Protocol for Solexa sequencing analysis

advertisement
Solexa sequencing protocol for transcription factors on MNase or Sonicated samples
2/4/08
1A: MNase-ChIP
a. Grow 30x106 cells, remove media and wash the cells (on the plate) 1x
with cold PBS plus BSA (5mg/ml) and 1x with cold PBS.
b. Scrap into 500ul of ice cold PBS complete (PBS containing protease
inhibitors).
c. Spin 1 min @ 2000 rpm.
d. Resuspend cells in 1 ml of the digestion buffer (50 mM Tris-HCl, pH7.6, 1
mM CaCl2, 0.2% Triton X-100 or NP-40), Add Sodium butyrate (5 mM),
proteinase inhibitor cocktail (1x), and fresh PMSF (0.5 mM).
e. Dispense 300 l of aliquot in ependorf tubes and warm up to 37°C for 2
min.
f. Add MNase (0.2, 0.3, 0.4 U) and incubate for 5 min at 37°C.
g. Stop the reaction by adding 300 l of (10 mM Tris, pH7.6, 5 mM EDTA)
h. Sonicate for 4x 30” (or 5 mins , 30sec on/off max intensity, using the
bioruptor in cold room) in ice water.
i. Dialyze against 200 ml of RIPA buffer ( 10 mM Tris, pH7.6, 1 mM
EDTA, 0.1% SDS, 0.1% Na-Deoxycholate, 1% Triton X-100) for 2 hrs at
4°C.
j. Spin down for 10 min at 4°C, Transfer supernatant to a new tube,
Resupend pellet in 0.5 ml of 1xTE.
k. Transfer Supernatant (~50ul following MNase treatment) and pellet to
new tubes and purify the DNA by phenol-CHCl3 extraction and ethanol
precipitation. (Following MNase digestion, analyze 10% on agarose gel.
l. If the digestion works well, then do ChIP according to established
protocols.
m. Add 10 l/ChIP of Dynabeads Protein A (Product no. 100.02) and G (no.
100.04 invitrogen) to eppendorf tubes. Add 600 l 1x PBS to wash.
Attach the beads to magnet. Aspirate off 1x PBS. Then add 100 l 1x
PBS, and add 2 g Ab to the beads. Incubate for 2 hours minimum on the
mixer at 4oC, to allow complete Ab binding to the beads.
n. Use magnet to remove supernatants and wash the beads twice with 1x PBS
to remove free IgGs (0.2 ml and 5 min each time).
o. Remove supernatant from the beads by magnet. Add 250 l of the
chromatin extracts to the beads. Rotate for 2 hrs at R.T. or at 4 C o/n for
lower background.
p. Wash the beads (10 min each time):
2x with 1 ml of RIPA buffer, 10 min each time;
2x with 1 ml of RIPA buffer + 0.3 M NaCl, 10 min each time;
2x with 1 ml of LiCl buffer (0.25 M LiCl, 0.5% NP40, 0.5% NaDOC)
1x with 1 ml of 1x TE + 0.2% Triton X-100
1
1x with 1 ml of 1xTE.
q. Resuspend the beads in 100 l of 1x TE. Add 3 l of 10% SDS and 5 l
of 20 mg/ml proteinase K. Incubate at 65 C o/n.
r. Vortex briefly, transfer supernatant to a new tube using magnet. Wash
beads with 100 l of 1x TE + 0.5 M NaCl. Combine the supernatant.
Extract 2x with 200 l of phenol/chloroform for extraction. Then add 2 l
of 20 mg/ml glycogen, and 20 l of 3 M NaOAc, pH5.3, and 500 l of
ethanol to the supernatant for p.p. the DNA.
s. Wash pellet once with 70% ethanol.
t. Resuspend pellet in 40 l of 1xTE. Use 2 l or the same amount DNA for
PCR analysis. Make sure the ChIP has worked well before moving to
Step 3.
u. Real-time PCR
For 25 l
20 l
2x master mix:
12.5 l
primer mix (5 M each): 2.5 l
Probe (2 M):
2.5 l
dd H2O:
5.5 l
10 l
2 l
2 l
4 l
23 l
2l
18 l
2 l
Add DNA template:
1B: ChIP on Sonicated Samples:
1) Prepare antibody-Dynal magnetic beads. (Wash 10 ul of each A/G Dynal beads,
per sample, three times in 500 ul of cold PBS plus BSA (5mg/ml) and incubate
with your antibody in cold PBS plus BSA (5mg/ml) for at least 6 hours with 500
ul PBS plus BSA (5mg/ml) on the mixer at 4oC. Wash beads twice with cold PBS
plus BSA (5mg/ml), resuspend in Dilution buffer and add to chromatin on step
11)
2) Induce cells by adding ligand to medium (E2 = 1x10-8M) for required time
(standard = 45 min)
3) Prepare 1% formaldehyde (fisher F79-500) to fresh media without serum and
warm to 37oC. For 50 ml add 1.35 ml of 37% formaldehyde solution. Replace
media with the warmed media containing the formaldehyde and leave for 10 min
in incubator. For 10 cm plate use 10ml, for 15 cm plate use 15ml.
4) Remove media and wash the cells (on the plate) 1x with cold PBS plus BSA
(5mg/ml) and 1x with cold PBS.
5) Scrap into 350ul for 10cm plate, 500ul for 15cm plate, of ice cold PBS complete
(PBS containing protease inhibitors) (Complete caplets from roche, 1 caplet in
1ml = 100X concentration)
6) Spin cells immediately at 2000 rpm for 1 min
2
7) Remove PBS complete and flick the pellet to resuspend in residual PBS. Add
350ul of lysis buffer (1% SDS, 10mM EDTA, 50mM Tris-HCl pH8.1 plus
protease inhibitors)…make up fresh. (You can freeze at this step to –80oC, 1st in
liquid nitrogen)
8) Sonicate 3 x 10 sec. Keep tip of sonicator just below the surface of the lysis
buffer. The setting is dependent on the specific sonicator and will need to be
optimized beforehand by trying several sonication conditions on fixed input
DNA, reversing the cross-linking and running the sonicated DNA on gel. With
current sonicator use 12% amplification.
9) Spin 15 min at max speed at 4oC. You should have a pellet of ~20ul. Supernatant
is the total chromatin used for PCR later as input. Sample can be freezed at –80oC
for weeks. Take a small sample (12 ul from 350 ul (~5%) as input and leave in
freezer). Remember to reverse formaldehyde fixing on input as well as sample
(Step 16). Also take 5 ul/plate to put on a gel to verify the sonication step, expect
200-400bp smear.
10) Dilute sample in dilution buffer (1% triton, 2mM EDTA, 150mM NaCl, 20mM
Tris-HCl pH 8.1). Try to dilute at least 1:5 if you can … 1:10
11) Add A/G Dynal magnetic beads prebound to antibody of choice. Start IP as
normal O/N 4oC.
12) Collect magnetic beads using a magnetic concentrator and wash 6 times in RIPA
buffer (50mM HEPES pH 7.6, 1mM EDTA, 0.7% Na Deoxycholate, 1% NP-40,
0.5M LiCl). Incubate on mixer for 20 min between every second wash.
13) Wash twice in 1 x TE (pH 7.6)
14) Remove all residual TE after last wash
15) Add 100ul of 1% SDS and 0.1M NaHCO3. Due the same to Input samples.
Vortex beads in this solution every few minutes for 30 min total. While at 65oC
O/N to reverse cross-linking. Minimum of 6 hours reverse, but a maximum of 1416 hours.
16) Purify with QIAquick spin kit (PCR purification kit)- add 500 ul PB, vortex,
collect beads, transfer supernatant to column, spin add 500 ul PE, spin, 500 ul PE,
spin, spin, collect in 50 ul EB buffer for IP and 100 ul for Input. Spin, Add 75 ul
to IP tubes and 150 ul to Input tubes. Quantify using picogreen
17) Use 5ul for real-time PCR (You may be able to dilute this sample depending on
your ChIPing efficiency. If it does not work at these concentration change Abs).
5 ul DNA
4 ul H2O
1 ul Primers (5uM each)
10 ul 2X SYBR
LIBRARY PREPARATION FOR SINGLE END SEQUENCING (Illumina)
2. Repair DNA ends using the Epicentre DNA END-Repair kit (Cat. No.
ER0720, Epicentre Biotechnologies, Tel 800-284-8474)
This step generates blunt-ended DNA.
3
1-34 ul DNA (1-2 ng)
5 ul 10x End repair buffer (330 mM Tris-acetate, pH7.8, 660 mM
potassium acetate, 100 mM magnesium acetate, 5 mM DTT)
5 ul 2.5 mM each dNTPs
5 ul 10 mM ATP
x ul H2O to adjust the reaction volume to 49 ml
1 ul End-Repair Enzyme mix (T4 DNA Pol + T4 PNK)
Incubate 45 min at room temperature.
Purify the DNA by Phenol-CHCl3 extraction. Resuspend the DNA in 30 ul
of 1xTE.
3. Add “A” to 3’ ends
30 ul DNA from above
2 ul H2O
5 ul 10x Taq buffer
10 ul 1 mM dATP
3 ul 5 U/ ml Taq DNA polymerase
Incubate for 30 min at 70°C.
Purify the DNA as before. Resuspend pellet in 10 ul of 1x TE.
4. Linker ligation (two mixed linkers).
The oligo mix should contain 10x molar excess of the DNA templates.
2X NEB quick ligase buffer
Annealed linkers (5 uM) – see below
Quick DNA ligase (NEB)
DNA sample
Total volume
10.0 ul
1.0 ul (IS THIS ENOUGH?)
1.0 ul
9.0 ul
21.0 ul
Incubate for 30 min at room temperature.
Ethanol precipitate. Resuspend in 10 ul.
Annealed linker
Oligo Forward: GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG (HPLC
purified)
Oligo Reverse: ACACTCTTTCCCTACACGACGCTCTTCCGATCT (HPLC purified)
- Combine
750 ul Tris-HCl (1M) pH 7.9
125 ul oligo Forward (40 uM stock)
125 ul oligo Reverse (40 uM stock)
4
- Heat at 95oC for 5 min, then immediately into 70oC heat block (holes filled with water)
and remove heat block and leave in the cold room to slowly cool. Make aliquots in the
cold room and freeze.
5. Size selection-2%
- Add 3ul to ligated DNA, run on a 2% Nu-Sieve Agarose gel.
- Run 120 V 1hr. Cut band in the 200 + 25 bp range. Although you may
not be able to see a band, the DNA is there but in very small amounts.
- Elute with Gel extraction kit, resuspend in 30 ul buffer EB.
6. Amplify the DNA using Solexa primers and enzyme mix (Run a 25 ml reaction).
10.5 ul of DNA
12.5 ul of master mix
1 ul of PCR primer 1.1 (5uM)
(AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT)
1 ul of PCR primer 2.1 (5uM) (CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT)
Total volume: 25 ul
Denature at 98°C for 30 sec.
98°C, 10”; 65°C, 30”; 72°C, 30”.
Try 18 cycles first, check 2.5 ml of product on 1.8% gel. If the band is not
clearly visible, do 3 more cycles. Check again.
Purify the amplified products on 2.5% agarose gel. Excise the band near 220 bp and
purify the DNA using Qiagen gel extraction kit. Use the regular gel extraction kit as
opposed to the MinElute in order to wash the membrane with a higher
volume. Heat the EB to 55 Celsius first. YOU MUST DO THE OPTIONAL STEPS, AS
IT DOES AFFECT YIELD. Measure the DNA concentration using picogreen or nanodrop. You may also verify the size quality of your sample using the bioanalyser.
5
Download