Supplementary methods
Cell Isolation
PBMC were isolated by Ficoll density gradient centrifugation. Fresh liver tissues were
washed, cut into small pieces and digested with 0.05% Collagenase IV (Sigma-Aldrich, St.
Louis, MO) and 0.002% DNase I (Roche, Basel, Switzerland) at 37C for 20 min. Dissociated
cells were filtered through a 150-μm mesh. TIL and NIL were obtained after Ficoll density
gradient centrifugation.
Evaluation of IL-17-producing cells and microvessel density (MVD)
Analysis was performed by two independent observers who were blinded to the clinical
outcome and Th17 data. Tissue sections were screened at low power field (100×) and five
most representative fields were selected at high power field (400×) with Leica DM IRB
inverted research microscope (Leica Microsystems, Wetzlar, Germany). IL-17-producing cell
density was quantified according to the mean number of IL-17-producing cells in five hot
spots (0.145 mm2 per field). For MVD, any brown-stained endothelial cell or endothelial cell
cluster that was clearly separated from adjacent microvessels, tumor cells, and connective
elements was counted as one microvessel, irrespective of the presence of a vessel lumen. The
mean microvessel count of the five most vascular areas was taken as MVD-CD34. There were
no significant differences in the counts between the two observers.
Migration assays
Migration assays were performed in a Transwell system with 5-µm pore size (Costar,
Cambridge, MA). 5 × 105 PBMC from HCC patients were added to the upper chamber and
CCL20/CCL22 (500 ng/ml; R&D Systems, Minneapolis, MN) were added to the lower
chamber. After incubation for 4 h, cells in the upper and lower chamber were harvested
separately and determined by FACS. Migration of Th17 cells was determined as described:
Migration index (%) = [number of Th17 cells migrating (lower chamber) / total number of
Th17 cells (Th17 cells in the lower chamber + remaining Th17 cells in the upper chamber)] ×
100%; number of Th17 cells = number of CD4+ T cells × the percentage of Th17 cells of
CD4+ cells. All assays were performed with four donors.
Real-time quantitative PCR
DNase-treated total RNA was reverse-transcribed using M-MLV Reverse Transcriptase
(Promega, Madison, WI) according to manufacturer's instructions. Primers spanning the exon
junction were designed using Primer Premier 5 (Premier Biosoft International, Palo Alto, CA).
Gene transcripts were quantified using SYBR Green Master Mix (Toyobo, Osaka, Japan) in
an ABI 7900 instrument (Applied Biosystems, Foster City, CA). Calculation of relative
change in mRNA was performed using the “delta-delta Ct method”, with normalization to
ACTB (encoding β-actin). The primers for Real-time quantitative PCR were as follows:
CCL20:
TGTGCGCAAATCCAAAACAG
(forward),
CCCTCCATGATGTGCAAGTG
(reverse); CCL22: CGTGATTACGTCCGTTACCGTC (forward), ATCCCTGAAGGTTAG
CAACACC (reverse); ACTB: CGCGAGAAGATGACCCAGAT (forward), GGGCATACC
CCTCGTAGATG (reverse).