carried out even on one-day old calves. This
will reduce the management cost of the cattle herd and will also benefit the industry through a high-throughput protocol in identifying bulls as prospective breeders
Acknowledgement
The authors would like to thank the members of Advance Reproductive Technology (ART) laboratory that for their helpin conducting the research.This research was been
funded by Ministry of Agriculture (MOA) under project 05-03-08-SF1103.
References
Asadpour R, Alavi-Shoushtari SM, Rezaii SA, Ansari MH. 2007. SDS-polyacrylamide gel electrophoresis of buffalo bulls seminal plasma proteins and their relation with
semen freezability. AnimReprod Sci. 102(3-4):308-313
Ax, R. 2008.Seminal proteins as fertility markers (Proceedings).CVC in Kansas City Proceedings.
Bedford, J. M. 1983. Significant of the need for mammals.Bio.Reprod. 28: 108-119.
Bellin, M. E., Hawkins, H. E., and Ax, R. L. 1994. Fertility of range beef bulls grouped according to presence or absence of heparin-binding proteins in sperm membranes
and seminal fluid. J. AnimSci 72: 2441-2448.
Bellin,, M. E.,Hawkins, H. E., Oyarzo, J N., Vanderboom, R. J., & Ax, R. L. 1996. Monoclonal antibody detection of Heparin-Binding protein on sperm corresponds to
increased fertiltiy of bulls. J. Anim. Sci. 74: 173-182.
Braundmeier, A. G. & Miller, D. J. 2000. The search is on: Finding accurate molecular markers of male fertility. J. Dairy Science84:
84: 1915-1925.
Ibrahim NM, Gilbert GR, Loseth KJ, Crabo BG. 2000. Correlation between clusterin-positive spermatozoa determined by flow cytometry in bull semen and fertility.J
Androl. 21(6):887-94.
Nordin, Y. 2006. Characterization of heparin-binding proterin associated with fertility in beef bulls. End of project report. Science Fund 01-03-03-0147-EA001.
Novak S, Smith TA, Paradis F, Burwash L, Dyck MK, Foxcroft GR, Dixon WT. 2010. Biomarkers of in vivo fertility in sperm and seminal plasma of fertile
stallions.Theriogenology 74(6):956-967.
Ramakrishnan P, Murugaiyah M, Pullikutty A, & Sheikh Omar A R. 2006.Relationship between bull fertility and binding of 3H heparin to spermatozoa in Sahiwal-Fresian
bull. J. Trop. Agric. and Fd. Sc. 34(2): 373-383.
Tan Ying Ju, MohamadRosalanAwang&JohariJiken Abdullah. 2009. Semen Characteristic from Young Brakmas Bull at the Central Performance Test, Muadzam Shah
MARDI Station. Proc. published in 30th Malaysian Society of Animal Production (MSAP) Annual Conference. p.219-220.
181 | MGC10
ID 046
046
Analysis of Multiple Mutations in Dihydrofolate Reductase (dhfr) Gene Associated with Antifolate Drug Resistance in
Plasmodium vivax Sabah Isolates
Nor Afizah Nuin1, Timothy William2, Prababakaran Dhanaraj3, and Lau Tiek Ying1*
1
Biotechnology Research Institute, Universiti Malaysia Sabah
2
Queen Elizabeth Hospital, Kota Kinabalu, Sabah
3
Kudat District Hospital, Kudat, Sabah
Email: [email protected]
ABSTRACT:
Plasmodium vivax is known to be the most geographically widespread malaria parasite and ranks second to cause death globally. High level resistance to antifolate
antimalarial drugs such as sulfadoxine-pyrimethamine (SP) are known to be associated with mutations in the dihydrofolate reductase (dhfr) gene of Plasmodium. This
study sought to identify single nucleotide polymorphisms (SNPs) in dhfr gene of P. vivax isolated from Kudat, Keningau and Kota Kinabalu, Sabah. Nested-PCR was
conducted to amplify dhfr gene on the confirmed single P. vivax infection based on species-specific nested-PCR. A total of 11 complete dhfr sequences in P. vivax were
amplified with product size of approximately 1.8 kb. The pvdhfr analysis showed the existence of four haplotypes including double (9.1%), triple (9.1%), quadruple
(62.5%), and quintuple (9.1%) mutant haplotypes. The double pvdhfr mutant haplotype, FRTNI (S58R + S117N) has already been described in previous studies. Mutation
at residue 57 (F->L) in our study resulted a novel codon CTC instead of TTA and TTG that was described previously. Additionally, three isolates were found to have wildtype haplotype, FSTSI with the percentage of 27.3%. The genetic similarity of haplotypes and the specific SNPs in P. vivax parasites could reflect the presence of
different geographic subdivision and time frame of P. vivax parasite. Therefore, these findings could provide critical information on the possible emergence and spread of
SP drug resistance in P. vivax Sabah isolates after the increase of failure in chloroquine (CQ) treatment.
Keywords: Plasmodium vivax, dhfr, antimalarial drug
INTRODUCTION
The disease of malaria remains as a health problem especially in underdeveloped and remote regions of the world (Cox-Singh, 1997). In Malaysia, the cases of malaria
were restricted to geographical locations especially rainforests and mountain areas.
Over the past ten years, the use of sulfadoxine-pyrimethamine (SP) combination has been the first-line antimalarial treatment in many countries after the widespread of
chloroquine resistance in Plasmodium falciparum. Specific point mutations in the parasite genes dihydrofolate (dhfr) and dihydropteroate synthase (dhps) have been
shown to cause resistance to pyrimethamine and sulfadoxine drugs, respectively (Imwonget al., 2003; Barnadaset al., 2008; Zeileet al., 2011).
In Malaysia, the combination of SP drug has been used in treatment for uncomplicated falciparum malaria since decades ago and still widely used despitethe widespread
of their clinical resistance (Abdullah et al., 2013).
MATERIALS AND METHODOLOGY
P. vivax sample collection.
collection. A total of 11 P. vivax single infection samples based on Plasmodium species-specific nested-PCR were selected in this study including 8
samples collected from Kota Kinabalu, and 3 samples collected from Kudat, Sabah. DNA extraction from blood spots on filter paper was performed using QIAamp DNA
mini kit (QIAGEN, UK) following the manufacturer’s instructions. Plasmodium species-specific nested-PCR was performed following previously described protocols
(Snounouet. al., 1993; Singh et. al., 2004).
Amplification And Sequencing of dhfrGene.
dhfr Gene. The dhfr gene for P. vivax was amplified by nested-PCR using newly designed primers. The condition used in nest-1 PCR
was as follows: initial denaturation at 98°C for 30sec, 35 cycles of the three steps: denaturation at 98°C for 10 sec, annealing at 64°C for 30 sec, and extension at
72°C for 55 sec. The final extension is at 72°C for 10 min, followed by 20°C incubation. For nest-2 PCR, the reaction was done under the following condition:
denaturation at 98°C for 30 sec, annealing at 72°C for 30 sec, and extension at 72°C for 50 sec. The final extension is at 72°C for 10 min, followed by 20°C incubation.
Gel extraction of the nest-2 PCR products was performed using Gel Extraction Kit (QIAGEN, UK). Sequencing reactions were outsourced to a commercial company,
Borneo Venture Sdn. Bhd. The DNA sequences were assembled and analyzed using SeqMan (DNASTAR) software. Completed sequences were aligned with Genbank
available wild-type and mutated sequences using CLUSTALW program in Mega 5.0 sequence analysis software to detect nucleotide polymorphisms across the entire
gene.
182 | MGC10
RESULTS AND DISCUSSION
Plasmodium vivax dhfr gene amplification.Based
on species-specific PCR, the ten selected P. vivax isolates were confirmed to be single P. vivax infection and all the
amplification.
samples were subsequently amplified with PCR for pvdhfr gene. The presence of dhfr gene in P. vivax samples is signified by the presence of PCR product in nest-2 with
the size of 1.8 kb when analyzed by gel electrophoresis in 1.5% agarose gel.
Analysis of dhfr gene for P. vivax.
vivax. Genes of pvdhfr for the 10 P. vivax isolates from this study were successfully sequenced (Fig. 1). Nucleotide polymorphisms of dhfr
gene were documented by comparison with DNA sequences from other geographical regions available at the Genbank. Table 1 shows the point mutations of pvdhfr gene
in P. vivax Sabah isolates as compared with other DNA sequences of the same genes.
M
1
2
3
4
(bp)
3000
2500
2000
1500
1000
750
500
250
1796 bp
Fig 1.0: Gel electrophoresis of pvdhfr in 1.5% agarose gel. 1)Sample KT024;2)Sample KT054;3)Sample KT089; 4)Negative control
183 | MGC10
All of the P. vivax isolates from this study were polymorphic with six nonsynonymous mutations identified which are F57L, S58R, T61M, H99S, S117T/N and I17N3F/L
as previously reported.However, the F57L mutation resulted from a novel codon at position 169 from TTC to CTC in this study (TTA and TTG mutations have been
described in previous studies).
Table 1.0: Point mutations of pvdhfr gene in P. vivax from Sabah isolates as compared with other P. Vivax isolates from other geographical regions
Note: Dot (.) indicates the amino acid similar to the wild-type sequence
Geographical
Geographical origin / Accession number
Position of Codon
57
58
61
99
117
173
AF525881 / Pakistan
F
S
T
H
S
I
EU478857 / India
.
R
.
.
N
.
AB547458 / Iran
.
R
.
.
.
.
AY772085 / Central Java
L
.
.
.
T
F
AY942933 / South Korea
I
R
M
.
T
.
FJ384777 / French Guiana
.
R
.
.
N
L
EU168431 / Madagascar
.
R
.
.
N
.
DQ244113 / Papua New Guinea
L
R
.
.
.
DQ244124 / Vietnam
.
R
.
.
N
.
AY772086 / Kalimantan
L
.
.
.
T
F
Sabah KK002
L
R
M
.
T
.
Sabah KK003
L
R
M
.
T
.
Sabah KK011
L
R
.
.
T
M
Sabah KK024
L
R
M
.
T
.
Sabah KK044
.
.
.
.
.
.
Sabah KK050
L
R
M
.
T
.
Sabah KK078
.
.
.
.
.
.
Sabah KK079
.
.
.
.
.
.
Sabah KT051
L
R
M
.
T
.
Sabah KT054
L
R
M
.
T
F
Sabah KT089
.
R
.
S
N
.
Note: Dot (.) indicates the amino acid similar to the wild-type sequence
184 | MGC10
It has been proposed that the mutations appeared in the homologous gene, pvdhfr(N117, R58, and T117) and pvdhps(G383, G553) are associated with SP resistance in
P. vivax (Imwonget al., 2001; 2003).The in vivo studieshave reported that mutations in pvdhfr have been implicated in resistance to pyrimethamine (Mula et al., 2011).
Previously reported two mutant genotypes, S117T and S117N, were also found in this study with the percentage of 64% and 9% respectively. Brega and his colleagues
(2004) had reported that the mutation S117N has been postulated to represent the first step in the drug-resistance selection process in the parasite while S117T has
been associated with highly mutated pvdhfr which may be responsible for development of high resistance to SP drug.
Considering SNPs of F57L/I, S58R, T61M, S117T/N, and I173F/L, the analysis of pvdhfr revealed the occurrence of four haplotypes, of which one has been reported
previously. The wild-type haplotypes FSTSI were found in 27.3% (n=3). Double pvdhfr mutant haplotype, FRTNI (S58R + S117N) was found in 9.1% of the samples
(n=1) and has already been described elsewhere for different regions including Indonesia, Thailand, Ethiopia, China, East Timor, Philipines, Vanuatu, Vietnam, Papua
New Guinea, Madagascar, and Iran (Hastings et al., 2004; Brega et al., 2004; Schunk et al., 2006; Auliff et al., 2006; Marfurt et al., 2008; Barnadas et al., 2008; Zakeri
et al., 2009).
Triple-mutant haplotype, LRTTI (F57L + S58R + S117T) and quintuple-mutant haplotype, LRMTF (F57L + S58R + T61M + S117T + I173F) were found in one isolate of
each case (9.1%). The other haplotype, LRMTI or quadruple-mutant haplotype were found highly prevalent as compared to other haplotypes in this study with the
percentage of 45.5%.
In view of the point mutations results obtained, mutations linked to SP resistance in P. vivax isolates from Sabah is highly prevalent. However, the correlation between
pvdhfr gene mutation and the resistance of antimalarial drug in P. vivax Sabah isolates cannot be confirmed since the in vitro and clinical responses were not assessed
and included in this study. Moreover, the small number of isolates studied does not reflect the whole population of malaria parasites in Sabah.
CONCLUSION
Even though the SP drug has not been intensively used in Sabah to treat P. vivax infection as the first line treatment, monitoring the role of point mutations identified in
this study is important since the possibility of emergence and spread of drug resistance to new lines treatment such as the antimalarial drug combination therapy is
under precautions.
ACKNOWLEDGEMENT
We thank all the patients who have contributed their samples, the healthcare staffs in assisting the samples collection for this study, and also the Ministry of Health
Malaysia for approving this project. This project is funded by Ministry of Higher Education – FRG0276-SG-2/2010.
REFERENCES
Barnadas, C., Tichit, M., Bouchier, C., Ratsimbasoa, A., Randrianasolo, L., Raherinjafy, R., Jahevitra, M., Picot, S., and Menard, D. 2008. Plasmodium vivaxdhfr and
dhpsmutations in isolates fromMadagascar and therapeutic response tosulphadoxine-pyrimethamine.Malaria Journal.7
7: 35
Mula, P., Fernandez-Martinez, A., Lucio, A., ramos, J. M., Reyes, F., Gonzalez, V., Benito, A., and Bersoza, P. 2011. Detection of high levels of mutations involved in
anti-malarial drug resistance in Plasmodium falciparum and Plasmodium vivax at rural hospital in Southern Ethiopia.Malaria Journal, 10:214
10
Singh, B., Kim Sung, L., Matusop, A., Radhakrishnan, A., Shamsul, S.S., & Cox-Singh, J. (2004). A large focus of naturally acquired Plasmodium knowlesi infections in
human beings.Lancet 363: 1017-1024
Snuonou, G., Viriyakosol, S., Jarra, W., Thaithong, S. & Brown, K. N. (1993). Identification of the four human malaria parasite species in field samples by the polymerase
chain reaction and detection of high prevalence of mixed infections. Molecular and Biochemical Parasitology 58(2): 283-292.
Zeile, I., Gahutu, J.B., Shyirambere, C., Steininger, C., Musemakweri, A., Sebahungu, F., Karema, C., Harms, G., Eggelte, T.A. and Mockenhaupt, F.P. 2011. Molecular
markers of Plasmodium falciparum drug resistance in southern highland Rwanda.
185 | MGC10
It has been proposed that the mutations appeared in the homologous gene, pvdhfr(N117, R58, and T117) and pvdhps(G383, G553) are associated with SP resistance in
P. vivax (Imwonget al., 2001; 2003).The in vivo studieshave reported that mutations in pvdhfr have been implicated in resistance to pyrimethamine (Mula et al., 2011).
Previously reported two mutant genotypes, S117T and S117N, were also found in this study with the percentage of 64% and 9% respectively. Brega and his colleagues
(2004) had reported that the mutation S117N has been postulated to represent the first step in the drug-resistance selection process in the parasite while S117T has
been associated with highly mutated pvdhfr which may be responsible for development of high resistance to SP drug.
Considering SNPs of F57L/I, S58R, T61M, S117T/N, and I173F/L, the analysis of pvdhfr revealed the occurrence of four haplotypes, of which one has been reported
previously. The wild-type haplotypes FSTSI were found in 27.3% (n=3). Double pvdhfr mutant haplotype, FRTNI (S58R + S117N) was found in 9.1% of the samples
(n=1) and has already been described elsewhere for different regions including Indonesia, Thailand, Ethiopia, China, East Timor, Philipines, Vanuatu, Vietnam, Papua
New Guinea, Madagascar, and Iran (Hastings et al., 2004; Brega et al., 2004; Schunk et al., 2006; Auliff et al., 2006; Marfurt et al., 2008; Barnadas et al., 2008; Zakeri
et al., 2009).
Triple-mutant haplotype, LRTTI (F57L + S58R + S117T) and quintuple-mutant haplotype, LRMTF (F57L + S58R + T61M + S117T + I173F) were found in one isolate of
each case (9.1%). The other haplotype, LRMTI or quadruple-mutant haplotype were found highly prevalent as compared to other haplotypes in this study with the
percentage of 45.5%.
In view of the point mutations results obtained, mutations linked to SP resistance in P. vivaxisolates from Sabah is highly prevalent. However, the correlation between
pvdhfr gene mutation and the resistance of antimalarial drug in P. vivax Sabah isolates cannot be confirmed since the in vitro and clinical responses were not assessed
and included in this study. Moreover, the small number of isolates studied does not reflect the whole population of malaria parasites in Sabah.
CONCLUSION
Even though the SP drug has not been intensively used in Sabah to treat P. vivax infection as the first line treatment, monitoring the role of point mutations identified in
this study is important since the possibility of emergence and spread of drug resistance to new lines treatment such as the antimalarial drug combination therapy is
under precautions.
ACKNOWLEDGEMENT
We thank all the patients who have contributed their samples, the healthcare staffs in assisting the samples collection for this study, and also the Ministry of Health
Malaysia for approving this project. This project is funded by Ministry of Higher Education – FRG0276-SG-2/2010.
REFERENCES
Barnadas, C., Tichit, M., Bouchier, C., Ratsimbasoa, A., Randrianasolo, L., Raherinjafy, R., Jahevitra, M., Picot, S., and Menard, D. 2008. Plasmodium vivaxdhfrand
dhpsmutations in isolates fromMadagascar and therapeutic response tosulphadoxine-pyrimethamine.Malaria Journal.7
7: 35
Mula, P., Fernandez-Martinez, A., Lucio, A., ramos, J. M., Reyes, F., Gonzalez, V., Benito, A., and Bersoza, P. 2011. Detection of high levels of mutations involved in
anti-malarial drug resistance in Plasmodium falciparum and Plasmodium vivaxat rural hospital in Southern Ethiopia.Malaria Journal, 10:214
10
Singh, B., Kim Sung, L., Matusop, A., Radhakrishnan, A., Shamsul, S.S., & Cox-Singh, J. (2004). A large focus of naturally acquired Plasmodium knowlesi infections in
human beings.Lancet 363: 1017-1024
Snuonou, G., Viriyakosol, S., Jarra, W., Thaithong, S. & Brown, K. N. (1993). Identification of the four human malaria parasite species in field samples by the polymerase
chain reaction and detection of high prevalence of mixed infections. Molecular and Biochemical Parasitology 58(2): 283-292.
Zeile, I., Gahutu, J.B., Shyirambere, C., Steininger, C., Musemakweri, A., Sebahungu, F., Karema, C., Harms, G., Eggelte, T.A. and Mockenhaupt, F.P. 2011. Molecular
markers of Plasmodium falciparum drug resistance in southern highland Rwanda.
186 | MGC10
ID 048
048
Using YLong--Tailed Macaques (Macaca fascicularis) in Southeast Asia
Y -Chromosome to Elucidate the Evolution and Dispersal Pattern of the Long
Jeffrine J. RovieRovie-Ryan1,2,*, M. T. Abdullah2, Soon Guan Tan3, Frankie T. Sitam1, Zainal Zahari Zainuddin4 & Zaaba Zainol Abidin5
Wildlife Genetic Resource Bank (WGRB) Laboratory, Ex-Situ Conservation Division, Department of Wildlife and National Parks (DWNP) Peninsular Malaysia
2
Department of Zoology, Faculty of Resource Science and Technology (FRST), Universiti Malaysia Sarawak (UNIMAS)
3
Department of Cell and Molecular Biology, Faculty of Biotechnology and Biomolecular Sciences, Universiti Putra Malaysia
4
Borneo Rhino Alliance (BORA)
5
Deputy Director General II Office, DWNP
Email: [email protected]
1
ABSTRACT:
We employed a combined segment of the testis-specific protein (TSPY) and the sex-determining region (SRY) of the Y-chromosome gene to elucidate the evolutionary
pattern of the long-tailed macaques (Macaca fascicularis) in Southeast Asia. A maximum-likelihood (ML) tree and a phylogenetic network were constructed using 147
sequences of M. fascicularis from the Peninsular Malaysia and Sarawak including sequences from the other regions of the species range taken from the other previous
studies. Measurements of standard genetic diversity indices were calculated. Our findings revealed that the M. fascicularis are separated into two major groups of the
continental and the insular lineages. Furthermore, the continental lineage is separated into two faunal regions demarcated at the Isthmus of Kra. The Y-chromosome
dataset revealed a dominant haplotype emerging at around 0.25 (±0.1) million years ago (mya) which was shared by 82 samples from the southern region of the
Isthmus of Kra which ranges from Songkhla, Thailand, the Malay Peninsula and downwards to Sumatra, Indonesia. The insular lineage emerged at around 0.61 (±0.4)
mya which occupied the island of Borneo and the Philippines. We also confirmed that the introgression of the M. mulatta Y-chromosome into the Indochinese M.
fascicularis (Vietnam and Cambodia) are absent in the M. fascicularis haplotypes from the southern region of the Isthmus of Kra.
Keywords: Macaca fascicularis, Y-chromosome, phylogenetic tree and network, dispersal route, time estimates.
INTRODUCTION
Biogeography history of the Southeast Asia (SEA) is of major interest to many biologists due to its unique assemblage of distinctive faunas where plenty of studies on the
zoogeography of primates are available (Brandon-Jones et al., 2004; Fooden, 1996; Nijman and Meijaard, 2008). In the genus Macaca, particularly in the long-tailed
macaques (Macaca fascicularis), studies have been conducted to investigate their evolution and dispersal in SEA and several hypotheses concerning their dispersal have
been suggested (Abegg and Theirry, 2002; Blancher et al., 2008; Smith et al., 2007).
Climatic, eustatic changes associated with periodic glaciations, and physical barriers have had a profound influence to the evolution and distribution of M. fascicularis in
SEA (Abegg and Theirry, 2002; Cannon et al., 2009; Kanthaswamy et al., 2008). During the Quaternary Periods, the expansion and retraction of forest refuges,
fluctuation of sea levels that exposed and submerged land connections, and existing physical barriers such as mountain ranges and large river systems could have
greatly determined the evolutionary pattern and dispersal scenario of M. fascicularis.
M. FASCICULARIS EXHIBIT A UNIQUE BEHAVIOUR WHERE FEMALES ARE SEDENTARY IN NATURE WHILE MALES SHOW HIGH LEVEL OF DISPERSAL. THIS BEHAVIOUR
WOULD LEAD TO CONFLICTS IN THE MOLECULAR PATTERN OF MATERNALLY AND PATERNALLY INHERITED GENE SEGMENTS. MITOCHONDRIAL DNA (MTDNA)
WOULD SHOW GENETIC RECORD OF ANCIENT BIOGEOGRAPHIC BARRIERS TO INTRASPECIFIC GENE FLOW WHILE Y-CHROMOSOMAL GENE WOULD GIVE
CONTEMPORARY GENE FLOW (TOSI ET AL., 2003). CONSEQUENTLY, Y-CHROMOSOMAL GENE WOULD GIVE INSIGHT INTO THE MOST RECENT EVIDENCE OF GENE
FLOW OF M. FASCICULARIS BETWEEN THE NOW SEPARATED INSULAR POPULATIONS.
THE M. FASCICULARIS REPRESENT ONE OF THE MOST SUCCESSFUL RADIATIONS OF NON-HUMAN PRIMATES SECOND ONLY TO THE RHESUS MACAQUES (M.
MULATTA) (ABEGG AND THEIRRY, 2002; TOSI ET AL., 2003). OCCUPYING MORE THAN 20 COUNTRIES IN ASIA, THE SPECIES COVERED AND AREA OF MORE THAN 5
MILLION KM2 (DELSON, 1980; FA, 1989; FOODEN, 1980) WHICH INCLUDES DEEP-WATER OCEANIC ISLANDS THAT HAVE NO HISTORICAL LAND CONNECTION TO THE
CONTINENTAL SHELF (ABEGG AND THEIRRY, 2002). THIS WIDE RANGE OF DISTRIBUTION MAKES M. FASCICULARIS A PRIME MODEL TO STUDY THE HISTORICAL
BIOGEOGRAPHY IN SEA. THEREFORE, IN THIS STUDY, WE INVESTIGATED THE EVOLUTION AND DISPERSAL PATTERN OF M. FASCICULARIS PARTICULARLY IN
MALAYSIA USING THE Y-CHROMOSOMAL GENE SEGMENT.
187 | MGC10
MATERIALS AND METHODS
Sample Collection
The location and number of individuals sampled are shown in Fig. 1 while the Appendix provides the details of each sample including sequences obtained from the NCBI.
Sampling was conducted by the Outbreak Response Team (ORT) of the Department of Wildlife and National Parks (DWNP) on conflict long-tailed macaques as part of the
Wildlife Disease Surveillance Programme (WDSP). The sampling was conducted according to all the rules and regulations by all the responsible authorities in Malaysia.
DNA Extraction, PCR Amplification and Sequencing
DNA was extracted from 147 M. fascicularis blood samples using the QIAamp DNeasy Blood and Tissue Kit using the protocol provided by the manufacturer (QIAGEN Ag.,
Germany). Five oligonucleotides were designed using the program Primer3 (Rozen and Skaletsky, 2000) as a plug-in in the Geneious v5.6 (Drummond et al., 2012) to
cover the testis-specific protein (TSPY) and the sex-determining region (SRY) of the Y-chromosome gene (Table 1). PCR amplifications were conducted in a GeneAmp®
PCR System 9700 (Applied Biosystems, USA) using a 20µl reaction volume consisting of 1.0µl of DNA template (~15–20ng), PCR mixtures containing 1X PCR buffer,
0.2mM dNTPs, 1.5mM MgCl2, 0.05U of the GoTaq® DNA Polymerase (Promega, USA), and 0.1µM of each primer. Amplification was done using the following PCR
profile: a preliminary denaturation at 98°C for 2 min followed by 45 cycles of 95°C for 30 sec, 55°C for 60 sec and 72°C for 60 sec. This was followed by a final
extension period of 72°C for 5 min before the samples were cooled to 10°C. Cycle sequencing on three primers (Table 1) were done on an ABI PRISM®377 DNA
Sequencer by a sequencing service provider (1st Base Laboratories Sdn. Bhd., Malaysia).
Fig. 1
Sampling localities throughout Peninsular Malaysia, Sarawak, and Sabah. The numbers indicates the sample numbers collected from each state of Malaysia.
188 | MGC10
Table 1
The profiles of the oligonucleotides used in this study.
Segment
TSPY
TSPY
Name
MFTSPY_F2
MFTSPY_R929*
Profile (3' to 5')
AGATGGAGCGGAGGCGCAAG
TGGCAGAGATGAACGGGATGC
TSPY
SRY
MFTSPY_R1564*
MFSRY_F1*
TGGATAAGACGGACCCCCAGGT
AGGGGGTAGCCTGGTTGGGC
SRY
MFSRY_R770
AGTGGCTGTAGCGGTCCCGT
* used for sequencing
Sequence and Phylogenetic Analysis
A total of 700 and 1,425 base-pairs (bp) of sequence length were obtained from the TSPY and SRY segments, respectively. Multiple sequence alignments were done by
using the program Geneious v5.6 (Drummond et al. 2012). Prior to further sequence analysis, the TSPY and SRY were combined as both segments are closely linked on
the Y-chromosome and partition homogeneity tests did not find significant differences in their evolutionary signal as previously reported (Tosi et al., 2000, 2003).
Sequence characterisations including variable sites, conserved sites, and parsimony-informative sites were examined by using MEGA v5 (Tamura et al., 2011). DnaSP v5
(Librado et al., 2009) were used to calculate the standard genetic diversity indices including the number of haplotypes (H), haplotype diversity (h) (Nei, 1987), and
nucleotide diversity (π) (Nei, 1987). Sequences of M. fascicularis from the other regional populations including from the other Macaca species were obtained from
GenBank (see Appendix). Representative species from the tribe Papionini were also selected and used as the outgroup prior to phylogenetic tree construction.
Using the haplotype data, two methods of phylogenetic relationships construction were used; (1) maximum-likelihood (ML) and (2) phylogenetic median-joining network.
MEGA v5 was used to construct the ML tree using the Kimura 2-parameter model with discrete gamma distribution (+G, parameter = 0.1959) as suggested by the
model test implemented in MEGA v5. The median-joining network was constructed using the Network program (Bandelt et al., 1999). Delson (1975) proposed a
divergence date of 5.5 million years ago (mya) for the last common ancestors (LCA) between the Macaca. Using this date, we recalibrated the ML tree and the
phylogenetic network to estimate the divergence date of several important events in the evolutionary and dispersal history of M. fascicularis in Southeast Asia.
Results
The combined segments including the outgroup sequences (N= 229) produced an alignment product of 2,140 bp. The M. fascicularis sequences (N= 179) consist of
2,107 bp of conserved sites, 21 bp of variable sites and 10 bp of parsimony informative sites. Six sites distinguishes the M. fascicularis from south of the Isthmus of Kra
(SIK) from the north of Isthmus of Kra (NIK) (Table 2). Within the six sites, four indels were detected at nucleotide position (np) 589-591 and 1,072 of the alignment.
These indels are all associated with all the sequences (N= 8) of M. fascicularis from Vietnam, Cambodia, and Tum Chompol (Thailand). Nucleotide diversity (π) for all the
M. fascicularis sequences is 0.00066.
DnaSP detected a total of 20 M. fascicularis haplotypes (Table 2) with a haplotype diversity (h) of 0.749. Sixteen haplotypes (Hap 1, 4-18) are unique to the samples
used in this study. Haplotype 2 (Hap 2) represents the dominant type which consists of 82 individuals from Songkhla (Thailand), Malay Peninsula, Sumatra, and Mauritius.
Hap 18 and 19 represents the individuals from Borneo (Sabah, Sarawak, and Kalimantan), Java, Philippines, and Sumatra. Interestingly, individuals from Cambodia, Tum
Chompol (Thailand), and Vietnam (N=8), formed Hap 20 which also consists of two individuals of M. mulatta.
The phylogenetic constructions using the ML and median-joining network are shown in Fig. 2 and 3, respectively. Both methods produced similar patterns of
phylogenetic relationships. Firstly, both methods separated the M. fascicularis from SIK from the NIK. Furthermore, the M. fascicularis of NIK is grouped with the M.
mulatta, M. fuscata, and M. cyclopis haplotypes. Secondly, the M. fascicularis from SIK is further divided into the continental and insular lineages.
189 | MGC10
Table 2 Haplotypes and variable sites of M. fascicularis within the combined analysis of the TSPY and SRY loci of the Y-chromosome segment. Six sites distinguished
the southern from the northern of Isthmus of Kra M. fascicularis as indicated by the uppercase letters.
SRY
Nhap
Region
2 5 5 5
7 7
0 9 9 9
1 6
4 5 6 7
4 2
Hap1
12
a
– – –
a t
Hap2
82
.
– – –
. .
Hap3
1
.
– – –
. .
Hap4
23
.
– – –
. .
Hap5
7
.
– – –
. .
Hap6
1
.
– – –
c a
Hap7
4
.
– – –
. .
Hap8
1
.
– – –
. .
Hap9
1
.
– – –
. .
Hap10
2
.
– – –
. .
Hap11
5
.
– – –
. .
Hap12
1
.
– – –
. .
Hap13
1
.
– – –
. .
Hap14
1
.
– – –
. .
Hap15
1
.
– – –
. .
Hap16
1
.
– – –
. .
Hap17
1
c
– – –
. .
SIK
Hap18
25
t
.
– – –
. .
(Ins)
Hap19
1
t
.
– – –
. .
NIK
Hap20
8
t
.
A C A
. .
SIK - South of Isthmus of Kra; NIK - North of Isthmus of Kra; Ins - Insular
SIK (Continental)
Hap.
1
5
8
a
.
.
.
.
TSPY
8
4
0
c
.
.
.
.
.
.
.
.
.
.
.
.
.
t
.
.
.
.
.
9
0
2
a
.
.
.
.
.
.
.
.
.
.
.
.
.
.
c
.
.
.
.
1
0
7
2
T
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
–
1
0
7
6
a
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
g
.
1
1
9
0
a
.
.
.
.
.
g
g
.
.
.
.
g
.
.
.
g
.
.
.
1
2
0
6
a
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
C
1
4
0
1
a
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
C
1
4
6
1
a
.
.
g
.
.
.
.
g
.
.
.
.
.
.
.
.
.
.
.
1
7
4
7
g
a
a
a
a
a
.
.
a
a
a
.
a
a
.
a
.
a
a
a
1
9
5
7
a
.
.
.
.
.
.
.
.
.
g
.
.
g
.
.
.
.
.
.
1
9
6
9
g
.
.
.
.
.
.
.
t
.
.
.
.
.
.
.
.
.
.
.
2
0
5
2
g
.
.
.
c
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
2
0
6
0
g
.
t
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
2
0
9
7
a
.
.
.
.
.
.
t
.
.
.
.
.
.
.
.
.
.
.
.
2
1
0
6
g
.
.
.
.
.
.
t
t
t
.
t
.
t
.
.
.
.
.
.
2
1
1
0
a
.
.
.
.
.
.
.
.
.
.
t
.
.
.
.
.
.
.
.
2
1
2
0
g
.
.
.
.
.
.
.
.
.
.
.
.
c
.
.
.
.
.
.
Calibration of both the phylogenetic tree and median-joining network at 5.5 mya for the LCA between the Macaca produced three dates of estimation as summarised in
Table 3. For the ML tree, the tree resolution could provide for only one date of estimation, Node A which was dated at 1.15 mya. Meanwhile for the median-joining
network, three estimation dates were obtained. Nodes A-C was dated as 2.36, 0.61, and 0.25 mya, respectively.
DISCUSSION
This study represents fresh new information on the gene flow of M. fascicularis in Malaysia using the Y-chromosomal gene segment with far greater samples size and
better coverage compared to other previous studies employing the same gene segment. This study also represents a novel attempt to elucidate the evolution and
dispersal of M. fascicularis in Malaysia particularly. Sixteen new haplotypes unique to the samples used in this study are detected. Several other interesting findings were
discovered in this study as elaborated in the subsections below.
Separation at the Isthmus of Kra
Isthmus of Kra have been documented to have limited the gene flow for animals from continental Asia to the Malay Peninsula and downwards to insular SEA, including in
avifauna (Hughes et al., 2003; Round et al., 2003), herpetofauna (Inger and Voris, 2001), and mammals (Abdullah, 2003; Hamada et al., 2008; Luo et al., 2004; Tosi et
al., 2002). Woodruff (2003) further suggested that the existence of this faunal transition was due to the occurrence of several marine transgression zones during the
Neogene (Miocene and Pliocene) and the Quaternary Period (Pleistocene and Holocene) with the latest one occurring as recently as 6-7 thousand years ago.
Avise (2009) described that if multiple substitutions consistently differentiate a group of haplotypes from another, a deep historical bifurcation is responsible in the gene
tree under investigation. In this study, both our methods of phylogenetic relationship reconstruction (ML and median-joining network) separated the M. fascicularis from
SIK from the NIK. Six mutation sites (four indels and two tranversions, see Table 2) were responsible for the demarcation. Using a small sample size from Malaysia,
similar finding was also observed in previous studies on M. fascicularis using Y-chromosomal gene (Tosi and Coke, 2007; Tosi et al., 2002, 2003). Additionally, M.
fascicularis from NIK carry the Y-chromosome of M. mulatta as a result of contemporary hybridisation (Tosi et al., 2002) while the SIK populations are free from such
introgression.
190 | MGC10
Fig. 2
Linearised ML tree constructed from the haplotypes of the M. fascicularis (LogL= -5247.91). Numbers on the branches represent bootstrapping support
values (1000 replications; Felsenstein 1985). Ins= Insular; NIK= North of Isthmus of Kra; SIK= South of Isthmus of Kra.
Separation of continental and insular lineages
Both our phylogeny tree and the median-joining network showed the separation of the continental M. fascicularis from the insular lineages which is also reflected in the
nucleotide by a transversion mutation occurring at the np 158 (Table 2). This finding is consistent with the finding by Tosi et al. (2003) and Tosi and Coke (2007). Tosi et
al. (2003) further suggested that the continental and insular lineages diverged as recent as 0.4mya. Our ML tree however did not resolve at the node where separation
between both lineages occurred, thus we couldn’t deduce the divergence date. Our median-joining network showed that the emergence of the insular lineage at around
0.61 (±0.4) mya which occupied Borneo and the Philippines while the dominant haplotype which was shared by samples from Songkhla, Thailand, the Malay Peninsula
and downwards to Sumatra, Indonesia emerged at around 0.25 (±0.1) mya.
191 | MGC10
Fig. 3
Haplotype median-joining network constructed showing the relationships among the species within the fascicularis species group. The size of each circle is
proportional to the number of individuals in each haplotype. Three dates of estimation were calculated (A-C) based on the calibration of 5.50 mya for the last common
ancestor between the Macaca represented by the red star (branches for the other Macaca species groups are not shown).
Table 3 Divergence dates estimated from the ML tree and the median-joining network. Node A-C are shown in Fig. 2 (ML) and 3 (network). Estimation for node B and
C for the ML tree was not available due to the unresolved phylogeny.
Node
A (LCA fascicularis group)
B (emergence of insular M. fascicularis)
C (emergence of the dominant M. fascicularis haplotype)
ML (mya)
1.15 ±2.6 (2SE)
na
na
Network (mya)
2.36 (SD±0.9)
0.61 (SD±0.4)
0.25 (SD±0.1)
ACKNOWLEDGEMENTS
We would like to thank the DWNP for providing the facilities, equipments, and personnel to conduct this pilot study. Also thanks all the DWNP states staffs for their
assistance. This pilot project is funded by the DWNP, and partly by the Proboscis genome research grant awarded to MT Abdullah. The sampling for ZMW coded samples
were funded by the USAID PREDICT programme. We would like to thank the Outbreak Response Team of DWNP for their dedication and help during sampling: Charles
Keliang, Azroie Daniel, Ahmad Faizal, and Emilia Joeneh.
192 | MGC10
REFERENCES
Abdullah, M.T. (2003) Biogeography and variation of Cynopterus brachyotis in Southeast Asia. PhD Thesis, The University of Queensland, Australia.
Abegg C. and Thierry B. (2002) Macaque evolution and dispersal in insular south-east Asia. Biological Journal of the Linnean Society 75:
75 555–576.
Avise J.C. (2009) Phylogeography: retrospect and prospect. Journal of Biogeography 36:
36 3-15.
Bandelt H-J., Forster P. and Röhl A. (1999) Median-joining networks for inferring intraspecific phylogenies. Molecular Biology and Evolution 16:
16 37–48.
Blancher A., Bonhomme M., Crouau-Roy B., Terao K., Kitano T. and Saitou N. (2008) Mitochondrial DNA sequence phylogeny of 4 populations of the widely distributed
cynomolgus macaque (Macaca fascicularis fascicularis). Journal of Herdity 99 (3):
(3) 254-264.
Brandon-Jones D., Eudey A.A., Geissmann T., Groves C.P., Melnick D.J., Morales J.C., Shekelle M. and Stewart C.-B. (2004) Asian Primate Classification. International
Journal of Primatology 25 (1):
(1) 97-164.
Cannon C.H., Morley R.J. and Bush A.B.G. (2009) The current refugial rainforests of Sundaland are unrepresentative of their biogeographic past and highly vulnerable to
disturbance. Proceedings of the National Academy of Sciences of the United States of America 106 (27):
(27) 11188-11193.
Delson E. (1975) Evolutionary history of the Cercopithecidae. Approaches to primate paleobiology. Contribution to Primatology 5: 167–217.
Delson E. (1980) Fossil macaques, phyletic relationships and a scenario of deployment. In Lindburg D.G. (ed.) The macaques. Studies in ecology, behavior and evolution
pp. 10–30. Van Nostrand Rheinhold, New York.
Drummond A. J., Ashton B., Buxton S., Cheung M., Cooper A., Duran C., Field M., Heled J., Kearse M., Markowitz S., Moir R., Stones-Havas S., Sturrock S., Thierer T.
and Wilson, A. (2012) Geneious v5.6. Available from http://www.geneious.com.
Fa J.E. (1989) The genus Macaca: a review of taxonomy and evolution. Mammal Review 19:
19 45–81.
Fooden J. (1980) Classification and distribution of living macaques (Macaca Lacèpéde, 1799). In Lindburg D.G. (ed.) The macaques. Studies in ecology, behavior and
evolution pp.1–9. Van Nostrand Rheinhold, New York.
Fooden J. (1996) Zoogeography of Vietnamese Primates. International Journal of Primatology 17 (5):
(5) 845-899.
Hamada, Y., Suryobroto, B., Goto, S. and Malaivijitnond, S. (2008) Morphological and Body Color Variation in Thai Macaca fascicularis fascicularis North and South of the
Isthmus of Kra. International Journal of Primatology 29:
29 1271–1294.
Hughes, J.B., Round, P.D. and Woodruff, D.S. (2003) The Indochinese–Sundaic faunal transition at the Isthmus of Kra: an analysis of resident forest bird species
distributions. Journal of Biogeography 30:
30 569–580.
Inger, R.F. and Voris, H.K. (2001) The biogeographical relations of the frogs and snakes of Sundaland. Journal of Biogeography 28:
28 863–891
Kanthaswamy S., Satkoski J., George D., Kou A., Erickson J.-A.B. and Smith D.G. (2008) Hybridization and stratification of nuclear genetic variation in Macaca mulatta
and M. fascicularis. International Journal of Primatology 29:
29 1295-1311.
Librado P. and Rozas J. (2009) DnaSP v5: A software for comprehensive analysis of DNA polymorphism data. Bioinformatics 25:
25 1451-1452.
Luo S.-J., Kim J.-H., Johnson W.E., van der Walt J., Martenson J., Yuhki N., Miquelle D.G., Uphyrkina O., Goodrich J.M., Quigley H.B., Tilson R., Brady G., Martelli P.,
Subramaniam V., McDougal C., Hean S., Huang S.-Q., Pan. W., Karanth U.K., Sunquist M., Smith J.L.D. and O’Brien S.J. (2004) Phylogeography and Genetic
Ancestry of Tigers (Panthera tigris). PLOS Biology 2 (12):
(12) 2275–2293.
Nei M. (1987) Molecular Evolutionary Genetics. Columbia University Press, New York.
Nijman V. and Meijaard E. (2008) Zoogeography of primates in insular Southeast Asia: species-area relationships and the effects of taxonomy. Contributions to Zoology
77 (2):
(2) 117-126.
Round P.D., Hughes J.B. and Woodruff D.S. (2003) Latitudinal range limits of resident forest birds in Thailand and the Indochinese–Sundaic zoogeographic transition.
Natural History Bulletin of the Siam Society 51:
51 69–96.
Rozen S. and Skaletsky H. (2000) Primer3 on the WWW for general users and for biologist programmers. In Krawetz S., and Misener S. (eds.) Bioinformatics Methods
and Protocols: Methods in Molecular Biology pp. 365-386. Humana Press, Totowa, NJ.
Smith D.G., McDonough J.W. and George D.A. (2007) Mitochondrial DNA variation within and among regional populations of longtail macaques (Macaca fascicularis) in
relation to other species of the fascicularis group of macaques. American Journal of Primatology 69:
69 182-198.
Tamura K., Peterson D., Peterson N., Stecher G., Nei M. and Kumar, S. (2011) MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood,
Evolutionary Distance, and Maximum Parsimony Methods. Molecular Biology and Evolution 28(10):
28(10) 2731–2739.
Tosi A.J and Coke C.S. (2007) Comparative phylogenetics offer new insights into the biogeographic history of Macaca fascicularis and the origin of the Mauritian
macaques. Molecular Phylogenetics and Evolution 42:
42 498-504.
Tosi A.J., Morales J.C. and Melnick D.J. (2000) Comparison of Y chromosome and mtDNA phylogenies leads to unique inferences of macaque evolutionary history.
Molecular Phylogenetics and Evolution 17(2):
17(2) 133–144.
Tosi A.J., Morales J.C. and Melnick D.J. (2002) Y-Chromosome and Mitochondrial Markers in Macaca fascicularis indicate introgression with Indochinese M. mulatta
and a biogeographic barrier in the Isthmus of Kra. International Journal of Primatology 23(1):
23(1) 161–178.
Tosi A.J., Morales J.C. and Melnick D.J. (2003) Paternal, maternal, and biparental molecular markers provide unique windows onto the evolutionary history of macaque
monkeys. Evolution 57(6):
57(6) 1419–1435.
Woodruff D.S. (2003) Neogene marine transgressions, palaeogeography and biogeographic transitions on the Thai-Malay Peninsula. Journal of Biogeography 30:
30 551–
567.
193 | MGC10
Appendix
No
Species
Sample Identification
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
Macaca arctoides
M. arctoides
M. arctoides
M. arctoides
M. assamensis
M. assamensis
M. cyclopis
M. cyclopis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
St0316
101.Malaya
Thai.2A
Hanoi.05.2
1.KIZ.B
89019
2682
1
Camb. 3
Camb. 4
290.WB
SV 2
SV 3
SV#4
289.WB
791.Tum.Chompol
668.Songkhla
A1828
A8097
A9652
A12133
Java.34
Borneo.PM666
Sarawak
Sepilok
Philippines
DM2687
UKM.003
UKM.004
Johor.DJ.95
PMW000121
PMW000123
WDSP/11/0079J
WDSP/11/0081J
WDSP/11/0082J
WDSP/11/0085J
WDSP/11/0089J
WDSP/11/0093J
WDSP/11/0094J
WDSP/12/0078
WDSP/12/0079
WDSP/12/0084
WDSP/12/0087
WDSP/12/0088
WDSP/12/0089
WDSP/12/0091
Hap.
No.
19
19
19
19
19
19
19
19
2
3
3
2
2
20
3
3
3
3
2
2
2
2
1
2
2
2
4
2
2
2
2
2
4
2
4
4
2
7
Origin/Location
unknown
Malaysia
Thailand
Vietnam
Southern China
Southern China
Taiwan
Taiwan
Cambodia
Cambodia
Vietnam
Vietnam
Vietnam
Vietnam
Vietnam
Tum Chompol, Thailand
Songkhla, Thailand
S. Sumatra, Indonesia
S. Sumatra, Indonesia
S. Sumatra, Indonesia
S. Sumatra, Indonesia
Java, Indonesia
Kalimantan, Indonesia
Sarawak, E. Malaysia
Sepilok, Sabah, E. Malaysia
Sibuyan Is., Philippines
P. Malaysia
Selangor, P. Malaysia
Selangor, P. Malaysia
Johor, P. Malaysia
Johor, P. Malaysia
Johor, P. Malaysia
Johor, P. Malaysia
Johor, P. Malaysia
Johor, P. Malaysia
Johor, P. Malaysia
Johor, P. Malaysia
Johor, P. Malaysia
Johor, P. Malaysia
Kedah, P. Malaysia
Kedah, P. Malaysia
Kedah, P. Malaysia
Kedah, P. Malaysia
Kedah, P. Malaysia
Kedah, P. Malaysia
Kedah, P. Malaysia
194 | MGC10
GenBank Acc. No. (SRY,
TSPY)
AF284292, AF284241
AF284291, AF284240
AF284293, AF284242
AF284294, AF284243
AF284295, AF284244
AY224238, AY224236
AF284296, AF284245
AF425289, AF425274
AF425286, AF425271
AF425287, AF425272
AF284304, AF284253
AF425282, AF425267
AF425283, AF425268
AF425284, AF425269
AF425285, AF425270
AF425288, AF425273
AF425295, AF425280
DQ832600, DQ832614
DQ832601, DQ832615
DQ832602, DQ832616
DQ832603, DQ832617
AF284303, AF284252
AF284302, AF284251
AF284299, AF284248
AF284300, AF284249
AF284298, AF284247
AF284297, AF284246
AF425293, AF425278
AF425294, AF425279
AF425292, AF425277
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
73
74
75
76
77
78
79
80
81
82
83
84
85
86
87
88
89
90
91
92
93
94
95
96
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
WDSP/12/0092
WDSP/12/0093
WDSP/12/0094
WDSP/12/0095
WDSP/12/0096
WDSP/12/0097
WDSP/12/0101
WDSP/12/0104
WDSP/12/0105
WDSP/12/0106
WDSP/12/0107
WDSP/11/0001
WDSP/11/0004
WDSP/11/0006
WDSP/11/0007
WDSP/11/0008
WDSP/11/0010
WDSP/11/0012
WDSP/11/0015
WDSP/11/0018
WDSP/11/0031
WPL130
WPL132
WPL137
WPL140
WPL143
WPL148a
WPL150
WPL161
WDSP/12/0115
WDSP/12/0116
WDSP/12/0118
WDSP/12/0119
WDSP/12/0456
WDSP/12/0457
WDSP/12/0461
WDSP/12/0462
WDSP/12/0464
WDSP/12/0465
WDSP/12/0167
WDSP/12/0172
WDSP/12/0179
WDSP/12/0181
WDSP/12/0190
WDSP/12/0195
WDSP/12/0202
WDSP/12/0318
WDSP/12/0325
WDSP/12/0336
WDSP/12/0338
7
7
7
8
9
4
10
4
2
11
12
2
4
4
4
4
2
2
2
1
2
3
3
3
3
3
3
3
3
4
1
4
2
2
2
2
2
2
2
2
2
2
11
2
2
4
1
11
10
11
Kedah, P. Malaysia
Kedah, P. Malaysia
Kedah, P. Malaysia
Kedah, P. Malaysia
Kedah, P. Malaysia
Kedah, P. Malaysia
Kedah, P. Malaysia
Kedah, P. Malaysia
Kedah, P. Malaysia
Kedah, P. Malaysia
Kedah, P. Malaysia
Kelantan, P. Malaysia
Kelantan, P. Malaysia
Kelantan, P. Malaysia
Kelantan, P. Malaysia
Kelantan, P. Malaysia
Kelantan, P. Malaysia
Kelantan, P. Malaysia
Kelantan, P. Malaysia
Kelantan, P. Malaysia
Kelantan, P. Malaysia
Labuan, P. Malaysia
Labuan, P. Malaysia
Labuan, P. Malaysia
Labuan, P. Malaysia
Labuan, P. Malaysia
Labuan, P. Malaysia
Labuan, P. Malaysia
Labuan, P. Malaysia
Langkawi, P. Malaysia
Langkawi, P. Malaysia
Langkawi, P. Malaysia
Langkawi, P. Malaysia
Langkawi, P. Malaysia
Langkawi, P. Malaysia
Langkawi, P. Malaysia
Langkawi, P. Malaysia
Langkawi, P. Malaysia
Langkawi, P. Malaysia
Negeri Sembilan, P. Malaysia
Negeri Sembilan, P. Malaysia
Negeri Sembilan, P. Malaysia
Negeri Sembilan, P. Malaysia
Negeri Sembilan, P. Malaysia
Negeri Sembilan, P. Malaysia
Negeri Sembilan, P. Malaysia
Pahang, P. Malaysia
Pahang, P. Malaysia
Pahang, P. Malaysia
Pahang, P. Malaysia
195 | MGC10
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
97
98
99
100
101
102
103
104
105
106
107
108
109
110
111
112
113
114
115
116
117
118
119
120
121
122
123
124
125
126
127
128
129
130
131
132
133
134
135
136
137
138
139
140
141
142
143
144
145
146
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
WDSP/12/0339
WDSP/12/0340
WDSP/12/0342
WDSP/12/0345
ZMW572
WDSP/12/0442
WDSP/12/0443
WDSP/12/0444
WDSP/12/0445
WDSP/12/0446
WDSP/12/0447
WDSP/12/0448
WDSP/12/0449
WDSP/12/0453
WDSP/12/0454
WDSP/12/0407
WDSP/12/0411
WDSP/12/0412
WDSP/12/0413
WDSP/12/0414
WDSP/12/0415
ZMW714
ZMW715
WDSP/12/0110
WDSP/12/0112
WDSP/12/0121
WDSP/12/0125
WDSP/12/0128
WDSP/12/0130
WDSP/12/0133
WDSP/12/0134
WDSP/12/0137
WDSP/12/0139
WDSP/11/0039
WDSP/11/0040
WDSP/11/0041
WDSP/11/0042
WDSP/11/0048
WDSP/11/0050
WDSP/11/0051
WDSP/11/0053
WDSP/11/0054
WDSP/11/0055
WDSP/11/0057
WDSP/11/0058
WDSP/11/0060
WDSP/11/0061
WDSP/11/0062
WDSP/11/0064
WDSP/11/0068
2
15
4
1
2
2
1
2
2
2
2
2
18
2
2
17
2
4
2
2
4
2
4
2
13
2
2
2
4
5
2
5
1
1
1
2
2
2
5
5
5
5
5
2
4
2
2
2
2
2
Pahang, P. Malaysia
Pahang, P. Malaysia
Pahang, P. Malaysia
Pahang, P. Malaysia
Pahang, P. Malaysia
Pangkor, P. Malaysia
Pangkor, P. Malaysia
Pangkor, P. Malaysia
Pangkor, P. Malaysia
Pangkor, P. Malaysia
Pangkor, P. Malaysia
Pangkor, P. Malaysia
Pangkor, P. Malaysia
Pangkor, P. Malaysia
Pangkor, P. Malaysia
Perak, P. Malaysia
Perak, P. Malaysia
Perak, P. Malaysia
Perak, P. Malaysia
Perak, P. Malaysia
Perak, P. Malaysia
Perak, P. Malaysia
Perak, P. Malaysia
Perlis, P. Malaysia
Perlis, P. Malaysia
Perlis, P. Malaysia
Perlis, P. Malaysia
Perlis, P. Malaysia
Perlis, P. Malaysia
Perlis, P. Malaysia
Perlis, P. Malaysia
Perlis, P. Malaysia
Perlis, P. Malaysia
Pulau Pinang, P. Malaysia
Pulau Pinang, P. Malaysia
Pulau Pinang, P. Malaysia
Pulau Pinang, P. Malaysia
Pulau Pinang, P. Malaysia
Pulau Pinang, P. Malaysia
Pulau Pinang, P. Malaysia
Pulau Pinang, P. Malaysia
Pulau Pinang, P. Malaysia
Pulau Pinang, P. Malaysia
Pulau Pinang, P. Malaysia
Pulau Pinang, P. Malaysia
Pulau Pinang, P. Malaysia
Pulau Pinang, P. Malaysia
Pulau Pinang, P. Malaysia
Pulau Pinang, P. Malaysia
Pulau Pinang, P. Malaysia
196 | MGC10
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
KC572634, KC572661
KC572635, KC572662
KC572636, KC572663
KC572637, KC572664
KC572638, KC572665
KC572639, KC572666
KC572640, KC572667
KC572642, KC572669
KC572643, KC572670
KC572644, KC572671
KC572645, KC572672
KC572646, KC572673
KC572647, KC572674
KC572648, KC572675
KC572649, KC572676
KC572650, KC572677
KC572651, KC572678
147
148
149
150
151
152
153
154
155
156
157
158
159
160
161
162
163
164
165
166
167
168
169
170
171
172
173
174
175
176
177
178
179
180
181
182
183
184
185
186
187
188
189
190
191
192
193
194
195
196
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fascicularis
M. fuscata
M. fuscata
M. fuscata
M. hecki
M. maura
M. mulatta
M. mulatta
M. mulatta
M. mulatta
WDSP/11/0069
WDSP/11/0070
WDSP/11/0071
WDSP/11/0073
WDSP/11/0074
ZMW487
ZMW490
WDSP/12/0371
WDSP/12/0386
WDSP/12/0392
WDSP/12/0397
ZMW477
QKPRP001
QKPRP002
QKPRP004
QKPRP006
QKPRP007
QKPRP008
QKPRP010
QKPRP011
QKPRP016
QKPRP019
WDSP/12/0232
WDSP/12/0350
WDSP/12/0351
WDSP/12/0352
WDSP/12/0353
WDSP/12/0355
WDSP/12/0356
WDSP/12/0239
WDSP/12/0274
10-236
3321
4124
6499
6621
7600
8944
9456
R209
X-957
22082
22086
13751
1
PM616
Burma.23269
India.92B.560
India.944D
16805
6
2
4
2
2
1
2
2
2
1
1
4
3
3
3
3
3
3
3
3
3
3
3
4
2
2
2
16
4
11
14
2
2
2
2
2
2
2
2
2
2
Pulau Pinang, P. Malaysia
Pulau Pinang, P. Malaysia
Pulau Pinang, P. Malaysia
Pulau Pinang, P. Malaysia
Pulau Pinang, P. Malaysia
Pulau Pinang, P. Malaysia
Pulau Pinang, P. Malaysia
Selangor, P. Malaysia
Selangor, P. Malaysia
Selangor, P. Malaysia
Selangor, P. Malaysia
Selangor, P. Malaysia
Telaga Air, Sarawak, E. Malaysia
Telaga Air, Sarawak, E. Malaysia
Telaga Air, Sarawak, E. Malaysia
Telaga Air, Sarawak, E. Malaysia
Telaga Air, Sarawak, E. Malaysia
Telaga Air, Sarawak, E. Malaysia
Telaga Air, Sarawak, E. Malaysia
Telaga Air, Sarawak, E. Malaysia
Telaga Air, Sarawak, E. Malaysia
Telaga Air, Sarawak, E. Malaysia
Telaga Air, Sarawak, E. Malaysia
Terengganu, P. Malaysia
Terengganu, P. Malaysia
Terengganu, P. Malaysia
Terengganu, P. Malaysia
Terengganu, P. Malaysia
Terengganu, P. Malaysia
Tioman, P. Malaysia
Tioman, P. Malaysia
Mauritius
Mauritius
Mauritius
Mauritius
Mauritius
Mauritius
Mauritius
Mauritius
Mauritius
Mauritius
Japan
Japan
Japan
Sulawesi, Indonesia
Sulawesi, Indonesia
Burma
N. India
N. India
N. India
197 | MGC10
KC572652, KC572679
KC572653, KC572680
KC572654, KC572681
KC572655, KC572682
KC572656, KC572683
KC572657, KC572684
KC572658, KC572685
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
DQ832590, DQ832604
DQ832591, DQ832605
DQ832592, DQ832606
DQ832593, DQ832607
DQ832594, DQ832608
DQ832595, DQ832609
DQ832596, DQ832610
DQ832597, DQ832611
DQ832598, DQ832612
DQ832599, DQ832613
AF284305, AF284254
AF284306, AF284255
AF425290, AF425275
AF284307, AF284256
AF284308, AF284257
AF284309, AF284258
AF284311, AF284260
AF284312, AF284261
AF425291, AF425276
197
198
199
200
201
202
203
204
205
206
207
208
209
210
211
212
213
214
215
216
217
218
219
220
221
222
223
224
225
226
227
228
229
M. mulatta
M. nemestrina leonina
M. n. leonina
M. n. leonina
M. n. nemestrina
M. n. nemestrina
M. n. nemestrina
M. n. pagensis
M. n. pagensis
M. nigra
M. nigrescens
M. ochreata
M. radiata
M. radiata
M. silenus
M. silenus
M. sinica
M. sinica
M. sinica
M. sylvanus
M. sylvanus
M. sylvanus
M. thibetana
M. thibetana
M. tonkeana
M. tonkeana
Allenopithecus nigroviridis
Cercopithecus mona
Mandrillus sphinx
Papio hamadryas
Presbytis melalophos
Theropithecus gelada
Trachypithecus cristatus
China.20156
12.KIZ.17
1.KIZ.2
Thai.1A
PM665.E.Borneo
SUKA.NE.Borneo
DM5424
pagensis.820
pagensis.955
PM661
101
Greyarm
3028
3033
108806
20382
985
716
979
04
201
1076
587041
Sich.KIZ
PM558.H.clade
PM558.N.clade
R146/97
SA.BF 3
1119
73-347
DJ.36
891096
DJ.1
S. E. China
South China
South China
Thailand
Kalimantan, Indonesia
Kalimantan, Indonesia
Sumatra, Indonesia
Siberut Island, Indonesia
Siberut Island, Indonesia
Sulawesi, Indonesia
Sulawesi, Indonesia
Sulawesi, Indonesia
India
India
Southwestern India
Southwestern India
Polonnaruwa, Sri Lanka
Polonnaruwa, Sri Lanka
Polonnaruwa, Sri Lanka
Northwestern Africa
Northwestern Africa
Northwestern Africa
Southwestern China
Southwestern China
Sulawesi, Indonesia
Sulawesi, Indonesia
Congo, Africa
Grenada
Central Africa
Eastern Africa
Johor, P. Malaysia
Eastern Africa
Kedah, P. Malaysia
198 | MGC10
AF284310, AF284259
AF284313, AF284262
AF284314, AF284263
AF284317, AF284266
AF284290, AF284239
AF284289, AF284238
AY224239, AY224235
AF284315, AF284264
AF284316, AF284265
AF284318, AF284267
AF284319, AF284268
AF284320, AF284269
AF284321, AF284270
AF284322, AF284271
AF284288, AF284237
AF284323, AF284272
AF284284, AF284233
AF284285, AF284234
AF284324, AF284273
AF284325, AF284274
AF284326, AF284275
AF425296, AF425281
AF284327, AF284276
AY224240, AY224237
AF284286, AF284235
AF284287, AF284236
AF284331, AF284280
AF284332, AF284281
AF284330, AF284279
AF284328, AF284277
AF284282, AF284231
AF284329, AF284278
AF284283, AF284232
ID 049
049
Composite Assembly of Pineapple Transcriptome Identifies the Methionine Salvage Pathway which is Responsible for Ethylene Biosynthesis
Raimi Mohamed Redwan,
Redwan, Christopher VooLokVooLok- Yung, and Vijay Kumar
Biotechnology Research Institute, Universiti Malaysia Sabah
Email: [email protected]
ABSTRACT:
Our current understanding on fruit ripening is based mainly on the research work that has been done on tomato, which is a model organism for climacteric fruits group.
This group of fruits are characterized by their pronounce increase in respiration and synthesis of ethylene upon ripening. Response to ethylene is conventionally used to
draw the line in characterizing fruits into climacteric and non-climacteric groups. Our main focus is to understand the ripening process in pineapple, as a model
organism for tropical non-climacteric fruits. To achieve this, two transcriptome libraries from the mature green and mature yellow fruit were assembled de novo together
with the pineapple ESTs downloaded from the NCBI database. This was done in order to maximize the assembly information for subsequent annotation purposes. This
final ‘composite transcriptome assembly’ produced 34,279 contigs with an average length of 1,025 bp and a N50 of 1,599 bp. Approximately, 68% of these sequences
were in match with NCBI Viridiplantae non-redundant protein database through Blast with an e-value of 1e-06 and 84% of these sequences were further annotated
through multiple public domain databases. The assembly provide insight to many pathways related to fruit development but most importantly it identifies the previously
incomplete methionine salvage pathways, which plays an important role in ethylene biosynthesis. Other pathways related to fruit development were also revealed. This
latest addition to the pineapple transciptome sequence information leads to many questions to be answered in deciphering the process of pineapple fruit development.
In addition, this assembly will provide as an excellent reference to compare expression between the unripe and ripe pineapple fruits transcriptome library.
Introduction
Pineapple (Ananas comosusvar. comosus) is among the most produced tropical fruits after banana and mangoes, with a global production of 21 million tonnes in the
year 2011 (FOASTAT, 2013). Traditional breeding of pineapple is a slow process and the progress has been hampered due to its high heterozygosity, self-incompability
trait and low seed fertility among its common commercial variety. Pineapple breeding programs is motivated by the need to improve its vigorosity, yield, tolerance to
common diseases, and most importantly higher fruit quality. However, breeding programs can take more than a decade to produce one good variety with viable
economical trait values as shown in the case of Josapine(Chan et al., 2003). Thus, the use of biotechnological tools coupled with molecular breeding is inevitable to
produce superior cultivars in a much shorter time. Many needs to be done as the genetic information of the plant is limited. As of now, the Genbank public database
(www.ncbi.nlm.nih.gov) contains only 5,941 EST sequences belonging to A. comosus. On the other hand, there are 77,393 EST sequences belonging to papaya (as of
September 26, 2013), which has been actively researched for its transgenic line (Davis & Ying, 2004).
Our understanding of ripening in pineapple is limited, as with the case of other non-climacteric fruits such as grapes, citrus, strawberry and pepper. In non-climacteric
fruits, the lack of spike in respiration or the increase in the production of ethylene prior to ripening is puzzling. On the other hand, in climacteric fruits such as tomato, the
process of fruit ripening is well defined by their pronounced ethylene production and increased of respiration during ripening. The unique ripening mechanism of nonclimacteric fruit development is still unclear. However, some studies have indicated that several non-climacteric fruits do carry similar ethylene biosynthesis genes (Paul
et al., 2012).
In this study, a ‘composite transcriptome library’ of the pineapple fruit was developed from Illumina short sequencing reads and from ESTs obtained from GenBank and
also developed in-house. The assembly was used to identify many important pathways related to fruit ripening but most importantly to complete the previously
fragmentary methionine salvage pathways known to be involved in the biosynthesis of ethylene. Identification of the methionine salvage pathways will provide clues to the
role of ethylene in non-climacteric fruit ripening.
Materials and Methods
Plant materials and RNA isolation
The plant materials (cv. Babagon) were taken from the experimental plot at Kampung Babagon, Sabah. Samples were collected from two developmental stages i.e.
unripe mature green and ripe mature yellow. The total RNA extraction and sequencing for both libraries was performed as described by Ong et al. (2012).
Bioinformatic pipeline
The amount of data generated by Illumina Genome Analyzer IIA for the unripe and ripe libraries were 64 million and 9 million sequences reads, comprising of 75 bp
paired-end reads, respectively. This represents an overall total of 73 Gb of pineapple transcriptome sequences. Any reads that did not pass the Phred value of 25 at the
5’end tail were trimmed off and sequences that were aligned to phi X174 library through Bowtie at default parameter were eliminated and not considered in the
assembly.
199 | MGC10
In order to improve the final assembly of short reads from Genome Analyzer IIA and to increase annotation information, 5,978 pineapple ESTs downloaded from NCBI (as
of 25th May 2013), were included together with the unripe and ripe transcriptome library that has been trimmed and filtered. These transcriptome libraries were
combined and assembled using two different platforms i.e. Oases (Schulz et al., 2012) and Trinity (Grabherr et al., 2011) at their default parameters. Oases was used
due to its ability to perform multiple k-mer assembly for broader expression quintiles sensitivity, while,Trinity was used for its performance in accuracy to construct full
length true transcript. Both libraries were then clustered independently through CD-HIT-EST (Huang et al., 2010) with sequence identity threshold of 90% to reduce
redundancy. Subsequently, the clustered libraries were then merged by using CAP3 (Huang & Madan, 1999) which compute overlaps between multiple alignment
sequences and builds consensus based on the sequence similarity of its default parameters (i.e. overlap length cutoff at 40, and overlap percent identity cutoff at 90%).
The contigs were then searched against the NCBI Viridiplantae non-redundant peptide sequence database at an E-value cut-off of 10-6 and the functional annotation
were performed through the free java based application, blast2go (http://www.blast2go.com/) pipeline. All of the transcripts with blast results were mapped, annotated,
scanned for motif via InterProScan plug-in and were integrated into the KEGG database (Kyoto Encyclopedia of Genes and Genomes) (http://www.genome.jp/kegg/)
through the same application to assign the sequences to any publicly available pathways based on their final annotation.
Results and Discussion
Composite transcriptome assembly
After filtering and trimming, only 70% (44 million reads) of the raw Illumina sequences passed the quality check and were included in the assembly. In combination with
pineapple EST, the final assembly produced 34,279 unique transcripts with total size of over 35 Mbps and a N50 of 1,599 bp [Table 1]. Prior to merging using CAP3, in
comparison to Trinity, the Oases MK assembly produced significantly more transcripts with larger total base pair size but with lower N50 value. Even though Oases gave
seven transcripts with sizes of more than 10,000 nt, the mean, median and the distribution of transcripts length were almost similar. This accentuates the concern of
redundancy introduced due to the MK strategy used in Oases. Nevertheless, the MK strategy is important for broader expression quintiles sensitivity. Thus, to reduce the
redundancy, both assemblies were subjected to clustering based on sequence similarity using the CD-HIT-EST. After merging the two assemblies into one using the
CAP3, the number of transcripts with larger size improved and so did the mean, median and the N50 value. Most importantly, it actually produced lesser transcripts
even in comparison to Trinity but with bigger data size, which indicates the success of CAP3 to collapse most of the redundant transcripts and build longer transcripts.
When compared to a previous pineapple fruit transcriptome study by Ong et al. (2012) which contained approximately about 4 Mb of data, this assembly with a total of
44 Mb of data added only another 5,551 transcripts but the N50 value improved significantly from 223 bp to 1,599 bp. This showcased the potential use of EST data to
improve the assembly of short read sequences such as from the Illumina technology to obtain high quality long reads contig or transcripts.
Functional Annotation
Transcripts that were subjected to a search against the Viridiplantae non-redundant database through the blastx analysis showed that 68% had at least one hit to the
database and of these, 22% had a top hit with Oryza sativa and 12% with Vitis vinifera [Figure 1]. Out of the 68% of the transcripts with Blast hits, 60% were
successfully annotated through GO. It is interesting to note that many of the transcripts had the most top hit with O. sativa and Zea mays as they are both in the Poales
order. However, V. vinefera is in Vitales order of the eudicotyledons, which is taxonomically distant from the Bromelicea family. Nevertheless, both of these two species
(pineapple and grapes) share the same ripening physiology, and that there are grouped as non-climacteric fruits. It was identified that the most abundant gene
ontologies under the biological process are “cellular processes”, “biosynthetis processes”, “response to stress”, “cellular component organization”, “transport”,
“catabolic processes”, and “response to abiotic stimulus”. Still in the top twenty most dominant GOs are the “post-embryogenic development” and “multicellular
organismal development” which contains many child GO nodes related to organismal, embryogenic development, ripening and abscission [Figure 2]. These are the
sequences that may lead to unravel the ripening regulation in pineapple. The same biological process distribution was also observed in Ong et al. (2012) despite of the
addition of the green mature fruit transcriptome and this accentuates the involvement of these transcripts during the ripening process. As for the molecular function, the
most abundant GOs are “nucleotide binding”, protein binding”, “hydrolase activity”, “transferase activity” and “kinase activity”. The GO distribution for molecular function
is similar as what was observed in the differentially expressed gene during the ripening process in orange, which is also a member of the non-climacteric fruits (Yu et al.,
2012). In the cellular component, the most abundant GOs are “plastid”, “membrane”, “plasma membrane”, “nucleus”, and “mitochondrion”.
200 | MGC10
Table 1: Statistics of composite transcriptome sequences assembly using two different assemblers, Oases (Assembly 1) and Trinity (As
(Assembly
sembly 2). The final
assembly of the two were merged using Cap3 and designated as Assembly 3.
Assembly
1
2
3
Number of transcripts
265,940
41,563
34,279
Total size (bp)
199,602,041
35,181,136
35,132,465
Longest transcript (bp)
10,901
9,878
13,464
Shortest transcript (bp)
101
201
132
Mean size (bp)
751
846
1,025
Median size (bp)
553
533
713
N50 length (bp)
1062
1,357
1,599
L50 count
59,583
8,246
7,135
Number of transcript > 500 nt
144,442 (54.3%)
21,640 (52.1%)
20,841 (60.8%)
Number of transcript > 1K nt
65,689 (24.7%)
12,417 (29.9%)
13,268 (38.7%)
Number of transcript > 10K nt
7
0
5
Without Blast
Hit
32%
10%
Oryza sativa
12%
Vitis vinifera
22%
56%
Zea mays
Others
With Blast Hit
68%
Figure 1: Blastx result against the Viridiplantae database. The small pie chart shows the most common organism in the top hit Blastx result.
201 | MGC10
endosome
peroxisome
nucleolus
cell wall
extracellular region
vacuole
cytosol
mitochondrion
plasma membrane
plastid
signal transducer activity
nuclease activity
receptor activity
structural molecule activity
sequence-specific DNA binding…
transporter activity
kinase activity
hydrolase activity
binding
reproduction
nucleotide binding
response to biotic stimulus
metabolic process
biological_process
response to abiotic stimulus
transport
anatomical structure morphogenesis
Cellular Component
multicellular organismal development
Biological Process
Molecular Function
response to stress
cellular process
Number of transcripts
10000
9000
8000
7000
6000
5000
4000
3000
2000
1000
0
Figure 2: Functional GO distribution of the transcripts after reduction through GOslim using the plant GO database for the cellular component, molecular
function and biological process.
Molecular Pathways
Over six thousands annotated transcripts were assigned with enzyme commission number and were integrated in their corresponding KEGG pathway maps. Among the
topmost significant pathways ranked based on the number of homologous transcripts, were the metabolomics pathways of purine, starch and sucrose, pyrimidine,
glycolysis/gluconeogenesis and phenylalanine. These pathways were part of the primary metabolisms that are required for basal plant growth and development.Other
pathways known to be related in fruit ripening and development were also found such as the phenylpropanoid biosynthesis, citrate cycle, fructose and mannose
metabolism, the terpenoid backbone biosynthesis and most importantly is the cysteine and methionine metabolism which includes the methionine salvage pathway in the
biosynthesis of ethylene [Figure 3].
202 | MGC10
Figure 3: Methionine salvage pathways. The enzymes found from the composite transcriptome assembly are in colour shaded box. The light shade box
referred to the enzymes newly identified. Figure adopted from KEGG website.
From the composite transcriptome assembly, all of the enzymes required to complete the methionine salvage pathways were identified. This is an important finding as it
now suggests that ethylene plays a more important role in pineapple fruit ripening, in spite of it being a non-climacteric fruit. Previously, by using all of the pineapple
ESTs available in public database domain, there were five unidentified genes in the pathway (Koia et al., 2012). With the addition of the RNA-seq data, the pathways is
now complete and open for further scrutinization. This is important in pineapple as it signifies the role of ethylene in non-climacteric fruits which may have been currently
underestimated. Furthermore, based on the KEGG database for grape, which has its genome sequenced (Velasco et al., 2007), only one enzyme has been identified in
the pathway, and thus could not complete the methionine salvage cycle. One might argue that all fruits despite of its climacteric characteristic produce ethylene, but
what differentiate them as for now is the system II ethylene signal transduction pathways that is responsible in its autocatalytic activity to reach the climacteric peak
(Bouzayen et al., 2010; Paul et al., 2012). Interestingly, through the data mining of the blast results there are over forty sequences that have at least one hit to ethylene
related gene [Table 2]. In addition, the constitutive tripe response gene of CTR which are known to play role in the negative regulation of ethylene response in this
system II were also found in the assembly for over 39 unique homologs. Similarly, similar gene family related to ethylene response signalling pathways were also found
in other non-climacteric fruits such as strawberry (Sun et al., 2013), orange (Katz et al., 2004) and grape (Chervin & Deluc, 2010). In grapes, these genes were upregulated during the ethylene peak in grape fruit ripening process and in strawberry mutant with down-regulated FaCTR1 and FaSAMS1 genes had inhibited red-coloring,
and firmness with increased ethylene production (Sun et al., 2013). This shows that the non-climacteric fruits also carry system II that was excluded from the nonclimacteric previously despite of its low ethylene production during ripening. This leads to questions of the sensitivity of the ethylene in non-climacteric and its
unresponsive response to the exogenous ethylene used to induce ripening off-vines.
Table 2: Unique blastx top hit results that
that are ethylene related.
related.
Ethylene related blastx result description
ethylene response factor
ethylene receptor
ethylene-insensitive protein
protein reversion-to-ethylene sensitivity1-like isoform 2
signal transduction histidine hybrid- ethylene sensor isoform 1
ethylene signal transcription factor
ethylene-responsive transcription factor 4
ethylene-responsive transcription factor rap2-7-like
ethylene-responsive transcription factor erf109-like
ethylene-responsive element binding protein
ap2 erebp transcription factor superfamily protein
ap2-like ethylene-responsive transcription factor ail5-like
ap2-like ethylene-responsive transcription factor at2g41710-like
ethylene-overproduction protein 1
anther ethylene-upregulated protein expressed
ethylene-dependent gravitropism-deficient and yellow-green-like 3
protein
203 | MGC10
Conclusion
Composite transcriptome assembly of pineapple provides us the platform to unravel the ripening process in pineapple. The start is the discovery of the methionine
salvage pathway which is central for ethylene biosynthesis and the ethylene signal transduction pathways component that were thought to be exclusive only for
climacteric fruit. The role of ethylene in non-climacteric fruits may have to be revised and pineapple has the potential to serve as the model for the ripening process of
non-climacteric fruits. The annotated assembly will serve as a good reference for further differential gene expression study that will shed more light to the ripening
process.
Acknowledgement
Acknowledgement
This work is supported by the Malaysian Government (Ministry of Higher Education) through the Fundamental Research Grant Scheme (Project no. FRG164-SG- 2008).
References
Bouzayen, M., Latché, A., Nath, P. & Pech, J.C. 2010. Mechanism of Fruit Ripening. In: Plant Developmental Biology - Biotechnological Perspectives. Springer.
Chan, Y.K., D’Eeckenbrugge, G.C. & Sanewski, G.M. 2003. Breeding and Variety Improvement. In: The pineapple: botany, production and uses (D. P. Bartholomew, R. E.
Paull, & K. G. Rohrbach, eds), pp. 33–55.
Chervin, C. & Deluc, L. 2010. Ethylene signalling receptors and transcription factors over the grape berry developmentƐ: gene expression profiling. Vitis49
49:129–136.
49
Davis, M.J. & Ying, Z. 2004. Development of Papaya Breeding Lines with Transgenic Resistance to Papaya ringspot virus. Plant Disease88
88:352–358.
88
Grabherr, M.G., Haas, B.J., Yassour, M., Levin, J.Z., Thompson, D. a, Amit, I., et al. 2011. Full-length transcriptome assembly from RNA-Seq data without a reference
genome. Nature biotechnology29
29:644–52.
29
Huang, X. & Madan, A. 1999. CAP3: A DNA Sequence Assembly Program. Genome Research9
9:868–877.
Huang, Y., Niu, B., Gao, Y., Fu, L. & Li, W. 2010. CD-HIT SuiteƐ: a web server for clustering and comparing biological sequences. 26:680–682.
26
Katz, E., Lagunes, P.M., Riov, J., Weiss, D. & Goldschmidt, E.E. 2004. Molecular and physiological evidence suggests the existence of a system II-like pathway of
ethylene production in non-climacteric Citrus fruit. Planta219
219:243–52.
219
Koia, J.H., Moyle, R.L. & Botella, J.R. 2012. Microarray analysis of gene expression profiles in ripening pineapple fruits. BMC plant biology12
12:240.
BMC Plant Biology.
12
Ong, W.D., Voo, L.-Y.C. & Kumar, V.S. 2012. De novo assembly, characterization and functional annotation of pineapple fruit transcriptome through massively parallel
sequencing. PloS ONE7
7:e46937.
Paul, V., Pandey, R. & Srivastava, G.C. 2012. The fading distinctions between classical patterns of ripening in climacteric and non-climacteric fruit and the ubiquity of
ethylene — An overview. Journal Food Science Technology49
49:1–21.
49
Schulz, M.H., Zerbino, D.R., Vingron, M. & Birney, E. 2012. Oases: robust de novo RNA-seq assembly across the dynamic range of expression levels. Bioinformatics
(Oxford, England)28
28:1086–92.
28
Sun, J.-H., Luo, J.-J., Tian, L., Li, C.-L., Xing, Y. & Shen, Y.-Y. 2013. New Evidence for the Role of Ethylene in Strawberry Fruit Ripening. Journal of Plant Growth
Regulation32
32:461–470.
32
Velasco, R., Zharkikh, A., Troggio, M., Cartwright, D. a, Cestaro, A., Pruss, D., et al. 2007. A high quality draft consensus sequence of the genome of a heterozygous
grapevine variety. PLoS ONE2
2:e1326.
Yu, K., Xu, Q., Da, X., Guo, F., Ding, Y. & Deng, X. 2012. Transcriptome changes during fruit development and ripening of sweet orange (Citrus sinensis). BMC
Genomics13
13:10.
BioMed Central Ltd.
13
204 | MGC10
ID 061
061
Genome Mapping of Red Clover (Trifolium
(Trifolium pratense L.)
Rozlaily Zainol1, Glyn Jenkins, Charlotte Jones, Matthew Lowe, Elaine James, Kirsten Skot, Phil Olyott, Ellen Coverdale and Michael Abberton2
1
Horticulture Research Centre, MARDI Headquarters
2
Institute of Biological, Environmental and Rural Sciences, Aberystwyth University
E-mail: [email protected]
ABSTRACT:
A new genetic linkage map of red clover, an important temperate forage legume was constructed using simple sequence repeats (SSR) and amplified fragment length
polymorphism (AFLP) markers derived from F1 mapping family developed from parents with diverse traits of interest, the early (Milvus) and late (Britta) flowering diploid
genotypes. Linkage mapping was performed based on a single parent analysis using JoinMap® 3.0 and two parental maps were constructed using 417 (317 AFLP and
100 SSR) markers, developed from a 327 genotypes of F1 mapping family. Each map consisted of seven linkage groups (LGs) corresponding to seven chromosome of
red clover (2n=14). And an integration of these maps resulted in eight LGs annotated with 139 (72 SSR and 67 AFLP) marker loci along 807 cM map length where LG
7b was the shortest (49 cM) and LG 2 was the longest (124 cM), and only 10% were skewed markers (6 SSR and 8 AFLP). The average distance between locus (map
density) was 5.8 cM ranging from 4 cM in LG 6 to 12.3 cM in LG 7b. The large number of individuals used in the mapping population and considerably high coverage of
co-dominant SSR markers mapped to the linkage group provides a strong basis for dissecting the genetic control of key traits by QTL analysis. Therefore, the red clover
genetic linkage map developed in this work is appropriate for QTL analysis.
Introduction
Red clover (Trifolium pratense L.) is an important forage legume in the temperate regions and it is usually processed into silage for livestock feeding in the winter (Jones
et al. 2003). It is also grown for soil improvement due to its ability to fix atmospheric nitrogen (N) in symbiosis rhizobium bacteria (Rhizobium leguminosarum), supplying
the N requirement of organic rotation farming and reducing fertilizer needs in conventional systems (Jones et al. 2003; Abberton et al. 2005).
Red clover is a diploid species (2n=14) with gametophytic self-incompatibility (Taylor and Smith, 1979) although tetraploid varieties have been produced (Taylor, 1983).
It is a cross-pollinated species with heterogeneous populations, consisting of heterozygous individuals (Smith et al., 1985). The genome size of red clover range between
420 – 440 Mbp (Abberton et al., 2008; Sato et al., 2005). The application of molecular markers for genetic analysis was given priority for crops with high economic
value or traits that are difficult to measure or improve efficiently by conventional method like red clover.
The first linkage map of red clover was constructed by Isobe et al. (2003), then by Sato et al. (2005) and Herrmann et al.(2006) and each of them using different
mapping population. In this study a new genetic linkage map was developed to be used in genetic analysis to locate quantitative trait loci (QTL) underpinning the
important morphological and agronomic trait associated with herbage yield in red clover.
Materials and methods
Plant materials. An F1 mapping family was developed from a reciprocal cross between two different diploid varieties of red clover, Milvus an early flowering type and
Britta, a late flowering type. The crossing was conducted at IGER (Institute of Grassland and Environment Research), Aberystwyth, United Kingdom. A total of 330
progeny were produced and 327 survived and were grown in Humax potting compost in 13 cm pots, arranged in order on benches in a frost-free glasshouse under
natural light. Plants were watered manually every day and these plants were used as a mapping family for molecular genetic analysis.
DNA extraction, SSR and AFLP analyses. DNA was extracted from fresh young, not fully expanded leaves using a modified CTAB (cetyltrimethylammonium bromide)
method (Doyle and Doyle 1987). SSR screening was performed on 208 primer pairs consisted of 65 primer pairs derived from white clover (TRSSR, ats and prs) (Kolliker
et al. 2001; Barrett et al. 2004), 66 from Medicago truncatula (MtB, mtmt_GEN coded as mtG) (T. Huguet CNRS-INRA, unpublished data; A. Seres, Grain Legume
Integrated Project (GLIP)) and 77 from red clover (RCS) (Sato et al. 2005). The PCR amplification reaction mixture (25 µl) for red clover primer pairs contained 4 ng
template DNA, 1X PCR buffer (Roche), 0.2 mM dNTPs (Roche), 0.5 µM of each forward and reverse primers (TAGN) and 0.03 U Taq DNA polymerase (Roche). A
GeneAmp PCR system 9700 thermocycler (Applied Biosystems) was employed using a touchdown programme with the following profile: 5 min at 94ºC, 10 cycles of 1
min denaturing at 94ºC, 30 s annealing at 50-55ºC (depending on the primer pair), 1 min extension at 72ºC; 20 cycles of 30 s at 94ºC, 30 s at 50-55ºC, 30 s at 72ºC;
final extension at 72ºC for 7 min and followed by 4ºC. The PCR reaction solution (25 µl) for amplification of white clover and Medicago truncatula derived primers
contained 4 ng template DNA, 1X PCR buffer (Qiagen), 5 mM dNTPs (Qiagen), 0.8 mM of each forward and reverse primers (TAGN), 0.05 mM HotStar Taq DNA
polymerase (Qiagen) and 2.5 mM magnesium chloride (MgCl2) (Qiagen). The PCR reaction was carried out using the same profile as described earlier except that it
started with a 15 min hold at 94ºC at the beginning of the programme.
205 | MGC10
AFLP analysis was performed according to the procedures modified from Vos et al. (1995). The DNA concentration used was 20 ng µl-1 per reaction. The primer
combinations were named according to the standard list for AFLP® primer nomenclature.
The SSR and AFLP amplification were analysed on an ABI 3700 genetic analyser (Applied Biosystem). The forward primer was labeled with one of the 4 fluorochrome
moieties (6 FAMTM=blue, VICTM=green, NEDTM=yellow or PETTM=red) and the size standard with LIZTM. The PCR products were diluted to 1:10 or 1:5 with sterilized
distilled water before being analysed on an ABI 3700 genetic analyser (ABI PRISM). The SSR and AFLP products generated were analysed by GeneMapper® version 3.7
(Applied Biosystem) with the analysis size range set from 50 to 500 bp matching the GeneScanTM 500 (-250) Liz ® size standard.
Map construction. Genetic linkage maps were constructed from an analysis of a single parent using computer software JoinMap® 3.0 (Van Ooijen and Voorrips 2001).
Construction of both parental maps was first initiated using SSR markers at a minimum LOD score of 2. Subsequently AFLP markers were added into the maps and
markers were grouped at a minimum LOD score of 9. Loci were ordered at LOD score threshold 1.0 and recombinant frequency threshold 0.4 and a jump threshold of
5.0 using the Kosambi mapping function to calculate map distance. The two maps were then combined using the mapped markers only, to form a bi-parental
consensus genetic linkage map of red clover for QTL mapping.
Results and Discussion
Development of markers
A total of 417 markers (317 AFLP and 100 SSR) were derived from 80 primer pairs (21 AFLP and 59 SSR) showing polymorphisms using 327 F1 progeny of red clover
mapping family (Table 1). Among 417 markers, 184 (44.1%) were bi-parental and 233 (55.9%) were mono-parental (lmxll is specific for Milvus and nnxnp for Britta).
About an equal number of loci segregated in each of the parents; 116 in Milvus and 117 in Britta. From 417 markers generated, 186 (44.6%) were skewed markers:
158 AFLP and 28 SSR markers.
Map construction
Seven linkage groups (LG), corresponding to the seven chromosomes of red clover (2n=14), were formed using 300 and 301 markers for each Milvus and Britta parental
maps, respectively (Table 2). The Milvus parental map was 780 cM long, consisted of 102 markers (45 SSR, 57 AFLP) with 7.6 cM average distance between marker
loci, and the size of the linkage groups ranged from 99 cM (LG 1) to 123 cM (LG 7). The total length of the Britta parental map was 599 cM consisting of 90 markers (42
SSR, 48 AFLP) at 6.7 cM average distance between marker loci and the shortest linkage group was 49 cM (LG 7) and the longest was 119 cM (LG 2). It was found that
15 markers present in both the parental maps.
When Milvus and Britta parental maps were combined 8 linkage groups were formed (Table 3, Figure 1) where more than 78% (139 out of 177) of the markers from
both parental maps were assigned to LGs 1 to 6 (except LG 7). It was found that 15 markers in the integrated map were present in both parental maps and
approximately 21% (38 out of 177) of the marker loci were lost during map integration (data not presented). The total length of the integrated map was 807 cM and LG 8
was the shortest (49 cM) and LG 2 was the longest (24 cM). The map comprised 139 markers (72 SSR, 67 AFLP) of which 14 (10%) were skewed markers (6 SSR and
8 AFLP). The average distance between loci was 5.8 cM ranging from 4 cM in LG 6 to 12.3 cM in LG 8. An approximately equal number of marker loci segregated in
both parental genotypes. From 139 marker loci, 56 (42.3%) segregated in Milvus, 58 (41.7%) in Britta and 25 (18%) in both parents. Only one bi-parental locus was
present in LG 7 and none in LG 8. Among the 72 SSR mapped marker loci, 14 (19.4%) were from white clover, 5 (7%) were from Medicago truncatula and 53 (73.6%)
were from red clover (Figure 1).
SSR markers were first used to construct the parental maps followed by the AFLP markers. This enabled the identification of linkage groups corresponding to those
produced by Sato et al. (2005). The seven LGs comprising each of the parental maps correspond to the seven chromosomes in red clover (2n=14). However, when
combining these two maps, one LG failed to integrate which results in a total of eight LGs in the integrated map. An insufficient number of bi-parental marker loci in LG 7
from both single parental maps is the reason why the markers failed to link together to form a single linkage group. A total of 15 bi-parental markers distributed along LG
1 to 6 in both parental maps acted as ‘bridge loci’ linking and orientating the other markers to each of their respective groups leading to the formation of 6 consensus
linkage groups. Therefore, the number of linked marker loci depends on the availability of bi-parental markers. As a result, a total of eight LGs comprising 139 marker
loci were developed for red clover using 317 AFLP and 100 SSR markers. 72% (72 out of 100) of the total SSR markers were mapped as compared to only 21% (67
out of 317) of the AFLP markers. It was found that all the red clover markers in this map aligned to the respective linkage groups as in the map constructed by Sato et al.
(2005). In addition, 2 marker loci RCS 7242 (LG1) and RCS 6072 (LG 5) not present on the map of Sato et al. (2005) were also successfully mapped. Having more codominant markers in the map and using dominant markers to fill up the gap between loci resulted in a more informative map in this study.
In this map a large majority of the markers were mono-parental loci (82%) which indicated high heterogeneity between the parental genotypes (Milvus and Britta) leading
to high variability in the mapping family. The number of markers segregating in each parent was similar (Table 3) which showed both parents have same level of
heterozygosity contributing to variability in the red clover mapping family.
SSR markers segregating in different families can potentially be used in different mapping populations. This has been demonstrated in linkage maps of red clover
(Herrmann et al. 2006) and white clover (Zhang et al. 2007) too. In this study the existence of marker loci derived from white clover (TRSSR, ats and prs) and Medicago
truncatula (MtB and mtG) widely distributed along the six linkage groups (LG 1, 2, 3, 4, 5 and 8) shows some evidence of synteny between these two species and red
206 | MGC10
clover. The higher number of white clover markers distributed along the linkage groups as compared to markers derived from Medicago truncatula supports the evidence
that white clover is more closely related to red clover than Medicago truncatula. Zhang et al. (2007) found that more red clover-derived markers mapped onto white
clover as compared to markers derived from Medicago truncatula.
Sato et al. (2005) used seven RCS red clover markers (RCS1647, RCS1588, RCS2546, RCS1777, RCS1627, RCS0037 and RCS0019) to anchor the chromosomes to
the genetic map. Five of these RCS red clover markers, mapped to three of the linkage groups in this study. Two of them, RCS1647 and RCS5390 in LG 4, were
identified on chromosome 7, whereas the other two RCS0036 and RCS0131 in LG 5 were found on chromosome 1. The RCS0069 which existed in LG 6 of the Milvus
parental map but lost during map integration was also found on chromosome 6. The presence of these DNA markers indicated the association between linkage groups in
this genetic map with three of the seven chromosomes in the red clover genome, and further strengthens the position of the mapped loci in this map.
The size of the map produced in this study was slightly shorter at 807 cM than the map constructed by Sato et al. (2005) (using 148 RFLP and 1286 SSR markers) who
found a length of 868.7 cM, but longer than the earlier maps of 535.7 cM based on 157 RFLP markers (Isobe et al. 2003) and 444.2 cM based on 216 AFLP and 42
SSR markers (Herrmann et al. 2006). Differences in the map length could be due to differences in the inheritance of the segregating mapping population (Collard et al.
2005). Due to the smaller number of markers, the average distance between marker loci was longer (5.6 cM) than the map constructed by Sato et al. (2005) and
Herrmann et al. (2006). The same situation occurred in a white clover map constructed by Jones et al. (2003) using a limited numbers of markers. However, differences
in the length of marker space below 10 cM are not likely to affect the power of detecting QTL (Darvasi et al. 1993). Therefore, this map is suitable for QTL analysis and
furthermore the markers were reasonably evenly distributed along all the linkage groups except for LG 8.
The number of individuals in a mapping population could affect the accuracy of a linkage map especially if it is to be used for mapping QTL. A minimum of 200
individuals are required as a reasonable size for mapping population for QTL analysis (Van Ooijen, 1992). The 327 progeny in this mapping family fulfilled this
requirement for QTL analysis.
Conclusion
This study has produced a reliable new red clover molecular-based genetic linkage map using co-dominant and dominant markers. The map coverage was estimated to
be about 52% of the genome by taking 420 Mbp as the physical red clover genome size (Abberton et al, 2008). Compare to the map of Sato et al. (2005), the map
coverage was about 93% of the total map length. The large number of individuals used in the mapping population and considerably high coverage of co-dominant SSR
markers mapped to the linkage group provides a strong basis for dissecting the genetic control of key traits by QTL analysis. Therefore, the red clover genetic linkage
map developed in this work is appropriate for QTL analysis.
Acknowledgements
The authors would like to thank all members of the Legume Breeding and Genetics Team at IBERS, Aberystwyth University for their assistance in this study. We are
grateful particular to Terry Michaelson Yeates, Andy Williams, Mick Fothergill and Ana Winters for their expertise, Sachiko Isobe of the National Agricultural Research
Centre, Hokkaido, Japan for information about the primers and the MARDI for giving the first author opportunity to conduct this study. Work at IBERS is supported by
Department of Environmental, Food and Rural Affairs and the Biotechnological and Biological Sciences Research Council.
References
Abberton MT, Collins R, Marshall AH, Webb KJ, Skot L (2005) New traits and new tools: Forage legume breeding. IGER Innovations 9:24-27
Abberton MT, Skot L, Donnison I, Jones C, Zainol R, Oldroyd G, Geurts R, Lang C, Mayer K, Kudrna D, Jetty A, Lin J Zuccolo A (2008) Using translational genomics to
underpin germplasm improvement for complex traits in crop legumes. ERANET Plant Genomics. Plant and Animal Genome XVII Conference
10-14 January 2008
San Diego, California
Barrett B, Griffiths A, Schreiber M, Ellison N, Mercer C, Bouton J, Ong B, Forster J, Sawbridge T, Spangenberg G, Bryan G Woodfield D (2004) A microsatellite map of
white clover. Theor Appl Genet 109:596-608
Collard BCY, Jahufer MZZ, Brouwer JB, Pang ECK (2005) An introduction to markers, quantitative trait loci (QTL) mapping and marker-assisted selection for crop
improvement: The basic concepts. Euphytica 142:169-196
Darvasi A, Weinred A, Minke V, Weller JI, Soller M (1993) Detecting marker-QTL linkage and estimating QTL gene effect and map location using a saturated genetic map.
Genetics 134:943-951
Herrmann D, Boller B, Studer B, Widmer F, Kolliker R (2006) QTL analysis of seed yield components in red clover (Trifolium pretense L.). Theor Appl Genet 112:536-545.
Isobe S, Klimenko I, Ivashuta S, Gau M (2003) First RFLP linkage map of red clover (Trifolium pretense L.) based on cDNA probes and its transferability to other red
clover germplasm. Theor Appl Genet 108:105-112
Isobe S, Sato S, Asamizu E, Klimenko I, Kozlov NN., Okumura K, Tabata S (2005) A high-density SSR linkage map of red clover and its transferability to other legumes.
Molecular breeding for the genetic improvement of forage crops and turf pp137
Jones R, Abberton MT, Weller R (2003) Enhancing the role of red clover for sustainable UK Agriculture. IGER Innovations 7:24-27
Kolliker R, Jones ES, Drayton MC, Dupal MP, Foster JW (2001) Development and characterisation of simple
sequence repeat (SSR) markers for white clover
(Trifolium repensL.). Theor Appl Genet 102:416-424
207 | MGC10
Sato S, Isobe S, Asamizu E, Ohimido M, Kataoka R, Nakamura Y, Kaneko T, Sakurai N, Okumura K, Klimenko I, Sasamoto S, Wada T, Watanabae A, Kohara M,
Fujishiro T, Tabata S (2005) Comprehensive structural analysis of the genome of red clover (Trifolium pratense L.). DNA Research 12:301-364
Smith RR, Taylor NL, Bowley SR (1985) Red clover. In: N. L. Taylor (Ed.) Clover Science and Technology. ASA-CSSA-SSSA, Madison, WI. pp 457-470
Taylor NL, Smith RR (1979) Red clover breeding and genetics. Adv Agron 31:125-154
Taylor, N. L. (1983) Registration of diploid and derived tetraploid red clover germplasm. Crop Science 23:
23 1226
Van Ooijen JW (1992) Accuracy of mapping quantitative trait loci in autogamous species. Theor Appl Genet 84:803-811
Van Ooijen JW and Voorrips RE (2001) JoinMap® 3.0. Software for the calculation of genetic linkage maps. Plant Research International, Wageningen, the Netherlands
Vos, P., Hogers, R., Bleeker, M., Van de Lee, T., Hornes, M., Frijters, A., Pot, J., Peleman, J., Kuiper, M.,
Zhang Y, Sledge MK, Bouton JH (2007) Genome mapping of white clover (Trifolium repens L.) and comparative analysis within the Trifolieae using cross-species SSR
markers. Theor Appl Genet 114:1367-1378
Table 1 Number of markers generated from AFLPs and SSRs based on segregation types
BiMonoTotal
Bi- parental loci
Mono- parental loci
Primer
markers
types
<hkxhk>
<efxeg>
<abxcd> <lmxll> <nnxnp>
AFLP
168(100)
73(30)
76(28)
317(158)
SSR
11(2)
5
43(14)
41(12)
100(28)
168(100)
11(2)
5
116(44)
117(40)
Total
417(186)
417
184
233
Parenthesis indicates the number of skewed markers at significance level P < 0.05
LG
1
2
3
4
5
6
7
Total
LG
1
2
3
4
5
6
7
Total
Map
length
(cM)
99
113
106
121
103
115
123
780
Map
length
(cM)
89
119
115
92
85
50
49
599
Table 2 Marker distribution on Milvus and Britta parental linkage map
Milvus Parental Map
Marker types
Map density
Total markers
Mono-Mono
(cM)
BiBi- parental
parental
15 (4 SSR, 11 AFLP)
6.6
9
6
12 (8 SSR, 4 AFLP)
9.4
5
7
15 (4 SSR, 11 AFLP)
7.0
10
5
17 (11 SSR, 6 AFLP)
7.1
6
11
17 (10 SSR, 7 AFLP)
6.1
4
13
14 (5 SSR, 9 AFLP)
8.2
4
10
12 (3 SSR, 9 AFLP)
10.3
1
11
102 (45 SSR, 57 AFLP)
7.6
39
63
Britta Parental Map
Marker types
Map density
Total markers
MonoMono(cM)
BiBi- parental
parental
16 (7 SSR, 9 AFLP)
5.6
5
11
12 (4 SSR, 8 AFLP)
9.9
4
8
21 (10 SSR, 11 AFLP)
5.5
7
14
14 (9 SSR, 5 AFLP)
6.6
4
10
10(4 SSR, 6 AFLP)
8.5
3
7
13 (5 SSR, 8 AFLP)
3.8
4
9
4 (3 SSR, 1 AFLP)
12.3
4
90 (42 SSR, 48 AFLP)
6.7
27
63
208 | MGC10
Skewed
markers
9
1
4
2
2
6
1
25
Skewed
markers
3
1
1
1
1
2
2
11
LG
1
2
3
4
5
6
7
8
SubSubtotal
Total
<hkxhk>
1
2
4
2
2
1
12
Table 3 Segregation types of integrated marker loci in combined map
Mono
BiBi- parental loci
parental loci
<efxeg>
<abxcd>
<lmxll>
<nnxnp>
2
4
11
1
1
7
7
2
1
3
14
3
1
11
10
1
13
4
1
7
8
11
4
9
4
56
25
58
114
Total markers
18 (9 SSR, 9 AFLP)
18 (9 SSR, 9 AFLP)
24 (12 SSR, 12 AFLP)
25 (16 SSR, 9 AFLP)
20 (13 SSR, 7 AFLP)
18 (7 SSR, 11AFLP)
12 (3 SSR, 9 AFLP)
4 (3 SSR, 1 AFLP)
139 (72 SSR, 67 AFLP)
139
Figure 1.
1 Genetic linkage map of red clover. Locus names consist of origin of the parental alleles (bi=bi-parental locus, M and B=Mono-parental locus heterozygous in
the parent from Milvus (M) and Britta (B)) followed AFLP or SSR primer code names. ‘s’ indicates a significantly distorted locus (P<0.05)
209 | MGC10
ID 064
064
Genetic Analysis of Some Production Traits in Flue Cured Virginia Tobacco (Nicotiana
(Nicotiana tabacum L.)
Fida Mohammad* and Qaizar Ahmed
Department of Plant Breeding and Genetics
Faculty of Crop Production Sciences, The University of Agriculture, Peshawar, Pakistan
Email: [email protected],pk
ABSTRACT:
This research was conducted to determine heterosis, combining ability and the mode of gene actions for various traits in FCV tobacco. Seven varieties were crossed in all
possible combinations to generate full diallel at the Tobacco Research Sub Station, Mansehra (hilly) during 2007. Forty two F1 hybrids along with their parent cultivars
were planted at the Tobacco Research Station (TRS), Pakistan Tobacco Board, Khan Ghari, Mardan (plain) and the Tobacco Research Sub Station (TRSS), Mansehra
(hilly) from 2008 to 2009. Experiments were planted in randomized complete block design with four replications. Two years experiments over two locations were termed
as 4 environments (E-1, E-2, E-3 and E-4). Data were recorded on various traits. Analysis of variance revealed significance (P<0.01) among genotypes and their
interactions with environments for all traits. Prior to genetic analysis, the adequacy of additive-dominance model was assessed through t2 test, regression analysis and
array analysis. Both additive (D) and dominance (H) components were significant for grade index and reducing sugars across all environments while additive (D)
component was significant only for plant height, leaves plant-1 and leaf area. Either both (D and H) or additive (D) components were significant for all other traits across
various environments. The environmental component (E) was significant for all traits across all environments except reducing sugars. The Vr Wr graphs revealed partial
dominance for most of the traits. The positions of arrays on regression line for maximum dominant or recessive genes in parent cultivars were environment-specific.
Estimates of narrow sense heritability were higher than 60% for days to flowering, leaves plant-1, internodal length, green leaves weight, cured leaves weight, number of
green leaves, number of cured leaves, yield and grade index across environments. Analyses of combining ability revealed that the role of additive gene action was
predominant for all traits across all environments except nicotine. Reciprocal effects were significant for days to flowering, internodal length, nicotine and reducing
sugars across all environments. However, the significance of reciprocal effects for other traits was environment-specific. The range of heterobeltiosis for yield related
traits was exhibited as -0.03 to -62.03% for traits desirable in negative heterosis and as 0.02 to 25.90% for traits desirable in positive heterosis. This study indicated
KHG22/Spt G 126; Spt G 28/Spt G 126; Spt G 126/KHG24 Spt G 126/Spt G 28; KHG24/Spt G 28 and Spt G 126/NC606 are best hybrids to be considered for further
investigation. [Due to space limitation, part of whole study is presented].
INTRODUCTION
Diallel cross technique, is a conventional approach that involves crossing a set of parental lines in all possible combinations including their reciprocals. Tobacco is grown
for leaf i.e., vegetative portion. Higher yields of leaf depend on number of harvestable leaves, leaf length, breadth and weight. Quality of leaf is also measured by grade
index and quantities of nicotine and reducing sugar contents. Phenotypic expressions of quantitative traits are genotype and environment specific. More than a single
gene contributes in the expression of a quantitative trait (Mather, 1949). Genes are interdependent both in their action and transmission. Mode of genes actions may be
dominance or epistative type. Measurement of genotype x environment interaction is quite efficient in diallel cross technique. Diallel analysis is based on a set of
assumptions (Jinks and Hayman, 1953; Hayman, 1954a & 1954b).
In Nicotiana tabacum L. yield is negatively correlated with total alkaloids (Lewis, 2006). Negative relationship between yield and total alkaloids complicates pyramiding
high yield with acceptable biochemical leaf profile. Diallel crossing technique could help inferring information about the genetic behaviour of the traits. Pyramiding and
segregation of alleles could yield genetic blends with different properties. Some plant characteristics such as leaf area are directly related to increase yield in tobacco
(Chaplin, 1969). Additive gene action is mostly responsible for controlling yield related traits. Keeping in view the need and importance of the tobacco industry, this study
was initiated with the objectives to study the basic impact of environmental effects on the genetic architecture and behaviour in terms of gene actions and assess the
genotype by environment interactions and components of genetic variance for some production traits.
MATERIALS AND METHODS
The present study was conducted to determine gene action, combining abilities and heterosis for various agronomic and biochemical traits in Flue Cured Virginia tobacco
(Nicotiana tabaccuum L.). Seven tobacco varieties/lines with contrasting traits were crossed in all possible combinations to generate 7x7 diallel at the Tobacco Research
Sub Station, Pakistan Tobacco Board, Mansehra in 2007. Seed of 42 F1 hybrids was collected and stored appropriately for planting during 2008 and 2009. In 2008 and
2009, all F1 hybrids along with their parent cultivars were planted in randomized complete block design in four replicates at Tobacco Research Station Mardan (plain) and
Tobacco Research Sub Station Mansehra (hilly). Hereafter the experiments conducted at Mardan during 2008, Mansehra during 2008, Mardan during 2009 and
Mansehra during 2009 will be referred to as Environment-1 (E-1), Environment-2 (E-2), Environment-3 (E-3) and Environment-4 (E-4), respectively. Space of 60 cm was
maintained between plants within each row and rows were 90 cm apart. Each entry was planted in one row plot of 6 m length. Cultural practices including weeding,
hoeing, earthing-up, fertilizer application etc were applied as recommended in general. Prior to diallel analysis, analyses of variance for various traits across
environments were worked out to know the significance of genotype by environment. In case of significant genotype by environment interaction, analyses of variance
over each environment were carried out.
210 | MGC10
RESULTS AND DISCUSSION
Test of significance
Data recorded on seven FCV tobacco varieties and their 42 F1 hybrids for various traits over four environments were subjected to combined analysis of variance.
Genotypes and GE were significant (P<0.01) for all traits. Significant GE implies that response of genotypes to various environments was different and thus it
necessitated considering analysis of genotypes in individual environments. Analyses of variance revealed significant differences among genotypes for all traits in four
environments. Significant differences in genotypes justified to proceed for genetic analyses.
Genetic components of variation and graphical representation
Leaf area
E-1: Assessment of scaling tests declared that additive dominance model is not valid.
E-2: In favour of E-2 the additive component D was positive and significant (7791.4) while the dominance components H were non significant so additive type of gene
action was more important than dominance gene action (Table 1). Unequal value for ratio of H2/4H1 to 0.25 (0.38), revealed that there was unequal distribution of
positive and negative genes in parents. Negative value of F and smaller ratio of dominant and recessive genes (0.36) than 1 indicated that there was greater
proportion of recessive genes in the breeding material. Significance of h2 component revealed the presence of dominance effects over all loci in heterozygous
phase. Presence of environmental influence was evident by a significant value of E (6074.39). Mean degree of dominance (0.39) was smaller than 1, indicating
partial dominance. Moderate value of narrow sense heritability (43%) was obtained (Table 1).
E-3: Significant value of D (430.38) and non significant value of H indicated presence of additive gene effects and absence of dominant effects (Table 1). The ratio of
H2/4H1 (-1.40) was unequal to 0.25 which indicated unequal distribution of positive and negative genes among parents. Non significant value of F and ratio of
dominant to recessive genes (-0.59) was less than 1 which pointed to presence of higher frequency of recessive genes. The environmental influence was evident
by significant value of component E (412.54). Average degree of dominance (0.25) showed partial dominance as its value being lesser than one. Estimate of
narrow sense heritability for leaf area was 55%.
E-4: Table 1 revealed that there was a positive and significant value of D component (1031.71). The H component was found non significant. This was an indication of
additive effects of genes. The component F and h2 were found non significant. Significant value of environmental component E (339.76) was observed. Average
degree of dominance (0.44) showed partial dominance as its value being smaller than one. Moderate estimate of narrow sense heritability (51%) was observed.
Leaf size in E-2, E-3 and E-4 was found to be under additive gene action and hence exhibited effectiveness of early generation selection. Dean (1974) and
Sadeghi et al. (2012) also advocated for additive gene action in the inheritance of leaf area. Contrary to findings in this study, Legg and Collins (1970) reported
that dominance type of gene action was involved in the inheritance of this trait. Partial dominance of the gene action validated earlier findings of Butorac et al.
(2004). In E-3 and E-4 green leaf weight was under the influence of additive gene effects mostly. Early generation selection will be effective in these environments.
The E-2 showed absence of both additive and dominance types of gene action and environmental influence was greater in expression of the trait. In E-1 both
additive and dominance gene effects were present in the inheritance of leaf area. Marani and Sachs (1966) reported that additive effects were responsible for the
trait but Gopinath et al. (1967) found both additive and dominance type of gene actions in the inheritance of leaf weight.
Number of
of cured leaves kg -1
E-1: Under E-1, significant value of D component (92.74) and non significant H component established the role of additive gene action in the inheritance of leaf number
(Table 1). The magnitudes of H1 and H2 components were observed to be unequal, indicating absence of symmetrical distribution of positive and negative genes.
This was confirmed by the ratio of H2/4H1 (0.35) which was not equal to 0.25. The F component and h2 were non significant. The ratio of dominant to recessive
genes in the parents, was observed as 1.14 (greater than one), indicating the presence of greater proportion of dominant genes in the parents. Influence of
environment was reflected by significant value of E component (9.19). Average degree of dominance (0.29) was an indication of partial dominance. High estimate
of narrow sense heritability (78%) favoured additive gene action.
E-2: Both D (133.15) and H (35.19) components were significant (Table 1). This indicated the presence of additive as well as dominance gene effects in the breeding
material for leaf number. An unequal distribution of positive and negative effects was revealed by the unequal values of H1 and H2 components and confirmed by
the ratio of H2/4H1 (0.10) which was less than 0.25. The value of F component (99.38) was significant and the ratio of dominant to recessive genes (6.30) in
parents was greater than one. It revealed that greater proportion of dominant genes was present in the breeding material. The value of h2 component was found
as negative (-24.30) which indicated absence of dominant effect at all loci in heterozygous phase. The environmental influence was indicated by significant value
of the E component (49.95). Average degree of dominance (0.51) was smaller than one indicating presence of partial dominance. Estimate of narrow sense
heritability (34%) was recorded for the trait.
E-3: For the data under E-3, the value of D component (57.51) was significant while H component was negative and non significant, which indicated additive effects
were responsible in the inheritance of this trait (Table 1). Values of H1 and H2 components were unequal to each other. The ratio displayed by H2/4H1 (-1.70) was
also not equal to 0.25. This pointed towards absence of symmetrical distribution of positive and negative genes in parents. The values of F and h2 component
were negative. The expected environmental component of variance E was observed (54.94) to be significant hence environment also played an important role in
expression of phenotype. The abundance of recessive genes was revealed in parents, as indicated by negative value for the ratio of dominant to recessive genes
(–0.55). Average degree of dominance was observed as 0.27. A moderate level of narrow sense heritability (52%) estimate was observed.
211 | MGC10
E-4: The additive component D (157.09) as well as dominance components H (108.47) were found positive and significant so both additive and dominant gene effects
were held responsible for controlling the trait (Table 1). The values of H1 and H2 were very far from each other in magnitude. Also the ratio obtained by H2/4H1
(0.10) was very much less than 0.25. These established the phenomenon of unequal distribution of positive and negative genes in parents. The F component
(108.75) was significant and the ratio of dominant to recessive genes (2.43) in parents was more than 1 which indicated a greater proportion of dominant genes
in parents for this trait. The value of h2 was negative and non significant. The environmental component of variation was found to be significant (46.19). Average
degree of dominance (0.83) was smaller than 1, so partial dominance was present in the breeding material. Moderate value of narrow sense heritability (50%)
was observed in the breeding material.
Breeding material used in this study exhibited additive gene effects in controlling leaf number per kg in cured condition except in E-2 where both additive and dominant
type of gene actions were present. Early generation selection could be more effective in E-1, E-3 and E-4. Additive gene effects were advocated by Butorac (2001) which
are in agreement to the findings of this study.
Grade index (%)
E-1: For grade index, both additive D (32.78) and dominance H (26.58) components were significant, indicating additive and dominant gene effects involved in the
heredity of this trait (Table 1). The H1 was not equal to H2 component in magnitude which pointed towards absence of symmetrical distribution of the positive and
negative genes in parents. This was also confirmed by the ratio of H2/4H1 (0.19) which was far from 0.25. The F component (27.71) was significant. The ratio of
dominant to recessive genes (2.77) in the parents was also greater than one. This indicated the presence of greater proportion of dominant genes in parent
cultivars. The h2 value (28.47) was also significant revealing presence of dominant effect over all loci at heterozygous phase. The environmental influence was
evident by the presence of a significant E component (3.64). Mean degree of dominance (0.90) was smaller than one indicating partial dominance. Moderate
estimate of narrow sense heritability (39%) was recorded for the trait.
E-2: Both additive D (28.59) and dominant H (36.92) components were found positive and significant (Table 1). It indicated the presence of both additive and dominant
gene effects. Values of H1 and H2 were not equal to each other. This showed that there was absence of equal frequencies of positive and negative genes in the
parents, which was confirmed by the unequal ratio of H2/4H1 (0.18) to 0.25. The F component (30.293) was positive and significant; also the proportion of
dominant to recessive genes was greater than 1. This indicated presence of greater proportion of dominant genes in parents. The h2 component was significant
(43.93) indicating the dominant effects over all loci in heterozygous conditions. Environmental influence was present as indicated by significant value of E
component (4.55). Mean degree of dominance (1.14) was greater than one, indicating over dominance. Low estimate of narrow sense heritability (26%) was
recorded for the trait which indicated minimal role of additive gene action.
E-3: Data for the grade index at E-3 revealed that additive and dominant gene effects were present in the breeding material (Table 1) because positive and significant
values of D (47.98) and H (14.67) were observed. The H1 and H2 components were not equal in magnitude and the ratio (0.22) displayed by H2/4H1 was not equal
to 0.25. This pointed towards unequal distribution of positive and negative genes in the parents. The component F (16.98) was positive and significant indicating
the presence of greater frequencies of dominant than recessive genes in parents. This was confirmed by the ratio of dominant to recessive genes in parents (1.94)
which was bigger than one. The h2 was found non significant. Phenotypic expression of grade index was also under the influence of environment as environmental
component E (3.32) was significant. Average degree of dominance (0.55) was smaller than one, indicating the presence of partial dominance. High estimate of
narrow sense heritability (71%) was observed which signified the role of additive gene action in the inheritance of this trait.
E-4: Both D and H components were positive and significant (41.49 and 21.61, respectively) indicating additive and dominant gene effects (Table 1). The H1 and H2
were significant but unequal to each other which suggested the absence of symmetrical distribution of positive and negative genes in parents. This was also
suggested by the unequal ratio of H2/4H1 (0.22) to 0.25. The F component (10.10) was positive and significant which indicated more frequencies of dominant
genes. This was confirmed by the ratio (1.41) of the dominant to recessive genes in parents greater than one. The component h2 was non significant. The
expected environmental component of variation E was significant (3.74). Average degree of dominance (0.72) was smaller than one, indicating partial dominance.
High narrow sense heritability estimate (67%) was recorded for this trait, indicating important role of additive gene effects.
For grade index, both additive and dominant gene effects were present in the current breeding material. Careful selection for the improvement of this trait in FCV tobacco
will be needed because of complicated mode of inheritance coupled with greater influence of environment. The current results are quite similar to those obtained by
Dean (1974) and Butorac et al. (1999).
212 | MGC10
LITERATURE CITED
Butorac, J., D. Vasili, V. Kozumplik and J. Beljo. 1999. Quantitative parameter of some burley tobacco traits. Rostlinna Vyroba. 45(4): 149-156.
Butorac, J. 2001. Regression analysis of some leaf parameters in Burley Tobacco. Agri. Conspectus Scientificus. 66 (3): 145-151.
Butorac, J., J. Beljo and J. Gunjaca. 2004. Study of inheritance of some agronomic and morphological traits in burley tobacco by graphic analysis of diallel cross. Plant
Soil Environ. 50(4): 162–167.
Chaplin, J.F . 1969. Registration of PDMS-1 and PDMS-2 Tobacco Germplasm1 (Reg. Nos. GP 5 and GP 6). Crop Sci. 9(5): 681-682.
Dean, C.E. 1974. Heterosis, inbreeding depression, and combining ability in diallel crosses of cigar-wrapper
tobacco. Crop Sci. 14(3): 482-484.
Gopinath, D.M., R. Lakshminaray and C.L. Narayana. 1967. The mode of gene action in flue-cured tobacco. Euphytica. 16(2): 293-299.
Hayman, B.I. 1954(a). The analysis of variance of diallel crosses. Biometrics 10: 235-244.
Hayman, B.I. 1954(b). The Theory and analysis of diallel crosses. Genetics. 39: 789-809.
Jinks, J. L. and B. I. Hayman1953. The analysis of diallel crosses. Maize Genetics News Letter 27: 48-54.
Legg, P.D. and G.B. Collins. 1970.. Genetic Parameters in Burley Populations of tobacco (Nicotiana tabacum L.) I. ‘Ky 10’ x ‘Burley 21’1. Crop Sci. 11(3): 365-367.
Lewis, R.S. 2006. Identification of germplasm of possible value for confronting an unfavorable inverse genetic correlation in tobacco. Crop Sci. 46(4): 1764-1771
Marani, A. and Y. Sachs. 1966. Heterosis and combining ability in a diallel cross among nine varieties of oriental tobacco. Crop Sci. 6(1): 19-22.
Mather, K. 1949. Biometrical Genetics. Methuen & Co., London.
Sadeghi, S.M., E. Amin and M. Ashouri. 2012. An investigation of gene action on different traits of tobacco under irrigated and drought stress environment. African J of
Biotech. 11(21): 4740-4751.
Table 1. Estimation of components of genotypic variance for traits in 4 environments, 2008-09 and 2009-10.
E-1
NCL
GI
LA
E-2
NCL
GI
LA
E-3
NCL
GI
LA
E-4
NCL
GI
D
92.74
+2.50
32.78
+2.36
7791.40
+999
133.15
+7.06
28.59
+3.12
430.38
+204
57.51
+12.39
47.98
+1.66
1031.71
+95
157.09
+14.63
41.49
+2.09
H1
7.88
+6.01
26.58
+5.69
1181.25
+2406
35.19
+16.99
36.92
+7.50
-26.60
+492
-4.04
+29.84
14.67
+4.00
195.47
+229
108.47
+35.23
21.61
+5.04
H2
11.06
+5.30
20.30
+5.01
1775.73
+2120
13.69
+14.97
27.24
+6.61
148.60
+433
12.71
+3.52
151.61
+202
43.72
+31.04
18.64
+4.44
3.43
+5.99
27.71
+5.67
-2825.92
+2397
99.38
+16.93
30.29
+7.47
-837.92
+490
27.42
+26.29
106.52
+29.73
16.98
+3.98
276.92
+228
108.75
+35.11
10.10
+5.02
-3.99
+3.56
28.47
+3.37
16823.52
+1424
-24.30
+10.05
43.93
+4.44
-179.06
+291
-25.26
+17.66
0.21
+2.37
-41.79
+135
-22.62
+20.85
5.58
+2.98
9.19
+0.88
3.64
0.84
6074.39
+353
49.95
+2.49
4.55
+1.10
412.54
+72
54.94
+4.38
3.32
+0.59
339.76
+34
46.19
+5.17
3.74
+0.74
Components
LA
Model not adequate
F
h2
E
(H1/D)1/2
0.29
0.90
0.39
0.51
1.14
0.25
0.27
0.55
0.44
0.83
0.72
H2/4H1
0.35
0.19
0.38
0.10
0.18
-1.40
-1.70
0.22
0.19
0.10
0.22
(4DH 1) + F / (4DH 1) – F
1.14
2.77
0.36
6.30
2.75
Heritability (ns)
78.28
39.44
43.47
34.11
26.00
Heritability (bs)
83.30
74.71
47.32
38.34
70.35
Parameter value is significant when it excedes 1.96 after dividing it with its standard error
-0.59
54.86
58.59
-0.55
51.75
57.11
1.94
71.71
85.54
1.89
51.39
56.27
2.43
49.75
59.36
1.41
67.17
85.39
1/2
1/2
LA: leaf area; NCL: number of cured leaves kg-1; GI: grade index
213 | MGC10
ID 065
065
Conception Rate of ICSIICSI -Derived Bovine Embryos
1
Habsah Bidin,
Bidin, 2Izuan Bahtiar Ab Jalal, 1Mohd Padzil Abd Rahman, 1Ahmad Johari, 1Ajis Hasan, 2Mohamad Naim Zakaria, 3Musaddin Kamaruddin.
1
National Animal Embrio Centre (NAEC),
2
Strategic Livestock Research Centre, MARDI Kluang Research Station
3
Strategic Livestock Research Centre, MARDI HQ
Email: [email protected]
ABSTRACT:
This study was initiated to determine the conception rate of embryos derived from ICSI. Cumulus-oocytes-complexes (COCs) with more than five layers of cumulus cells
were used in the study. Following maturation, oocytes were activated using calcium ionophore A23187 before or after ICSI. Bovine spermatozoa were injected
individually into matured oocytes. After ICSI, presumptive zygote were cultured in CR1-amino acid culture medium at 38.5oC and 5% CO2 for 7 days post sperm injection.
The mean percentage of cleavage and blastocyst rates of pre- and post-ICSI activated oocytes were 65.16% and 6.00% and 59.99% and 4.84%, respectively. The
embryos were frozen and subsequently transferred to recipient dams. In vivo-produced embryos from Charoke cows were transferred to recipient dams as control. The
ICSI- and in vivo-derived embryos were transferred to 17 recipient dams in two programmes. In the first programme, four recipient dams each received ICSI-derived
embryos and in vivo-derived embryos, whereas in the second programme, four and five dams received ICSI-derived embryos and in-vivo-derived embryos, respectively.
The results of the present study showed that the conception rate of ICSI- and in vivo-derived embryos in the first embryo transfer programme was 25% (1/4) and 50%
(2/4). However, no pregnancy was detected in the second embryo transfer programme. Thus, this study indicated that it is possible to achieve conception in cattle using
ICSI-derived embryos. However, further studies using more ICSI-derived embryos and recipient dams are required to determine the effectiveness of the ICSI technique in
achieving conception of recipient dams.
Keywords:
Keywords Conception rate, Pregnancy Diagnosis, ICSI embryo, Calcium Ionophore, bovine.
INTRODUCTION
Intracytoplasmic sperm injection (ICSI) is an important technique in assisted reproduction, especially in the treatment of human infertility and endangered species
conservation. ICSI offers great opportunity for research on oocyte activation and fertilization, development of transgenic animals, and the generation of sex-preselected
offsprings. ICSI is advantageous when only very few spermatozoa are available for insemination. Numerous studies reported the birth of healthy offspring after transfer of
embryos produced by ICSI. In bovine, the birth of the first offspring using ICSI-derived embryo was reported by Goto et al., (1990). However, the rate of blastocyst
formation and live newborn were greatly reduced when zygotes were produced by ICSI. ICSI remains a low efficiency technology in comparison with alternative
techniques such as in vitro fertilization (IVF). Therefore, the study was initiated to determine the conception rate of embryos derived from ICSI.
MATERIALS AND METHODS
The microinjection procedure was carried out using the inverted microscope (Zeiss Axiovert 135) equipped and fitted with two arms of the Eppendorf micromanipulators.
Each oocyte was placed in a drop (5 ul) of injection medium (HEPES-beffered TCM199 supplemented with 10% of Steer Serum) covered with paraffin oil. A small volume
(1-2 ul) of sperm suspension was added to another drop containing 10% polyvinylpyrrolidone (PVP; Sigma, St. Louis, USA). A spermatozoon was picked up from the
sperm drop and injected into the cytoplasm of the oocyte that was held by a suction-controlled holding pipette positioned with the first polar body at 12.00 or 6.00
o'clock. Spermatozoa were immobilized by pressing the spermatozoa tails to the oocyte membrane prior to the injection of a spermatozoa into an oocyte. After ICSI,
presumptive zygotes were cultured in CR1-amino acid culture medium at 38.5oC and 5% CO2 for 7 days post sperm injection. In the study, Charoke cows were used as
donors for the production of in-vivo produced embryos (control). The ICSI- and in vivo-derived embryos were frozen using vitrification solution before transferred to
recipient dams.
Two embryo transfer (ET) programmes was conducted using 17 recipient dams. All cows received a controlled internal drug releasing device (CIDR-B) containing 1.38g
progesterone for 12 days followed by an intramuscular injection of Prostaglanding-F2α (PGF2 Estrumate) that were given twice on day 11 prior to CIDR-B removal.
Observation of estrus was done 36-72 hours after CIDR-B removal. During the observation, estrous cows were given 2 ml of receptal after 6 hours of standing heat
detection and this was repeated on the next day. On day 7 of the estrous cycle, frozen embryos were non-surgically transferred to the uteri of 17 recipient cows (Charoke
breed). In the first ET programme, four recipient dams each received ICSI-derived embryos and in vivo-derived embryos, whereas in the second programme, four and five
recipient dams received ICSI-derived embryos and in vivo-derived embryos, respectively. Pregnancy was diagnosed by rectal palpation 90 days post ET.
RESULTS AND DISCUSSIONS
The present study demonstrated that the conception rate of ICSI- and in vivo-derived embryos in the first embryo transfer programme was 25% (1/4) and 50% (2/4).
However, no pregnancy was detected in the second embryo transfer programme. Similar results were reported using embryos derived from ICSI of Y sperm head
(Hamano et al., 1999) and the birth of calves ranged between 9% to 50% (Garcia-Rosello et al., 2008).
214 | MGC10
In cattle, the majority of studies demonstrated that artificial activation of bovine oocytes after conventional ICSI improved the fertilization rate. Fertilization rates in cattle
ranged between 50% to 80%, whereas embryo development to the blastocyst stage ranged from 4% to 40.1% (Garcia-Rosello et al., 2008). In the study, oocytes were
activated using calcium ionophore A23187 before or after ICSI. Calcium ionophore is one of the most frequently used articial factors for oocyte activation and for
balancing the maturation supporting factor (Korkmaz et al., 2013). Among the treatment, pre- or post- oocyte activation treatment using calcium ionophore A23187 is
more effective than pre- and post- treatment. The mean percentage of cleavage and blastocyst rates of pre- and post-ICSI activated oocytes were 65.16% and 6.00%
and 59.99% and 4.84%, respectively. Other study showed lower cleavage rate (41.82%) but higher blastocyst rate (12.73%) in post-ICSI activated oocytes (Korkmaz et
al., 2013). These results demonstrated that calcium ionophore A23187 can be used to activate oocytes before or after ICSI.
The results of the present study indicated that in vitro matured oocytes activated with calcium ionophore A23187 before or after ICSI can result in blastocyst
development. The conception rate of ICSI-derived embryos in the first embryo transfer programme was 25% (1/4). Thus, this study indicated that it is possible to achieve
conception in cattle using ICSI-derived embryos.
CONCLUSION
In conclusion, oocyte activation using calcium ionophore A23187 before or after ICSI affected the production of transferable embryos. The conception rate from the
transfer of ICSI-derived embryo was 25% (1/4). However, further studies using more ICSI-derived embryos and recipient dams are required to determine the
effectiveness of the ICSI technique in achieving conception of recipient dams.
ACKNOWLEDGEMENT
This project was funded by e-Science Project No 02-03-08-SF0308, Ministry of Science, Technology and Innovation (MOSTI).
REFERENCES
Garcia-Rosello E., Garcia-Mengual E., Coy P., Alfonso J. and Silvestre MA. (2008). Intracytoplasmic sperm injection in livestock species: An update. Reprod Dom Anim
(Review article): 1-9
Goto K., Kinoshita A., Takuma Y. and Ogawa K. (1990). Fertilisation of bovine oocytes by the injection of unmobilized killed spermatozoa. Vet. Rec. 127: 517-520
Hamano K., Li X., Qian X, Funauchi K., Furudate M and Minato Y. (1999). Gender preselection in cattle with intracytoplasmically injected, flow cytometrically sorted
sperm heads. Biol of Reprod. 60: 1194-1197
Korkmaz O, Kuplulu S., Agca Y., Polat, IM. (2013). Effect of oocyte quality and activation protocols on bovine embryo development following intracytoplasmic sperm
injection. Turk J Vet Anim Sci. 37:26-30
215 | MGC10
ID 066
066
Genetic Diversity of Terubok, Tenualosa toli,
toli , from Mukah, Sarawak Inferred by Partial Cytochrome b (Cyt(Cyt-b)
Abdul Hadi Abdul Aziz, Shahreza Md. Sheriff, NurAsma Ariffin, Muhd DanishDanish- Daniel,
Daniel, Wong Lilian, Seah Ying Giat, Abol Munafi Ambok Bolong and Nabilah
Mohamad Ali
Faculty of Fisheries and Aqua-Industry, Universiti Malaysia Terengganu
Email: [email protected]
ABSTRACT:
Terubok (Tenualosa toli) is a commercially important fish from Sarawak in which the numbers of the fish caught in the past 15 years were declining. Mukah area is one
of few sites in Sarawak where this species can be found. The populations in this area however also have been heavily exploited for the fisheries industry. Hence, this
study was conducted to investigate the mitochondrial genetic diversity of T. toli from Mukah, Sarawak through Cyt-b gene. DNA extractions were carried out on 27
samples caught from the wild. PCR amplification using universal Cyt-b primers had been conducted and sequence of 469 bp length of partial Cyt-b gene was obtained
from each sample. Phylogenetic analysis was then performed to study the relationship amongst the individuals. The genetic diversity of the population was determined
through the haplotype and nucleotide diversity. The haplotype diversity Hd of T. toli was relatively low (Hd = 0.214). The nucleotide diversity was also low for this
population. Moreover, only four haplotypes were identified from the 27 individuals. Meanwhile, a single haplotype was shared amongst 24 individuals. These findings
correlate with previous study that showed the number of the fish caught had drastically declined and might cause a genetic deprivation towards its population.
Comparably, Maximum Likelihood analysis revealed that one T. toli individual were separated from the main clade, suggesting that these individual might come from
another Terubok populations. The findings of this study have provided the understanding in the population structure of this species in coastal area of Mukah region in
Sarawak. Genetic diversity of the mitochondrial DNA Cytochrome b of the T. toli would be useful in the implementation of conservation and fisheries management of this
species in the future.
1.0
Introduction
The Tenualosa toli or locally known in Sarawak as the Terubok is one of the most important Clupeoid fish that is sought in the market due to its highly prized meat and
especially for its roe (Wong, 2004). It is sometimes exported to the Peninsular Malaysia and neighboring countries. In Sarawak, Mukah is known to be one of the main
landing site of terubok (Phillip, 2006). It has been reported that the population of terubok had been heavily exploited and their numbers had been declining drastically
(Phillip, 2006; Hambali et al., 2011). This may periodically affect its genetic diversity. However, the genetic data that indicates the genetic variability of the population is
not well documented. A population structure that has a small genetic diversity would result in low heterozygosity (Hauser et al., 2002). This would lead to the severe
effects of inbreeding depression (O’Leary et al., 2013) which would affect its reproductive success. Prolong effect of such event might cause the lost of one of the most
important fisheries resources in the future within the Borneo’s regions, severing the socio-economics of the local citizens as had been reported in several species
(Maggio et al., 2006; Gonzalez-Tizon et al., 2008; Xiao et al., 2012).
Molecular marker had been successfully used to identify the phylogenetics of closely related fish species and also in migrating fish species (Jamsari Amirul, et al., 2011;
Zardoya et al., 2004). It also has been used to analyze the genetic diversity of the fish population (Okumus & Ciftci, 2003). Mitochondrial DNA marker is one of the most
widely used marker applied in genetic population and variation studies in fish population (Zardoya et al., 2004; Lakra et al., 2009; Ma et al., 2010). Study on genetic
diversity had also been done to several local Malaysian fishes (Haslawati et al., 2011; Nguyen et al., 2006; Norfatimah et al., 2009; Nazia et al., 2010). However
genetic study on T. toli has not been well documented. The ability to determine the genetic diversity will enable researcher to understand the population structure of T.
toli Sarawak. This will give an insight and a deep understanding regarding the population of T. toli in Mukah region. The information obtained from this research can be
used to develop the genetic database of T. toli in Sarawak which can contribute in the management and restoration of the fisheries resources. Due to this, a study was
conducted to determine the genetic diversity of the T. toli from the Mukah region of Sarawak.
2.0
Materials and Methods
A total of 27 samples of terubok, T. toli, were collected from the coastal area of Mukah region, Sarawak. These samples were identified morphometrically based on its
morphological characteristics according to the verification of Turan et al., (2006). The key identification for the Tenualosa sp. was based on Whitehead (1985). All the
white muscle tissue and fin clips collected were preserved in 95% ethanol and stored at -20oC until DNA extraction. Total genomic DNA was extracted using the DNA
extraction kits, the Cell/Tissue DNA Extraction Kit (Spin Column) (BioTeke Corporation, China). Amplification of partial Cytochrome b (Cyt-b) gene was done using two
primers based on Faria et al., (2006) which were the Cytb2 f (5’-CCTTCTAACATTTCAGTCTGATG-3’) and Cytb2 r (5’-AGGATTGTGGCCCCTGCAATTAC-3’). A PCR mixture
containing 2.5 μl of 10× PCR buffer; 1.25 μl of 25 mM MgCl2; 0.6 μl of 100 pmol of both primers; 0.2 μl of 5U Taq DNA polymerase; 0.5 of 10,000 uM dNTP; and 2.0
μl of 100 ng DNA sample was prepared in a 25 μl reaction. The cycling profile began with the initial step (95oC for 5 minutes), followed by 30 cycles of denaturation (at
94oC for 40 seconds), annealing (at 50oC for 45 seconds) and extension (at 72oC for 60 seconds) and finally subjected to the final extension (72oC for 7 minutes). After
216 | MGC10
that, the PCR product was purified using a DNA purification kit (Vivantis, Malaysia) according to the manufacturer’s protocol. All the purified PCR products were then
sequenced bi-directionally by First Base Laboratories Sdn. Bhd. using the same primers for PCR amplification.
The obtained sequences were edited using 4Peaks (Nucleobytes Inc.) and FinchTV (Geospiza Inc.) to remove any unwanted sequences, noise and gaps. Each of the
sequences was then identified using the Nucleotide Basic Local Alignment Search Tool (BLAST) at the National Center of Biotechnology Information (NCBI) database
(http://www.ncbi.nlm.nih.gov). The sequences were then aligned together with the corresponding sequences of other Tenualosa sp. available (Tenualosa toli, Accession
number: KC405574.1 and Tenualosa illisha, Accession number: EU552622.1) in the GenBank using the CLUSTAL W program through the MEGA software version 5.1
(Tamura et al., 2011). Tetrapturus pfluegeri (Accession number: DQ198010.1) from the Istiophoridae family and Coris julis (Accession number: HM049942.1) from the
family Labridae had been chosen as the outgroup. Kimura-2-parameter was chosen as the best-fit substitution model in phylogenetic analysis. Neighbor-Joining,
Maximum-Parsimony and Maximum-Likelihood algorithms were used to reconstruct the phylogenetic tree with 1000 replications of bootstrapping (Tamura et al., 2011).
Analysis of Molecular Variance (AMOVA) had been conducted using the Arlequin program (Version 5.1, Population Genetics CMPG Lab) to calculate the haplotype
variation and mean haplotype frequency (Excoffier et al., 2007). DnaSP (Version 5.1, Universitat de Barcelona) was used to estimate the mitochondrial genetic variation
including the nucleotide variation between the samples and to determine the level of genetic variation within phylogenetic clades through the calculation of Tajima’s test
of neutrality.
3.0
Results and Discussion
The amplification of partial Cytochrome-b (Cyt-b) performed on all T. toli samples obtained a fragment with an approximate size of 500 bp for all the samples. Sequence
analysis of the amplified fragment showed that the total length was 469 nucleotides. All sequences had 100% similarity with the mitochondrial DNA Cytochrome b
sequence of T. toli (Accession Number: AP011600.1 and KC405574.1) in the Genbank Database confirming that all samples collected were T. toli. In phylogenetic
analysis, Neighbour-Joining (NJ), Maximum-Likelihood (ML) and Maximum-Parsimony (MP) trees showed similar patterns (NJ and MP not shown). Figure 3.1 showed the
phylogenetic tree generated by Maximum-Likelihood algorithm. In general, almost all of the T. toli samples were clustered in one clade separated from sister group and
outgroup. Among the 27 T. toli samples, 4 haplotypes were found. In general, one dominant haplotype was shared among 24 T. toli samples while the other 3 samples
possessed unique haplotype (MU1, MU22 and MU29) (Table 3.1 and 3.2). The haplotype diversity (Hd) calculated was low which was 0.214 and nucleotide diversity, π,
was extremely low 0.00095. Tajima’s neutrality test for the sample is -2.094036. The shared haplotype (hap 01) was the common and likely to be the ancestral.
Research by Luhariya et. al (2012) also found shared haplotype and discussed that it might be the source of origin from which all haplotypes have originated and evolve
to become unique haplotype.
In this study, a low haplotype and nucleotide diversity of 0.214 and 0.00095 respectively indicates a less diverse population. Cárdenas et al. (2009) stated that a
population with a haplotype diversity ranging from 0.15 to 0.51 showed that the genetic diversity of the population is low which might be due to the reproductive strategy
of the species to disperse over a large area of oceanic waters, without forming schools or aggregations. Study by Heyden et. al (2010) also revealed a low genetic
diversity on demersal fish. Result of the study recovered 19 haplotypes in total with low haplotype and nucleotide diversity of 0.53 and 0.0014 respectively. Genetic
study on Clarias marcocephalus by Nazia et. al (2010) also found a low genetic diversity and concluded that the individuals might originated from a single population.
Thus, the low diversity found on the T. toli population in the present study indicates that the samples might come from one population. As the mtDNA is maternally
inherited, it was stated that samples originating from a single parent could result in a single population specific haplotype (Avise, 1994). However further studies should
be done on T. toli from other areas in Sarawak to confirm this matter. This will provide a more precise data on its population structure in Sarawak. The success of
conservation programs and effective management policies depend on the levels of genetic divergence within and between species and developing strategies to maintain
the natural genetic diversity (Lakra et. al, 2009). Such data could be very useful in the management and restoration of T. toli which is currently been heavily exploited.
Haplotype
Hap 01
Hap 02
Hap 03
Hap 04
Table 3.1: Haplotype shared by all samples of Tenualosa toli
Sample
MU2, MU3, MU4, MU5, MU6, MU7, MU9, MU10, MU11, MU13, MU14, MU15, MU16, MU17, MU18, MU19, MU20,
MU23, MU24, MU25, MU26 MU27, MU28 and MU30
MU1
MU22
MU29
217 | MGC10
Table 3.2: Composite sequence for the haplotypes discovered in Mukah population.
Composite Sequence
Haplotype
Hap 01
5’AAACTTCGGGTCCCTCCTGGGACTCTGCTTGGCATCACAAATCTTAACAGGACTATTCCTGGCCATGCACTACACCTCTGATATCGCAAC
CGCCTTTTCATCGGTTACACACATCTGCCGCGACGTCAATTACGGATGATTAATTCGAAATGTGCACGCAAATGGTGCATCCTTTTTCTTC
ATGTGTATCTATGCCCATATTGGCCGAGGACTCTACTACGGCTCTTATCTGTACAAAGAAACCTGAAACATTGGGGTTGTCCTACTGTTGC
TGGTCATGATAACAGCCTTCGTCGGCTACGTCCTTCCCTGAGGACAAATATCCTTCTGGGGGGCCACAGTCATTACAAACCTACTGTCTG
CTGTGCCTTACGTAGGAAACGAGCTCGTCCAATGAATTTGAGGAGGCTTCTCCGTTGATAATGCCACCCTTACCCGATTCTTCGCCTTCCA
CTTCCTATTCCCATTC
-3’
Hap 02
5’-
Hap 03
5’-
Hap 04
5’-
GA
7 8
A T
23 25
-3’
T
223
G
17
-3’
-3’
* The composite sequences for each of the haplotypes. The numbers indicate the position of the composite nucleotide from the 5’ end of the sequence.
Conclusion
Genetic study on T. toli in Mukah area, Sarawak showed a low genetic diversity with haplotype and nucleotide diversity of 0.214 and 0.00095 respectively. The finding
indicates that the population is less diverse and might be originating from a single population. However more study is needed to obtain a deeper understanding on its
population structure in Sarawak.
218 | MGC10
MU28
MU30
MU27
MU26
MU25
MU24
MU23
MU20
MU19
MU18
MU17
MU16
MU15
MU14
MU13
MU11
MU10
MU9
MU22
MU29
MU7
MU6
MU5
MU4
MU3
MU2
Tenualosa toli KC405574.1
MU1
Tenualosa ilisha EU552622.1
Tenualosa macrura 2
90
100
Tenualosa macrura 1
Tenualosa macrura SG
Coris julis HM049942.1
Tetrapturus pfluegeri DQ198010.1
99
0.05
Figure 3.1. Maximum Likelihood tree .Topology of phylogenetic tree constructed using Maximum Likelihood algorithm. Coris julis and Tetrapturus pfluegeri used as
outgroup. Value at each node is the bootstrap value (1000 replicate).
Acknowledgement
The authors would like to thank Ministry of Education Malaysia for providing the Fundamental Research Grant Scheme (FRGS) under grant no. 59245. The authors would
also like to thank the Department of Agriculture, Sarawak and Mr. Kairulnieza Waynie for assisting in collection of samples.
219 | MGC10
REFERENCES
Avise J.C. (1994). Molecular markers, natural history, and evolution.Chapman and Hall, New York.
Cárdenas, L., Silva, A.X., Magoulas, A., Cabezas, J., Poulin, E. and Ojeda, F.P. (2009). Genetic population structure in the Chilean jack mackerel, Trachurus murphyi
(Nichols) across the South-eastern Pacific Ocean. Fisheries Research 100: 109–115.
Excoffier, L., Laval, G., & Schneider, S. (2007). Arlequin (version 3.0): An integrated software package for population genetics data analysis. Evolutionary Bioinformatics ,
47-50.
Faria, R., Weiss, S., & Alexandrino, P. (2006). A molecular phylogenetic perspective on the evolutionary history of Alosa spp. (Clupeidae) . Molecular Phylogenetics and
Evolution , 40, 298-304.
Gonzalez-Tizon, A. M., Fernandez-Moreno, M., & Vasconcelos, P. (2008). Genetic diversity in fishery-exploited populations of the banded murex (Hexaplex trunculus)
from the southern Iberian Peninsula. Journal of experimental Marine Biology , 363, 35-41.
Hambali, M. T., Shabdin, M., Yuzine, E., Ahmad Sallehin, A. A., & Khairul Adha, A. (2011). Current status of Terubok Sarawak (Tenualosa toli) in the south-west coast of
Sarawak, Malaysia. UMTAS .
Haslawati, B., Rizman-Idid, Muniandy and Zakaria-Ismail. (2011). MtDNA variation in Peninsular Malaysian Pangasiid catfish: application of DNA barcoding in fisheries
management. Fourth International Barcode of Life Conference Adelaide, Australia.
Hauser, L., Adcock, G. J., Smith, P. J., Ramirez, J. H., & Carvalho, G. R. (2002). Loss of microsatellite diversity and low effective population size in an overexploited
population of New Zealand snapper (Pagrus auratus) . Proceedings of the National Academy of Sciences , 99 (18), 11742-11747.
Heyden, S., Lipinski, M.R. and Matthee, C.A. (2010). Remarkably low mtDNA control region diversity in an abundant demersal fish. Molecular Phylogenetics and
Evolution: 1183–1188.
Jamsari Amirul, F.J., Pau, T.M. and Siti-Azizah, M.N. (2011). Genetic structure of the snakehead murrel, Channa striata (channidae) based on the cytochrome c oxidase
subunit I gene: Influence of historical and geomorphological factors. Genetics and Molecular Biology: 152-160.
Lakra WS, Goswami M, Gopalakrishnan A. (2009). Molecular identification and phylogenetic relationships of seven Indian Sciaenids (Pisces: Perciformes, Sciaenidae)
based on 16S rRNA and cytochrome c oxidase subunit I mitochondrial genes. Molecular Biology Rep 36:831–839.
Luhariya, R. K., Lal, K. K., Singh, R. K., Mohindra, V., Punia, P., Chauhan, U. K., et al. (2012). Genetic divergence in wild population of Labeo rohita (Hamilton, 1822)
from nine Indian rivers, analyzed through MtDNA cytochrome b region . Molecular Biology Report , 39, 3659-3665.
Maggio, T., Andaloro, F., Hemida, F., and Arculeo, M. (2005). A molecular analysis of some Eastern Atlantic grouper from the Epinephelus and Mycteroperca genus.
Journal Experimental Marine Biology Ecology, 321: 83-92.
Nazia, A. K., Suzana, M., Azhar, H., Nguyen Thay, T. T., & Siti Azizah, M. N. (2010). No genetic Differentiation Between Geographically Isolated Populations of Clarias
macrocephalus (Gu Ɛnther) in Malaysia revealed by Sequences of mtDNA Cytochrome b and D-loop Gene Regions . Journal of Applied Ichtyology, 26:568570.
Nguyen Thuy, T. T., Ingram, B., Sungan, S., Gooley, G., Sim, S. Y., Tinggi, D., et al. (2006). Mitochondrial DNA diversity of broodstock of two indigenous mahseer
species, Tor tambroides and Tor douronensis (Cyprinidae) cultured in Sarawak, Malaysia . Aquaculture , 253 (1-4), 259-269.
Norfatimah, M. Y., Siti Azizah , M. N., Othman, A., Patimah, I., & Jamsari, A. J. (2009). Genetic Variation of Lates calcarifer in Peninsular Malaysia Based on the
Cytochrome b Gene . Aquaculture Research , 40, 1742-1749.
O'Leary, S. J., Hice, L. A., Feldheim, K. A., Frisk, M. G., McElroy, A. E., Fast, M. D., et al. (2013). Severe Inbreeding and Small Effective Number of Breeders in a
Formerly Abundant Marine Fish . PLOS ONE , 8 (6), e66126.
Okumus, I. and Ciftci, Y. (2003). Fish Population Genetics and Molecular Markers: II- Molecular Markers and Their Applications in Fisheries and Aquaculture. Turkish
Journal of Fisheries and Aquatic Sciences 3: 51-79.
Phillip, W. P. H. (2006). Working paper on the efforts in conservation & management of Terubok (Tenualosa toli) fishery in Sarawak, Malaysia. Seminar on terubok
Conservation .
Tamura, K., Peterson, D., Peterson, N., Nei, M., & Kumar, S. (2011). MEGA 5: Molecular Evolutionary Genetics Analysis. Molecular Biology Evolution, 10, 2731-2739.
Turan, C., Oral, M., Ozturk, B., & Duzgunes, E. (2006). Morphometric and meristic variation between stocks of Bluefish (Pomatomus saltatrix) in the Black, Marmara,
Aegean and northeastern Mediterranean Seas . Fisheries Research , 139-147.
Wong, S. (2004, January 8). Bringing back the Terubok. THE SUN, Environment . Retrieved from http://www.undp.org.my/uploads/archives/jan0804.pdf [Accessed on
9th October 2012].
Whitehead, P. (1985). Clupeoid fishes of the world (suborder Clupeoidei): an annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads,
anchovies, and wolfherrings . FAO Species Catalogue , 7, 222.
Xiao, M. S., Xia, H. W. and Ma, Y. H. (2012). Genetic variation of the Chinese longsnout catfish, Leiocassis longirostris in the Yangtze River revealed using mitochondrial
DNA cytochrome b sequences. Acta Ecologica Sinica 32: 305– 313.
Zardoya, R., Castilho, R., Grande, C.,Favre-Krey, L., Caetano, S., Marcato, S., Krey, S. and Patarnello. T. (2004). Differential population structuring of two closely related
fish species, the mackerel (Scomber scombrus) and the chubmackerel (Scomber japonicus), in the Mediterranean Sea. Molecular Ecology 13: 1785-1798.
220 | MGC10
ID 068
068
Transcriptomics Application for the Understanding of the BPH Resistance in Rice
A.G.M Bahagia1,2, A. B. Norliza1, J. Pritchard2, and B. V. FordFord- Lloyd2
Malaysian Agricultural Research and Development Institute (MARDI)
Rice and Industrial Crop Research Centre, Seberang Perai Research Station, 13200 Kepala Batas, Pulau Pinang
School of Biosciences, University of Birmingham, Edgbaston, Birmingham, B15 2TT, U.K
Email: [email protected]
ABSTRACT:
Recent developments in rice genomics has greatly facilitated new technologies to be used to decipher the complex process of resistance mechanism against rice brown
planthopper (BPH), Nilaparvata lugen before any efficient strategies to control the dangerous pest were to be implemented. In this study, microarray analysis (44K genes
Agilent chip) was conducted on 12 rice varieties with different background of BPH resistance to identify candidate genes that plays the role in BPH resistance. The
results revealed differences in gene expression between the resistant and susceptible varieties which coincide with Electrical Penetration Graph (EPG) and honeydew
clock experiments carried out previously. A total of 21556 probes successfully passed the filter of the statistical analysis using quantile method. A number of 239
probes were significantly identified to be different in the analysis between the resistant versus susceptible varieties. The expression of eighty nine genes were upregulated while hundred fifty genes were down regulated. GO (gene ontology) analysis based on biological process indicated that the genes were classified into 11
categories such as response to stress (44 genes), response to external stimulus (27 genes), transportation (18 genes), cellular process (16 genes), metabolic process
(13 genes and cell differentiation (7 genes). Some of the genes identified, correlated highly with the phenotype data. Among them are hexose transporter (R=0.71), zinc
transporter (ZIP1) (R=0.8) and UDP-glucosyltransferase (R=-59) gene which are highly correlated with the type 4 EPG waveform. Here we present the microarray
analysis on the 12 rice varieties and the potential candidate genes that may play a role in BPH resistance to be further analysed and validated in the future. This project
applied advance tools to understand Bph resistance in rice. By studying the fundamentals, this works aim to decipher the complex mechanism of BPH resistance in rice.
An improvement of rice plant breeding program for tolerance/resistance rice against BPH is envisaged.
Introduction
A transcriptome is the complete set of transcripts representing all messenger RNA molecules in the cell (Wang et al., 2008). Transcriptomics is a systematic and
comprehensive study of all the RNA transcripts of a cell, tissue or organism under defined conditions and generally involves gene expression analysis (Thompsom and
Gogging, 2006). The evaluation is based on mRNA expression patterns which are highly influenced by the environmental conditions surrounding the genes (Lockhart and
Winzeler, 2000), which include location, development stage and temperature of the cell. Transcriptomics is associated with gene function and can be measured through
the analysis of the gene expression. A higher gene expression will indicate that the gene is active (up regulated) and highly significant for certain traits.. Many genes have
contributed their part in activating other genes in certain biological functions such as genes associated with defence signalling pathway. Therefore,understanding the
whole biological mechanism for certain process would be challenging without a special tool like the microarray technique. The ability of microarrays to analyze
thousands of genes in parallel has made it a vital tool in transcriptomics studies. Presently, this technology is being used to examine a wide range of biological issues for
plants, animals and humans (Allemeersch, 2006). Although microarray technology possessed great potential for plant biotechnology research, their applications are still
underutilised. So far, there is no report that this technology is being applied comprehensively in any plant breeding program in Malaysia.
The evaluation of plant performance for the selection of desirable traits is a basic step in plant breeding. Previously, this process were carried out based only on
morphological characters such as high yield, good cosmetics, shape or resistance to stress. However, MAS has been proved to be more efficient, effective and reliable
than phenotypic selection. The markers could have links with specific traits of the plant, and they allow plant breeders to identify their character of interest and make
their selection and it can also help to monitor the transfer of desirable genes from one plant to another such as from parents to their progeny. Transcriptomics technology
not only reveals the differential expressions between plant varieties but can also give insights into what is happening at the cellular level such as at different
developmental stages, tissues locations or non-stressful conditions. Linking transcriptomics technologies and MAS is a fruitful strategy for future rice plant breeding in
MARDI. As a breeder, the main objective is not only to identify useful candidate genes, but at the same time to also understand the real mechanism behind the scenes.
In this study, we use rice resistant variety against brown plant hopper (BPH) as a study case. The aim is to enhance our molecular genetics knowledge of resistance
mechanisms for the development of novel strategies to overcome BPH attack. As the data obtained can be used as potential biomarker for MAS or MAB for BPH
resistance, this in return will facilitate the breeding process and furthermore integrated to reduce the time and resources for the development of new variety.
Materials and Methods
The rice plant
The plants rice varieties were divided into three groups namely susceptible, moderately resistant and resistant based on previous study (Ghaffar et al. 2011). Two
biological replicates were used for each variety giving eight replicates for each of resistant, moderately resistant and susceptible. The plants were then grown in mesh
cages to maintain humidity (60 x 60 x 60 cm) at 23-260C and 16L: 8D photoperiod. The plants were maintained until they were 42 days old.
221 | MGC10
Sample preparation and RNA isolation
Stem tissue samples were collected at 42 days. In order to homogenize the sample, five stems sample from five rice plants were pooled and represented one treatment
and one replicate. The pooled stem tissues were snap frozen in liquid nitrogen and then kept at -80 0C. RNA extractions were conducted using RNeasy Mini kit
(Qiagen) according to the manufacturer’s instructions. RNA quality and concentration were determined using Agilent BioAnalyzer 2100 and NanoDrop 1000
(Thermoscientific) and the RNA was stored at -70 0 C until further use.
Microarray and data analysis
Agilent rice 4x44 K DNA oligo gene chips (Agilent, technology) with single colour were used to study the gene expression levels. All microarray analysis such as
labelling, hybridization, washing and scanning were performed according to the manufacturer’s instructions (Agilent Manual part No. G4140-90040, edition version 5.7,
March 2008) and were carried out at Functional Genomic laboratory, University Of Birmingham, United Kingdom. GenePix 4.0 software was used for image analysis and
data extraction base on signal intensity.
Data from the scanner software were further analyzed using GeneSpring GX10.0 (Agilent) including fold change, t-test significant level, one-way ANOVA and principle
component Analysis. Then, Ontology analysis was performed based on biological process using TIGR (The Institute for Genomic Research) id. Finally, differences in
expression of candidate genes between varieties were correlated with feeding behaviour of BPH determined by EPG (Electrical Penetration Graph) data from a previous
experiment (Ghaffar et al. 2011)
Results and discussions
In disease and insect studies, the related resistance genes usually showed high expression patterns in resistant varieties. In contrast, susceptible varieties behave in a
different way, with low expression levels of the related resistance genes. The evidence of this phenomenon has been shown in our study using resistance, moderate
resistance and susceptible rice plant varieties. The microarray analysis results in figure 1showed that 239 genes out of 41,000 genes (Rice Agilent gene chips) have
significant different expression level between the resistance and susceptible groups. Another 219 genes were found to have a significantly different expression level
between the moderate resistance and susceptible groups. There was no significance differences found when the resistance and moderate resistance groups were
compared. Interestingly, these results correlates with the results obtained from the EPG experiment (Ghaffar et al. 2011.) which provided full evidence of the reliability of
the morphological and molecular data. These data also support the previous claim that moderate and resistance varieties could have a close genetic relationship due to
the long history of the breeding process as in MR219 and MR232 (Habibudin 2009, pers. comm). From the bioinformatics analysis, several genes were found to be
grouped in the biotic stress gene functions groups which is of highly significance with the anticipated genes involved in BPH resistance. This includes protein kinase,
nutrient transporter and peroxidase genes.
Interestingly, 7 genes were found matched within the known bph markers regions and 3 genes belong to Rathu Heenathi , which indicates that genes from Rathu
Heenathi are likely to contribute significantly to the differentiation between the resistance and susceptible groups. It is clear evidence that Rathu Heenathi is a good
parent due to the heritable resistance character in its progeny, F1. This variety has been used extensively in rice breeding programmes in Asia (Lakshminarayana and
Khush, 1977).
The results presented here have also the ability to facilitate the prioritization of strong candidate genes for BPH resistance breeding . Three genes coding for hexose
transporter (Os10g0539900), metallothionein-like protein (Os12g0571100) and zinc finger (Os12g0631200) have been classified as the strongest potential candidate
genes based on their close association with known BPH gene markers and BPH feeding ability. Further analysis which similarly have been carried out for Bph14 genes
are strongly suggested. With further validation, these sets of genes represent potential genes that can be utilised during marker assisted breeding for BPH resistance in
rice.
Conclusion
This study proved the usefulness of transcriptomics approaches for the identification of BPH resistance genes candidate, even where there is no BPH interference in the
plant. We also highlighted potential genes that could be used in MAS. This provides advantage for an early selection process in a plant breeding program. Molecular
mechanism of a plant defence system in rice was also elucidated abide further validation and clarification using functional genomics study. The results clearly clarify the
important role of resistance genes for protection against BPH attack. This will paved the way for better understanding in BPH resistance and MAS utilisation for smart
BPH resistance breeding strategy in rice.
Acknowledgements
Special thank Professor J S Bale, Dr Habibudin Hashim and colleagues for their valuable comments and assistance in this work. We also thank laboratory staff, Miss Fay
and Miss Liane for their technical support.
222 | MGC10
References
Allemeersch, (2006). Statistical analysis of microarray data: applications in platform comparison, compendium data, and array CGH. Ph.D.Thesis. Electrical engineering,
Katholieke Universitiet, Leuven, Belgium
Ghaffar, M.B. A.B., Pritchard, K. and Ford-Lloyd, B. (2011). Brown planthopper (N. lugens Stal) feeding behaviour on rice germplasm as an indicator of resistance. PLoS
One 6(7): e22137
Lakshminarayana and Khush, (1977). Lakshminarayana, A. and Khush, G.S. (1977) New genes for resistance to the brown planthoppers. Crop Science 17: 96-100
Lockhart and Winzeler, (2000). Genomics, gene expression and DNA arrays. Nature 405:827–836
Thompsom and Gogging, (2006). Transcriptomics and functional genomics of plant defence induction by phloem-feeding insects. Journal of Experimental Botany, vol. 57,
no. 4:755–766
Wang, H.Y., Yang, Y., Su, J.Y., Shen, J.L., Gao, C.F., et al. (2008). Assessment of the impact of insecticides on Anagrus nilaparvatae (Pang et Wang) (Hymenoptera :
Mymanidae), an egg parasitoid of the rice planthopper, Nilaparvata lugens (Hemiptera : Delphacidae). Crop Protection 27: 514-522
Picture 1: Box plot normalization data and principal component analysis on 22 samples. Principal component analysis (PCA) for susceptible (brown), moderate (red) and
resistance (blue)
223 | MGC10
Picture 2: Venn diagram shows the two groups in relation to the number of significant genes. Red represents resistant versus susceptible and blue represents
moderately resistant versus susceptible
224 | MGC10
ID 069
069
Genotyping for Fragrance in Sabah Rice Germplasm by Using Allele Specific Amplification (ASA) of the BADH2 Gene
Chee Fong Tyng1,2, Khairun Nisaa’ Bt Mohd Nor 2, Mariam Abdul Latip2,3& Vijay Kumar 1*
1
Biotechnology Research Institute,
2
School of Sustainable Agriculture,
3
Centre of Postgraduate Study, Universiti Malaysia Sabah
Email: [email protected]
ABSTRACT:
The occurrence of fragrance in rice has been associated with the accumulation of 2-acetyl-1-pyrroline (2AP). The presence of 2AP is widely accepted as a result of an 8
bp deletion and three SNPs in exon 7 of the BADH2 gene (encoding for betaine aldehyde dehydrogenase 2) located on chromosome 8 of the rice genome. The two types
of mutations caused a premature stop codon that disables the production of the BADH2 enzyme. In order to differentiate between fragrant and non-fragrant rice varieties,
a simple PCR based technique known as Allele Specific Amplification (ASA) was employed in this study. A sensory test was also used to verify the outcome of the ASA
genotypes. A total of 53 Sabah rice germplasm were used to ascertain its fragrance status. A Thailand rice variety, Thai Hom Mali, was used as a positive control for
fragrant rice, as well as another rice variety, IR36, was used as a negative control for non-fragrance. Four primers, namely, the External Sense Primer (ESP), Internal
Fragrant Antisense Primer (IFAP), Internal Non-fragrant Sense Primer (INSP) and External Antisense Primer (EAP) were used in the PCR reaction during ASA of the BADH2
gene. Out of 53 germplasm, 84.9% are homozygous dominant and are categorized as non-fragrance. Two germplasm (3.8%) are heterozygous butarein the categoryof
non-fragrance as well. Meanwhile, eight (11.3%) were found to be homozygous recessives and were categorized as fragrant. After the ASA and the sensory test were
compared, it was found that 56.5% of the genotyping results were not in concordance with the phenotypic results derived from the fragrance sensory evaluation. Further
investigationsare required to identify the reasons for this incongruence. Nevertheless, this study provides a quick and easy way to identify fragrant rice varieties which will
become a valuable resource in crop development programs.
Keywords
Traditional rice, fragrant, 2-acetyl-1-pyrroline (2AP), Betaine Aldehyde Dehydrogenase 2 (BADH2), Allelle Specific Amplification (ASA)
Introduction
It has been reported that more than 120 chemical compounds are responsible for the presence of aroma in rice, with the major contribution attributed to 2-acetyl-1pyrroline (2AP) (Varaporn Laksanalamai and Sarath Ilangantileke, 1993; Sugunya Mahatheeranont et al., 2001; Jezussek et al., 2002; Bradbury et al., 2005a).The
expression of 2AP is a result of the loss of function (mutation) of the betaine aldehyde dehydrogenase (BADH2) or OsBADH2 homolog (Bradbury et al., 2005; Niu et al.,
2008; Champagne, 2008; Shi et al., 2008). A deletion of an 8 bp region and 3 SNPs in exon 7 of the BADH2 gene,which is located at chromosome 8, causes a frame
shift mutation that generatesa premature stop codon (Bradbury et al., 2005a; b). While the wild type copy of the BADH2gene is supposed to produce gamma-amino
butyric acid (GABA), the loss of function due to the mutationsresults in the accumulation of 2AP, which is responsible for the uniquearoma of rice (Bradbury et al., 2005a,
b; Fitzgerald et al., 2010; Figure 1).
According to Bradbury et al. (2005a), the BADH2 gene has 15 exons and 14 introns with a total size of 6,153 bp (Figure 2). Sequence information of the gene is reported
in GenBank, with the accession number: AP004463 or AP005537 (Os2AP). Based on the nucleotide sequence, Bradbury et al. (2005b) developed an assay named
allele specific amplification (ASA), which they claim as a perfect marker for the detection of aroma in rice. The ASA assay checks for the presence of an 8 bp deletion
and 3 SNPs at exon 7 of the BADH2 gene.
225 | MGC10
Figure 1: Biochemical pathway leading to formation of 2AP (Fitzgerald et al., 2010)
Figure 2:BADH2gene (dark grey = exon; light grey = intron) at chromosome 8
The ASA assay consists of four primers within a single PCR reaction. These four primers are designated as External Sense Primer (ESP), Internal Fragrant Antisense
Primer (IFAP), Internal Non-fragrant Sense Primer (INSP), and External Antisense Primer (EAP).The external primersESP and EAP, generates a positive control PCR
fragment, with a size of either 577 or 585 bp (this is usually seen as an approximately 580 bp fragment after a 1.5% agarose gel electrophoresis).The INSP and EAP
primers will produce a 355 bp PCR fragment from non-aromatic rice samples. Meanwhile, the presence of a 257 bp product from the amplification using primers ESP
and IFAP indicate that the rice samples are aromatic (Figure 3). Heterozygous individuals will have three fragments i.e. 580, 355 and 257 bp.
Figure 3:
Figure illustrated the amplified region according to primers flanked as described by Bradbury et al. (2005b)
Currently, there is limited information of the aromatic status of traditional rice germplasm in Sabah. As such, this study was performed to rapidly screen Sabah’s
traditional rice germplasm for the presence of aroma by using the ASA assay developed by Bradbury et al. (2005b) as described above.
Materials
A total of 53Sabah traditional rice germplasm were collected from farmersin the districts of Tuaran and Kota Belud from 2009-2010. These samples were then used to
ascertain its status of fragrance by using the ASA assay. A Thailand Jasmine rice variety, Thai Hom Mali, was used as a positive control for fragrant rice, while IR36,
aninternational rice varietyfrom International Rice Research Institute (IRRI), was used as a negative control for non-fragrant rice.
226 | MGC10
Methods
The methodology is divided into two parts, firstly, thefragrance sensory evaluation and secondly, the ASA assay.Fragrance sensory evaluation was carried out as
suggested by Ahmadikhah et al. (2010).Three de-hulled rice grains were placed in a 1.5 ml tube containing 300 µl distilled water and incubated at 95 oC for 15 min.Next,
a panel of four individuals were asked to sniff the rice vapour and score the fragrance. The scale of the score is defined as: 0 for the absence of fragrance; 1 for
moderatelyfragrant; and 2 for strong fragrance.
DNA was isolated from rice grain using the recommended method by Zheng et al. (1995) with minor modified as suggested by Kang et al. (1998). Polymerase chain
reaction (PCR)for the ASA assay was performed in a total volume reaction of 25 µl containing 1xPCR buffer (Promega), 1.25 mM MgCl2(Promega), 0.16 mM dNTPs
(Promega), 10 pmol INSP, 10 pmol IFAP, 15 pmol ESP, 15 pmol EAP, 1 U Go Taq ® Flexi DNA Polymerase (Promega) and 50 ng/µl genomic DNA.
Cycling condition follows Bradbury et al. (2005) with slight modification as follows: predenaturation at 94oC for 2 min followed by 35 cycles at 94oC for 60 sec, 54oC for
90 sec,72oC for 55 sec,before concluding with a final extension of 72 oCfor 5 min in a Bio-Rad DNA Engine Peltier Thermal Cycler. The PCR products were then
electrophoresed using a 1.5% agarose gel.The presence of bands at 580 and 257 bp; 580 and 355; and 580, 355 and 257 bp was scored as aa, AA and Aa,
respectively.
Results and Discussion
Sensory evaluation revealed that of the 53 samples, 34% was classified as fragrant, while 20.8% were highly fragrant. Approximately, 32.1% were found to be nonfragrant. Meanwhile, 13.2% were inconclusive as panel members gave different scores for the fragrance.On other hand, PCR results (Figure 4) revealed that the
samples were divided to, 84.9%,3.8% and 11.3%for each of the genotypes i.e. AA, Aa, and aa, respectively. The result indicated most of the samples studied were not
aromatic. This result is not in concordance with the sensory evaluation test.
Figure 4. Agarose gel electrophoresis of the ASA assay indicates the genotypes of the various Sabah rice germplasm. Lane M: 100 bp DNA ladder. Lane 1: Angit; Lane
2: Julia; Lane 3: Tomilin; Lane 4: Pandasan; Lane 5: Tolungan; Lane 6: Landus; Lane 7: Tombusul; Lane 8: Kesising; Lane 9: Silia; Lane 10: Rungus; Lane 11: Posising
Kuning; Lane 12: Tombusul; Lane 13: Talawa; Lane 14: Penampang; Lane 15: Sipitang (Pulut); Lane 16: Duit; Lane 17: Kalawat; Lane 18: Ambang; Lane 19: Kuning;
Lane 20: Tahunan; Lane 21: Pulut; Lane 22: Sarawak; Lane 23: Sarawak; Lane 24: Kalawat; Lane 25: Pandasan; Lane 26: Keningau. Lanes 13 and 19 show a banding
profile of the ‘aa’ genotype; Lanes 21-23: genotypes belonging to ‘Aa’; while, the rest are ‘AA’ genotypes.
The data was re-analysedagain through: 1) inconclusive result of sensory evaluation was excluded; 2) highly fragrant sensory score was re-labelled as fragrant sensory;
and 3) genotypes Aa and AA were grouped together. The sensory test and the ASA assay are in agreement that 6.5% of the germplasm were aromatic (Table 1). The
rice germplasm that fall in this group are Tarab Arab, Keningau and a previously uncharacterised sample.
227 | MGC10
Table 1: Result showed fragrant sensory evaluation and genotyping of Sabah rice germplasm
Genotype
aa
AA and Aa
Total
Sensory
non-fragrant
6.5%
30.4%
37%
fragrant
6.5%
56.5%
63%
Total
13%
87%
It may be possible that while the genotype is indicative of the presence of fragrance, the 2AP may not be sufficiently present to elicit an aroma from the panel members.
Perhaps environmental factors such as weather, fertility of soil, soil moisture, temperatures, storage condition and agingmay determine the strength and duration of the
rice aroma (Rohilla et al., 2000; Jezussek et al. 2002; Itani, et al., 2004; Wongpornchai et al., 2004).
Aninteresting finding of this study is that 56.5% of the samples that was classified as ‘non-fragrant’ by the ASA assay were actually classified as ‘fragrant’ bymembers
of the panel. It is believed that there are two reasonsfor the finding. Firstly, the fragrance is not due to the presence of 2AP (Jezusseket al., 2002;Fitzgerald et al., 2008;
Shu et al., 2008; Yang et al., 2008; Kottearachchi et al., 2010).Secondly, the ASA marker is not able to detect other mutations in BADH2 gene (Aramawathi et al., 2008;
Bourgis et al., 2008; Fitzgerald et al., 2008; Shi et al., 2008; Srivong et al., 2008; Saha et al., 2010; Vanavichit and Yoshihashi, 2010; Myint et al., 2012). As such,
there is a need to further verify the results of the sensory test with a more objective assay with the use of a GS-MS. The identification of aromatic rice germplasm will be
useful in the development of rice breeding programs.
Acknowledgement
The authors would like to thank Ms. Mary M. Siambun for her kind assistance in the sample collection. The work was partially funded by the Malaysian AgroBiotechnology Institute (ABI), Malaysia through the grant number GL0084.
References
Ahmadikhah, A., Arkhy, A. and Ghafari, H. 2010. Development of an allele specific amplification (ASA) co-dominant marker for fragrance genotyping of rice cultivars.
Archives of Applied Science Research 2:204-211
Amarawathi, Y., Singh, R.,Singh, A.K., Singh, V.P., Mohapatra, T., Sharma, T.R. andSingh, N.K. 2008. Mapping of quantitative trait loci for basmati quality traits in rice
(Oryza sativa L.). Molecular Breeding 21:49-65
Bradbury, L.M.T., Fitzgerald, T.L., Henry, R.J., Jin, Q.S. and Waters, D.L.E. 2005a. The gene for fragrance in rice. Plant Biotechnology Journal 3:363–370
Bradbury, L.M.T., Henry, R.J., Jin, Q., Reunke, R.F. and Waters, D.L.E. 2005b. A perfect marker for fragrance genotyping in rice. Molecular Breeding 16:279–283
Champagne, E.T. 2008. Rice Aroma and Flavor: A Literature Review.Cereal Chemistry 85:445–454
Fitzgerald, M.A., Hamilton, R.N.S., Calingacion, M.N., Verhoeven, H.A. and Butardo, V.M. 2008. Is there a second fragrance gene in rice? Plant Biotechnology Journal
6:416-423
Fitzgerald, T.L., Waters, T.L.E., Brooks, L.O. and Henry, R.J. 2010. Fragrance in rice (Oryza sativa) is associated with reduced yield under salt treatment.
Environmental and Experimental Botany 68:292–300
Itani, T., Tamaki, M., Hayata, Y., Fushimi, T. and Hashizume, K. 2004. Variation of 2-acetyl-1-pyrroline concentration in aromatic rice grains collected in the same
region in Japan and factors affecting its concentration. Plant Production Science 7:178-183
Jezussek, M., Juliano, B.O. and Schieberle, P. 2002. Comparison of Key Aroma Compounds in Cooked Brown Rice Varieties Based on Aroma Extract Dilution Analyses.
Journal of Agricultural and Food Chemistry50:1101–1105
Kang, H.W., Cho, Y.G., Yoon, U.H. and Eun, N.Y. 1998. A Rapid DNA Extraction Method for RFLP and PCR Analysis from a Single Dry Seed. Plant Molecular Biology
Reporter 16:1-9
Kottearachchi, N.S., Priyangani, E.G.D. and Attanayaka, D.P.S.T.G. 2010. Identification of fragrant gene, fgr, in traditional rice varieties of Sri Lanka. Journal of the
National Science Foundation of Sri Lanka38:139-143
Lanka
Myint, K.M., Arikit, S., Wanchana, S., Yoshihashi, T., Choowongkomon, K. and Vanavichit, A. 2008. A PCR-based marker for a locus conferring the aroma in Myanmar
rice (Oryza sativa L.). Theoretical and Applied Genetics 125:887–896
Niu, X., Tang, W., Huang, W., Ren, G., Wang, Q., Luo, D., Xiao, Y., Yang, S., Wang, F., Lu, B-R., Gao, F., Lu, T. and Liu, Y. 2008. RNAi-directed downregulation of
OsBADH2 results in aroma (2-acetyl-1-pyrroline) production in rice (Oryza sativa L.). BMC Plant Biology 8:100-109
Saha, P.S., Nandagopal, K., Ghosh, B. and Jha, S. 2012. Molecular characterization of aromatic Oryza sativa L. cultivars from West Bengal, India. Nucleus 55:83–88
Shi, W., Yang, Y., Chen, S. and Xu, M. 2008. Discovery of a new fragrance allele and the development of functional markers for the breeding of fragrant rice varieties.
Molecular Breeding 22:185–192
Shu, X.S., Fang, Y.G., Xian, J.L., Xian, J.W., Xu, D.W., Guang, J.R. and Hong, L. 2008. Genetic Analysis and Gene Fine Mapping of Aroma in Rice (Oryza sativa L.
Cyperales, Poaceae). Genetics and Molecular Biology 31:532-538
228 | MGC10
Srivong, P., Wangsomnuk, P., Pongdontri, P., 2008. Characterization of a Fragrant Gene and Enzymatic Activity of Betaine Aldehyde Dehydrogenase in Aromatic and
Nonaromatic Thai Rice Cultivars. Khon Kaen University (KKU) Science Journal 36:290-301
Sugunya Mahatheeranont, Sukanya Keawsa-ard, and Kanchana Dumri. 2001. Quantification of the Rice Aroma Compound, 2-Acetyl-1-pyrroline, in Uncooked Khao
Dawk Mali 105 Brown Rice. Agricultural and Food Chemistry49:773–779
Vanavichit, A. and Yoshihashi, T. 2010. Molecular Aspects of Fragrance and Aroma in Rice. Series Editors: Kader, J-C and Delseny, M. Advances in Botanical Research
56:49-73
Varaporn Laksanalamai and Sarath Ilangantileke. 1993. Comparison of Aroma Compound (2-Acetyl-Pyrroline) in leaves from Pandan (Pandanus amaryllifolius) and Thai
Fragrant Rice (Khai Dawk Mali 105). Cereal Chemistry Journal 70:381-384
Wongpornchai, S., Dumri, K., Jongkaewwattana, S., and Siri, B. 2004. Effects of drying methods and storage time on the aroma and milling quality of rice (Oryza sativa
L.) cv. Khao Dawk Mali 105. Food Chemistry 87:407–414
Yang, D.S., Lee, K.-S. Jeong,O.-Y., Kim, K.J. and Kays, S.J. 2008. Characterization of Volatile Aroma Compounds in Cooked Black Rice. Journal of Agricultural and
Food Chemistry56:235–240
Zheng K., Huang, N., Bennett J. and Khush, G. S. 1995. PCR-based Marker Assisted Selection in Rice Breeding. IRRI Discussion Paper Series No. 12. International
Rice Research Institute, Manila, the Philippines.
229 | MGC10
ID 080
080
Genetic Relationships of Malaysian Rice Landraces Based on Morphological Characteristics
Site Noorzuraini binti Abd Rahman1, Mohd Shukri Mat Ali2, Ismail Muhamod Nor 1, and Fauziah binti Shafie1.
1
Strategic Resource Research Center. MARDI SeberangPerai
2
Strategic Resource Research Center, MARDI Headquarters
Email: [email protected], [email protected], [email protected]
ABSTRACT:
In Malaysia, the first modern rice variety was released in year 1964 and officially known as Malinja. The variety was produced through hybridization between local rice
landrace, Padi Siam and Japonica rice variety, Pebifun. Until now, more than ten rice landraces were used in rice breeding activities such as Pandan Gelap, Engkatek,
Secupak, and Radin Goi. Due to the evolvement of breeding activities, conservation, and evaluation of local or traditional rice landraces are essential. Therefore, MARDI
Rice Genebank was established in 1989 to collect local rice genetic resources in the genus Oryza and conserve the germplasm collection ideally under secured storage
conditions. Currently, MARDI Rice Genebank has conserved a total of 8247 accessions of local rice landraces collected from entire Peninsular Malaysia, Sabah, and
Sarawak. Expeditions to collect all rice landraces in each planting areas, it was observed that some landraces are duplicated. A study was undertaken to evaluate the
genetic diversity of the landraces based on their morphological characteristics. Twelve rice landraces were selected namely Anak Didek, Anak Ikan, Anak Limbat, Anak
Naga, Anak Puteh, Anak Rambai, Mayang Segumpal, Mayang Puteh, MayangEbos, Radin Ebos, Radin Goi, and Seri Raja. The morphological characterization data was
extracted from Rice Information System (RGBIS). The characterization was carried out from the rice descriptor list developed by IBPGR-IRRI Rice Advisory Committee
(1980). Twenty two (22) morphological characters were selected for this study; consisted of 11 quantitative traits and 11 qualitative traits.
Coefficient of variation of the quantitative traits showed culm number was more variable followed by ligule length and leaf width. While, for qualitative traits, most of the
traits showed higher variability with the highest was stigma colour followed by culm strength and leaf angle. The correlation coefficients observed most of the traits have
significant and highly significant correlation among the traits. This study revealed that these morphological traits may useful to breeders for crop improvement as most of
the traits showed high variability. However, further study based on molecular analysis may be proposed for detecting the genetic diversity of these rice landraces
because selected markers can detect high degree of polymorphism in rice.
INTRODUCTION
INTRODUCTION
Malaysia is one of the mega-diversity countries of the world which contains about 7% of the world’s known species. It has a total land area of 32.86 million ha and its
harboursabout 12,500 species of flowering plants, and more than 1,100 species of ferns or fern allies (Malaysia’s National Policy on Biological Diversity, 1998).
Theseplant genetic resources are important for future use especially for food security (food sources in the future) and as biological control of pests and diseases.
About 1.8 million hectares of the major rice granaries in Malaysia(AQUASTAT, 2011) were cultivated with modern rice varieties with an annual production of 2.4 million
tons in 2008 (FAO, 2009). The rice breeding activities in Malaysia were started as early as 1915. The main objective was to select the superior landraces among the
local rice. The first modern rice variety was released in year 1964 and officially known as Malinja. The variety was produced from a hybridization between local landraces
namely Padi Siam, and Japonica rice variety namely Pebifun. Until 2013, there were 42 modern rice varieties with superior traits were successfully released. More than
10 local rice landraces were used in these rice breeding activities such as Pandan Gelap, Engkatek, Secupak, Radin Goi, etc. The landraces are not only important to
contribute in generating desired characteristics such as long panicle length, heavy grain weight, long and slender grain shape; but they are also important for
contributing special traits such as aromatic, red pericarp colour, brown pericarp colour, low amylose content (glutinous rice), etc.
Rice Genebankwas established in year 1989 for the function related to conservation of rice varieties available in the country. The facility was jointly financed by MARDI
and Bioversity International (formerly known as IPGRI). There are two main objectives in this genebank(1) to collect a full spectrum of the rice genetic resources in the
genus Oryza and (2) to conservethe rice germplasm ideally under secured storage conditions. Nowadays, MARDI Rice Genebank already conserved a total of 8247
accessions of Malaysian rice landraces collected from entire Peninsular Malaysia, Sabah, and Sarawak. These landraces consisted of rainfed lowland and rainfed upland
rice. Since the objective of the genebank is to collect as much as possible therice landraces in each village or planting area, however, we observed most of the rice
landracesare duplicated. However, MARDI Rice Genebank still conserved the landraces as individual accessions. The aim of this study was to study the genetic diversity
and relatedness of duplicated landraces based on their morphological characteristics. Twelve local rice landraces were selected for this study namely Anak Didek, Anak
Ikan, Anak Limbat, Anak Naga, Anak Puteh, Anak Rambai, Mayang Segumpal, Mayang Puteh, Mayang Ebos, Radin Ebos, Radin Goi, and Seri Raja.
230 | MGC10
MATERIALS AND METHODS
Malaysians Rice Landraces
A total of 165 rice varieties that representative of twelve rice landraces were selected for this study. The landraces were selected based on popularity which had been
purified and recommended for planting over the Peninsular Malaysia in year 1950s such as MayangSegumpal (1951), Anak Naga (1951), Seri Raja (1952).
Morphological Characterization of Selected Malaysian Rice Accessions
The morphological characterization data of twelve selected rice landraces were extracted from Rice Information System namely RGBIS. Planting season for this activity
was done during main-season i.e. October to March. A total of 120 rice plants were planted for each accession. 22 morphological characters were selected for this
study; consisted of 11 quantitative traits and 11 qualitative traits. The characterization was carried out following the rice descriptor list developed by IBPGR-IRRI Rice
Advisory Committee (1980). The quantitative traits were collected namely leaf length, leaf width, ligule length, culm length, panicle length, culm number, culm diameter,
grain length, grain width, grain weight, and maturity days. While, the qualitative traits were collected namely flag leaf angle, leaf angle, blade colour, culm angle,
internode colour, culm strength, panicle type, panicle exsertion, panicle axis, secondary branching, and stigma colour.
Analysis of the Morphological Data
The mean, standard deviation, and coefficient of variation were done using SAS 9.3. The clustering pattern for the morphological characters of all the rice landraces was
also generated using SAS 9.3.
RESULT AND DISCUSSION
Morphological Variation of Malaysian Rice Landraces
The study observed culm length showed the highest mean value followed with leaf length and panicle length. While, for qualitative traits, the means value were
calculated based on their scoring values. The highest mean value was flag leaf angle, followed with panicle exsertionand culm strength.
The coefficient of variation represents the ratio of the standard deviation of the mean. It is important for comparing the degree of variation from one data series to
another, even if the means are drastically different from each other. Coefficient of variation of the quantitative traits showed culm number was more variable followed by
ligule length and leaf width. While, for quantitative traits, most of the traits showed higher variability with the highest was stigma colour followed by culm strength and
leaf angle.These result revealed that the Malaysian rice landraces presented higher variation among the variable traits. Pandey et al. (2009) recorded highly significant
difference among 40 genotypes of rice with 12 quantitative traits. Sohrabi et al. (2012) observed highly significant and significant variation among 50 rice accessions
originated from Peninsular Malaysia and Sabah. Chandra et al. (2007) also measured highly significant variation at 0.01 revealed by 14 quantitative traits among 57
accessions of upland rice.
Correlation between traits is important for selecting desired characters by many breeders. Most of the traits especially yield and yield component traits are influenced by
interaction of genotype and environment, thus, selection based on correlation coefficient makes it easy for plant breeders (Ahmadikhah et al., 2008). This study observed
most of the traits have significant and highly significant correlation among the traits (Table 2). Significant and positive correlation was observed between leaf width with
leaf length and panicle length with culm strength. Meanwhile, culm angle and maturity dayshowed negative and significant correlation with grain weight. Most of the
traits showed positive and highly correlation among the traits such as panicle length with leaf length, leaf width, and culm length; culm strength with leaf angle, culm
angle, and culm diameter; maturity day with ligule length, culm length, and panicle length; grain length with ligule length and panicle length; and grain weight with grain
length and grain width.
Positive and high correlation between culm length and panicle length was also observed in other studies (Sohrabi et al., 2012). These traits are important especially for
the breeders for developing superior rice varieties which have an accurate plant height for produce maximum length of the panicle. Besides that, positive and highly
significant correlation between culm strength with culm diameter is important for developing rice variety which is tolerant to lodging. Lodging is one of the important
constraints to high yield and stable production in rice (Zhang et al., 2010). Previous study observed many factors affected lodging in rice such as plant height, length and
diameter of basal internodes, panicle types, etc (Zhang et al., 2010). Most traits under this study may be suitable for the breeders for developing superior rice variety i.e.
high yield and resistance to lodging.
231 | MGC10
Table 1. Mean, maximum and minimum value, standard deviation, and coefficient of variation of 22 morphological traits of Malaysian rice landraces
Variable Traits
N
Mean
Maximum
Minimum
StdDev
Std Error
Variance
Coeff of
Variation
LLT
165
59.46
79.8
35.8
6.89
0.54
47.52
11.59
LWD
165
13.19
33.2
6.6
2.24
0.17
5.02
16.98
LIGLT
165
23.98
35
13
4.31
0.34
18.57
17.97
CULT
165
128.50
155.6
51.2
11.79
0.92
138.96
9.17
PLT
165
29.52
37.2
20.4
2.86
0.22
8.20
9.70
CUNO
165
10.06
19.4
6.6
1.89
0.15
3.56
18.74
CUDI
165
4.09
6
2.2
0.61
0.05
0.38
15.01
GRLT
165
8.35
10.1
7
0.52
0.04
0.27
6.19
GRWD
165
2.53
2.8
1.9
0.13
0.01
0.02
5.10
GW
164
21.52
26
17.1
1.68
0.13
2.82
7.80
FLA
163
4.12
7
1
1.50
0.12
2.24
36.34
LA
165
1.91
5
1
0.98
0.08
0.96
51.35
BLCO
165
1.97
5
1
0.50
0.04
0.25
25.34
CUAN
162
2.04
7
1
1.03
0.08
1.06
50.40
INCO
164
1.15
2
1
0.35
0.03
0.13
30.93
CUST
163
2.18
9
1
1.43
0.11
2.04
65.52
PTY
162
1.69
5
1
0.77
0.06
0.59
45.31
PEX
164
2.30
4
1
0.89
0.07
0.79
38.60
PA
165
2.00
2
2
0.00
0.00
0.00
0.00
BR
165
1.92
2
1
0.28
0.02
0.08
14.59
STCO
163
1.95
5
1
1.70
0.13
2.90
87.27
MAT
165
161.67
182
142
10.36
0.81
107.26
6.41
LLT=leaf length, LWD=leaf width, LIGLT=ligule length, CULT=culm length, PLT=panicle length, CUNO=culm number, CUDI=culm diameter, GRLT=grain length,
GRWD=grain width, GW=grain weight, FLA=Flag leaf angle, LA=leaf angle, BLCO=blade leaf colour, CUAN=culm angle, INCO=internode colour, CUST=culm strength,
PTY=panicle type, PA=panicle axis, BR=secondary branching, STCO=stigma colour, and MAT=maturity day
232 | MGC10
Table 2.Pearson’s correlation coefficient among 22 morphological traits of Malaysian rice landraces
LLT
LLT
LWD
LIGLT
CULT
PLT
CUNO
CUDI
GRLT
GRWD
GW
FLA
LA
BLCO
CUAN
INCO
CUST
PTY
PEX
PA
BR
STCO
MAT
.
.
1.00
LWD
0.15*
1.00
LIGLT
0.51**
-0.19**
CULT
0.32**
0.24**
0.14
1.00
PLT
0.26**
0.21**
0.13
0.37**
CUNO
-0.06
-0.17
-0.08
-0.35**
-0.48**
1.00
CUDI
-0.09
0.05
0.12
0.28**
0.14
-0.27**
1.00
GRLT
0.20**
-0.01
0.25**
0.03
0.23**
0.07
-0.01
GRWD
-0.05
0.07
-0.04
-0.03
-0.17
-0.04
0.09
0.01
1.00
GW
0.10
0.04
0.11
-0.06
0.05
0.05
0.00
0.56**
0.23**
FLA
0.05
0.12
-0.17
0.11
0.03
0.07
-0.09
0.16
0.20**
0.12
1.00
LA
-0.12
-0.04
-0.07
-0.06
-0.10
-0.02
0.31**
-0.05
0.11
0.05
-0.11
1.00
BLCO
-0.12
-0.09
-0.08
-0.25**
-0.37**
0.22**
-0.10
-0.20**
0.03
-0.03
-0.18
0.32**
CUAN
-0.11
-0.07
0.10
0.17
0.33**
-0.36**
0.25**
-0.08
-0.04
-0.16*
-0.01
0.01
-0.07
1.00
INCO
-0.09
-0.06
-0.03
-0.14
-0.11
-0.19
0.13
-0.45**
0.00
-0.25**
-0.28**
0.36**
0.23**
0.10
CUST
0.03
-0.04
0.07
0.19
0.16*
-0.22**
0.43**
-0.03
0.07
-0.05
-0.04
0.31**
-0.02
0.49**
0.32**
1.00
PTY
0.02
0.04
-0.07
-0.30**
-0.19
0.09
-0.11
-0.22**
0.03
-0.05
-0.19**
0.39**
0.38**
-0.17
0.49**
0.03
PEX
-0.05
0.00
0.18
-0.07
0.28**
-0.11
0.17
0.00
-0.04
-0.02
-0.19**
0.19**
0.01
0.35**
0.28**
0.32**
0.10
1.00
PA
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
BR
-0.09
0.03
-0.03
0.05
-0.02
0.13
-0.12
0.27**
-0.06
0.11
0.20**
-0.25**
-0.28**
-0.09
-0.55**
-0.12
-0.33**
-0.04
.
1.00
1.00
1.00
1.00
1.00
1.00
1.00
1.00
STCO
0.05
-0.32**
0.33**
0.16
-0.12
0.05
0.18
0.01
-0.10
-0.17
-0.12
-0.01
0.06
0.10
0.05
0.18
-0.14
-0.15
.
-0.03
1.00
MAT
-0.02
-0.17
0.30**
0.31**
0.26**
0.01
0.02
0.17
-0.08
-0.16*
-0.06
-0.42**
-0.19**
0.27**
-0.38**
-0.09
-0.44**
-0.03
.
0.16
0.42**
1.00
*Significantly at 0.05. **Significantly at 0.01. LLT=leaf length, LWD=leaf width, LIGLT=ligule length, CULT=culm length, PLT=panicle length, CUNO=culm number, CUDI=culm
diameter, GRLT=grain length, GRWD=grain width, GW=grain weight, FLA=Flag leaf angle, LA=leaf angle, BLCO=blade leaf colour, CUAN=culm angle, INCO=internode colour,
CUST=culm strength, PTY=panicle type, PA=panicle axis, BR=secondary branching, STCO=stigma colour, and MAT=maturity day
Cluster Analysis for 22 Morphological Traits of Malaysian Rice Landraces
A total of 165 rice accessions of Malaysian rice landraces were clustered into sixteen groups by 11 quantitative and 11 qualitative traits, respectively. Cluster I was the
biggest consisted of 47 rice accessions and cluster III was the smallest consisted of only one accessions. Cluster II, IV, and V consisted of 46, 32, and 25 accessions,
respectively.Sohrabi et al. (2012) clustered the upland rice germplasm into six groups. Ahmadikhah et al. (2008) clustered 58 rice varieties into four groups based on 18
morphological traits, and genetic distance was around 0.75. Meanwhile, Veasey et al. (2008) clustered 23 populations of rice into 10 groups based on 20 morphological
characters. Sohrabi et al (2012) stated that the genotypes which having distant clusters could be hybridized to get higher heterotic responses.
When the Malaysian rice accessions were clustered into small clusters i.e. cluster 1 to cluster 16. The result showed that the rice landraces were grouped according to
their varieties such as cluster 2 and cluster 6 mostly consisted of RadinEbos, cluster 8 mostly consisted of RadinGoi, cluster 9 mostly consisted of Anak Naga, cluster 13
mostly consisted of MayangSegumpal, and cluster 15 mostly consisted of Naka Raja.These revealed that morphological traits successful grouped the rice accessions
according to their variety.
233 | MGC10
Figure 1. The dendrogram of Malaysian rice accessions based on 22 morphological traits
20000
B
e
t
w
e
e
n 15000
C
l
u
s
t
e
r
10000
S
u
m
I
o
f
S 5000
q
u
a
r
e
s
I
1
2
II
3
4
5
6
IV
7
8
9
10
11
8
V
15
12
13
16
14
0
781119999888113355858445578111111511111134419135857791481888919888111111111111151178111111111141111111111111199911111119119911199999999999991111199999999111111111111
450122599788334523774350996333333533333382032378847823493123009787333333333333363450333433333311011333330001355960630223066956244552234433331126623444462666566666666
834594891268
545566 533335 849
34 4
038074466466634357 90 8990999997 2960374571564523624032623300590139018952116871550070805716011901202122
96
017650 927458 8 5
3 8
4934721636852 82 9723146091
60244
2 6 19
7 75
24
019662283019
accno
CONCLUSION
This study revealed that Malaysian rice landraces consisted of a wide spectrum of variation among the accessions. Several morphological traits showed significant and
highly significant correlations which were useful for developing superior rice varieties. The clustering pattern also showed the Malaysian rice accessions having a distant
cluster which showed that the accessions were useful for hybridization. Besides that, small clustering pattern showed that the morphological traits under this study may
cluster the accessions according to their variety group. However, further study based on molecular analysis may be proposed for detecting the genetic diversity of these
rice landraces because selected markers can detect high degree of polymorphism in rice.
REFERENCES
Ahmadikhah A, Nasrollanejad S, and Alishah O. (2008). Quantitative studies for investigating variation and its effect on heterosis of rice. International Journal of Plant
Production. 2(4): 297-308
AQUASTAT (2011).FAO’s global information system.Food and agriculture organization of the United Nations. Website updates: 09/05/2011. Accessed on 15/8/2013.
Chandra R, Pradhan S, Singh S, Bose L, and Singh O. (2007). Multivariate analysis in upland rice genotypes.World Journal of Agricultural Sciences. 3(3): 295-300
Food and Agriculture Organization (FAO) (2009). FAO rice market monitor. Trade and market division.Food and Agriculture Organization of the United States. 12(1): 1-38
IBPGR-IRRI Rice Advisory Committee.(1980). Descriptor for rice (Oryza sativa L.).International Rice Research Institute (IRRI) and International Board for Plant Genetic
Resources (IPBGR). Manila, Philippines. 1-21
Malaysia’s National Policy on Biological Diversity (1998). Ministry of Science, Environment, and Technology.Official declaration on April 16, 1988. Kuala Lumpur.
http://www.arbec.com.my/NBP.pdf. Date accessed 15/8/2013
Pandey P, John Anurag P, Tiwari D. K., Yadav S. K., and Kumar B. (2009). Genetic variability, diversity, and association of quantitative traits with grain yield in rice (Oryza
sativa L.). Journal of Bio-Science. 17 (1): 77-82
Sohrabi M, Rafii M. Y., Hanafi M. M., Siti NorAkmar A, and Latif M. A. (2012). Genetic diversity of upland rice germplasm in Malaysia based on quantitative traits. The
Scientific World Journal. 2012: 1-9
ZhangFeng-zhuan, JinZheng-xun, MaGuo-hui, Shang Wen-nan, LiuHai-ying, Xu Mei-lan, and Liu Yan. 2010. Dynamics changes of lodging resistance and chemical
component contents in culm and sheaths of Japonica rice during grain filling. Chinese Journal of Rice Science. 17(3): 264-270
234 | MGC10
ID 085
085
Restoration of SHPSHP-1 Expression by 55-Azacytidine Confer Sensitivity in ImatinibImatinib -Resistant BCRBCR-ABL Chronic Myeloid Leukaemia
MF Johan and HA AlAl- Jamal
Department of Haematology, School of Medical Sciences, Universiti Sains Malaysia
Email: [email protected]
ABSTRACT:
Imatinib mesylate, a tyrosine kinase inhibitor specifically targets BCR/ABL fusion protein and induces haematological remission in patients with chronic myeloid
leukaemia (CML). However, majority of CML patients treated with imatinib develop drug resistant under prolonged therapy. SHP1, a tyrosine phosphatase that negatively
regulates JAK/STAT signalling pathway, is frequently absent in CML due to gene methylation. 5-Azacytidine (5-Aza) is a demethylating agent that has shown activity
against myeloid leukaemias by reactivation of silenced tumour suppressor genes. The aim of this study is to investigate the potential mechanism of resistance to
BCR/ABL inhibitor (imatinib) in a BCR/ABL positive CML cell line, K562. We developed a resistant cell line by long-term co-culture of K562 cells with imatinib, designated
as K562R and treated the cells with 5-Aza (K562R+5Aza). TaqMan® Array Human JAK/STAT Pathway gene expression assays was performed for both K562R and
K562R+5Aza in ABI 7500 Fast Real-Time PCR System. Upregulated genes were analysed using pyrosequencing. Sensitivity towards imatinib was determined using MTS
assays and apoptosis analysis was performed using annexin V-FITC binding assays. IC50 of imatinib on K562R+5Aza was 300 nM compared to 4000 nM (K562R) (Z=2.323, P=0.02) that confirmed the sensitivity. Moreover, the apoptotic cells in K562R+5Aza were 59% compared to only 20% in K562R (P<0.001) at 300 nM. Gene
profiling reveals down-regulation of JAK/STAT negative regulators, SOCS1, SOCS2, SOCS3, SHP1 and PTPN11 in K562R cells. However, after treatment with 5-Aza,
only SHP1 gene was upregulated, by 6-folds. Pyrosequencing showed that restoration was due to demethylation of SHP1 gene. The results of this study suggested that
restoration of SHP1 expression in 5-Aza treated resistant CML cells induces sensitivity response to imatinib and increases the cell death. Our findings support SHP1 as a
negative regulator of JAK/STAT signalling pathway and may an play important role in the treatment of imatinib resistant BCR/ABL positive CML.
Introduction
Chronic myeloid leukemia (CML) is a clonal myeloproliferative hematopoietic stem cell disorder and characterized by excess proliferation of myeloid progenitor cells. It is
characterized by a cytogenetic aberration consisting of a reciprocal translocation between the long arms of chromosomes 22 and 9; t(9;22). The translocation results in
an observation termed the Philadelphia (Ph) chromosome and encoded a highly tyrosine kinase-activated chimeric oncoprotein named BCR/ABL. Deregulated tyrosine
kinase activity of BCR/ABL protein stimulates cell proliferation and inhibits apoptosis that is thought to be responsible for the changes in normal cellular functions such as
growth, differentiation, adhesion, and migration. Finally, malignant cell transformation is induced that is responsible for CML phenotype (Kantarjian et al, 2000;Melo et al,
2003).
Imatinib mesylate is a tyrosine kinase inhibitor that specifically targets BCR-ABL fusion protein and induces hematological remission in chronic myeloid leukaemia (CML)
patients (Melo &Barnes, 2007). Interestingly, majority of CML patients treated with imatinib would develop resistance under-prolonged therapy (Esposito et al, 2011). It
was shown that in CML patients with progressing disease, BCR/ABL mutations play a major role in imatinib resistant (Shah et al, 2002; Branford et al, 2003). Moreover,
expression profiling and in vitro studies predict the involvement of additional genes in imatinib resistance and disease progression (Radich et al, 2006). However, most of
those genes have not been thoroughly investigated or described in clinical specimens from CML patients.
One of the most important signaling cascades that regulate cell proliferation and apoptosis giving rise to the development of leukemia is the Janus kinase/signal
transducers and activators of transcription (JAK/STAT) signaling pathway (Vaidya et al, 2011). A variety of ligands including cytokines, hormones, growth factors, and
their receptors stimulate the JAK/STAT pathway. JAK/STAT signaling pathway is negatively regulated by suppressors of cytokine signalings (SOCS), tyrosine
phosphatases (SHP1) and protein inhibitors of activated STAT (PIAS) (Greenhalgh &Hilton, 2001; Yoshikawa et al, 2001; Wu et al, 2003; Qiu et al, 2012). SHP1 is a nontransmembrane protein tyrosine phosphatase expressed most abundantly in hematopoietic cells (Yi et al, 1992). It serves as an important negative regulator in cytokinemediated signal transduction, including that of the JAK/STAT signaling pathway (Klingmuller et al, 1995). Gene methylation and silencing of SHP1 are relatively common
in leukemia, and loss of SHP1 due to methylation has been hypothesized to deregulate various signaling pathways and promote leukemogenesis (Zhang et al, 2000; Oka
et al, 2001; Chim et al, 2004). Nevertheless, relatively few studies have been performed to directly test this hypothesis and delineate the mechanism by which loss of
SHP1 contributes to resistant to tyrosine kinase inhibitors.
In cancer cells, global hypomethylation is accompanied by hypermethylated and transcriptionally silenced tumor suppressor genes. This requires the continuous activity
of DNA methyltransferases (DNMTs) during cell division. Thus, inhibition of DNMTs has been successfully used in epigenetic cancer therapy to reverse aberrant
mutations and to reactivate epigenetically silenced tumor suppressor genes (Mund et al, 2005; Gore et al, 2006). The DNMT inhibitors 5-azacytidine (5-Aza), has the
ability to reversing the methylation of DNA and reactivation of silenced tumor suppressor genes (Taylor and Jones, 1982; Stresemann et al, 2008). It has been approved
for the treatment of myelodysplastic syndrome, a preleukaemic bone marrow disorder. Despite their use in the clinic and in numerous preclinical studies, the knowledge
of the mode of action of these drugs is still incomplete (Stresemann &Lyko, 2008).
235 | MGC10
To investigate the potential mechanisms of resistance to TKI, we developed a resistant cell line (designated as K562R) by long-term coculture of the human leukemia cell
line, K562 (CML, BCR/ABL positive), with imatinib mesylate. We also treated the cells with 5-Aza to globally demethylate the DNA. We used TaqMan® Array Human
JAK/STAT Pathway for gene expression analysis on Applied Biosystem 7500 Fast Real-Time PCR System. We aimed to investigate potential mechanism of resistance to
BCR/ABL inhibitors and restoration of negative regulators in resistant CML cells treated with demethylating agent induces the sensitivity towards imatinib.
Materials and Methods
Imatinib mesylate and 5-Azacytidine
Imatinib mesylate was purchased from LC Laboratories (Woburn, MA) and dissolved in dimethyl sulfoxide (DMSO) before use. 5-azacytidine (5-aza) was purchased from
Sigma-Aldrich (St Louis, MO) and dissolved in RPMI 1640.
Cell lines and development of resistant cell lines
Human K562 cells were cultured with RPMI 1640 (Life Technologies, Grand Island, NY) supplemented with 10% fetal bovine serum (FBS; Life Technologies, Grand
Island, NY) at a density of 2 to 10 X 105 cells/mL in a humid incubator with 5% CO2 at 37°C. Log phase growing K562 cells were cocultured with increasing
concentration of Imatinib for 3 months. The resistant lines were grown in normal medium without imatinib for at least 48 hours before experiments.
Cell Proliferation assay
Leukemic cells were seeded in 96-well culture plates at a density of 2 X 104 viable cells/100 μL/well in triplicates and were treated with Imatinib. Colorimetric CellTiter
96 AQueous One Solution Cell Proliferation assay (MTS assay; Promega, Madison, WI) was used to determine the cytotoxicity. IC50 values were determined by MTS
assay and determined using plotted graph. Each experiment was in triplicate.
Apoptosis Assay
Annexin V–FITC binding assay (BD Pharmingen, San Diego, CA) was used as recommended by the manufacturer and analyzed by flow cytometry. Each experiment was
in triplicate.
PCR Array
TaqMan® Array 96–Well Fast Plates for JAK/STAT signaling pathway gene expression (Applied Biosystem, Foster City, USA) was performed on Applied Biosystem 7500
Fast Real-Time PCR System according to the manufacturer’s protocol. Selected downregulated and upregulated genes were confirmed with RQ-PCR.
Statistical analysis
The nonparametric Mann–Whitney test (at P<0.05) was employed to determine the differences in the mean of IC50 values between the K562R+Imatinib, K562R and
parental cell lines. Repeated Measure ANOVA (at P< 0.05) was conducted to explore the statistical differences in the percentage of apoptotic cells between the
K562R+Imatinib, K562R and parental cell lines. All statistical analyses were performed using the SPSS software package (Version 20,SPSS, Chicago, USA).
Results
Long-term coculture of K562 cells with imatinib
The Human leukemia K562 cells with BCR/ABL were cocultured with gradually increasing concentration of Imatinib for 9 months, resulting in a resistant line, designated
as K562R.The MTS assay was used to determine the cytotoxic effects of Imatinib on K562R and the parental cell lines. The IC50 values of Imatinib on resistant lines was
approximately 10 times higher than parental K562 cells. Similarly, annexin V binding assay revealed that the resistant lines were also resistant to imatinib as compared
with the parent K562 cells.
Downregulation of SOCS1, SOCS2, SOCS3, SHP1 and PTPN11 expressions in K562R cells
To explore possible mechanisms of resistance, we used a real-time PCR-based approach to profile and compare the gene expression in K562R and parental cell lines.
The list of selected differentially expressed genes more than 2-fold among them was shown in Table 1. The negative regulator genes of JAK/STAT signalling pathway,
the SOCS1, SOCS2, SOCS3, SHP1 and PTPN11 were down-regulated approximately 2-fold and more.
236 | MGC10
Table 1
Downregulated genes in K562R
Gene Names
Fold Change
SOCS1
-2.7
SOCS2
-4.5
SOCS3
-2.83
SHP1
-2.5
Reverse sensitivity to imatinib in K562R+5-Aza cells
To investigate the mechanisms of drug resistance, K562R was treated with 5-Aza for 7 days. The MTS assay and Annexin V were used to determine the cytotoxic effects
and apoptosis of imatinib on K562R+5-Aza. The IC50 values of imatinib on K562R+5-Aza was approximately 10 times lower than untreated K562R cells [300 nM
compared to 4000 nM (Z=-2.323, P=0.02)] (Fig. 1). Moreover, the apoptotic cells in K562R+5-Aza were 59% compared to only 20% in K562R (P<0.001) at 300 nM
(Fig. 2).
Fig. 1. Cytotoxicity and IC50 of imatinib on K562+5-Aza (Left) and K562R (Right).
Fig. 2. Adjusted mean (estimated marginal) of apoptotic cells at different concentrations of imatinib (0, 100 and 200 nM) in K562R+5-Aza and untreated cells.
Overexpression Of SHP-1 in K562R+5-Aza cells
After treatment with 5-Aza, SHP1(6 folds) was the only overexpressed negative regulators of JAK/STAT pathway together with MAP2K6 (10 folds) and IL4R (>15 folds).
Thus, 5-Aza restored SHP1 expression by 6-folds in K562R treated with 5-Aza.
237 | MGC10
Discussion
Resistance to imatinib tyrosine kinase inhibitor remains the challenge in the treatment of CML patients. Gene expression profiling for imatinib resistant and sensitive cell
lines and patients have been studied by many researchers to identify the cause of resistance to imatinib using microarray assays (Villuendas et al, 2005; Binato et al,
2006;Melo &Chuah, 2007). However, the regulation due to demethylating by 5-Aza have only been reported by few studies.In the present study, the restoration of
sensitivity and SHP1 gene expression after treatment with 5-Aza were studied by development of resistant BCR/ABL K562R cells. TaqMan® Array 96-Well Fast Plates
for JAK/STAT signaling pathway reveals restoration of SHP1expression by 6-folds in imatinib resistant CML cells treated with 5-Aza compared to the untreated cells. The
results in this study are in keeping with those previously reported which stated that the mechanism of resistance to tyrosine kinase inhibitors in resistant cell lines was
due to down regulation of negative regulator genes of JAK/STAT pathway such as SOCS family and SHP1 and that the restoration of the gene expression achieved by
treatment of the resistant cells with 5-Aza (Han et al, 2006; Zhou et al, 2009). In addition, MTS and flow cytometry were used to determine the proliferation and
apoptosis of 5-Aza treated and untreated resistant cells after treatment with different concentration of imatinib. The MTS results showed more than ten folds higher in
the IC50 of imatinib on the resistant cells, K562R compared to parental K562 cells, thus restores the sensitivity to imatinib. Moreover, the percentage of apoptotic cells in
5-Aza treated K562R was 3X higher than in untreated. In addition, Luo et al, 2009 andMorgillo et al, 2011 findings were similar to ours. The results of this study
suggest that, the restoration of SHP1gene expression in 5-Aza treated resistant CML cells induces sensitivity response to imatinib and increases cell death.
Conclusion
Our findings support the function of SHP1 as a negative regulator of JAK/STAT signaling pathway and may play an important role in the treatment of imatinib resistant
BCR/ABL positive CML.
Acknowledgment
The work was funded by Short Term grant (304/PPSP/61312004) from Universiti Sains Malaysia. Thanks to staffs at Molecular Laboratory, Department of Haematology,
School of Medical Sciences, and Craniofacial Laboratory, School of Dental Sciences, Universiti Sains Malaysia for their supports.
References
Binato, R., A. Mencalha, L. Pizzatti, V. Scholl, I. Zalcberg, and E. Abdelhay. 2009. RUNX1T1 is overexpressed in imatinib mesylate-resistant cells. Mol Med Rep 2
(4):657-61.
Branford, S., Z. Rudzki, A. Harper, A. Grigg, K. Taylor, S. Durrant, C. Arthur, P. Browett, A. P. Schwarer, D. Ma, J. F. Seymour, K. Bradstock, D. Joske, K. Lynch, I.
Gathmann, and T. P. Hughes. 2003. Imatinib produces significantly superior molecular responses compared to interferon alfa plus cytarabine in patients with
newly diagnosed chronic myeloid leukemia in chronic phase. Leukemia 17 (12):2401-9.
Chim, C. S., A. S. Wong, and Y. L. Kwong. 2004. Epigenetic dysregulation of the Jak/STAT pathway by frequent aberrant methylation of SHP1 but not SOCS1 in acute
leukaemias. Ann Hematol 83 (8):527-32.
Esposito, N., I. Colavita, C. Quintarelli, A. R. Sica, A. L. Peluso, L. Luciano, M. Picardi, L. Del Vecchio, T. Buonomo, T. P. Hughes, D. White, J. P. Radich, D. Russo, S.
Branford, G. Saglio, J. V. Melo, R. Martinelli, M. Ruoppolo, T. Kalebic, G. Martinelli, and F. Pane. 2011. SHP-1 expression accounts for resistance to imatinib
treatment in Philadelphia chromosome-positive cells derived from patients with chronic myeloid leukemia. Blood 118 (13):3634-44.
Gore, S. D., S. Baylin, E. Sugar, H. Carraway, C. B. Miller, M. Carducci, M. Grever, O. Galm, T. Dauses, J. E. Karp, M. A. Rudek, M. Zhao, B. D. Smith, J. Manning, A.
Jiemjit, G. Dover, A. Mays, J. Zwiebel, A. Murgo, L. J. Weng, and J. G. Herman. 2006. Combined DNA methyltransferase and histone deacetylase inhibition
in the treatment of myeloid neoplasms. Cancer Res 66 (12):6361-9.
Greenhalgh, C. J., and D. J. Hilton. 2001. Negative regulation of cytokine signaling. J Leukoc Biol 70 (3):348-56.
Han, Y., H. M. Amin, C. Frantz, B. Franko, J. Lee, Q. Lin, and R. Lai. 2006. Restoration of shp1 expression by 5-AZA-2'-deoxycytidine is associated with downregulation
of JAK3/STAT3 signaling in ALK-positive anaplastic large cell lymphoma. Leukemia 20 (9):1602-9.
Kantarjian, H., J. V. Melo, S. Tura, S. Giralt, and M. Talpaz. 2000. Chronic Myelogenous Leukemia: Disease Biology and Current and Future Therapeutic Strategies.
Hematology Am Soc Hematol Educ Program:90-109.
Klingmuller, U., U. Lorenz, L. C. Cantley, B. G. Neel, and H. F. Lodish. 1995. Specific recruitment of SH-PTP1 to the erythropoietin receptor causes inactivation of JAK2
and termination of proliferative signals. Cell 80 (5):729-38.
Luo, J. M., Y. Li, L. Yang, X. J. Liu, S. P. Wen, F. X. Wang, J. Y. Zhang, X. J. Zhang, and Z. R. Dong. 2009. [Effect of a methylation inhibitor 5-aza-2'-deoxycytidine on
SHP-1 gene expression, proliferation and apoptosis in K562 cells]. Zhongguo Shi Yan Xue Ye Xue Za Zhi 17 (2):309-14.
Melo, J. V., and D. J. Barnes. 2007. Chronic myeloid leukaemia as a model of disease evolution in human cancer. Nat Rev Cancer 7 (6):441-53.
Melo, J. V., and C. Chuah. 2007. Resistance to imatinib mesylate in chronic myeloid leukaemia. Cancer Lett 249 (2):121-32.
Melo, J. V., T. P. Hughes, and J. F. Apperley. 2003. Chronic myeloid leukemia. Hematology Am Soc Hematol Educ Program:132-52.
Morgillo, F., E. Martinelli, T. Troiani, M. Orditura, F. De Vita, and F. Ciardiello. 2011. Antitumor activity of sorafenib in human cancer cell lines with acquired resistance to
EGFR and VEGFR tyrosine kinase inhibitors. PLoS One 6 (12):e28841.
Mund, C., B. Hackanson, C. Stresemann, M. Lubbert, and F. Lyko. 2005. Characterization of DNA demethylation effects induced by 5-Aza-2'-deoxycytidine in patients
with myelodysplastic syndrome. Cancer Res 65 (16):7086-90.
Oka, T., T. Yoshino, K. Hayashi, N. Ohara, T. Nakanishi, Y. Yamaai, A. Hiraki, C. A. Sogawa, E. Kondo, N. Teramoto, K. Takahashi, J. Tsuchiyama, and T. Akagi. 2001.
Reduction of hematopoietic cell-specific tyrosine phosphatase SHP-1 gene expression in natural killer cell lymphoma and various types of
238 | MGC10
lymphomas/leukemias : combination analysis with cDNA expression array and tissue microarray. Am J Pathol 159 (4):1495-505.
Qiu, X., G. Guo, K. Chen, M. Kashiwada, B. J. Druker, P. B. Rothman, and J. L. Chen. 2012. A requirement for SOCS-1 and SOCS-3 phosphorylation in Bcr-Abl-induced
tumorigenesis. Neoplasia 14 (6):547-58.
Radich, J. P., H. Dai, M. Mao, V. Oehler, J. Schelter, B. Druker, C. Sawyers, N. Shah, W. Stock, C. L. Willman, S. Friend, and P. S. Linsley. 2006. Gene expression
changes associated with progression and response in chronic myeloid leukemia. Proc Natl Acad Sci U S A 103 (8):2794-9.
Shah, N. P., J. M. Nicoll, B. Nagar, M. E. Gorre, R. L. Paquette, J. Kuriyan, and C. L. Sawyers. 2002. Multiple BCR-ABL kinase domain mutations confer polyclonal
resistance to the tyrosine kinase inhibitor imatinib (STI571) in chronic phase and blast crisis chronic myeloid leukemia. Cancer Cell 2 (2):117-25.
Stresemann, C., I. Bokelmann, U. Mahlknecht, and F. Lyko. 2008. Azacytidine causes complex DNA methylation responses in myeloid leukemia. Mol Cancer Ther 7
(9):2998-3005.
Stresemann, C., and F. Lyko. 2008. Modes of action of the DNA methyltransferase inhibitors azacytidine and decitabine. Int J Cancer 123 (1):8-13.
Taylor, S. M., and P. A. Jones. 1982. Mechanism of action of eukaryotic DNA methyltransferase. Use of 5-azacytosine-containing DNA. J Mol Biol 162 (3):679-92.
Vaidya, S., K. Ghosh, and B. R. Vundinti. 2011. Recent developments in drug resistance mechanism in chronic myeloid leukemia: a review. Eur J Haematol 87 (5):38193.
Villuendas, R., J. L. Steegmann, M. Pollan, L. Tracey, A. Granda, E. Fernandez-Ruiz, L. F. Casado, J. Martinez, P. Martinez, L. Lombardia, L. Villalon, and M. A. Piris.
2006. Identification of genes involved in imatinib resistance in CML: a gene-expression profiling approach. Leukemia 20 (6):1047-54.
Wu, C., M. Sun, L. Liu, and G. W. Zhou. 2003. The function of the protein tyrosine phosphatase SHP-1 in cancer. Gene 306:1-12.
Yi, T. L., J. L. Cleveland, and J. N. Ihle. 1992. Protein tyrosine phosphatase containing SH2 domains: characterization, preferential expression in hematopoietic cells, and
localization to human chromosome 12p12-p13. Mol Cell Biol 12 (2):836-46.
Yoshikawa, H., K. Matsubara, G. S. Qian, P. Jackson, J. D. Groopman, J. E. Manning, C. C. Harris, and J. G. Herman. 2001. SOCS-1, a negative regulator of the
JAK/STAT pathway, is silenced by methylation in human hepatocellular carcinoma and shows growth-suppression activity. Nat Genet 28 (1):29-35.
Zhang, Q., P. N. Raghunath, E. Vonderheid, N. Odum, and M. A. Wasik. 2000. Lack of phosphotyrosine phosphatase SHP-1 expression in malignant T-cell lymphoma
cells results from methylation of the SHP-1 promoter. Am J Pathol 157 (4):1137-46.
Zhou, J., C. Bi, J. V. Janakakumara, S. C. Liu, W. J. Chng, K. G. Tay, L. F. Poon, Z. Xie, S. Palaniyandi, H. Yu, K. B. Glaser, D. H. Albert, S. K. Davidsen, and C. S. Chen.
2009. Enhanced activation of STAT pathways and overexpression of survivin confer resistance to FLT3 inhibitors and could be therapeutic targets in AML.
Blood 113 (17):4052-62.
239 | MGC10
ID 086
086
Yield Performance of Selected Introduced Banana Cultivar in East Coast Peninsular Malaysia
Umikalsum Mohamed Bahari,
Bahari, Suhana Omar and Mohd Asrul Sani
Horticulture Research Center, MARDI HQ
Email: [email protected]
ABSTRACT:
Six introduced banana varieties supplied by the International Network for the Improvement of Banana and Plaintain (INIBAP) were evaluated for their yield performance
(bunch weight, number of hands, number of fruits, plant height and pseudostem girth) as well as 4 popular local varieties under commercial growing management in
MARDI Jerangau, Terengganu. There were evaluated in 2 categories which were cooking type (FHIA 21 and FHIA 25) and fresh consumption (BITA 3, GCTCV 106,
GCTCV 119 and GCTCV 247). Local check for cooking type was Pisang Tanduk while Pisang Berangan Intan and Pisang Montel were for fresh. The experiment was
conducted in Completely Randomised Design (CRD) with 4 replicates. Among the cooking bananas, FHIA 25 had the highest bunch weight of 25.3 kg which was highly
significantly different with the local variety, Pisang Tanduk (9.0 kg). For fresh, GCTCV 106 had a lower yield compared to the local variety Pisang Montel with 18.8 kg
and 22.6kg respectively. However, there was no significant difference between the two varieties. Cavendish cv. Williams and cv. Rose were planted as reference clone
for Fusarium wilt.
Introduction
Malaysia is the centre of origin and diversity of banana in the world. It is the second most widely cultivated fruit, covering about 29,132 ha with a total production of
306,283 metric tonnes (DOA, 2011) and remains the second most important fruit crops after durian. Banana cultivation is largely a smallholder enterprise where farms
are small, unorganized and farmers often adopt inferior technology. Apparently, this production practice often results in low yield and inferior quality that has been a
major constraint to export of fresh fruits. It is therefore necessary to adopt good production practices and inefficient postharvest handling to ensure consistent supply of
high quality banana to the industry. In order to address the various constrains on the production of banana, several R&D activities were conducted to help the industry
including collaborations with the INIBAP-BAPNET. Several varieties were introduced to evaluate and compare with local cultivar under local cultivar. Any economic
potential varieties will be compliment or replace current fresh and cooking varieties.
Materials and Methods
Experiments were carried out at MARDI Jerangau Station, Terengganu. The seven introduced hybrids and somaclones were used for evaluation and they were hyrids
FHIA 21(AAAB), FHIA 25 (AAAB), BITA 3, GCTCV 106(AAA), GCTCV 119(AAA) and GCTCV 247(AAA). The control varieties used were cv. Rose (resistance to Fusarium
wilt) and Cavendish cv. Williams (susceptible). The local popular cultivars included Pisang Tanduk, Pisang Berangan Intan, Pisang Montel and Pisang Embun.
All planting materials were generated through tissue culture. The experimental design used was Completely Randomised Design (CRD) with 4 replications of 10 plant per
variety per replication. Standard culture practices and drip irrigation were applied. Data for yield performance of bunch weight, number of hands, number of fruits, plant
height and girth diameter of pseudostem were recorded at shooting and at harvest following the INIBAP Technical Guidelines (1994; 2003). Analysis of variance was
used to distinguish the plant means (SAS Inst. 1990).
Results and Discussions
Five important traits of plant height, bunch weight, pseudostem girth, number of hands and number of fruits were evaluated and discussed for 12 varieties selected. The
mean value of all varieties under evaluation at first harvest showed in Table 1.
High yield is determining factor for commercial viability of a variety of choice. In this study, FHIA 25 showed the best yield at 25.3 kg followed by Pisang Montel at 22.6
kg. However FHIA 21 did not give impressive yield which is at only 12.9 kg per bunch. The lowest bunch weight recorded among the 10 selected varieties was Pisang
Tanduk at 7.2 kg. As for the Fusarium resistant controls, cv. Rose gave very low yield at 2.7 kg while Cavendish cv. Williams gave a decent yield of 17.1 kg per bunch.
Another important trait determine is plant height. Result showed the tallest varieties reaching 300cm and more were Pisang Berangan (300 cm) and Bita 3 (302.5 cm).
While the short varieties were cv. Rose (159.8 cm) and Cavendish cv. William (195.3 cm). Plant height and short stature characters is an important economic factor in
the commercial planting. Short stature plants is preferred for ease of harvesting and plot maintaining. There was correlation between plant height and girth diameter and
it is usually in line with the increased height. However plant height is variety-specific and it is also depends on the environment. The number of fruits showed positive
correlation with number of hands and it is normally influence the bunch of weight.
240 | MGC10
Conclusion
Among the 12 varieties, FHIA 25 (cooking type) produced the highest in mean of bunch weight, plant height, girth of pseudostem, number of hands in a bunch at harvest
and number of fruits at harvest. As for dessert, the local commercial variety Pisang Montel gave the best yield among all. From the data recorded, it seem that the
introduced variety FHIA 25 has potential to be commercialize for cooking type. However these attributes may still not be enough to ensure that these variety will be
commercially accepted by Malaysian. Further studies are needed to determine the true potential of this introduced variety especially with the taste.
References
•
DOA (2011). Perangkaan Tanaman Buah-buahan Malaysia 2011. 191p
•
INIBAP (1994). IMTP-2 Technical Guidelines for Fusarium wilt sites. 10p
•
INIBAP (2003). Global evaluation of Musa germplasm for resistance to Fusarium wilt, Mycosphaerella leaf spot diseases and nematode: Performance Evaluation.
Technical Guidelines 2003
•
SAS (1990). SAS user guide; SAS/STST, version 6. SAS Inst. Inc. Cary, N.C.
Table 1: Mean of important traits for 12 selected banana varieties at first harvest in Jerangau, Terengganu.
Variety
Plant Height
Girth Diameter
Bunch weight
No. of hands
No. of fruits
FHIA 21
258.3ab
66.7 bc
12.9 def
6.5 cd
72.8 c
FHIA 25
270.7 ab
92.1 a
23.6 a
11.9 a
232.6 a
GCTCV 106
215.0 bd
53.2 e
18.8 bc
7.1 bc
103.3 b
GCTCV 119
240.3 ab
63.0 cd
11.1 ef
6.0 d
69.2 c
GCTCV 247
224.0 bd
55.7 e
15.9 cde
8.1 b
101.9 b
Bita 3
302.5
69.2
16.6
P. Tanduk
243.3 ab
68.3 bc
P. Berangan
300.5 a
P. Montel
bcd
70.0 c
9.0 f
2.6 e
11.3 d
71.8 b
15.6 cde
7.3 bc
107.8 b
196.8 d
55.9 e
22.6 ab
7.9 b
112.9 b
P.Embun
277.3 ab
64.9 c
17.3 cd
7.1 bc
100.6 b
Williams
195.3 d
57.8 ed
17.1 cd
7.5 bc
93.8 b
159.8 d
32.8 f
3.5 g
8.1 b
Means with the same letter within same column are not significantly different at P<0.05
95.4 b
cv. Rose
a
bc
241 | MGC10
cd
7.0
ID 087
087
Association Mapping of Quantitative Traits in Tropical Sweet Corn
Pedram Kashiani1*, Ghizan Saleh1, Jothi Malar Panandam2 and NurAshikinPsyquay Abdullah1
Department of Crop Science and 2Department of Animal Science, Faculty of Agriculture, Universiti Putra Malaysia
E-mail: [email protected]
1
ABSTRACT:
Association mapping (AM), based on linkage disequilibrium, is a complementary strategy to traditional quantitative trait loci (QTL) mapping for describing associations
between genotypes and phenotypes in crop plants. Most of agronomic traits in sweet corn (Zea mays cover. saccharata) are controlled by several genes at different loci
with varying degrees of genetic contribution. To identify genomic regions responsible for these traits, a genome-wide association study was conducted on 13 tropical
inbred lines using 150 microsatellite DNA markers.A total of 1347 alleles were amplified, out of which 344 were unique among the inbred lines. Prior to association
mapping, population structure was assessed based on allele frequency using Bayesian model based approach, identifying five main heterotic groups among the inbred
lines. Association analysiswas performed with 10,000 permutation replicates to determine chromosome-wise and genome-wise significance levels of association tests.In
total, 19 significant marker-trait associations were identified when significance level was set at p≤0.01.The portion of total variance estimated by the marker ranged
from 0.303 to 0.635. Each chromosome possessed at least one (Chromosomes 1, 2 and 6) to three loci (Chromosomes 3 and 7) associated with one of 17 agronomic
traits measured.Among the yield related traits, dehusked ear diameter was found to be associated withbnlg1526located on Chromosome 10, while dehusked ear length
was associated with bnlg1518, umc1147, umc1265, umc1652 and bnlg1401 located on Chromosome 10, 1, 2, 4 and 9, respectively. Husked ear length and dehusked
ear weight were found to be associated with phi053 (Chr-3) and umc1143 (Chr-6), respectively. Significant associations identified in the present study can be utilized as
a powerful tool for uncovering potential QTL-allele matrix for further marker-assisted breeding on tropical sweet corn.
INTRODUCTION
Complex quantitative traits are usually influenced bya large number of genes as well as environmentaleffects. Understanding the genetic basis of complextraits have
traditionally been the focus of quantitativegenetics, which relies on partitioning phenotypicvariation within and among individuals withknown degrees of relatedness
(Lynch and Walsh, 1998). However, as theavailability of useful genetic markers have increased,it has become possible to associate genome regionscontaining these
markers to variation in complextraits.Genetic linkage map construction has been recognized as an essential tool for plant molecular breeding using DNA markers
because they are neutral, lack epistasis and are simply inherited in a Mendelian nature.The method of linkage analysis is well developed for bi-parental crosses between
inbred lines. However, one of the limiting factors in genomic analysis of many plant species is that most genomic studies have been conducted in experimental
populations developed from a bi-parental cross. Thus, while many quantitative trait loci (QTL) have been reported, the effects of these QTLs often turn out to be unique to
a specific genetic background, and there has been limited success in applying the results across breeding populations. Many researchers now consider that association
analysis, whereby genes and QTL are detected in a random set of genotypes from a mixed genetic background, is a viable solution to this problem (Breseghello and
Sorrells, 2006). The increased availability of molecular markers and the refinement of statistical tools have kindled renewed interest in this approach.Association
mapping (AM) is based on the assumption that there is a set of markers available and either they represent actual genes (or alleles) or that of the markers are so close to
the actual functional genes that they co-segregate and happen to be in linkage disequilibrium (LD). This implies that the LD mapping is done with a natural population in
which association between traits and markers exists due to linkage disequilibrium. The degree of LD depends on the recombination events that have taken place in
history(Nordborg and Tavare, 2002).
The goal of this research was to apply AM approaches to identify SSR markers associated with important agronomic traits in 13 advanced inbred lines. Pedigree
information was not available for the lines. Therefore there is a potential for false marker-trait associations because of population structure or family relatedness.
Statistical procedures that account for population structure and family relatedness were employed to minimize false positives and maximize power.
MATERIALS AND METHODS
Through a long breeding program conducted in Universiti Putra Malaysia, a set of homozygous inbred lines developed from different tropical-source populations was
obtained after eight generation of self-pollination and selection. Among these, 13, originally developed from Malaysian,Indonesian, Hawaiian, Taiwanese and Thailand
source-populations, were selected for associate mapping of important agronomic traits. Twenty seeds from each inbred line were germinated in jiffy cups and seedlings
were grown to the two-leaf stage. Genomic DNA was extracted from young leaves of 20 seedlings per line using the DNeasy® Plant Mini Kit from QIAGEN® following the
manufacturer’s instruction with minor modification to the washing steps. One hundred and fifty microsatellite regions were chosen from the MaizeGDB
(http://www.maizegdb.org.php) based on their polymorphism information contents (PIC) and QTL information reported in previous investigations. Six microsatellite
primers out of 150 were not amplified even when tested at different annealing temperatures. The amplifications were performed as described in Kashiani et al. (2012a;
2012b).
242 | MGC10
The genetic structure of the inbred lines has been investigatedwith a model-based analysis. SSR data were used to estimate the LD values among loci and their
significance on a genome-wide basis. Linkage disequilibrium (LD) estimates were calculated based on the maximum likelihood estimate (MLE) using an expectation
maximization algorithm [38].Classical (D), standardized (D') and conventional (r2) LD coefficients for any pairs of alleles amplified at two loci on a same chromosome were
estimated based on Lewontin and Kojima (1960).Population structure consisted of a Q matrix that describes the percent subpopulation parentage was derived using the
model-based approach described byFalush et al.(2003). Furthermore, the complete set of SSR loci was used to obtain co-ancestry K matrices for all the inbred lines
based on the model proposed by Loiselleet al. (1995)and Hardyand Vekemans(2002).The influence of the genetic diversity structure present in the phenotypic variation
of target traits wasassessed by means of multiple regression. Association analysis was performed with 10,000 permutation replicates to determine chromosome-wise
and genome-wise significance levels of association tests. The significance of marker-phenotypeassociations was tested using: (i) the fixed general linear modelincluding
the population structure coefficients,(ii) the mixed linear model including the Q populationstructure coefficients and thekinship matric. Marker–trait associations were
considered reliable using thresholds of P≤0.05 and0.01 marker-wise level and P≤0.05 experiment-wiselevel (Bonferroni’s correction).
RESULTS AND DESCUSSION
Results showed that there was a wide range of agronomic and genetic differences among the inbred lines evaluated. Significant variations in agronomic performance
revealed by the inbred lines indicated the presence of high genetic diversity among them. Among the inbred lines, the highest husked fresh ear yield was obtained from
TSN-S8 with value of 6549 kg ha-1, but this was not significantly higher than those obtained from TSK-S8, BAK-S8 and MAN-S8 (6483, 6402 and 5798 kg ha-1,
respectively).
A total of 1347 bands were amplified using the SSR markers, out of which 344 were found to be unique bands among the inbred lines. SSR markers exhibited high
Shannon’s information index (I), Nei’s expected heterozygosity (Nei’s), and polymorphic information content (PIC), with mean values of 1.053, 0.586 and 0.582
respectively, indicating their appropriateness in detecting genetic variability among the inbred lines. The genetic relationships among the accessions were investigated
using a model-based Bayesian clustering method. For estimation of true number of genetically diverse groups (K) after merging the phenotypic and molecular data, the
posterior probability of the data for a given K (1 to 13) was estimated. Results pointed out that the minimum and optimal number of hypothetical well distinct subgroups
present among the inbred lines was equal to five. The ad hoc model used obviously showed that the second order of change in log probability of the data was highest
when K was set at five (Figure 1).In this study, effect of population structure that describes the percent subpopulation parentage was estimated using the model-based
approach described by Falush et al. (2003). This was due to the fact that the presence of population structure can result in spurious associations, that is, associations
between a phenotype and markers that are not linked to any causative loci (Lander and Schork, 1994). Such associations can occur when the agronomic trait varies
across subpopulations, thereby increasing the probability that affected individuals will be sampled from particular subpopulations. Any marker allele that is in high
frequency in the overrepresented subpopulations will then be associated with the trait (Ewens and Spielman, 1995; Pritchard et al., 2000).
Four hundred and forty six pairs of alleles were found to be in linkage disequilibrium, from which only 50 pairs of loci were separated less than 50cM from each other on
the same chromosome. A triangle plot was generated for pairwise LD between marker sites in a hypothetical genome fragment, where pairwise LD values of
polymorphic sites are plotted. Figure 2 displays r2values and the corresponding p-values from 10000 permutation test.
1.0
0.9
0.8
0.7
0.6
∆K 0.5
0.4
0.3
0.2
0.1
0.0
1
2
3
4
5
6
7
8
9
10
11
12
13
K
Figure 1. Graph indicating the true number of heterotic groups (K) based on an ad hoc statistic using the normalized second order rate of change in the log probability
(∆K) of data
243 | MGC10
Figure 2: Pairwise LD values of polymorphic sites plotted on both theX- and Y-axis; above the diagonal displays r2 values and belowthe diagonal displays the
corresponding p-values. Each cell represents the comparison oftwo pairs of marker sites with the color codes for the presenceof significant LD.
Nineteen signifificant
marker-trait associations were detected with the Q-K-GLM model when significance level was set at p≤0.01 (Table 1). However, only seven
fi
associations were found to be significant after permutation test. The portion of total variance estimated by the marker ranged from 0.303 to 0.635. Each chromosome
possessed at least one (Chromosomes 1, 2 and 6) to three loci (Chromosomes 3 and 7) associated with one agronomic trait. Among the yield related traits, dehusked
ear diameter was found to be associated with bnlg1526 located on Chromosome 10, while dehusked ear length was associated with bnlg1518, umc1147, umc1265,
umc1652 and bnlg1401 located on Chromosome 10, 1, 2, 4 and 9, respectively. Husked ear length and dehusked ear weight were found to be associated with phi053
(Chr-3) and umc1143 (Chr-6), respectively. To reduce the percentage of false-positive associations (Type I error), only the associations with significant probability after
permutation test were considered significant (pp≤0.05). Based on this criterion, the following associations were considered significant: bnlg1526 associated with
dehusked ear diameter, phi053 associated with dehusked ear length, umc1143 associated with dehusked ear weight, umc1154, umc1426 and umc1153 associated
with ear height, and umc1916 associated with plant height. Previous studies have shown that sweet corn yield is highly positively correlated with ear characteristics
(Kashiani and Saleh, 2010; Kashiani et al., 2010). This indicates the usefulness of bnlg1526, phi053 and umc1143 for further molecular breeding for tropical sweet
corn.
244 | MGC10
Table 1.Nineteen
signifificant
marker-trait associations detected with the Q-K-GLM model when significance level was set at p≤0.01
1.
fi
Chr
ANT
umc1279
C9
4.9
50.53
0.0044
0.3596
0.676
3.56
0.07
DHED
bnlg1526
C10
284.7
227.76
0.0005
0.0194*
0.65
56.72
0.25
DHEL
bnlg1518
C10
526.4
2.89E+05
0.0014
0.1012
0.405
3.40
0.00
DHEL
DHEL
umc1147
C1
C2
714.4
77.7
20.72
20.72
0.0039
0.0039
0.2412
0.2412
0.314
0.314
15.80
15.80
0.76
0.76
DHEL
umc1652
bnlg1401
C4
228.4
17.18
0.0057
0.3340
0.353
8.90
0.52
umc1143
C9
C6
147.5
17.5
39.4
47.13
0.0063
0.0014
0.3588
0.0376*
0.397
0.512
5.00
2073.31
0.13
43.99
EH
umc1154
C7
596
66.53
0.0002
0.0182*
0.32
201.88
3.03
EH
umc1426
umc1153
C7
47.8
72.68
0.0006
0.0240*
0.326
137.13
1.89
C5
C8
676.7
414.1
38.54
25.4
0.0009
0.0024
0.0456*
0.2150
0.312
0.303
196.71
190.70
5.10
7.51
DHEL
DHEW
EH
EH
HEL
bnlg1152
F Value
P≤F
PP≤F
PP
R2
EMS
SSR
umc1265
cM
MMS
Trait
phi053
bnlg1337
C3
318.2
56.12
0.0010
0.0322*
0.516
11.27
0.20
NE
C4
708.6
33774.22
0.0042
0.3014
0.548
4.41E+07
1306.15
NE
umc2328
C7
381.5
94.87
0.0100
0.5740
0.546
5.27E+07
5.56E+05
NKR
bnlg197
C3
544.4
13.64
0.0094
0.4200
0.43
86.82
6.37
PH
umc1916
C8
626.7
218.25
0.0005
0.0252*
0.423
667.58
3.06
SIL
umc1019
C5
469.6
14928.07
0.0063
0.3446
0.632
14.94
0.00
TAS
bnlg1798
C3
511.5
30.95
0.0090
0.4940
0.635
17.77
0.57
ANT = Anthesis interval, DHED = Dehusked ear diameter, DHEL = Dehusked ear length, DHEL = Dehusked ear weight, EH = Ear height, HEL = Husked ear length, NE =
Number of Ears per hectare, NKR = Number of kernels per row, PH = Plant height, SIL = Number of days to silking, TAS = Number of days to tasseling, Chr =
Chromosome, cM = Position of SSR based on cM, PP = Permutation probability, MMS = Marker mean squares and EMS = Error mean squares.
CONCLUSION
Based on the results of this study, association mapping revealed the influence of several chromosome regions on the variability of agronomic traits in sweet corn. SSR
markers bnlg1526, phi053 and umc1143 were significantly associated with ear characteristics. Therefore, they can be used for marker-assisted selection among the
inbred lines toward yield improvement. Significant associations identified in the present study can also be utilized as a powerful tool for uncovering potential QTL-allele
matrix for further marker-assisted breeding on tropical sweet corn.
245 | MGC10
REFERENCES
Breseghello F, Sorrells ME (2006) Association Analysis as a Strategy for Improvement of Quantitative Traits in Plants. Crop Sci. 46(3): 1323-1330
Ewens WJ, Spielman RS (1995) The transmission/disequilibrium test: history, subdivision, and admixture. Am J Hum Genet 57(2): 455-64
Falush D, Stephens M, Pritchard JK (2003) Inference of population structure using multilocus genotype data: linked loci and correlated allele frequencies. Genetics
164(4): 1567-87
Hardy OJ, Vekemans X (2002) spagedi: a versatile computer program to analyse spatial genetic structure at the individual or population levels. Molecular Ecology Notes
2(4): 618-620
Kashiani P, Saleh G (2010) Estimation of genetic correlations on sweet corn inbred lines using SAS mixed model. American Journal of Agricultural and Biological
Sciences 5(3): 309-314
Kashiani P, Saleh G, Abdullah NAP, Abdullah SN (2010) Variation and genetic studies on selected sweet corn inbred lines. Asian Journal of Crop Science 2(2): 78-84
Kashiani P, Saleh G, Panandam JM, Abdullah NAP, Selamat A (2012a) Demarcation of informative chromosomes in tropical sweet corn inbred lines using microsatellite
DNA markers. Genetics and Molecular Biology 35: 614-621
Kashiani P, Saleh G, Panandam JM, Abdullah NAP, Selamat A (2012b) Molecular characterization of tropical sweet corn inbred lines using microsatellite markers.
Lander E, Schork N (1994) Genetic dissection of complex traits. Science 265(5181): 2037-2048
Lewontin RC, Kojima K (1960) The evolutionary dynamics of complex polymorphisms. Evolution 14(4): 458-472
Loiselle BA, Sork VL, Nason J, Graham C (1995) Spatial Genetic Structure of a Tropical Understory Shrub, Psychotria officinalis (Rubiaceae). American Journal of Botany
82(11): 1420-1425
Lynch M, Walsh B (1998) Genetics and Analysis of Quantitative Traits. Sinauer Associates, Sunderland, MA
Nordborg M, Tavare S (2002) Linkage disequilibrium: what history has to tell us. Trends Genet. 18(2): 83-90.
Pritchard JK, Stephens M, Donnelly P (2000) Inference of population structure using multilocus genotype data. Genetics 155(2): 945-959
246 | MGC10
ID 088
088
Chromosome Doubling In A. Malaccensis through In Vitro Polyploidization
A.R. Siti Suhaila1,4*, N. Mohd. Saleh2,4, M. Norwati1, M.C. Mahani3, H. Siti Salwana1, P. Namasivayam4, K.I. Kandasamy5, H. Nor Hasnida1, I. Haliza1, A.
Nazirah1, Y. Muhd. Fuad1
1
Forest Research Institute Malaysia (FRIM) 2Agro-Biotechnology Institute 3School of Environmental and Natural Resource Sciences, Faculty of Science and Technology,
UniversitiKebangsaan Malaysia (UKM) 4Department of Cell and Molecular Biology, Faculty of Biotechnology and Biomolecular Sciences, Universiti Putra Malaysia (UPM)
5
Malaysian Biotechnology Corporation Sdn. Bhd
Email: [email protected]
ABSTRACT:
The use of antimitotic agents to induce chromosome doubling has been successfully applied in many crops for decades. The resulting plants(called polyploids) are mostly
superior compared to their diploid counterparts and are selected by breeders as planting stock. The success of producing polyploidsdepends on many factors such as
concentrations of antimotic agent, exposure time, explants and species. This study was to investigate the capacity of the antimitotic agents (colchicine and trifluralin) for
inducing chromosome doubling in Aquilaria malaccensis using shoot tip and nodal segment in vitro explants. Flow cytometric analyses, chromosome number and
stomatal size were used to determine the optimal concentration of each antimitotic agent for polyploidization. Findings from this study show that reagent concentrations
and exposure time were significant parameters. Trifluralin at a concentration of 0.1 mM resulted in the highest success rate of polyploidization, followed by colchicine
treatment of 1 mM. The maximal exposure time tested (120 hours) resulted in a significant increase in polyploidization by trifluralin and colchicines. Additionally, the
antimitotic agents reacted differently towards different explants. Nodal segments showed higher ploidy level changes in comparison to shoot tip. The chromosome
number for diploid (2n = 14) and tetraploid (4n = 28) was confirm through optimized root tip squashing technique. The stomatal size in tetraploid plantlets was observed
to be larger than diploid, 33.26+0.6cm and 23.14+0.5cm, respectively. These plants are being grown in greenhouse for further testing of their potential use in breeding
programme.
Keywords: Aquilaria malaccensis, shoot tip, nodal segment, antimitotic agents, polyploid
INTRODUCTION
Chromosome doubling (polyploidization) played an important role in the evolution and speciation phenomenon in plants (Tate et al., 2005). Studies of chromosome
number had revealed a large number of natural polyploids occurring especially in angiosperms plant group (Tate et al., 2005). Chromosome doubling causes cell
enlargement resulting in larger vegetative and reproductive parts of the plant (Tate et al, 2005; Dolezel et al, 2007). Therefore, polyploid plants are usually more rigor
and more adaptable to its surroundings compared to its diploid counterparts. Thse are some of the agronomic traits that breeders look for especially when facing the
ever changing environment and to ensure survival after planting. Due to its superior characteristics, manipulation of ploidy level has become an established method for
improving many plant species and hybrids (Griesbach, 1985; Teoh, 2005; Tang and Chen, 2007). The research on polyploidsis not restricted to food crops and
ornamental plants, but also towards manipulation of timber trees. In cases of Agathis robusta, Elaeocarpus grandis, and Pawlonia tomentosa, polyploids of thesespecies
showed promising potential (Gamage et al, 2010). Another advantage of polyploidization is enhancementthe secondary metabolites production by some medicinal plants
such as Vertivaria zizaniodes L. Nash, Z.officinale and Artimisia annua in quantitive manner (Lavania, 1988; Dhawan and Lavania, 1996; Jesus-Gonzalez and Wheathers,
2003).
Aquilaria malaccensis is an important non-timber product. It is an agarwood-producing species used as incense, perfume and medicine in many pharmaceuticals and
aromatic industries worth millions of US dollars annually. The increase in demand has led to the diminishing supplies and rising price among others and is listed under
Appendix II (CITES)(Burkill, 1966). To ensure the sustainability of the agarwood trade and to avoid extinction of Aquilaria species, Malaysian Timber Industry Board (MTIB)
has limited the trading of agarwood to be 200,000 kg per year (MTIB, 2013). The agarwood from A. malaccensis is considered the best by the agarwoodtraders.
However, A. malaccensis growth rates are relatively slower compared to some other Aquilaria species causing shortage in supplies of agarwood woodchips and essential
oil (Kassan, 2013). Therefore, characteristics such as fast growth rate and bigger diameter would be desirablein view of the increasing demand of the agarwood in global
market.The objective of the study is to develop in vitro polyploidization protocol for A. malaccensis and study the morphological differences the polyploidy plantlets.
RESULTS AND DISCUSSION
Shoot tips and nodal segments of A. malaccensis were selected and soaked in MS hormone-free liquid medium containing trifluralin (0, 0.01, 0.05, 0.1 mM) and
colchicine (0,0.5,1.0 and 2.0 mM) with various exposure time (0, 6, 12, 24, 48 and 120 hours). The chromosome doubling was observed in both different types of
explants used (Table 1). A significant decrease in the number of diploids was observed with increasing concentration of the antimitotic agents. This phenomenon was
more pronouncedin nodal segment explantscompared to shoot tips. However, the increment in exposure time showed more consistent results suggesting it to be a more
important factor towards chromosome doubling compared to the concentrations of antimitotic agents.
247 | MGC10
Table 1. The chromosome doubling in A. malaccensis using antimitotic agents (at different concentration and exposure time) towards different explants (30 samples of
shoot tip and nodal segment). The chromosome doubling occurred more frequent at longer period of exposure time.
The DNA content and genome size was determined using flow cytometric analyses (Figure 1,a,d) withRaphanus sativus cv. Saxa as an internal reference, 1.1pg 2C(Table 2). The diploid A. malaccensis (clone pK7) gave DNA content value of 1.86+0.02 pgC-1 with genome size of 909.56+7.85 Mbp. The tetraploid (pK/t7) gave value
of 3.86+0.03 pgC-1 and genome size of 1887.54+8.42 Mbp. The values showed the tetraploid had at least doubled the amount of both DNA content and genome size
in A. malaccensis. The values of the In Figure 1, the differences in stomata size was observed between diploid and tetraploid samples. The stomatal size in tetraploid
samples were observed to be larger and at lower density (33.3+0.6um) compared to diploid (23.1+0.5um). The guard cells also showed higher number and intensity of
chlorophyll granules within forpolyploid samples. The chromosome numbers were determined using optimized root tip squashing method with diploid A. malaccensis,
2n=14 and tetraploid, 4n=28.
1
Table 2: The DNA contents of diploid and polyploidy Aquilaria malaccensis with Duncan’s group analysis
Sample
Mean DNA content + SE
Mean genome size + SE
(pg 2C-1)
(Mbp)
pK 7 (diploid)
1.86 + 0.02
909.56+ 7.85
pK/t 7 (tetraploid)
3.86 + 0.03
1887.54+ 8.42
Mean + SE DNA content (bp) = 0.978 x 109 x DNA content (pg)(Dolezel et al., 2003).
248 | MGC10
1
Figure1: (a-g) Morphological and cytological analyses ofA.
malaccensis: a-c – diploid; d-f – polyploids. Flow cytometric
analysis to obtain the 2C DNA content using leaf samples: (a)
first peak, 1-control, R. sativus cv. Saxa), second peak, 2-A.
malaccensis diploid; (d) single peak, 3-polyploid A.
malaccensis (tetraploid); (b) morphology of diploid stomata; (e)
tetraploid stomata; (c) chromosome number of diploid A.
malaccensis, 2n=14; (f) chromosome number of tetraploidA.
malaccensis, 4n=28; g diploids (1,2) and tetraploid (3,4) A.
malaccensis plantlets in greenhouse (7 months old).
2
3
(a)
(d)
(b)
(e)
5 µm
(c)
(g)
(f)
1
2
3
4
The polyploids showing faster growth patterns compared to the diploid plants, namely 40% higher in heights. (Figure 1,g). The polyploidy plantletswere selected and
further assessed to evaluate its potential for hybridizing and breeding programme.
CONCLUSION
Thisstudy has successfully developed the chromosome doubling protocol in A. malaccensis. The polyploid plantlets were phenotypically different compared to their
diploid counterparts, which include relatively larger stomatal size and faster growth rate comparedto the diploid plantlets under in vitro condition. These polyploids can
potentially be introduced as new varieties, and as a results increase the diversity of A. malaccensis in the global market.
ACKNOWLEDGEMENTS
This research was financially supported by the RMK-10(TC):22410104005. The authors thank staff of Tissue Culture Lab and Genetic Lab for technical assistance.
249 | MGC10
REFERENCES
Burkill, I (1966).A Dictionary of economics products of the Malay Peninsular, I. Government of Malaysia and Singapore.The Ministry of Agricultural and Corporative. Kuala
Lumpur.
De Jesus-Gonzalez L. & Weathers P.J. (2003).TetraploidArtemisia annuahairy roots produce more artemisinin than diploid. Plant Cell Rep 21:809-813.
DhawanO.P &LavaniaU.C. (1996). Enhancing the productivity of secondary metabolites via induced polyploidy: a review. Kluwer Academic Publishers.Euphytica 87:81-89.
Griesbach R.S. (1985). Polyploidy in Phalaenopsis orchid improvement. Journal of Heredity 76:74-75.
Harshi K. Gamage, Peter Prentis, Andrew Lowe, Malcolm Lamont, Susanne Schmidt. Comparing diploid and modified putative polyploid lines of trees Agathis robusta,
Elaeocarpus grandis, and Pawloniato mentosa. Poster presentation. University of Queensland, Australia.
Harshi K. Gamage, Peter Prentis, Andrew Lowe, Malcolm Lamont, Susanne Schmidt. Comparison of genetic and physiological traits of diploid progenitors and modified
polyploid lines of tree species.PolyGenomX Ltd., company report, September 2010. Accessed from http://www.polygenomx.com
JaroslavDolezel, Johann Greilhuber& Jan Suda (2007). Estimation of nuclear DNA content in plants using flow cytometry.Nature Protocols Vol.2 No. 9.(pg. 2233-2244).
Jennifer A. Tate, Douglas E. Soltis& Pamela S. Soltis (2005). Polyploidy in Plants.The Evolution of the Genome.Copyright 2005. Elsevier Inc. Chapter 7(pg. 371-426).
Kassan, I (2013).Presented at Quo Vadis IndustriGaharu di Malaysia (2013), 28-29 September, Mandarin Court Hotel, Kuala Lumpur, 50150 Malaysia.
LavaniaU.C. (1988). Enhanced productivity of the essential oil in the artificial autopolyploid of vetiver (Vetiveria zizaniodes L. Nash).Kluwer Academic Publisher.Euphytica
38:271-277.
Malaysian Timber Industry Board (MTIB)(2013). Presented at 1st International Scientific Symposium on Agarwood (ISSA2013), 3-5 September 2013, Universiti Putra
Malaysia.
Tang C.Y. and Chen W.H. (2007). Chapter 1: Breeding and development of new varieties in Phalaenopsis. In ‘Orchid Biotechnology’. (Eds W.H. Chen and H.H. Chen) pp.
1-22.
Teoh E.S. (2005). Orchids of Asia (3rd Ed.), edited by Marshall Cavendish.Times Editions, Singapore.
250 | MGC10
ID 091
091
Morphological Characterization of Averrhoa carambola Accessions at MARDI Kluang
1
Ahmad Hafiz, B.1, Abd Rahman, M.2,
Horticulture Research Centre, MARDI Kluang Station
2
Horticulture Research Centre, MARDI
Email: [email protected]
ABSTRACT:
Characterization of morphological characters is one of the breeding procedures to evaluate the existing germplasm for future breeding work of starfruit. A total of 102
accessions of Averrhoa sp. was collected throughout Malaysia and introduced from other countries. The objective of this work was to characterize starfruit accessions at
MARDI germplasm based on morphological traits for their variation. As a start only twenty two accessions were used for this study and twenty traits (12 quantitative and
8 qualitative) were recorded from 2011 to 2012. Result from cluster analysis using twelve quantitative traits shows that the 22 accessions were classified into four major
groups. Quantitative traits of fruit quality were characterized by mean difference. It can be concluded that genetic diversity of starfruit germplasm were exist and can be
classified based on plant morphological characteristic for future breeding objectives.
Introduction
Starfruit (Averrhoa carambola) is one of the most popular tropical fruits in Malaysia. More than 90% of the starfruit grown in Malaysia is exported, with the Netherlands
being the most important market. Starfruit was planted commercially mainly in the west coast states of Peninsular Malaysia. The main areas of production are Johor,
Selangor, Perak, Melaka and Negeri Sembilan. The origin of starfruit is not clear, but it is probably native to Malaysia, Indonesia and Southern China (Abd Rahman and
Maimun, 2008). Starfruit has never been found in wild. It was domesticated throughout India and Southeast Asia since prehistoric times.
To date, the Department of Agriculture has registered 19 starfruit clones (Anon, 1995). Among these, B10 and B17 are two commercial varieties that are being planted
widely in Malaysia. B10 is very popular because of its better shape, texture, long storage life and this variety is being used for export market whereas B17 is being
produced for local market.
At MARDI, starfruit genetic conservation programme has been initiated since 1989. To date MARDI has 102 accessions of Averrhoa sp. that have been collected
throughout Malaysia and introduced from other countries. The objective of this work was to characterize some of starfruit accessions at MARDI germplasm for future
breeding work.
Materials and Methods
Twenty two starfruit accessions from MARDI germplasm that were planted at MARDI Kluang Station, Johor were evaluated. The information for each accession was in
Table 1. Morphological traits were characterized based on the traits published by Anon, 1995 (Table 2). Twenty traits (12 quantitative and 8 qualitative) were recorded
from 2011 to 2012. For fruit quality, 10 matured fruits (Index 4) were randomly harvested for data recording. Fruit quality traits namely fruit weight (g), fruit length (cm),
fruit width (cm), total soluble solids (oBrix), flesh color rating (Table 3) and number of seeds per fruit were measured and recorded. Shoot colour and flower colour were
measured by using RHS fifth edition colour chart. Analysis of variance using ANOVA, Duncan Multiple Range Test (DMRT) and cluster analysis using SAS inst. (1990)
were applied for statistical analysis.
Result and Discussion
Result from ANOVA showed that there is a highly significant difference between accessions on all parameters (Table 4). This shows that there is a wide variation
between each accession in starfruit germplasm especially in number of seed that give the highest CV (42.3 %). Starfruit is a cross pollinated plant and therefore it
gives wide variation on number of seed produced. Average fruit weight is 157.1g with skin colour rating of 2.4 and the TSS is 7.22 OBrix. TSS and fruit size is one of the
most desirable traits for commercial variety besides of fruit shape, skin color, flesh color, texture and yield.
Two morphological traits from the 12 originally measured (orientation of the leaves to the branch/twigs and form of end leaflets) were eliminated as they showed only one
phenotypic class. Qualitative traits showed from two to seven phenotypic classes (Table 2). Result from cluster analysis shows that the 22 accessions could be classified
into four major groups (Figure 1). Among the group, based on the mean cluster distance, it was observed that cluster 1 and 4 are highly dissimilar. Commercial variety
B10 and B17 were in the same group in cluster 1 altogether with collections from Florida, USA (BM23), and two accessions from Melaka (BM19 and BM20). It shows
that there is close relationship among these accessions.
Pollinizer clones B2 and B11 were grouped in cluster 2. Cluster 4 has only one accession namely B13 or Istana Perak 1. The analysis of overall pattern of genetic
diversity and relationships among germplasm accessions facilitates the selection of parents with diverse genetic background (Murphy et al., 1986). Fruit quality traits are
also important in investigating genotypic relationship for starfruit commercialization (Ahmad Hafiz B., et al 2012).
251 | MGC10
Conclusion
Broad morphologic diversity was found in some starfruit accessions using plant morphology traits characterization. Two flower traits and eight leaf traits were positively
associated with morphological variability in starfruit germplasm. Fruit quality traits are also important in investigating genotypic performance together with plant
morphology traits in starfruit breeding.
References
Abd. Rahman M., and Maimun T. (2008). Starfruit (Averrhoa carambola L.) Breeding for Horticultural Crops @ MARDI. 267-280.
Ahmad Hafiz, B., Abd Rahman, M., Mohd Asrul, S., Jasni, I. and Sahrom, M.N (2012). Hierarchical cluster analysis of genetic diversity in starfruit (Averrhoa sp)
germplasm based on six fruit quality traits: A preliminary study. Proceeding in Plant Breeding Seminar, ABI Institute, 3rd-5th July 2012.
Anon. (1995). Ciri-ciri Pengenalan Klon Belimbing. Jabatan Pertanian Kuala Lumpur: 26.p
Anon. (1995). Senarai klon buah-buahan yang didaftar oleh Jabatan Pertanian. Jabatan Pertanian Kuala Lumpur: 6-7.
Murphy, J.P., Cox T.S and D.M. Rodgers. (1986). Cluster analysis of red winter wheat cultivars based upon coefficients of parentage. Crop Science, 26: 672-676.
SAS Inst. (1990) SAS user guide; SAS/STST, version 6. Cary, N.C.: SAS Inst. Inc.
Table 1. Starfruit accessions selected for characterization from MARDI germplasm
Accession
DOA number
Local name/origin
Accession
DOA number
Local name/origin
BM1
B1
Yong Toh Yin/Perak
BM12
B12
Chan Yong 2/ Serdang Baru,
Selangor
BM2
B2
MAHA66/Port Dickson,
N.Sembilan
BM13
B13
Istana Perak 1/ Kuala
Kangsar, Perak
BM3
B3
Foo Red/ Port Dickson,
N.Sembilan
BM14
B14
Istana Perak 2/ Kuala
Kangsar, Perak
BM4
B4
Sg. Besi 1/Sungai Besi,
Selangor
BM15
B15
Istana Perak 3/ Kuala
Kangsar, Perak
BM5
B5
Sg. Besi 2/Sungai Besi,
Selangor
BM16
B16
-
BM6
B6
Sg. Besi 3/Sungai Besi,
Selangor
BM17
B17
Belimbing madu/Triang,
Pahang
BM7
B7
Sg. Besi 4/Sungai Besi,
Selangor
BM19
-
-/Air Molek, Melaka
BM8
B8
Sg. Besi 5/Sungai Besi,
Selangor
BM20
-
-/Air Molek, Melaka
BM9
B9
-/Serdang Baru, Selangor
BM23
-
-/ Jelebu,
N.Sembilan
BM10
B10
-/Serdang Baru, Selangor
BM25
-
-/ Ulu Lenggeng N.Sembilan
BM11
B11
Chan Yong 1/Serdang
Baru, Selangor
BM27
-
Fwang Tung/Florida, USA
252 | MGC10
Table 2. Summary of qualitative traits in starfruit characterization study.
Traits a
Orientation of the leaves to the
branch/twigs
Phenotypic classes b
Vertical (22), Horizontal (0)
Form of lateral leaflets
Ovate (11), Oblong (11)
Form of base leaflets
Oblique horizontal (8), Oblique downward (1), Oblique upward (13)
Form of end leaflets
Accuminate (0), Accute (0), Mucronat (22)
Form of terminal leaflets
Obovat (8), Elliptic (5), Ovate (9)
Form of upper surface of young
leave
Highly curved downward (0), Highly curved upward (2), Slightly curved downward (1), Slightly curved upward
(19), Flat (0)
Form of upper surface of
matured leave
Highly curved downward (0), Highly curved upward (4), Slightly curved downward (0), Slightly curved upward
(17), Flat (1)
Lustrousity of young leave
Yes (6), No (16)
Leave stalk colour
Browned green (14), Browned red (4), Reddish green (4), Red (0)
Shoot colour
Red group (0), Greyed red (6), Greyed orange (12), Greyed purple (4)
Flower type/morph
Thrum (10), Pin (12)
Flower colour
a
64A (1), 64B (1), 70A (8), 71A (3), 71B (4), 72A (3), 72B (2) ;according to RHS Colour chart
Traits according to the book Ciri-ciri Pengenalan Klon Belimbing, DOA (1995)
b
Numbers in brackets indicate the number of accessions per class
Table 3. Skin colour rating chart
Rating no.
Description
1
Dark green
1.5
Light green
2
25% yellow
2.5
Light yellow
3
3.5
4
Golden yellow
Orange
Reddish orange
253 | MGC10
Table 4. Mean square from ANOVA for fruit quality traits
Source
df
Fruit
Weight
(g)
Fruit
Length
(cm)
Fruit
Width
(cm)
Wing
Width
(cm)
Wing
Length
(cm)
Flesh
colour
TSS
(oBrix)
Seed no.
Clone
21
10335.9**
11.0**
4.6**
0.2**
0.5**
1.9**
13.8**
30.9**
Error
113
362.8
0.52
0.2
0.0
0.1
0.3
0.4
6.9
Total
134
157.1
11.5
6.6
2.0
2.3
2.4
7.2
6.2
7.0
11.8
21.2
8.4
42.3
Mean
CV
12.1
6.3
7.1
** - significantly different at p<0.01, * - Significant at p≤0.05, ns - not significant
Figure 1. Dendogram of starfruit accessions based on morphological data.
254 | MGC10
Table 5. Grouping of genotypes in clusters
Clusters
Accessions
1
B14, B15, B19, B20, B10, B17, B23
2
B5,B6,B1,B9, B4, B27, B2, B11, B3
3
B16,B25, B12,B7, B8
4
B13
255 | MGC10
IV
ID 092
092
Evaluation and Selection of Red Blush Mango Progenies
Mohd Azhar Hassan1, Johari Sarip2, Nor Hanis Aifaa Yusoff1 and Suhanna Ahmad2
1
Horticulture Research Centre, MARDI Bukit Tangga Station
2
Horticulture Research Centre, MARDI
Email: [email protected]
ABSTRACT:
Mango can be classified into 3 groups based on the skin color of its ripe fruit, which are green, yellow and red-blush. Red-blush skin is considered a necessity in
mangoes for the USA and European markets, even though the quality maybe inferior to those non-showy cultivars. While in Malaysia and Asia markets, green and yellow
mangoes are very popular while the reddish is very rarely seen. SB003 and SB019 are progenies which are developed via open-pollinated mango crossing approach. In
this approach, strawberry mango variety was used as a maternal parent. Red-blush skin color and few other good quality characters make strawberry mango as a good
parent but unfortunately it is not adapted to local environment hence being a poor yielder. The fruit size is also very small and below market demand. SB003 and SB019
are Malaysia’s first mango progenies with beautiful red blush skin and orange flesh, high yielding, medium fruit size (350-450 g), oval-shaped fruit, sweet-scented, less
fibrous, less juicy, sweet (18-20%) and bit sour taste, excellent flavor, high Vitamin C content, slight tolerance to anthracnose infection, no IFR incidence and a possibility
of dwarf plant. However, Genotype x Environmental study has to be carried out before they can be launched and recommended for commercial cultivation.
INTRODUCTION
Europeans prefer a deep-yellow mango that develops a reddish tinge. In the USA, mango color is an important factor since everyone admires a beautiful mango overlaid
with red color. Red skin is considered a necessity in mangoes that are shipped to European markets, even though the quality maybe inferior to those non-showy cultivars.
Introducing of Malaysia's first mango progeny can diversify the commercial mango clones which already established in the local market such as Chokanan, Harumanis,
Sala and Nam Dok Mai. The uniqueness of a red blush, excellent taste and fragrant smell definitely will attract the attention of mango lovers even the price is higher than
existing commercial clones in the market (Mohd Azhar and Ithnin, 2009). This will increase the economy of mango growers, wholesalers and sellers. Reddish skin
mango will also create opportunity for local mango market to penetrate European and the USA markets.
The objective of this research is to develop, evaluate and select superior mango progenies which comprise the outstanding characters including red blush skin to be
launched as a Malaysia’s first mango hybrid.
MATERIALS AND METHODS
This research has been conducted in MARDI Bukit Tangga Station, Bukit Kayu Hitam, kedah, Malaysia. The F1 generation plot was established via open-pollinated
mango crossing approach. Open-pollinated seeds were collected from Strawberry mango variety (Fig. 1) as a maternal parent. A total of 330 F1 progeny plants were
generated, which were planted in the field at spacing of 3m x 3m. All of them were assessed for desirable fruit quality as well as fruit yield, anthracnose and IFR
incidence, fruiting habits and plant dwarfness.
RESULTS AND DISCUSSION
Two promising open-pollinated F1 progenies with a combination of desirable economic traits were identified from the plot. SB003 (Fig. 2), a progeny with international
marketable fruit size (350-450 g), attractive red blush skin and orange flesh color, oval-shaped fruit, sweet-scented, less fibrous and juicy, sweet (TSS: 18-20%) and bit
sour taste, high vitamin C content, high yielding, slight tolerance to anthracnose infection, no IFR incidence and possibility to be a dwarf plant. SB019 (Fig. 3), a progeny
with acceptable fruit size (250-350 g), attractive red blush skin and orange flesh color, oval-shaped fruit, fragrance, sweet and sour flavor, average fruit yield, slight
tolerance to anthracnose infection, absent of IFR and possibility to be a dwarf plant.
Considering all fruit quality parameters, the 2 selected progenies have shown commercially amazing quality characters compare to their maternal parent (Table 1). Fruit
weight is an important parameter in the European and USA market, but in Malaysia mango market there is much more flexibility. The USA market demands fruits varying
from 250 g to 600 g, while European market demands fruits varying from 300 to 450 g (Bally et al., 1999). In this study, both of selected progenies showed fruit size
inside the weight range of European and USA market, which is good to create opportunity for local mango market to penetrate European and the USA markets.
Both of the selected progenies also showed a very attractive red skin color. Europeans prefer a deep-yellow mango that develops a reddish tinge. In the USA, mango
color is an important factor since everyone admires a beautiful mango overlaid with red color. Red skin is considered a necessity in mangoes that are shipped to
European markets, even though the quality maybe inferior to those non-showy cultivars (Pinto et al., 2000). The oval-shaped fruit of both selected progenies are also
superior character in mango packaging and exporting. The roundish-shaped fruit will cause difficulty in packaging and consumer handling (Tomer et al., 1996).
256 | MGC10
The fruit yield and fruit setting of both selected progenies and maternal parent are shown in Table 2. The results showed that both of selected progenies produced high
fruit yield, which was more than 100 fruits per tree. The yield of these selected hybrids was 45-55% higher than their maternal parent.
Table 3 shows the percentage of anthracnose and IFR incidence on fruits of 2 selected hybrids and a parent. It showed a presence of the anthracnose incidence at day
12 after inoculated by Colletotrichum gloeosporioides fungus (Sarip et al., 1992), but the percentage of the incidence was quite low. This result approved that these
selected progenies are slight tolerance to anthracnose infection. The table also shows the selected progenies and parent are free from IFR incidence.
CONCLUSION
SB003 and SB019 are two promising hybrids with marvelous characters developed from hybridization process. However, Genotype x Environmental study has to be
carried out before they can be launched and recommended for commercial cultivation.
ACKNOWLEDGEMENT
The authors gratefully thanks to Malaysia Agricultural Research and Development Centre (MARDI) for the research fund. The authors also wish to thank Mohd Musanif
Ghazali and Mr. Adnan Ambiah for their technical assistance. Appreciation is extended to Deputy Director of Breeding Program, Horticulture Research Centre, MARDI for
supporting the publication of this paper.
REFERENCES
Bally, I.S.E., Harris, M.A., Kulkarni, V.J., Hamilton, D., Johnson, P.R., Robinson, D. and Leonardi, J. 1999. The Australian national mango breeding project. Acta Hort.
509:225-231.
Mohd Azhar, H. and Ithnin, B. 2009. Hybridization of Chok Anan with Strawberry mango clones by hand pollination technique. Proc. 8th Malaysia Genetics Congress.
Pahang, Malaysia 4-6 August. p. 360-363.
Pinto, A.C. de Q., Vargas Ramos, V.H. and Junqueira, N.T.V. 2000. New varieties and hybrid selections from mango hybridization program in central region of Brazil.
Acta Hort. 509: 207-211.
Sarip, J. 1992. Screening of mango resistance against anthracnose. MARDI Res. J. 20(1): 23-28.
Tomer, E., Gazit, S., Lavi, U., Ripa, S.M. and Zipori, I. 1996. Mango breeding in Israel – principals and difficulties. Acta Hort. 455:245-251.
257 | MGC10
Tables
Table 1. Fruit quality characters of two selected progenies and Strawberry variety (maternal parent)
Plant
Fruit
weight
(g)
Flesh
recovery (%)
Fruit
shape
Skin
color
Flesh
color
Aroma
Juicy
Fibrous
TSS
(Brix%)
TTA
TSS/TTA
(BAR)
AA
(VitC)
Taste
Strawberry
182.1
70.3
Roundish
Red
Orange
Yes
Moderate
Low
15.3
0.79
19.4
2.42
Sweet
sour
SB003
442.4
77.0
Oval
Red
Orange
Yes
slightly
Low
18.2
0.85
21.4
5.49
Sweet
sour
S B019
303.6
79.4
Oval
Red
Orange
Yes
slightly
Low
16.7
1.69
9.9
2.81
Sweet
sour
Table 2. Fruit yield and fruit setting of two selected progenies and Strawberry variety (maternal parent)
Plant
Strawberry
SB003
SB019
Fruit yield
60
133
112
Fruit setting/stalk
1
1
2
Table 3. Percentage of anthracnose and IFR incidence of two selected progenies and Strawberry variety (maternal parent)
Plant
Strawberry
SB003
SB019
Anthracnose incidence (%)
90
32
52
258 | MGC10
Fruit setting/stalk
1
1
2
Figures
Fig. 1. Strawberry mango variety
Fig. 2. SB003 progeny
Fig. 3. SB019 progeny
259 | MGC10
ID 093
093
Discovery of Genes Involve in Alkaloid Biosynthesis Pathway of Tongkat Ali Root.
Norlia, B.,
B., Nor Hasnida, H., Norwati, A., Mohd Rosli, H. &Norwati, M.
Forest Research Institute Malaysia(FRIM)
Email: [email protected]
ABSTRACT:
Tongkatali is indigenous to South-East Asian countries and the most popular medicinal plant in Malaysia. The plant extract, especially roots have been widely used in
traditional medicines for its antimalaria, anti-pyretic, antiulcer, cytotoxic and aphrodisiac properties. Wide range of chemical compounds have been isolated and
characterized from root of tongkatali, among which the alkaloids and quassinoids form a major portion. Alkaloids isolated from root of tongkatali has been reported
posses cytotoxic effects. The alkaloids such as canthin-6-one alkaloids and β-Carboline alkaloids have been isolated from root of tongkatali. In compliment to chemical
finding, we carried out molecular study on tongkatali root through transcriptome analysis using next generation DNA sequencing technology. DNA sequencing of
tongkatali roots from 10 - year- old tree using Illumina sequencing technology, produced more than 41 million sequencing reads, while de novo assemblies yielded
44,855 unigenes. Gene ontology (GO) through Blast2GO has categorised the transcripts into 16 groups based on biological process level 2. The main categories were
metabolite process which involved a total of 11,542 unigenes (23%). The Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways database generated for 138
metabolic pathways, among them three were the biosynthesis of alkaloids related, which were Indol, Isoquinoline and; tropane, piperidine and pyridine alkaloid
biosynthesis. In total 20 genes encodes for different enzymes, which involve in the pathways were identified to express in root of tongkatali.
Keywords: Tongkatali, transcriptome, alkaloids, Illumina sequencing technology
INTRODUCTION
Tongkatali is indigenous to South-East Asian countries and the most popular medicinal plant in Malaysia.The plant extract, especially roots have been widely used in
traditional medicines for its antimalaria, anti-pyretic, antiulcer, cytotoxic and aphrodisiac properties(Chan et al., 1986; Kardanoet al., 1991; Ang et al., 1995; Tada et al.,
1991; Morita et al., 1990; Low et al., 2013). Wide range of chemical compounds have been isolated and characterized from root of tongkatali,among which the alkaloids
and quassinoids form a major portion. The alkaloids such as canthin-6-one alkaloids and β-Carboline alkaloids have been isolated from root of tongkatali (Mitsunagaet
al., 1994).Alkaloids isolated from root of tongkatali has been reported posses cytotoxic effects (Kardono et al., 1991). In compliment to chemical finding,we carried out
molecular study on tongkatali root throughtranscriptome analysis using next generation DNA sequencing technology.
Keywords: Tongkatali, transcriptome, alkaloids, Illumina sequencing technology
MATERIALS AND METHODS
METHODS
Plant materials
Ten-year-old tongkatali root was collected from tongkatali plot, Bukit Hari, FRIM. Root harvested was immediately put in liquid nitrogen until further processing. For
longer storage, the root were kept at -80oC.
RNA isolation and integrity analysis
Tongkatali root were taken out from the storage, either from liquid nitrogen or -80oC. Isolation of RNA was carried out using RNeasy Plant Mini Kit (Qiagen) according to
protocol outlined by the supplier. High quality RNA prior to next generation DNA sequencing is very important to ensure a good result. RNA quality was determined
using Agilent 2100 bioanalyzer (Agilent Technologies). Agilent technology assess the RNA quality and grade it as RNA Integrity Number (RIN), a numbering system is
from 1 to 10, with 1 being the most degraded profile and 10 being the most intact. Sample preparation and apparatus set-up to determine the RNA quality was carried
out according to the manual supplied by the supplier.
Illumina sequencing
The total RNA with absorbance 260/280 nm ratio of ~2.0 and RIN number more than 8.0 was chosen for Illumina sequencing. Each of RNA sample was used to
generate a paired end cDNA library for 100 bp-paired-end sequencing reads. Generation of cDNA libraries using mRNA-Seq assay and sequencing on Illumina Genome
analyzer II platform on Solexa NGS were out sourced to Beijing Genome Institute (BGI), China.
Bioinformatics analysis
The raw sequence data was quality checked and trimmed. SOAPdenovo (http:// soap.genomics.org.cn/soapdenovo.htlm) software was used to assemble the sequence
reads into contigs, scaffolds and unigenes. All unigenes were used as queries in searching Nr and SwissProt databases (E-value <10-6) and functional annotated by GO
analysis with Blast2GO software (version 2.4.4; http://www.blast2go.org). Blast2GO is an automated tool for the assignment of gene ontology terms and was designed
for use with novel sequence data (Conesaet al., 2005). Blast2GO software was also used to mapped the annotated transcripts to the Kyoto Encyclopedia of Genes and
Genome (KEGG) in order to identify the genes involved in important pathways.
260 | MGC10
RESULTS AND DISCUSSION
DNA sequencing of tongkatali roots from 10-year-old using Illumina sequencing technology produced a total of 41,357,870 reads. 44,855 unigenes were finally
assembled with an N50 and average length of 843 and 562 bp, respectively. Blastx analysis of assembled unigenes against the GeneBank non-redundant protein
database resulted in the identification of 19,000 (42.36%) sequences with at least one significant alignment to an existing gene. The other 25,855 sequences (57.64%)
did not have any hit in the GenBank. Among the BLASTX-hit transcripts, most of them showed the highest homology with those from Vitisvinifera (5,047),
Ricinuscommunis (4,513), Populustrichocarpa (4,224) and Prunuspersica (3,023).
Gene ontology (GO) through Blast2GO were used to classify the functions of the assembled transcripts. Analysis through biological process level 2 has categorised the
transcripts into 16 groups and the main categories were metabolite and cellular process (Figure 1). A total of 11,542 unigenes(23%)whichwere categorised under
metabolite processes, are useful for further analysis to identify genes involved in biosynthesis of potential compound in tongkatali roots. The KEGG maps for 138
metabolic pathways were generated from the assembly unigenes and the results were exported. Three of them were the biosynthesis of alkaloids related, which were
Indol, Isoquinoline and; tropane, piperidine and pyridine alkaloid biosynthesis. Intotal 20 genes encodes for different enzymes, which involve in the pathways were
identified to up-regulate in root of tongkatali. The genes and enzymes encoded were listed in table 1.
In summary, analysis on the transcriptome of tongkatali roots has provided valuable resources for gene discovery, which will accelerate the research progress in
molecular biology of tongkatali. These results demonstrate that the Illumina paired-end sequencing together with an advance bioinformatics is a fast and cost effective
approach for gene discovery in non-model organism such as tongkatali.
ACKNOWLEDGEMENTS
This project was supported by FRIM development fund (RMK-10). We thank Director of Natural product Division and staff of Etnobotany, FRIM for the tongkatali roots
samples; and Codon Genomics Sdn. Bhd. for bioinformatics assistance.
REFERENCES
1. Ang, H. H., Chan, K.L. &Mak J.W. 1995. In vitro antimalaria activity of quassinoids from Eurycoma longifolia against Malaysian chloroquine-resistant
Plasmodium falciparum isolates. PlantaMedica, 61:177-178
2. Bhat, R. &Karim, A.A. 2010. Tongkat Ali (Eurycomalongifolia Jack): a review on its ethnobotany and pharmacological importance. Fitoterapia, 81:669-679
3. Chan, K.L., O’Neill, M.J., Phollipson, J.D. &Warhurst, D.C. 1986. Plants as sources of antimalarial drugs. Part 3. Eurycoma longifolia Jack. Planta Medica,
52:1205-107
4. Conesa, A., Gotz, S., Garcia-Gomez, J.M., Terol, J., Talon, M. & Robles, M. 2005. Blast2GO: a universal tool for annotation, visualization and analysis in
functional genomics research. Bioinformatics, 21(18):3674-3676
5. Kardono, L.B.S., Angerhofer, C.K., Tsauri, S., Padmawinata K., Pezzuto, J.M. &Kinghorn, A.D. 1991. Cytotoxic and antimalarial constituents of the roots of
Eurycoma longifolia. Journal of Natural Products, 54:1360-1367
6. Low, B-S., Kumar Das, P. & Chan, K-L. 2013. Standardized quassinoid-rich Eurycoma longifolia extract improved spermatogenesis and fertility in male rats
via the hypothalamic-pituitary-gonadal axis. Journal of Ethnopharmacology, 145:706-714
7. Mitsunaga, K., Koike, K., Tanaka, T. &Itokawa, H. 1994. Canthin-6-one alkaloids from Eurycoma longifolia. Phytochemistry 35: 799-802
8. Morita, H., Kishi, E., Takeya, K., Itokawa, H. & Tanaka, O. 1990. New quassinoids from the roots of Eurycoma longifolia. Chemistry Letters, 749-752
9. Tada, H., Yasuda, F., Otano, K., Doteuchi, M., Ishihara, Y. &Shiro, M. 1991. New antiulcer quassinoids from Eurycomalongifolia. European Journal of
Medicinal Chemistry, 26:345-349
261 | MGC10
Figure 1: Pie chart representation of GO classification based on biological process. Numbers in bracket indicate the number of transcripts in each particular class.
Table 1: Up-regulated unigenes of transcriptome data from tongkatali root involved in alkaloids biosynthesis pathways.
unigenes and the enzyme code were listed accordingly.
Pathway
Enzymes code
Enzymes name
IndoleAlkoloid biosynthesis
4.1.1.28
L-tryptophan decarboxylase
4.3.3.2
Strictosidine synthase
1.14.11.20
Deacetoxyvidoline 4-hydroxylase
1.14.13.73
Tabersonine 16-hydroxylase
3.1.1.78
Polyneoridine-aldehyde esterase
Isoquinoline Alkaloid Biosynthesis
1.4.3.2
L-amino acid oxidase
2.6.1.1
Aspartate aminotransferase
2.6.1.5
Tyrosine aminotransferase
2.6.1.57
Aromatic-amino-acid transaminase
4.1.1.25
Tyrosine decarboxylase
4.1.1.28
Aromatic-L-amino acid
decarboxylase
1.4.3.21
Primary-amine-oxidase
2.3.1.150
Salutoridinol 7-O-acetyltransferase
1.1.1.247
Codeinonereductase
2.1.1.140
S-coclaurine N-methyltransferase
Tropane, Piperidine and Pyridine
2.1.1.53
Putrescine N-methyltransferase
alkaloid Biosynthesis
1.4.3.21
Primary-amine oxidase
2.6.1.1
Aspatate aminotransferase
2.6.1.5
Tyrosine amino transferase
2.6.1.9
Histidol-phosphate aminotransferase
2.6.1.57
Aromatic-amino acid transaminase
1.1.1.237
Hydroxyphenyl pyruvate reductase
1.1.1.206
Tropine dehydrogenase
1.14.11.11
Hyoscyamine-dioxygenase
262 | MGC10
Biosynthesis pathways, enzymes encoded by the
Unigenes
Unigene_6964
Unigene_5468
Unigenes_121
Unigenes_21637
Unigenes_5543
Unigenes_2926
Unigenes_1367
Unigenes_11260
Unigenes_9670
Unigenes_35268
Unigenes_32889
Unigenes_923
Unigenes_20529
Unigenes_4386
Unigenes_41223
Unigenes_1177
Unigenes_923
Unigenes_1367
Unigenes_11260
Unigenes_716
Unigenes_9670
Unigenes_4486
Unigenes_19635
Unigenes_43328
ID 095
095
Studies on Heterosis in Brinjal (Solanum
(Solanum melongena L.) for Yield and Its Components
Suhana, O.1, Abdul Rahman, M.1 and Mohamad, O.2
Horticulture Research Centre, Ibu Pejabat MARDI, Persiaran MARDI-UPM
2
Faculty of Plantation and Agrotechnology, UiTM
Email: [email protected]
1
Key words:
words Brinjal, heterosis, yield, yield components
ABSTRACT:
Five hybrids derived from crossing of five selected varieties without reciprocal were evaluated at MARDI Research Plot in Serdang. The objective of this study was to
select the best hybrids for yield and its components based on heterosis value. Data were recorded on yield and its components that are time to flowering, plant height,
fruit number per plant, fruit weight, fruit length, fruit circumference and yield per plant. Result showed that there is significant different from all the parameters studied as
shown by ANOVA table. All traits shown low to intermediate heterosis as compared to mid-parent and best-parent. As compared to mid-parent, fruit weight give the
highest heterosis (79.90%) followed by fruit circumference (37.50%), yield per plant (36.24%), fruit lenght (22.54%), and fruit number per plant (3.40%). Negative
heterosis were observed for plant height (-4.20%) and early flowering (-13.80%). These value reflect dwarfness and earliness in flowering characters. The best potential
hybrids is NTH08077 x T.Telunjuk which showed significant heterosis value of three out of seven traits studied. The hybrids need to be further evaluated before they can
release for commercial cultivation.
Introduction
Brinjal (Solanum melongena L.) is a common and important vegetable in many Asian countries including Malaysia. Crop improvement of brinjal are involves strategies to
enhance the yield and quality components. The common approach of selecting parents based on performance does not necessarily lead to fruitful results. The selection
of best parents for hybridization has to be based on the complete genetic information of potential parents. With these points in view, heterosis studies were undertaken
which are prerequisite in any plant breeding programme which provides the desired information regarding varietal improvement or exploiting heterosis for commercial
purposes.
Materials and Methods
The study was conducted at MARDI Research Plot, Serdang in 2010 and 2011. Five selected varieties namely MTE 1, MTE 2, Terung Bujur, Terung Telunjuk and
NTH080077 were crossed randomly excluded reciprocal and five combinations of F1 hybrid seed were obtained. These seed of hybrids MTE 2 x MTE 1, MTE 2 x
NTH08007, MTE 2 x T.Telunjuk, T.Bujur x T.Telunjuk, NTH080077 x T. Telunjuk, together with the five parents were grown in a Randomized completed design with
three replications. Observation were recorded for time to flowering, plant height, fruit number per plant, fruit weight, fruit lenght, fruit circumference and yield per plant.
Analysis of Variance (ANOVA) and Duncan’s Multiple Range were used distinguish the plant means (SAS Inst. 1990). Heterosis was calculated as the percentage of F1
performance in the favourable direction over Mid-Parent (MP) and Better-Parent (BP).
Results and Discussion
Analysis of variance for yield and its components was presented in Table 1. All genotypes were significant for all traits measured. Coefficient of variation (CV) values for
yield and its components ranging from 4.14% to 15.84% showed that less variability occur for all traits. Heterosis estimates in Table 2 indicated that T.Bujur x T.Telunjuk
showed the early flowering trait over Mid-Parent (MP) and Better-Parent (BP) with negative value (-13.8% and -19.7% respectively) which it takes about 49.9 days to
flower. Number of days flowering is an important component in determining the duration of the fruit on the plants.
In this study, the NTH080077 x T. Telunjuk showed dwarfness traits in plant height for both MP and BP with ranging from -14.2% and -22.5% respectively. This hybrid
also showed a good and acceptable heterosis for fruit weight (79.9% (MP) and 54.2% (BP), fruit circumference (37.50% (MP) and 2.45% (BP) and yield (26.18% (MP)
and 18.32% (BP). The heterosis estimates of F1 hybrids for fruit number per plant not occurred for both over MP and BP with ranging from -43.6% - 3.4% and similarly
result revealed from fruit weight (except NTH080077 x T. Telunjuk) and fruit length (except T.Bujur x T.Telunjuk). Heterosis in yield apparently arose from the fruit weight
component rather than from fruit number, fruit length and fruit circumference. For yield, three out of five hybrids showed heterosis over MP namely MTE 2 x NTH08007
(36.24%), MTE 2 x T.Telunjuk (30.58%) and NTH080077 x T. Telunjuk ( 26.18%) while only NTH080077 x T. Telunjuk (18.32%) expressed over BP.
Conclusions
Low to intermediate heterosis was recorded over Mid-Parent and Better-Parent for all traits studied. The hybrids derived from crossing of NTH08077 and T.Telunjuk
showed a good potential which showed dramatic increase in yield including fruit weight and fruit circumference. On the other hand, further evaluation need to be done
to confirm this findings
263 | MGC10
Acknowledgement
The authors thanks MARDI and UKM for supporting this studies
References
Chadha, M.L, Joshi, A.K. & Ghai, T.R. 1990. Heterosis breeding in brinjal. The Indian Journal of Horticulture 47: 417-423.
Singh, A.K., Pan, R.S., Mathura Rao & Krisna Prasad, V.S.R. 2004. Heterosis for yield and its contributing attributes in brinjal (S. melongena L.). Vegetable Science.
Table 1. Analysis of variance mean square values, Coefficient of variation (CV) and mean for yield and its components in brinjal
Source
df
Time to
Plant
Fruit
Fruit weight
Fruit
Fruit circumference
circumfer ence
Yield/
flowering
height (cm)
number/
(g)
length (cm)
(cm)
Plant (g)
(days)
Plant
Treatment
11
49.28**
79.68**
109.96**
3639.36**
107.28**
77.19**
690094.49**
Error
18
5.91
18.53
13.38
27.75
1.17
0.69
28331.60
Total
29
13.02
15.84
7.25
8.06
5.48
11.64
33.06
23.09
72.66
13.43
15.20
1446.06
T.Bujur x T.Telunjuk
NTH080077 x T. Telunjuk
49.9±2.2
-13.8
-19.7
43.8±4.2
39.7
39.0
23.9±0.1
-12.9
-43.6
55.7±1.0
-25.1
-55.0
18.9±1.3
22.54
20.21
10.1±0.4
-27.12
-48.21
1308.6±21.8
-10.54
-36.52
63.2±0.8
5.1
5.0
27.5±3.7
-14.2
-22.5
24.3±0.6
-24.6
-32.3
47.0±0.6
79.9
54.2
7.1±0.1
-4.08
-25.10
12.9±0.1
37.50
2.45
1059.2±53.9
26.18
18.32
CV
4.41
** = Significantly different at p < 0.01
Mean
55.18
Table 2. Mean + SE and Heterosis of hybrids over Mid-Parent and Better-Parent
MTE 2 x MTE 1
MTE 2 x
NTH08007
Time to flowering
Mean + SE
58.3±2.5
54.0±0.5
(days)
Heterosis (MP)
1.2
-1.5
Heterosis (BP)
0.3
-6.8
Plant height (cm)
Mean + SE
39.3±3.7
27.7±1.7
Heterosis (MP)
11.4
2.2
Heterosis (BP)
3.4
-1.0
Fruit
Mean + SE
15.6±1.8
25.6±2.1
number/plant
Heterosis (MP)
-9.0
3.4
Heterosis (BP)
-19.7
-23.6
Fruit weight (g)
Mean + SE
108.1±5.0
72.9±5.2
Heterosis (MP)
-5.2
-0.0
Heterosis (BP)
-16.1
-41.4
Fruit length (cm)
Mean + SE
15.6±0.7
8.7±0.3
Heterosis (MP)
-21.92
6.47
Heterosis (BP)
-43.7
-24.64
Fruit
Mean + SE
19.8±0.8
19.8±0.7
circumference
Heterosis (MP)
-5.46
11.05
(cm)
Heterosis (BP)
-23.08
-17.89
Yield (g)
Mean + SE
1705.6±276.9
1828.8±51.3
Heterosis (MP)
-8.6
36.24
Heterosis (BP)
-9.05
-7.84
MTE 2 x
T.Telunjuk
52.7±0.4
-9.7
-12.8
35.4±0.7
19.0
17.4
22.3±0.3
-8.4
-36.6
64.6±1.6
-45.4
-4.7
9.8±0.03
-23.95
-27.26
13.2±0.03
-17.25
-46.44
1439.4±50.0
30.58
-9.79
264 | MGC10
ID 097
097
Evaluation and Selection of Tomato Lines for Lowland Cultivation
Nor Hazlina, M.S.,
M.S., Sebrina Shahniza, S., Rozlaily, Z.
Horticulture Research Centre, MARDI Head Quarters, Persiaran MARDI-UPM
Email: [email protected]
ABSTRACT:
The performances of fifteen tomato improved lines from Taiwan’s AVRDC were evaluated under Malaysian environment condition. Experiments were carried out at
MARDI Station in Serdang and Jalan Kebun. The experiments were laid out in completely randomized block design (RCBD) with four replicates. The traits under studies
are fruit weight, fruit size, fruit colour, fruit taste and fruit yield. The incidence of bacterial wilt on the plants was also taken. Results showed that the fruit yield, fruit
weight and fruit length were significantly different among the lines. In term of plant growth performance, nine lines did not growing well and four died at early stage of
planting. Only two lines performed well and showed low incidence of bacterial wilt caused by Ralstonia solanacearum. These lines will further be tested and evaluated
together with the local tomato varieties to find the best potential variety for the low land cultivation.
INTRODUCTION
Tomato is one of the important vegetables in Malaysia. The total local production of tomato was increased from 43 000 MT (2004) to 59 000 MT (2007) (Anon 2008).
Being a temperate crop, tomato in Malaysia is best grown in Cameron Highlands where the temperature is low. The mean temperature is about 18 °C with a range 925°C. However, vegetable cultivation in the highland has been reduced due to land limitation and this could be solved by extending the cultivation to the low land area. It
was found that tomato grown in lowland produces smaller and less intense red fruit colour which did not reach to the standard tomato requirement. Other problems
include susceptible to diseases especially the soil born bacterial wilt which can cause 50% mortality.
To reduce the incidence of bacterial wilt and yet still having reasonably good fruit size as in the lowlands, tomato was recommended to be planted in soilless culture
under rain shelter / fertigation system. However, this has increased the cost of production. It was reported that the production cost under rain shelter is 2.3 times higher
than the open system. The total investment cost calculated for one hectare area under was RM 326,875 whereas in an open area was RM141,827 (Khairol et al. 2006)
The high cost is due to the cost of structure (RM 125,000), planting media (RM 15,000 per hectare) and fertigation system (RM 25,000 per hectare).
Therefore, it is a need to produce tomato variety that could be grown in high temperature for low land cultivation. A number of improved lines from AVRDC have been
selected to be tested under Malaysian environment condition. The traits under studies are fruit weight, fruit size, fruit colour, fruit taste and fruit yield. The incidence of
bacterial wilt on the plants was also taken.
MATERIALS AND METHOD
A total of 15 tomato lines (AVT1, AVT2, AVT3, AVT4, AVT5, AVT6, AVT7, AVT8, AVT9, AVT10, AVT11, AVT12, AVT13, AVT14, AVT15) provided by the Taiwan’s AVRDC
were planted and evaluated in MARDI’s Station at Serdang and Jalan Kebun. Experiments were conducted in a Randomized Completely Block Design (RCBD) with four
replicates. Twenty plants per varieties per each replicates were planted in a single row bed at a planting distance of 60 within row and 150 cm between beds (60 cm x
150 cm). The single row bed was covered with double- coated silver plastic mulch with black sided facing downwards while the silvery surface facing upwards. Individual
plant staking was adopted and minimal pruning were conducted at early growth stage to remove the unwanted shoots. Pest and disease maintenance and standard
fertilizer regime was adopted and disease incidences were monitored accordingly.
RESULTS AND DISCUSSION
Fruit yield
The average fruit yield of fifteen tomato lines in Serdang was 463.23 g/plant and in Jalan Kebun were 458.79 g/plant. The average value of both locations was 460.67
g/plant with a range 53.33 g/plant to 1579.1 g/plant. The AVT11 (1026.57 g/plant), AVT1 (945.57 g/plant) and AVT13 (751.08 g/plant) had higher yields in Jalan
Kebun while AVT15 (929.84 g/plant), AVT14 (743.80 g/plant), and AVT3 (631.62 g/plant) were the top higher yield in Serdang (Figure 1). The average values of fruit
yield obtained in Jalan Kebun were higher by 26% compared to Serdang. The analysis of fruit yield showed there were significant differences among the fifteen tomato
lines between locations as revealed by the analysis of variance indicating that tomato lines had a different behavior in both Serdang and Jalan Kebun location (Table 1).
Fruit weight
The average of fruit weight in Jalan Kebun was 52.58 g/fruit while in Serdang was 41.57 g/fruit. The average of the fruit weight was 47.77 g/fruit ranging from 7.7
g/fruit (AVT8) to 172.50 g/fruit (AVT11). The AVT1 (105.06 g/fruit) gave the higher fruit weight in Jalan Kebun while AVT11 (85.16 g/fruit) gave the highest fruit weight
in Serdang (Figure 2). According to the analysis of variance, the results showed there were statistical differences among fifteen tomato lines in Serdang and Jalan Kebun
locations. Statistically significant differences in the fruit weight indicate there was the great variability among the tomato lines studied.
265 | MGC10
Fruit colour
It was found that the fruit colour among the fifteen tomato lines is red and orange. AVT7, AVT8, AVT10, AVT13 and AVT14 were grouped in reddish fruit while AVT1,
AVT3, AVT9, AVT11, AVT12 and AVT15 were grouped in orange fruit skin colour (Table 2).
TSS
The average value of total soluble solids was 3.74 oBrix with a range from 2.15 oBrix and 5.04 oBrix. AVT15 had the highest TSS and AVT8 was the lowest. There were
no significant difference found among fifteen tomato lines in both Serdang and Jalan Kebun locations.
pH
The average pH value was 3.93 with a minimum value was 3.64 and a maximum was 4.20 for the AVT15 and AVT3 respectively. There were no significant differences
and no variability in fruit taste among the fifteen of AVRDC tomato lines presented in Serdang and Jalan Kebun.
Bacterial wilt incidence
The performance of fifteen tomato lines showed nine lines did not grow well, four died at early stage of planting and two lines performed well under Malaysian
environment. AVT13 and AVT14 showed the lower incidence of bacterial wilt and performed well under Serdang and Jalan Kebun environment.
CONCLUSIONS
There was a range of variability on fruit size among the fifteen tomato lines tested in this study. Four lines i.e AVT2, AVT4, AVT5 and AVT6 did not performed well and
died at very early stage of planting. Two lines i.e AVT13 and AVT14 showed low incidence of bacterial wilt and can perform well under the hot or stress environment.
These lines show good candidate for lowland cultivation and further evaluation will be carried out for detail information.
REFERENCES:
1.
2.
3.
Anon (2008). Situation and Outlook. Vegetable Industry. Economic and Technology research Centre, MARDI
http://faostat.fao.org
Khairol, M.A., Noor Auni, H., Roslina, A., Mohd. Redzuan, M.S. (2006). The Prospect of Tomato Production under Rainshelter in Malaysia. Proceeding on
greenhouses, environmental controls and in-house mechanization for crop production in the tropics and sub-tropics; in Acta Horticulture. 710, pp. 539-542.
yi el d M
EAN
1100
1000
900
800
700
600
500
400
300
200
100
0
A
V
T
1
A
V
T
1
0
A
V
T
1
1
A
V
T
1
2
A
V
T
1
3
A
V
T
1
4
A
V
T
1
5
A
V
T
3
A
V
T
7
A
V
T
8
A
V
T
9
A
V
T
1
A
V
T
1
0
Figure 1
AVT1
AVT14
AVT5
A
V
T
1
2
A
V
T
1
3
A
V
T
1
4
A
V
T
1
5
A
V
T
3
A
V
T
7
A
V
T
8
A
V
T
9
Ser dang
Jkebun
sam
pl e
A
V
T
1
1
AVT10
AVT15
AVT6
AVT11
AVT2
AVT7
AVT12
AVT3
AVT8
l ocat i on
AVT13
AVT4
AVT9
Yield of fifteen tomato lines in Serdang and Jalan Kebun locations
266 | MGC10
sam
pl e
wg M
EAN
110
100
90
80
70
60
50
40
30
20
10
0
A
V
T
1
A
V
T
1
0
A
V
T
1
1
A
V
T
1
2
A
V
T
1
3
A
V
T
1
4
A
V
T
1
5
A
V
T
3
A
V
T
7
A
V
T
8
A
V
T
9
A
V
T
1
A
V
T
1
0
A
V
T
1
1
Figure 2
AVT1
AVT14
AVT5
A
V
T
1
3
A
V
T
1
4
A
V
T
1
5
A
V
T
3
A
V
T
7
A
V
T
8
A
V
T
9
Ser dang
Jkebun
sam
pl e
A
V
T
1
2
AVT10
AVT15
AVT6
AVT11
AVT2
AVT7
AVT12
AVT3
AVT8
sam
pl e
l ocat i on
AVT13
AVT4
AVT9
Mean of tomato fruit weight in Serdang and Jalan kebun locations
Table 1 F values and standard deviation of six variables in fifteen tomato lines at Serdang and Jalan Kebun location
Variable
Weight
Length
Width
TSS
pH
Yield
Mean
Std Dev
F values
47.77
34.78
40.96**
4.70
2.06
6.96**
4.04
1.14
60.79**
3.74
1.19
12.86ns
3.93
0.25
14.33ns
460.67
383.83
2.91*
ns = not significant (P.0.05); * significant (p<0.05); ** highly significant (p<0.01)
267 | MGC10
Table 2
Fruit quality characteristics and bacterial wilt scoring incidence of fifteen tomato lines evaluated at Serdang and Jalan Kebun locations
1=Perfect condition
2=Slight; less than 15% of foliage or plant affected
3=Moderate; between 16%=40% of foliage or plant affected
4=Extreme; over 41% of foliage or plant affected
Tomato lines
Fruit weight
Fruit length
Fruit width
TSS
pH
Yield
AVT1
AVT2
AVT3
AVT4
AVT5
AVT6
AVT7
AVT8
AVT9
AVT10
AVT11
AVT12
AVT13
AVT14
AVT15
105.06
57.18
36.84
15.87
22.17
16.95
93.91
37.64
61.22
34.06
56.90
5.08
6.59
5.00
4.81
3.26
3.66
5.10
3.94
5.42
4.29
4.36
5.73
3.92
3.53
2.60
3.39
2.87
5.74
3.97
4.40
3.78
4.69
4.11
3.98
3.08
2.03
3.39
4.12
4.37
4.08
3.87
2.77
4.63
4.14
4.19
3.94
3.91
3.75
3.88
3.81
3.90
3.97
4.05
3.65
945.57
497.50
221.05
100.85
169.37
234.30
759.46
406.06
520.54
573.84
606.86
268 | MGC10
Bacterial
wilt
incidence
3
4
3
4
4
4
3
3
3
3
3
3
2
2
3
Colour
Orange
Orange
Red
Red
Orange
Red
Orange
Orange
Red
Red
Orange
ID 100
Comparative Performance of Nigerian X Avros, Cameroon X Avros and Zaire X Avros Genetic Materials Planted on Inland Soils
Nor Azwani Abu Bakar,
Bakar , Mohd Din Amiruddin, Noh Ahmad, Norziha Abdullah and Rajanaidu Nookiah
Malaysia Palm Oil Board
Email: [email protected]
ABSTRACT:
The study aimed at comparing the performance of Nigerian (NGA) x AVROS, Cameroon (CMR) x AVROS and Zaire (ZRE) x AVROS genetic materials, planted on inland
soils, in MPOB Keratong. The progenies were planted in a randomized complete block design (RCBD) with two replications. Analysis of variance (ANOVA) revealed that
both NGA x AVROS and ZRE x AVROS crosses were not significantly different for fresh fruit bunch (FFB) yield but highly significant for bunch number (BNO) and average
bunch weight (ABWT). However, ANOVA for CMR x AVROS showed that the crosses only highly significant for FFB but not for the other yield components. For fruit
components, ANOVA showed highly significant difference for mesocarp to fruit (M/F), shell to fruit (S/F), and oil to dry matter (O/DM) indicating there was high genetic
variation for these characters. For palm height, NGA x AVROS and CMR x AVROS crosses showed significant different with mean palm height of 2.46 and 2.38 m,
respectively. Progeny PK 2005 from NGA x AVROS gave the lowest palm height (2.08 m) with mean height increment of 0.34 m yr-1, lower than the current planting
material (0.45 m yr-1). Generally, the performance of the ZRE x AVROS crosses was better for FFB yield and its components. NGA x AVROS and CMR x AVROS crosses on
the other hand showed higher potential for bunch quality characters.
Key words: germplasm; performance and oil palm
Introduction
As the most traded vegetable oils, the oil palm (Elaies guineensis) is ranked as the world's highest yielding oil crop with an output 5-10 times greater per hectare than
other leading vegetable oils (global-palm-oil, 2013). Malaysia is the second largest producer of palm oil (18 million tonnes for about 4.2 million hectares) after Indonesia
(23.9 million tonnes for about 6.0 million hectares) (Mielke, 2011). The palm oil industry of the country is the fourth largest contributor to the national economy and
currently accounts for RM53 billion in the gross national income. The Malaysian oil palm industry is supported by strategic policies as well as research and development
(R&D) activities from the Malaysian Palm Oil Board (MPOB) in developing productive planting material. However, the very narrow genetic base of current oil palm was a
major obstacle towards increasing yields of the oil palm genetic materials. Hence, since 1981, MPOB has carried out a number of germplasm explorations in Africa and
South America for germplasm collections of E. guineensis and E. oleifera (Rajanaidu, et al., 1996).
Elaeis guineensis, the African tropical oil palm has attributed of interest to oil palm breeder particularly in high yield, dwarfness, high iodine value and high kernel content.
MPOB has discovered the potential palms collection of elite oil palm planting materials via selecting the outstanding Nigerian dura and pisifera palm to increase the level
of genetic variability in current Deli duras and teneras/pisifera (Rajanaidu, et al., 1996). The germpalms materials also have been screened for resistance planting
material to the Ganoderma basal stem rot disease, a serious threat to oil palm industry in Malaysia. Some CMR and the Democratic Republic of the Congo (DRC - exZaire) materials populations have shown a high tolerance to Ganoderma disease in field planting (Idris et al. 2005 and Soh et al., 2009). They also have been highlighted
for their high combining ability (Mohd Din et al., 2005).
The high potential of these elite materials has driven the breeders to cross the germplasm materials with AVROS pisifera, a source of pollen originated from Zaire’s Eala
Botanical Garden. The AVROS has been widely distributed to become as the source of pisifera parents for major seed producers worldwide. They are noted for high oilyielding and vigorous growth-conferring attributes (Janick and Paull, 2008). They also exhibit high mesocarp-to-fruit and oil to bunch ratios but are tall (Lee and Yeow,
1985; Rajanaidu et al., 1986 and Rao et al., 1999; Noh, et al., 2012). Thus, MPOB examined a total of 14 Elaies guineensis germplasm material crossed with AVROS
pisifera as male parent, planted in inland soil, at 136 palms ha−1 in 1996. Therefore, this paper outlines the performance of NGA x AVROS, CMR x AVROS and ZRE x
AVROS genetic materials planted in MPOB Keratong, Pahang.
Materials and Method
A total of fourteen progenies of oil palm from NGA x AVROS, CMR x AVROS and ZRE x AVROS crosses were planted in Trial 0.351 in inland soil at MPOB Keratong
Research Station in 1996. They were laid down in triangular planting system at 9 m apart in randomized Completely Block Design (RCBD) with sixteen palms per plot
(progeny) in two replications. The germplasm materials originated from Africa were used as female parents and the male parents were the AVROS pisiferas planted at
Trial 0.174 MPOB Kluang Research Station. The site in Keratong is characterized by soils of Serdang series and average annual rainfall below 2000 mm (Djonko et al.,
2011). Data collections were carried out for bunch yield (2004 - 2007), bunch quality components (2000 - 2012) and one round vegetative measurement (2004). The
data were analyzed by using Statistical Analytical System (SAS) with respect to bunch yield, fresh fruit bunch (FFB), average bunch weight (ABWT) and number of
harvested bunches (BNO), bunch quality characters (fruit to bunch (% F/B), mesocarp to fruit (% M/F), shell to fruit (% S/F) and kernel to fruit (% K/F) ratios) were
analyzed as described by Blaak et al., (1963) and then modified by Rao et al., (1983) on individual palms.
269 | MGC10
Results and discussion
Analysis of variance (ANOVA) revealed that NGA x AVROS and ZRE x AVROS crosses were not significantly different for fresh fruit bunch (FFB) yield but they were highly
significant for bunch number (BNO) and average bunch weight (ABWT) components. On the contrary, ANOVA for CMR x AVROS showed highly significant for FFB but not
for the other bunch yield components (Table 1). Mean performance of the three crosses resulted that the highest mean for FFB was 169.67 kg palm -1 yr -1, with mean
BNO of 10.59 bunches palm-1 yr -1 and ABWT of 16.51 kg bunch-1 which came from ZRE x AVROS crosses. On the other hand, the yield components (FFB, BNO and
ABWT) for all crosses were higher when compared to standard cross (DxP) which gave 148.5 kg palm -1 yr -1 , 9.73 bunches palm-1 yr -1 and 15.27 kg bunch-1
respectively except for CMR x AVROS which resulted slightly the same. Among the 14 progenies, PK 1963 had the highest FFB yield of 177.97 kg palm -1 yr -1, more
than 15% above the grand mean. Highly significant difference for bunch quality components viz. mesocarp-to-fruit (M/F), shell to fruit (S/F), and oil-to-dry matter (O/DM)
indicating high genetic variation for these characters. PK 1867 and from NGA x AVROS had M/F of 82.49 % and consequently ranked as the lowest shell-to-fruit ratio
(S/F) with 7.83%. ANOVA showed that O/DM was significantly different except for CMR x AVROS and they were reasonably good which ranged from 74.22 to 78.40 %
for all progenies. On the other hand, progeny PK 1815 and PK 1923 from ZRE x AVROS crosses had good fruit-to-bunch ratio (F/B) with 66.87 and 67.16 %,
respectively. NGA x AVROS was the only cross that gave a significant different result for O/B and exhibited the highest mean of 25.70 %, derived from PK 1867, followed
with PK 2005 and PK 1768 with 24.27 % and 24.20%, respectively. ANOVA indicated highly significant differences among progenies derived from NGA x AVROS and
CMR x AVROS for palm height. Progeny PK 2005 from NGA x AVROS gave the lowest palm height (2.08 m) with mean height increment of 0 .34 m yr- , lower than the
current planting material (0.45 m yr-1).
Table 1: Means Square for bunch yield, bunch trait and vegetative measurement of NGA x AVROS, CMR x AVROS and ZRE x AVROS materials
Country
Source of Variance
FFB
BNO
ABWT
M/F
S/F
O/DM
F/B
O/B
HT
df
Between Family
3
801.63ns
54.58**
68.93**
311.97**
276.49**
47.64**
69.25ns
129.32**
1.45**
Within Family
67
1613.50ns
14.15ns
8.51ns
15.78ns
6.73ns
4.54ns
31.95ns
9.10ns
0.14ns
Between Family
6
7709.45**
22.63ns
28.58 ns
127.64**
53.66**
11.51*
94.56*
5.73ns
0.57**
Within Family
100
3022.53ns
14.15ns
19.43ns
26.73ns
9.73ns
5.61ns
48.46ns
11.36ns
0.19ns
Between Family
2
907.78ns
47.50**
53.96**
14.04ns
3.07ns
22.19**
27.24ns
10.77ns
0.21ns
Within Family
44
1612.26ns
8.02ns
13.59ns
27.04ns
10.46ns
4.76ns
28.19ns
9.11ns
0.11ns
NGA x AVROS
CMR x AVROS
ZRE x AVROS
270 | MGC10
Table 2: Means of NGA x AVROS, CMR x AVROS and ZRE x AVROS materials
Country
NGA x AVROS
CMR x AVROS
ZRE x AVROS
DxP
Progeny
Code
Mean 20042004 -2007
PK 1595
FFB
154.52a
BNO
11.94a
PK 1768
143.10a
7.80c
PK 1867
158.07a
9.78b
PK 2005
157.49a
11.75a
Mean 2012
ABW
13.27b
2004
M/F
72.05c
S/F
17.69a
O/DM
74.22b
F/B
57.06b
O/B
18.97b
HT
2.21b
17.89a
78.77b
10.29b
78.22a
61.59a
24.20a
2.77a
16.29a
82.49a
7.83c
78.04a
61.74a
25.70a
2.58a
13.94b
80.08a
10.02b
77.41a
61.46a
24.27a
2.08b
2.463803
Mean
154.0276
15 4.0276
10.12324
15.61493
79.38303
10.51318
77.29167
60.81348
23.91727
PK 1776
103.99b
6.91b
12.67b
73.58ab
12.57cd
75.30b
62.70a
22.21a
2.74a
PK 1885
146.02ab
9.52ab
15.52ab
68.21c
13.10bcd
77.01ab
61.92a
20.47a
2.30b
PK 1904
163.56a
9.91ab
17.16a
76.94a
17.85a
78.40a
58.19ab
22.40a
2.37b
PK 1917
153.91a
9.43ab
16.11ab
71.30bc
14.57bcd
76.35ab
61.96a
21.48a
2.14b
PK 1922
138.07ab
8.52ab
15.99ab
71.30bc
12.04d
76.34ab
64.43a
22.04a
2.46ab
PK 1963
177.97a
10.89a
16.21ab
72.19bc
15.02bc
76.55ab
61.27ab
21.48a
2.44ab
PK 1971
146.88ab
9.72ab
15.64ab
77.16a
15.73ab
76.45ab
55.53b
21.58a
2.21b
Mean
147.1628
9.222336
15.68243
72.5672
14.63796
76.70118
61.26355
21.65935
2.382804
PK 1815
173.89a
10.31b
17.28a
71.72a
15.88a
74.98b
66.87a
21.65a
2.50a
PK 1858
174.47a
12.75a
14.07b
73.44a
15.33a
77.41a
64.35a
22.99a
2.36a
PK 1923
161.03a
9.16b
17.62a
73.47a
14.92a
75.10b
67.16a
21.02a
2.60a
Mean
169.6719
16 9.6719
10.59043
16.50957
72.67763
15.46816
75.71474
66.21895
21.86895
2.49
Mean
Mean
148.5354
9.7302
15.2654
82.29
9.91
78.52
63.73
26.41
2.41
Note: FFB = fresh fruit bunch, BNO = bunch numbers, ABWT=average bunch weight, N= number, MFW= mean fruit weight, M/F= mesocarp to fruit, K/F= kernel to
fruit, S/F= shell to fruit, O/DM= oil to dry mesocarp, F/B = fruit to bunch, O/B = oil to bunch, K/B = kernel to bunch, HT= height and SC= DxP standard cross **, * and
ns are significant at P < 0.01, P <0.05 and non-significant, respectively.
Conclusion
Analysis of variance (ANOVA) showed NGA x AVROS performed better in term of bunch quality such as M/F, S/F and O/DM as these characters were highly significant
and showed promising results. ZRE x AVROS on the other hand was performing well for bunch traits. Meanwhile, CMR x AVROS showed average performance for most
of the traits. The genetic base of the current parental materials can be improved by intercrossing with the germplasm materials that showed high genetic variability level
to develop new lines of parental materials.
Acknowledgement
Acknowledgement
The authors wish to thank Malaysian Palm Oil Board (MPOB) for providing research facilities and permission to publish this paper
References
BLAAK, G., SPARNAAIJ, L.D., MENENDEZ, T.: Breeding and Inheritance in the Oil Palm (Elaeis guineensis Jacq.). II. Methods of bunch quality of analysis. J.W. Afr .Inst.
Oil Palm Rest. 4 (1963) 146 -155.
DJONKO, H.B., KUSHAIRI, A., RAJANAIDU, N. AND JALANI, B. S. Assessment Of Bunch Yield And Its Components For Cameroon-Based Dura X Pisifera Oil Palm (Elaeis
Guineensis Jacq.) Populations Proceeding of International Seminar on Breeding for Sustainability in Oil Palm (ISOPB), 18 November 2011. P. 167 – 177
IDRIS, A., KUSHAIRI, A., ISMAIL, S. AND ARIFFIN, D. Selection for partial resistance in oil palm to ganoderma basal stem rot. Journal oil palm rest 16(2005): 12-18
JANICK, J. AND PAULL, R.E. (ed.): The Encyclopedia of Fruit
books.google.com.my/books?isbn=0851996388 [Accessed on 7th July 2013]
and
271 | MGC10
Nuts
[online].
London.CABI
publishing;
2008.
Available
from:
KUSHAIRI, A. Genetic variation for bunch yield, bunch quality and morphophysiological traits in oil palm breeding populations.
populations Bangi Selangor, Malaysia:
Universiti Kebangsaan Malaysia; 1998. Ph.D. Thesis.
LEE, C.H. AND YEOW, K.H. 1985.Progress in breeding and selection for seed production at HMPB Oil palm research station. The Planter.;61:18–31.
Planter
LUBIS, A.. AND KISWITO. New perspective in oil palm breeding in Indonesia. In: Proceedings of the South East Asian Plant Genetic Resources; month year; Bogor,
Indonesia. Badan Penelitian dan Pembangunan Pertanian, Lembaga Biologi Nasional-LIPI; pp. 181–197. IBGR, SEAMEO/BIOTROP.
MIELKE, T. (ed.). 2009. Oil World Annual 2011, Vol. 1. Hambourg: ISTA Mielke GmbH.
MOHD DIN A., KUSHAIRI, A., RAJANAIDU, N., NOH, A. AND ISSA. Z.A. 2005. Performance of Various Oil Palm Introgressed Populations at MPOB. Proceedings of
Agricultural, Biotechnology and Sustainability Conference, 25-29 September 2005 (unedited version). p. 111-143.
NAIR, K..P. P. 2010.The Agronomy and Economy of Important Tree Crops of the Developing World. pp 224
NOH, A., RAFII, M. Y., SALEH, G., KUSHAIRI, A., LATIF, M. A. 2012. Genetic Performance and General Combining Ability of Oil Palm Deli dura x AVROS Pisifera
Tested on Inland Soils. Scientific World Journal Published [online]2012 May 22. Available from http://dx.doi.org/10.1100/2012/792601 [Accessed 14th July 2013].
PR Newswire. Global Palm Oil Market Report: 2013 Edition- Concept Analytics. [Online]. Available from:http://www.prnewswire.com/news-releases/global-palm-oil2013-market-report-199544291.html[accesd [3rd July 2013].
RAJANAIDU, N., JALANI, B.S., SOH, A.C., TWEK, J., MUSA, B., CHIN, C.W. and YONG, Y.Y. Performance of second generation of PORIM Nigerian materials
evaluated in Malaysia. Proceeding of the 1996 PORIM Palm Oil Congress (Agriculture) (1996)
RAJANAIDU, N., TAN, Y.P., ONG, E.C. AND LEE, C.H. The performance of inter-origin commercial D×P planting material. In: Proceedings of the international Worksp on
Oil Palm Germplam and Utilization; 1986; Bangi Selangor, Malaysia. Malaysian Palm Oil Board; pp. 155–161.
RAO, V., LAW, I.H., ZURAINI, S. AND CHIA, C.C.Ekona and AVROS- A tale of two Pisiferas.
Pisiferas In: Proceedings of the MPOB International Palm Oil Conference (PIPOC’99);
1999; Bangi Selangor, Malaysia. Malaysian Palm Oil Board; pp. 90–102.
RAO, V., SOH, A.C., CORLEY, R.H. V. LEE, C.H., RAJANAIDU, N., TAN, Y.P., CHI, C.W. and LIM, K.C.
SOH, A.C., WONG, C.K., HO, Y.W AND CHOONG, C.W. Oil Palm. Vollmann, J. & I. Rajcan (eds). Oil Crops-Handbook for Plant Breeding. London, New York Springer
Dordrecht Heidelberg (2009) p. 333-367.
TAN, S.T. LEE T.P. AND NGUI M.: A critical reexamination of the methods of bunch quality analysis In Oil Palm Breeding.PORIM Occasional.9-28(1983)
272 | MGC10
ID 106
Profiling of Functional Secondary Metabolic Genes from Two Pitaya Varieties, Hylocereus undatus and Hylocereus polyrhizus
Rafidah Badrun1, Sew Yun Shin1, & Dr. ZainuddinHj Meon2
1
Biotechnology Research Centre, MARDI
2
Station Centre, MARDI
Email: [email protected]
ABSTRACT:
Pitaya is a non-seasonal fruit crop with short fruiting cycle which takes around 45 days. These fruits had gained much interest in society because of its exotic features,
attractive colour, nutritional value and pleasant taste. Studies have shown that pitaya fruit is rich in phenolic compounds and high phytoalbuminantioxidants value that
prevents the formation of cancer-causing free radicals. This research has been carrying out to discover key functional secondary metabolic genes from white pitaya
(Hylocereus undatus) and red pitaya (Hylocereus polyrhizus) and also to determine the stage of pitaya fruit ripening when the functional secondary metabolic genes of
interests are highly expressed. We have outsourced RNA-sequencing of two mRNA from white and red pitaya samples at stage 35 DAA (Day after anthesis) to ILLUMINA,
USA. Sequence assembly using Velvet software version 0.7.55 revealed a total of 62,333 unigenes (red pitaya) and 61,272 unigenes (white pitaya). Homology search
(BlastX) against non-redundant amino acid database revealed 31,423unigenes (red pitaya) and 32,820 unigenes (white pitaya) with significant hits at cut off E-value
≤10-5. Functional genes associated with secondary metabolism of white and red pitayas that mapped onto biochemical pathways were been identified. From gene
expression pattern analysis, Cyclo-dopa 5-o-glucosyltransferase wasfound to be expressed higher at first 3 stagesof white pitaya but Betanidin 6-o-glucosyltransferase
was found to be expressed higher in 3 later stages in red pitaya. While Betanidin 5-o-glucosyltransferase has equal pattern of expression which is higher express at 2
early stages in white pitaya and 2 later stages at red pitaya. The pattern of gene expression for GOI’s involved in betalains biosynthesis pathway are varies in all pitaya
stages. Both red and white pitayas have equal distribution of highly expressed genes involved in betalains pathway.
Introduction
Pitayas are mainly divided into three types, white pitaya (Hylocereus undatus), red pitaya (Hylocereus polyrhizus) and yellow pitaya (Hylocereus megalanthus). These fruits
had gained much interest in society because of its exotic features, attractive colour, nutritional value and pleasant taste. There is always good demand of pitaya fruits in
domestic market and better price as compared to other local fruit crops. For that reasons, the rate of pitayas fruit industry in Malaysia was increasing tremendously fast
with its national planting areas up to 927.6 hectares in the year of 2006 (Cheah&Zulkarnain2008). Studies have shown that pitaya fruit is rich in phenolic compounds
and high phytoalbuminantioxidants value that prevents the formation of cancer-causing free radicals (Fabrice et al., 2005). A secondary metabolite namely
betacyaninsparticulary from red pitayas are most promising, not only as colouring agents but also in possessing antiradical potential (Escribano et al, 1998;
Pedreno&Escribano, 2001).
As pitaya is an emerging fruit crop, most of the research has been focused on its agronomy, food technology aspects, chemical profiling and pharmacological trials on
their phyto-nutrients. However, research on the molecular studies of pitayas is very lacking and gene information of pitayas particularly in regards to their health benefit
phyto-chemicals deposited in the public databases is extremely limited. It is important to gain an understanding on the vast networking of genes particularly genes
associated with secondary metabolism and their expression profile throughout the fruit developmental stages. By utilizing the next generation sequencing method and
bioinformatics, functional genes associated with secondary metabolism of white and red pitayas that mapped onto biochemical pathways could be identified.
Materials and Methods
Red pitaya fruits tagged at 25 day after anthesis (DAA), 30DAA, 35DAA and 40DAA were collected from MARDI Kundang Station. The skin of harvested pitaya fruit was
peeled off and the pulp was cut into small pieces. Pulp of the five fruits were pooled and mixed well before being frozen in liquid nitrogen and stored at -80°C until use.
RNA extraction from the frozen pulp was carried out according to method as described in Valderrama-Cháirez et al. (2002). Extracted total RNA was then purified using
Qiagen RNA column. The concentration and purity of total RNA was measured using Nanodrop machine. Subsequently both red and white pitaya total RNA were sent to
Illumina, USA for outsourcing of cDNA library construction and cDNA sequencing.Taqman probes were used in a realtime experiment and 2 housekeeping genes (actin
and ubiquitin) were selected and to design probe and primers for Real Time purpose. This Real time study is very important and crucial step to determine and find out at
which pitaya DAA stages of these GOIs were highly expressed.
Result and Discussion
The integrity and quality of purified total RNA was checked using gel electrophoresis (Figure 1) and Agilent Bioanalyzer 2100. Results of Bioanalyzer showed the ratio of
integrity (RIN) of total RNA extracted from both 35DAA red (Figure 2) and white pitaya (Figure 3) samples were very high, RIN=9.4 for both indicated that the quality of
total RNA was very good.
273 | MGC10
Figure 1: Gel electrophoresis of purified total RNA samples extracted from red and white pitaya fruit samples.
1
10
2
3 4
5 6
7
8
9
28S rRNA
18S rRNA
Legend:
L1: 25DAA(1) RDF
L2: 25DAA(2) RDF
L3: 30DAA(1) RDF
L4: 30DAA(2) RDF
L5: 40DAA(1) RDF
L6: 40DAA(2) RDF
L7: 35DAA(1) RDF
L8: 35DAA(2) RDF
L9: 35DAA(1) WDF
L10: 35DAA(2) WDF
Figure 2: Results of Bioanalyzer 2100 on the integrity of purified total RNA extracted from 35DAA red pitaya sample.
274 | MGC10
Figure 3: Results of Bioanalyzer 2100 on the integrity of purified total RNA extracted from 35DAA white pitaya sample
Sequencing results of red pitaya sample showed that total number of paired-end reads obtained was 18,530,028 sequences and the total number nucleotides was
1,389,752,100 nt. Meanwhile,sequencing results of white pitaya sample showed total number of pitaya paired-end reads obtained was 9,399,156 sequences and total
number nucleotides obtained was 845,924,040 nucleotides. Sequence assembly using Velvet software version 0.7.55 revealed a total of 62,333 unigenes (red pitaya)
and 61,272 unigenes (white pitaya). Homology search (BlastX) against non-redundant amino acid database revealed 31,423unigenes (red pitaya) and 32,820 unigenes
(white pitaya) with significant hits at cut off E-value ≤10-5.
Comparative transcriptome between red and white pitaya using Fisher Exact Test in Blast2Go software showed that 61 biological processes unique to red pitaya while
only 3 biological processes unique to white pitaya. Both pitayas shared a total of 362 biological processes in common with 283 processes over-expressed in red pitaya
and 79 over-expressed in white pitaya. By comparing the red and white pitayas in terms of their secondary metabolites, we noticed that they share 36 commonly
expressed genes encoding for enzymes involved in secondary metabolism, while there were 21 and 18 uniquely expressed genes in red and white pitaya respectively.
Through the comparatives transcriptome data, there were several secondary metabolites pathways that involved in both pitayavarities which includes phenylpropanoid
biosynthesis, terpenoid backbone biosynthesis, isoquinoline alkaloid biosynthesis, tropane, piperidine and pyridine alkaloid biosynthesis, limonene and pinene
degradation, betalain biosynthesis and polyketide sugar unit biosynthesis. These pathways have been identified as secondary metabolic pathways with the most
abundant transcripts in red and white pitaya (Table 1.)
1
2
3
4
5
6
Table 1: Top 6 secondary metabolic pathways with the most abundant transcripts in red and white pitaya
Red Pitaya (No. Transcript Hits)
White Pitaya (No. Transcript Hits)
Phenylpropanoid biosynthesis (28)
Phenylpropanoid biosynthesis (32)
Limonene and pinene degradation (23)
Terpenoid backbone biosynthesis (27)
Tropane, piperidine and pyridine alkaloid biosynthesis (21)
Isoquinoline alkaloid biosynthesis (22)
Isoquinoline alkaloid biosynthesis (20)
Tropane, piperidine and pyridine alkaloid biosynthesis (20)
Terpenoid backbone biosynthesis (19)
Limonene and pinene degradation (15)
Betalain biosynthesis (18)
Polyketide sugar unit biosynthesis (11)
The distinct differences between these two pitayavarities was their flesh coloring, therefore it was very interesting to select genes for Real Time study from coloring
secondary metabolites pathways as our gene of interest. In this case we have selected genes encoded enzymes involved in betalains biosynthesis pathway. Some
metabolites compounds in betalains pathway also have been discovered to have many potential uses especially in health.
In plants, generally betalains pigments are responsible for imparting yellow, red and purple colors to flower, grains, vegetables and fruits. Betalains include powerful
antioxidant pigments. There were 2 categories of betalains; betacyanins (include the reddish to violet betalains pigment) and betaxantins (provide yellow to orange color
of betalains). Scientific research has shows that betalains help to reduce the risk of blood clots by protecting the thin lining of blood vessels. Betalains also can strongly
275 | MGC10
reduced oxidized LDL cholesterol and protect many types of cells especially brain cells from toxin known to trigger tumors. Besides that, betalains can provide significant
protection from toxins that directly can affect liver.
The gene of interest (GOI) which we have selected from betalains biosynthesis pathway including betanidin 5-o-glucosyltransferase, betanidin 6-o-glucosyltransferase,
catechol o-methyltransferase, cyclo-dopa 5-o-glucosyltransferase and 4,5 -dopadioxygenaseextradiol. These genes were involved in synthesis and degradation of some
secondary metabolic compound in betalains biosynthesis pathway. The analysis of realtime result for this experiment was been analyzed using comparative Ct (∆∆ct)
method to determine the change expression of target in a sample relative to same target in a reference sample. In early stage which is 25 DAA, most of the genes
showed higher expressions in white compared to red except 4,5dopadioxygenase (Figure 4). While at 30 DAA, 3 genes which are cyclo-dopa 5-o-glucosyltransferase ,
betanidin 5-o-glucosyltransferase and catechol o-methyltransferase give higher expression in white compared to red but at this stage, the expression of 4,5
dopadioxygenase and betanidin 6-o-glucosyltransferase were more higher in red compared to white pitaya (Figure 5).
4,5 -dopadioxygenaseextradiol
Betanidin 5-o glucosyltransferase
Catechol o-methyltransferase
Betanidin 6-o glucosyltransferase
Cyclo-dopa 5-glucosyltransferase
Figure 4: Gene expression pattern of target gene (GOI) in 25 DAA between white and red pitaya.
276 | MGC10
4,5 -dopadioxygenaseextradiol
Betanidin 5-o glucosyltransferase
Catechol o-methyltransferase
Betanidin 6-o glucosyltransferase
Cyclo-dopa 5-glucosyltransferase
Figure 5: Gene expression pattern of target gene (GOI) in 30 DAA between white and red pitaya
Meanwhile at 35 DAA, the expression pattern of 4,5dopadioxygenase and betanidin 6-o-glucosyltransferase remain higher in red pitaya including betanidin 5-oglucosyltransferase. All the gene’s expression pattern follow the same pattern with number of hits identified from RNA-seq results but except for betanidin 5 -oglucosyltransferase which supposed to have equal expression in both variety and also cathecol o methytransferase which supposedly higher in red pitaya (Figure 6). At
40 DAA, all the subjected genes were expressed higher in red compared to white except for cathecol o methytransferase which expressed higher in white pitayas (Figure
7).
277 | MGC10
4,5 -dopadioxygenaseextradiol
Ratio of hits = R7 : W1
Betanidin 5-o glucosyltransferase
Ratio of hits = R2 : W2
Betanidin 6-o glucosyltransferase
Ratio of hits = R3 : W0
Cyclo-dopa 5-glucosyltransferase
Ratio of hits = R3 : W4
Catechol o-methyltransferase
Ratio of hits = R3 : W0
Figure 6: Gene expression pattern of target gene (GOI) in 35 DAA between white and red pitaya with the ratio of hits in RNA-seq data.
278 | MGC10
4,5 -dopadioxygenaseextradiol
Betanidin 5-o glucosyltransferase
Betanidin 6-o glucosyltransferase
Cyclo-dopa 5-glucosyltransferase
Catechol o-methyltransferase
Figure 7: Gene expression pattern of target gene (GOI) in 40 DAA between white and red pitaya.
From the findings of gene expression pattern, we suggested that the gene expression pattern for all selected genes were slightly difference when compared to individual
stages of pitaya maturity. Cyclo-dopa 5-o-glucosyltransferase has been found to express higher in first 3 stages of white pitaya but Betanidin 6-o-glucosyltransferase
was found to be express higher in 3 later stages in red pitaya. While Betanidin 5-o-glucosyltransferase has equal pattern of expression which is higher express at 2 early
stages in white pitaya and 2 later stages at red pitaya. However, there are two genes which continuously expressed higher in all stages which are 4, 5
dopadioxygenaseextradiol remain higher in red and cathecol o-methyltransferase (remain higher in white pitaya at all stages). The pattern of gene expression for all
genes of interested which have been selected involved in betalains biosynthesis pathway are varies in all pitaya stages. It shows that both red and white pitayas have
equal distribution of highly expressed genes involved in betalains pathway and have same potential in producing important secondary metabolite especially in
betalainsbiosynthesis pathway although the white pitaya has less demand in market compared to red pitaya.
Conclusion
The identified genes will assist in distinguishing the promising underlying biochemical pathways between those two varieties of pitaya studied. This will ultimately enable
us in harnessing the potential of pitaya as functional food with optimal level of beneficial phyto-chemicals and also to control the production of those phyto-nutrients
through genetic manipulation.
Acknowledgement
We would like to thank and acknowledgeMOA (Ministry of Agriculture) in funding this research (Grant No. -RB 1194SF10)
279 | MGC10
References
Cheah, L.S. & Wan, M. Zulkarnain. 2008. Status of pitaya cultivation in Malaysia (ed. D.O. Agriculture), Putrajaya
Escribano et al. (1998).Characterization of the antiradical activity of betalains from Beta vulgaris L. roots.Phytochemical Analysis 9: 124–127.
Fabrice et al. (2005) Colorant and antioxidant properties of red-purple pitahaya (Hylocereus sp.)Fruits.60(01):3 - 12.
Pedreno&Escribano (2001).Correlation between antiradical activity and stability of betanine from Beta Vulgaris L. Roots under different pH, temperature and light
conditions. Journal of the Science of Food and Agriculture, 81, 627-631.
Valderrama-chairez, Andres cruz& Octavio Parades Lopez (2002). Isolation of functional RNA from cactus fruit.Plant Molecular Biology Reporter.20:
20: 279–286,
280 | MGC10
ID 107
3D Structural Prediction and Modeling of xylanase in Bacillus coagulans STST -6
Ainu Husna M S Suhaimi1, Rabiatul Adawiyah Zainal Abidin2, Abdullah Sipat3, Khatijah Yusoff4
1
Strategic Livestock Research Centre, MARDI
2
Centre for Marker Discovery & Validation, MARDI
3
Redhacare Sdn Bhd
4
Universiti Putra Malaysia
Email: [email protected]
ABSTRACT:
In-silico structure prediction and modeling of 210 amino acid sequence translated from 630 bp xylanase gene from Bacillus coagulans ST-6 was performed. BLASTP
was utilized to search for similarity of xylanase protein sequences against non-redundant databases. SWISS-MODEL server was used for 3-D modeling of the xylanase
protein. The 3-D model was then evaluated using two programs called PROCHECK and Combinatorial Extension (CE) and constructed using 3EXUB consisting of 185
amino acid sequence as the template. 3EXUB originated from Bacillus substilis and had the lowest e-value score, of 1e-43 upon similarity testing of xylanase proteins
using BLASTP. The predicted 3-D model consists of more beta sheets with fewer alpha helices. Stereochemical quality of a protein structure by producing a graphical
plot called Ramachandran Plot showed that the model generated through the homology modeling process is acceptable, with 99.4% residues fall in the most favoured
regions. Important residues were also identified. The catalytic residues were Glu104, Glu197 while Tyr95, Tyr106 and were predicted to be involved in substrate binding.
Unfortunately, another important residue (Arginine, R) was found to be unconserved in the alignment. An arginine was predicted to be available at the position of 138th of
the sequence and it was identified to play an important role in the active site of this enzyme. The similarity as well as identification of catalytic and substrate binding
residues in the locally isolated xylanase will provide a valuable information on its activities therefore useful for its potential utilization of the pulp and paper as well as the
feed industry.
Introduction
Endo-β 1.4-Xylanase breaks down heteroxylan, which is one of the main hemicellulose components of plant cell wall (Paes et al, 2012). Heteroxylan is ubiquitious in
nature and thus has a lot of industrial potential. By-products obtained via xylan hydrolysis using xylanase can be used in the food and fuel, feed as well as pulp and paper
industry. Thermostable xylanases are of interest in the industrial world as it withstands high heat treatments. Usage of thermostable xylanase in nature minimizes and
reduces cost production because cooling system is not needed (Shi et al, 2013). Thus, sources of thermostable xylanases have been isolated from several sources
around the world.
Bacillus coagulans ST-6 is a thermophile isolated from a local hot spring in Malaysia. It produces thermostable endo-1,4-β-xylanase. 2.6 kb of its genomic DNA has
been cloned and recombinants were shown to express xylanase activity when transformed into host cell E. coli DH5α (Adnan, 1996). The cloned fragment was
sequenced revealing an open reading frame (ORF) of 680 bp. In this paper, we report the in silico analysis of 3D structure prediction of xylanase from Bacillus coagulans
ST-6 to gain understanding of its structure and function.
Materials and Method
Homology searching
The nucleotide sequences of cloned xylanase in Bacillus coagulans ST-6 were translated into protein sequence using ORF Finder
(http://www.ncbi.nlm.nih.gov/gorf/gorf.html). BLASTP from NPSA web server (http://npsa-pbil.ibcp.fr/cgi-bin/npsa_automat.pl? page=/NPSA/npsa_blast.html) was
performed to search similarity sequences of xylanase protein sequences against Protein Data Bank database. Multiple sequence alignment (MSA) was conducted
using ClustalX to align the candidate sequences as well as to identify the conserved region and important residues in xylanase protein sequences.
Secondary structure prediction
The secondary structure of xylanase was predicted using PSIPRED (http://bioinf.cs.ucl.ac.uk/psipred/).
Model Building, Refinement and Checking
A 3D model of xylanase was constructed on the basis of 3D structure templates from BLASTP similarity searching. This model building was carried out using the
SWISS-MODEL server (http://swissmodel.expasy.org). The 3D model was then evaluated using two programs called PROCHECK and Combinatorial Extension (CE). It
is crucial to evaluate the 3D model for correctness of the overall fold or structure, errors over localized regions and stereochemical parameters such as bond
lengths and angles.
281 | MGC10
Results and Discussion
The 210 amino acid sequences translated from 630 bp xylanase gene from Bacillus coagulans ST-6 is denominated as XYNBC6. The results from BLASTP analysis had
identified ten of 3D protein structures with significant identity to XYNBC6 protein sequence. In general, most of the solved 3D protein structures were from endo-1,4-βxyalanase protein family. Among the templates, 3EXUB was chosen as the template for model building. The best template was chosen based on the highest percentage
of sequence identity between the target and template proteins. 3EXUB consists of 185 amino acid sequence with e-value score of 1e-43 and has the highest identity
(55.29%) to XYNBC6. Interestingly, 3EXUB was generated from the Bacillus family but from different species: Bacillus substilis. Multiple sequence alignment of ten
significant templates and XYNBC6 protein sequence revealed a block of conserved region was identified (Figure 1). The conserved regions may play important roles in
the function of XYNBC6 protein.
Upon secondary structure prediction from results by PSIPRED, XYNBC6 protein consists of mainly β-sheets with the existence of a short α-helix towards the end tail of
the polypeptide (Figure 2). The alignment of sequence-structures was submitted into SWISS MODEL and the target template was set to 3EXUB to predict the 3D model of
XYNBC6 (Figure 3). Similar to secondary prediction, the overall 3D model also revealed more beta sheets with fewer alpha helixes (Figure 4A). The Ramachandran Plot
generated for the XYNBC6 model was acceptable, with 99.4% residues found in the most favoured [A,B,L], additional allowed [a,b,l], and generously allowed regions
[~a,~b,~l] (Figure 4B). Only 1 residue (0.6%) falls in the disallowed regions, which is glutamic acid at position 59.
To further compare the overall model generated to the template used, Combinatorial Extension (CE) was used. A model-template superimposition was generated to see
the overall backbone conformation between them, based on the C alpha positions (Figure 4C). The RMSD value scored for the model is 1.82Å while the z-score value is
6.11 (proteins with the same fold usually have a z-score value of 3.5 and above). Even though the model and the template only share 57% sequence identity and 63%
sequence similarity, observation of the core region of the model generated shows structural conservation. The model generated shows that it shares a common
backbone to the template except for a few looped regions (Figure 4C).
The important residues of the protein were also identified from the alignment of sequence templates. It was suggested that the residues might play roles as catalytic
residues and binding site (Wakarchuk et al, 1994). The predicted catalytic residues were Glu104, Glu197 (Figure 4D & Figure 4E) while Tyr95, Tyr106 were predicted to
involve in substrate binding (Figure 4F) Unfortunately, another important residue (Arginine, R) was found to be unconserved in the alignment. An arginine is predicted to
be available in the position of 138th of the sequence as it is identified to play an important role in the active site of this enzyme.
Figure 1: Multiple sequence alignment of xylanase (XYNBC6) and sequence templates. Red block shows the conserved region from these groups of sequence and
importantly residues.
282 | MGC10
Figure 2: Secondary structure prediction of XYNBC6 made up of β-sheets with the existence of a short α helix towards the end of the polypeptide tail
283 | MGC10
Figure 3: 3D model of XYNBC6 generated through homology modeling approach using SWISS-MODEL
Figure 4: A:3D model colored based on secondary structure color scheme (purple : alpha helix ; yellow : beta sheet); B:Ramachandran
Plot for XYNBC6 3D model;
B:
C :Structural superimposition of XYNBC6 model and the template 3EXUB used using Combinatorial Extension; XYNBC6 model is colored in blue while 3EXUB is colored in
red.; D: Stick model representing the catalytic residues for XYNBC6 comprising of Glu104 and Glu197 E: Close-up view of catalytic residues for XYNBC6 (Glu104 and
Glu197); F: Stick model representing substrate binding site for XYNBC6 comprising of Tyr95 and Tyr106.
284 | MGC10
Conclusion:
This study indicates that XYNBC6 has high similarity and predicted function with other endo-1,4 B- xylanases, mainly 3EXUB isolated from Bacillus subtillis. The
identification of catalytic and substrate binding residues will provide valuable information on the mechanisms involved in its activities. However, further study has to be
carried out to gain more understanding on the interaction and mechanism among proteins in order to explore its function in industry.
References :
Adnan, N (1996) Pengklonan dan pengekspresan gen xilanase termostabil daripada Bacllus coagulans ST-6
ke dalam Escherichia coli HB101 . Thesis MSc. Universiti Putra Malaysia
Paes G, Berrin JG and Beaugrand J (2012) GH11 xylanases : Sructure/function/properties relationships and aplications . Biotechnology Advances 30 : 564 -592.
Shi H, Zhang Y, Li X, Huang Y, Wang L, Wang Y, Ding H and Wang F (2013) A novel highly thermostable xylanase stimulated by Ca2+ from Thermotoga thermarum :
cloning exression and characterization. Bioetechnology for biofuels 6 (26) : 2-9
Wakarchuk WA, Campbell RL, Sung WL , Davoodi J and Yaguchi M (1994) . Mutational and crystallographic analyses of the active site residues of the Bacillus circulans
xylanase. Protein Science3 : 467-475.
285 | MGC10
ID 117
Genetic Variants in the HERHER-2/neu Gene and Risk of Breast Cancer.
Awatif Siddig1, Adem Abdu2 , Kamal Hammed3 and Mohamed Abdelrahim Osman 4
1Faculty of Medical laboratory Technology, Sudan University for Science and Technology, Sudan. 2Department of Pharmacology, Faculty of Medicine and Health
Sciences,UAE University, United Arab Emirates. 3Department of Surgery, Faculty of, Medicine, Khartoum University Sudan. 4 University of El Imam El-Mahdi Sudan.
Email: [email protected]
ABSTRACT:
Background:
Background Genetic alterations of the proto-oncogene human epidermal growth factor receptor (HER-2/neu) have been shown to induce malignant transformation
and metastasis. Genotyping studies have addressed the association of codon 655 Isoleucine to Valine polymorphism located in the transemembrane coding region,
and the risk of breast cancer, but the results are inconsistent. The present study investigated the association of HER-2/neu Ile655Val polymorphism and the risk of
breast cancer in Sudanese population; in addition the joint effect of HER-2/neu variants and our previously reported ESR1C325G polymorphism were tested for their
association with breast cancer risk.
Methods: Candidate single nucleotide polymorphism (SNP) in HER-2/neu Ile655Val SNPs [db SNP rs1136200] gene was genotyped in breast cancer patients and in
healthy controls that were randomly selected from the same age group as the patients. Genotyping was performed using a high throughput allelic discrimination
method using Real-Time PCR and data on clinical features and demographic details were collected. Associations between genotype and breast cancer were assessed
by means of logistic regression.
Results:
Results: The Prevalence of Val/Val genotype was similar in patients of breast cancer and control subjects. In comparison with the Ile/Ile genotype, the Ile/Val had a
borderline significantly (p=0.06) higher risk of breast cancer (OR= 2.95, 95% CI 0.97-8.96). Regarding the genotypic and allelic frequencies stratified by age and
menopausal status there were no significant associations. A significantly higher risk of breast cancer was observed among homozygous carrier of ESR1325 CC
genotype and heterozygous carrier of HER-2/neu655 Ile/Val genotype (P=0.05, adjusted OR (95% CI) = 4.9 (1.0-24)).
Conclusion: The association of HER-2/neu Ile655Val polymorphism and risk of breast cancer was borderline significant with the heterozygous carrier being at higher
risk. However the frequency of different polymorphic variants varies with the ethnicity. Our study demonstrated, that a significant gene-gene interaction between
ESR1325C (previously reported) and HER-2/neu 655Ile/Val variants may jointly contribute to a higher risk of breast cancer.
Introduction
The human epidermal growth factor receptor 2 (also known as c-erbB-2 or HER-2/neu) is a member of HER family which includes four homologous receptors named
HER-1 to HER-4 (Stern DF 2000). These receptors share a similar molecular structure; including an extra cellular ligand binding domain, a single hydrophobic transmembrane
domain, and a cytoplasmic tyrosine kinase domain. HER-2/neu is a proto-oncogene that is located on chromosome 17q11.2-12 and encodes a 185KD (p185HER2)
transmembrane glycoprotein with tyrosine kinase activity Akiyama etal 1986, Callahan 1989 The overexpressition of HER-2/neu in epithelial cells have been shown to affects the
regulation of cellular growth, apoptosis, motility, and adhesionEccless,2001.Previous studies have indicated that HER-2-neu activation through amplification/overexpression
is involved in oncogenic transformation and tumorigenesis in breast cancer Di Fiore etal 1987. Clinical studies have shown that HER-2/neu overexpression is observed in 60% of
ductal carcinoma in situ and in 20-30% of infiltrating breast carcinoma which correlated with other parameters indicative of tumor progression, such as: the tumor size
nodal involvement and the absence of hormone receptor expression Schonborn et al 1994. Amore recent study proposed that HER-2 contributes to angiogenesis and metastasis
Guilian Niu and W.Bradford Carter 2007
Papewalis et al 1991, identified a polymorphism of human HER-2/neu, at codon 655, that result in an isoleucine (Ile) to valine (Val) substitution
(Ile655Val). Positive association of this polymorphism with the breast cancer was first reported by Xie etal, however, subsequent studies on the Ile655Val in relation to
breast cancer remain controversial. In the present study, we aimed to evaluate the association of HER-2/neu Ile 655Val polymorphism and the risk of breast cancer in
Sudanese population.
Material and methods:
methods
A case-control study was conducted to assess the association between genotype frequencies and breast cancer risk. We used biospecimens to identify common low
penetreance alleles. 100 patients of primary breast cancer 98 females and 2 males, mean (sd) age: 46.4 (13.5) years and 90 controls 84 females and 4 males, mean
(sd) age: 46.2 (13.4) were used for this study Patients were pathologically confirmed in Khartoum Teaching Hospital, Soba University Hospital and Omdurman Hospital,
Sudan. Peripheral blood samples from cases as well as control subjects were obtained.Control subjects were randomly selected from the general population in
Khartoum State from the same age group as the patients, in addition a structural questionnaire was filled to elucidate information on demographic factors,
menstruation, reproductive history, dietary habits, prior diseases, physical activities and tobacco and alcohol use. Written informed consent regarding the usage of
samples for genetic experiments was obtained from all subjects and the study protocol was approved by the research board of Collage of Medical Laboratory Sciences,
286 | MGC10
University of Sudan for Science and Technology, Khartoum, Sudan.