เอกสารสิทธิบตั รยุโรป จากฐานข้ อมูล http://gb.espacenet.com
เรื่ อง ข้ าว ในหมวด เปปไทด์ซงึ่ ประกอบด้ วยกรดอะมิโนมากกว่า 20 ตัว
(Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins;
Derivatives thereof)
จานวน 45 เรื่ อง
ปราโมทย์ ธรรมรัตน์และนิศากร วรวุฒยิ านันท์
หน่วยสร้ างสานึกและพัฒนาประโยชน์จาก
เอกสารสิทธิบตั รเพื่อการวิจยั และพัฒนา (สสวพ) สกว
สถาบันค้ นคว้ าและพัฒนาผลิตภัณฑ์อาหาร มหาวิทยาลัยเกษตรศาสตร์ 0-2942-8629 ต่อ 626, 908
1/503
1. AU2003245803 - 3/11/2004
A PROTEIN CONTROLLING RICE TILLER, A GENE ENCODING THE
PROTEIN AND A METHOD OF MANIPULATING PLANT TILLER OR
BRANCHING USING THE GENE
URL EPO =
http://v3.espacenet.com/textdoc?F=3&CY=ep&LG=en&IDX=AU2003245803
Inventor(s):
LI JIAYANG (--); QIAN QIAN (--); LI XUEYONG (--); ZENG DALI (--); FU
ZHIMING (--); WANG YONGHONG (--); XIONG GUOSHENG (--); WANG XIAOQUN (--); LIU
XINFANG (--)
Applicant(s):
INST OF GENETICS AND DEVELOPME (--)
IP Class 4 Digits: C07K; C12N
IP Class:C07K14/415; C12N15/63; C12N15/05
Application Number:
AU20030245803 (20030603)
Priority Number: WO2003CN00429 (20030603); CN20020129196 (20020820)
Family: AU2003245803
Equivalent:
WO2004018508; CN1477112; CN1185256C
Abstract:
Abstract not available for AU2003245803
Abstract of corresponding document: WO2004018508
The present invention provides a protein controlling rice tiller or branching which has a amino acid
sequence shown by SEQ ID NO: 2 or a functional analog sequence thereof obtained by substitution,
deletion, or addition of one or more amino acids of SEQ ID No: 2, wherein the functional analog is still
able to control rice tiller or branching. The present invention also provides a nucleotide sequence
encoding the protein, a vector containing this nucleotide sequence and a method of manipulating rice
tiller or branching using the vector.Description:
Description of corresponding document: WO2004018508
>;Desc/Clms Page number 1;
A PROTEIN CONTROLLING RICE TILLER. A GENE ENCODING THE
PROTEIN AND A METHOD OF MANIPULATING PLANT TILLER OR
BRANCHING USING THE GENE Technical Field
This invention relates to a protein controlling rice tiller, a gene encoding the protein, a vector carrying
the gene and a method of manipulating plant tiller or branching using the gene.
Background Art
Tiller is an important morphological character of most grass family plants. Tillers are a kind of lateral
branches that originate from the axillary bud formed on each internode of the stem and grow
independently of the mother stem due to their own adventitious roots. Tillering patterns of grass family
plants can be divided into different types according togenesic sites thereof, rhizome-like tillering,
sparse tillering and dense tillering pattern. In plants with rhizome-like tillering pattern such as
sugarcane, rhizomes grow horizontally under the ground and produce a vertical shoot at a long
distance. In plants with sparse tillering pattern, lateral branches and adventitious roots are formed on
2/503
the caudex internodes under the ground, and the lateral shoots incline upward outside the leaf sheath. In
plants with dense tillering pattern such as rice, lateral branches and adventitious roots are formed on the
caudex internodes near the ground, and the lateral shoots grow parallely with the mother plant in the
leaf sheath. There is ameristem region in the first internode of rice stem. Cell divisions in this region
make internode elongation and regulate internode site of tillering to maintain the development of tiller
bud in different planting depth and keep the dense tillering pattern.
The rice tillering stage starts after the formation of the fourth complete leaf.
This is a very important stage in the rice growth period during which most vegetative organs of rice
plants such as leaves, tillers and roots are formed. Tiller number per plant determines panicle number
which is a key determination factor of rice grain yield. Extremely high or low number of tillers will
influence grain yield. Therefore,
>;Desc/Clms Page number 2;
tillering ability is an important agronomic trait that determines grain yield.
The study on tiller focused on the morphology and physiology in the past. The study on physiology of
rice cultivation made a better illustration about the relationship of tiller number and environmental
conditions, including the regulation of tiller development by factors such as temperature, light, water,
farming techniques and mineral nutrition and like, particularly, the effect on tiller by the level of
nitrogen nutrition. Genetics studies on rice tiller developed later, it is generally deemed that tiller is
regulated cooperatively by multiple genes. With the growth of rice plants, contribution of additive
action of genes to tiller increases and becomes predominant, whereas that of nonadditive action of
genes and environmental factors becomes subordinate. In addition, other genes such as dwarf genes
also affect rice tillering ability, and plants with these genes show very strong tillering ability. In the
case of some key genes mutate, tiller number will alter significantly. For example, Takamura and
Kinoshita obtained several tillering mutantsrcnl, 2,3, 4, 5 (rcn, reduced culm number) with low tillering
number by Y-ray radiation mutagenesis. Butrcral-rcra5 mutants were only primarily mapped to certain
rice chromosomes, they have not been isolated so far(Takamura I and T. Kinoshita 1987 Genic
identification of the mutant genes for reduced culm-number in rice. Japan J. Breed37(suppl) : 182-183).
We isolated a spontaneous tillering mutantoo culm1(naocl) in the japonica cultivar H89025, which is a
mutant with extremely low tillering number and has only one main culm without any tillers. Genetic
analysis showed that the7noel mutant was caused by a recessive mutation in a single nuclear locus. We
have cloned the MOC1 gene through a map-based cloning approach, which is the first defined gene
that controls tiller in rice and other monocots. Although several genes controlling dicot plants
branching have also been isolated previously, such as tomato LS gene (Schumacher K., Schmitt T. ,
Rossberg M. , Schmitz G. and Theres K. 1999. The Lateral suppressor (Ls) gene of tomato encodes a
new member of the VHIID protein family. Proc. Natl. Acad. Sci. USA 96: 290-295) and
ArabidopsisAtLS gene (Greb, T. , Schafer, E., Herrero, R. , Muller, D. , Tillmann, E. , Schmitz, G. ,
and Theres, K. 2001.
Mutation in the Arabidopsis and tomato lateral suppressor genes suggest a common
>;Desc/Clms Page number 3;
control mechanism for lateral shoot formation. Program and abstracts of12"'international conference
on arabidospis research. P. 225. ), However, LS gene and AtLS gene might not be utilized in
manipulating tiller of monocots due to the large evolution distance between dicots and monocots. In
order to improve grain yield and quality, today farmers mainly take cultivation techniques to
manipulate tillering number of rice and other grass family crops. It will be more efficient and
economical if tillering number of grass family crops can be manipulated through genetic engineering
techniques. Therefore, the MOC1 gene obtained in this invention, which controls rice tillering number,
has great application potential.
Contents of the Invention
An object of the invention is to provide a protein that controls rice tiller or branching.
3/503
Another object of the invention is to provide a nucleotide sequence that encodes the protein of the
invention.
A further object of the invention is to provide a vector carrying the nucleotide sequence of the
invention.
A further object of the invention is to provide a transformant containing the vector of the invention.
A further object of the invention is to provide a method manipulating plant tiller and branching.
Therefore, the present invention provides a protein controlling rice tiller or branching which has a
amino acid sequence shown by SEQ ID NO : 2 or a functional analog sequence thereof obtained by
substitution, deletion, or addition of one or more amino acids of SEQ ID No: 2, wherein the functional
analog is still able to control rice tiller or branching. The MOC1 protein obtained in this invention
belongs to the GARS transcription factors family, and shares 44% and 37% identity to tomato LS
protein and ArabidopsisAtLS protein respectively. Although also involved in plant branching, LS and
AtLS were originated from dicot plants, the large evolution distance between rice and them makes
them unsuitable for genetic manipulation of
>;Desc/Clms Page number 4;
tiller number in rice and other monocots. Therefore, the creativity and novelty of this invention are not
affected.
The protein of the invention preferably has the amino acid sequence shown by SEQ ID No: 2.
The invention also provides a nucleotide sequence that encodes the amino acid sequence shown by
SEQID No: 2 or a functional analog sequence thereof obtained by substitution, deletion, or addition of
one or more amino acids of SEQ ID No: 2, wherein the functional analog is still able to control rice
tiller or branching
The MOC1 gene obtained in this invention is a novel gene that is isolated from the rice mocl mutant.
The gene of the invention preferably has the sequence shown by SEQ ID No: 1.
The invention also provides a vector carrying a nucleotide sequence that encodes the amino acid
sequence shown by SEQ ID No: 2 or a functional analog sequence thereof obtained by substitution,
deletion, or addition of one or more amino acids of SEQ ID No: 2, wherein thefunctioanl analog is still
able to control rice tiller or branching. This vector might be pC8247 or pC8247S.
The invention also provides a transformant containing the said vector of the invention. The said
transformant includesE. coli, Agrobacterium tunefacieizs or plant cells.
The invention also provides a method of manipulating plant tiller or plant branching including
transformation of plant cells using the said vector of the invention; and cultivation of the plants from
the transformed plant cells.
Today, there is a worldwide contradiction between the large-scale decrease in farming land and the
rapid increase in population. It is very pressing to greatly improve the grain yield on per unit area,
wherein proper plant type and population structure are important basis for improving grain yield and
quality. Isolation of the MOCI gene makes it feasible to manipulate plant type and to form proper plant
population structure through genetic engineering techniques.
Description of Figures
The following drawings will further illustrate the present invention, but not be interpreted to limit the
present invention.
4/503
Figure 1. Phenotype of the riceB7l01loculm 1 mutant(mocl). a, wild-type rice breed H89025; b,
the77tocs mutant.
Figure 2. Primary location of the MOC1 locus on the rice Chromosome 6. RM3 is a SSLP marker, and
the others are RFLP markers.
Figure 3. Physical mapping of the MOCI gene. Y4149 and Y2242 are YAC clones;18dD02,45cD09,
and 4cAll are BAC clones. Arabic numerals indicate the crossover events on 560 chromosomes
detected by each RFLP marker. The MOCI gene was located between the18dD02R and Y2242R, both
of which lie on the same BAC clone4cAl l.
Figure 4. Fine localization of the MOC1 gene. 12-2,15-1, 17-2 and 17-3 are newly developed CAPS
markers. Arabic numerals indicate the crossover events in 4020 chromosomes detected by each CAPS
marker. The MOCI gene was located on a20-lob region between the marker 12-2 and 17-3. Plasmid
clones P4123 and P4124 from the random library of BAC clone4cAl l cover the MOCI gene.
Figure 5. Plasmid map of the binary plant expression vectors pC8247 and pC8247S. Plasmid pC8247
carries the entire MOCI gene, whereas control plasmid pC8247S carries a truncated MOCI gene
missing the coding sequence of 188 amino acids at the C-terminal.
Figure 6. Phenotype of T, transgenic rice plants in the function complementation test. a, wild-type
H89025; b, pC8247S transformant; c, pC8247 transformant. Plasmid pC8247 that carries the entire
MOCI gene resorted the tillering number of the77ZOcl mutant, but the control plasmid pC8247S
transformant still shown monoculm phenotype.
Figure 7. Tillering numbers of each order in the MOCI transgenic rice plants. 1, 2,3, 4 and 5 represent
primary, secondary, tertiary, quaternary, and quinternary tiller respectively. Tillering numbers were
counted at the heading stage and shown as Mean SE (n = 10). The MOC1 transgenic rice plants have
much more high order tillering number (tertiary, quaternary, and quinternary tiller) than wild-type
H89025.
>;Desc/Clms Page number 6;
Figure 8. Plasmid map of the E. coli expression vectorpGEX-2T/MOCl. The entire MOC1 gene was
fused in the same open reading frame with GST and was driven by the IPTG inducible Lac promoter.
Figure 9. The inducible expression of the GST-MOC1 fusion protein. lane 1, protein molecular marker
; lane 2, the vectorpGEX-2T before induction; lane 3, the vectorpGEX-2T/MOCl before induction;
lane4-8, the vectorpGEX-2T/MOCl that was induced by 0.4 mM IPTG for1, 2,4, 6, and 8 hours
respectively. lane 9-10, the vector pGEX-2T that was induced by 0.4 mM IPTG for 2 and 6 hours
respectively.
The molecular weight of GST and GST-MOC1 protein is 27 kDa and 72 lcDa respectively. Expression
of the GST-MOC1 fusion protein reached the highest level after induction for 6 hours by 0.4 mM
IPTG.
Figure10. Purification of the GST-MOC1 fusion protein. a, After affinity purification, there is still
mixed proteins besides the 72kDa GST-MOC1 fusion protein. M, protein molecular weight marker ;
1,2 and 3, after elution for the first, second and third time with 10 mM reductive glutathione
respectively. b, the GST- MOC1 fusion protein recovered from the gel. M, protein molecular weight
marker ; 1, the GST-MOC1 fusion protein after electronic elution; 2, the GST-MOC1 fusion protein
after dialyse.
Mode of Carrying Out the Invention Example 1. Map-based cloning the MOCI gene controlling rice
tiller 1. Isolation and genetic analysis of therice monocul777 1 mutant (mocl)
5/503
The spontaneousJnonoculm 1 mutant (7oc0) was isolated in the wild-type rice breed H89025(07 yza
sativa L. ssp. Japonica). The? Moc7 mutant has only one main culm without any tillers, as shown in
Figure 1. Reciprocal cross experiment between the mocl mutant andH89025 revealed that the mocl
mutant phenotype was caused by a recessive mutation in a single nuclear locus.
2. Mapping population and genomic DNA isolationof MOCI gene
In order to isolate the MOCI gene using a map-based cloning approach, a largeF2 mapping population
with high polymorphism was obtained from crosses between
>;Desc/Clms Page number 7;
the naocl (japonica) and Minghui 63 (Oryza sativaL. ssp.indica) plants. About 2 gram of leave material
was collected from each of the 2010F2 plants that show the monoculm phenotype in the tiller fastigium
stage. Genomic DNA was isolated from rice leaves with modified CTAB method (BarczalcAJ, Zhao J,
Pruitt K. D. Genetics 1995,140 :303-31). About 100 mg rice leaves was ground into powder in a mortar
with 5 cm diameter after freezing in liquid nitrogen and transferred into 1.5 ml centrifuge tube for total
DNA isolation. The DNA pellet was resuspended in100 ulultrapure water. 1ul DNA sample was used
in each SSLP and CAPS reaction while 30 ul for RFLP analysis.
3. Primary localization of the MOC1 gene
A small mapping population of 280F2 plants was used for SSLP (Simple Sequence Length
Polymorphism) and RFLP (Restriction Fragment Length Polymorphism) analysis in the primary
localization stage. According to the previous reports (Al ; : agi, H. , Yokozeki, Y, Inagaki, A. ,
Fujimura, T. 1996. Microsatellite DNA markers for rice chromosomes. Theor. Appl. Genet. 93: 10711077. Chen, X., Temnykl1, S. , Xu, Y., Cho, Y. G. McCouch, S. R. 1997. Development of
amicrosatellite framework map providing genome-wide coverage in rice. Theor. Appl.
Genet. 95: 553-567. ), 90 SSLP primer pairs were synthesized, and PCR amplification was performed
according to the reported conditions, after separation by 4% agarose gel electrophoresis and dying by
EB, the polymorphism of the PCR products were detected. For RFLP and other Southern analysis, the
genomic DNA was completely digested by different restriction enzymes, separated by 0.8% agarose
gel electrophoresis, and then transferred onto the Hybond N'nylon membrane (Amersham), and
hybridized with probes labeled with
the long arm of the rice Chromosome 6 (Figure 2).
4. Physical localization of the MOC7 gene
On the reportedYAC-based physical map of rice breedNipponbare (Saji, S. et al. 2001. A physical map
with yeast artificial chromosome clones covering 63% of the 12 rice chromosomes. Genome 44:32-37),
there are 11 YAC clones within the MOCI region. We isolated several YAC end DNA clones such as
Y2242R, Y2242L, Y4149R and Y4149L using theiPCR (inverse Polymerase Chain Reactions) method,
wherein Y2242R was developed into a RFLP probe successfully. Then, the RFLP markers flanking the
MOCI gene (R1559 and Y2242R) were used as probes to screen the rice breedNipponbare BAC library
(provided by Clemson University Genomics Institute, CUGI). Positive BAC clones were arranged into
a BAC contig according to the fingerprint of BAC clones provided by CUGI. Primers were designed
according to the BAC end sequences produced by the CUGI STC sequencing project (http://www.
genome. clemson.edu/projects/rice/rice~bac~end/), some BAC end DNA clones were isolated using
PCR method, and18dD02R and 45cD09F were developed into RFLP markers successfully. According
to the linkage analysis of MOCI gene with YAC or BAC ends i. e. , Y2242R, 18dD02R and 45cD09F,
further confined physically the MOC7 gene onto a single BAC clone 4cAll (Figure 3). The BAC clone
4cAll containing the MOCI gene was sonicated into fragments of 1.5-3. 0kb, and then cloned into
plasmid vectorpUCl9 after filling-in. Thus a random library of 4cAll for BAC sequencing was
constructed. Single clone in this library was randomly picked up, plasmid DNA was extracted and
sequenced.
5. Fine localization of the MOCI gene
In order to finely localize the MOCI gene, we first developed 4 new CAPS (Cleaved
AmplifiedPolymorphic Sequence) markers i. e. 12-2,15-1, 17-2 and 17-3 according to the sequence of
the BAC clone4cAll, the primer sequences thereof and the restriction enzymes that were used shown in
6/503
Table 1. Then, linkage analysis was carried out with these CAPS markers in a large mapping
population of 2010F2 mutant plants to screen the individual that occurred cross-over between the
MOCI gene and each CAPS marker. The MOCI gene is finally fine localized between the CAPS
>;Desc/Clms Page number 9;
marker 17-3 and 12-2, the physical distance is only 20 kb (Figure 4).
Tablel. New CAPS markers developed in the invention.
EMI9.1
CAPS PCR primer sequence Lenghth of Restriction Marker PCR Enzyme Products 12-2 F :
5'GACCACTTGATCTCTCATGAC3'1684 bp Mse I R : 5'GAGATCGAACAAGATGGGGAC3' 15-1
F : 5'GCCACTTGATCTCCTAAGTG3'1835 bp BstN I R : 5'GATGAGACGTCTGATCACAG3' 17-2
F : 5'GTTTGACACTCCCACTGATGG3'1737 bp Nde I R : 5'GGATCATATCCACCATGCATG3' 173 F : 5'GTAACGGAGGTAGCTCTTGAG3'1742 bp Msp I R :
5'AAAGAATCAAGCAGCAGGTGG3'6. Prediction and comparison analysis of the MOCI gene
Four putative open reading frames (ORF) were predicted using the GENSCAN software (http :/genes.
mit.edu/GENSCAN. html) in the20-kb genomic sequence region between the marker 17-3 and 12-2.
Then, these ORFs were analyzed in the protein database of theGenBank using the BLASTX program.
Among them, the protein encoded by ORF1 shared high identity with the tomato LS (44 %) and
ArabidopsisAtLS (37%), all of which belong to the GRAS transcription factors family. Since both LS
andAtLS control lateral branching of dicot plants, the homologous ORF1 is very likely the MOCI gene
that controls rice tiller. The genomic fragment of ORF1 was thus amplified from both wild-type
H89025 and the7nocl mutant using primers designed according to the sequence of the BAC clone
4cAll(MOClfl : 5'- TCGTTGTAG TAGCTCTG GTG-3'and MOClr3:5'CTAACTAGAGATCGAGTAGC-3'), and the PCR products were sequenced directly.
Sequence analysis revealed that a1. 9-kb retrotransposon was inserted into the mocl mutant, which
causes a premature translation stop of the MOCI protein.
>;Desc/Clms Page number 10;
Example 2. Transformation of the rice mocl mutant and function analysis of the MOCI gene1.
Construction of plant expression vector
In order to confirm the identity of ORF1 as the MOC1 gene that controls rice tiller, the wild-type
genomic fragment of ORF1 was transformed into the mocl mutant, then observed whether the tillering
number of the transgenic rice restored normal.
Therefore, we constructed a plant expression vector for rice transformation as follows.
Plasmid clones P4123 and P4124 from the random library of the BAC clone 4cAll for sequencing the
sequence of BAC clone 4cAllwere jointed together through the common Sad site, and a 3.2kb fragment
containing the entire coding region of the MOCI gene, 1.5kb upstream sequence and 0.3kb downstream
sequence was obtained (Figure 4). In addition, a 2.4kb fragment was obtained by digestion of the
plasmid P4123 using the enzyme SacI, which contains a partial ORF of the MOCI gene missing the
coding sequence of188 amino acids at the C-terminal (Figure 4).
The 3.2kb and 2.4kb fragments were cloned into the binary vector pCAMBIA1300 (CAMBIA, Clunies
Ross St, Black Mountain/GPO Box 3200, Canberra, ACT 2601, Australia), and transformation
plasmids pC8247 and pC8247S were obtained respectively (Figure 5). pC8247 and pC8247S were
transformed into theAgrobacteriuti7 tumefaciens strain LBA4404 respectively through the
electroporation method.
2. Transformation of the rice mock mutant
7/503
The mature seeds of the ricernocl mutant weredehusked, sterilized, and inoculated onto the callusinducing medium. After 3 weeks, the vigorously growing, light-yellow, incompact embryogenic calli
derived from the scutella were used as transformations. The calli were infected by the LBA4404 strains
containing binary plasmid vector pC8247 and pC8247S respectively, and then grown in darkness at 25
C for 3 days. Antibiotic-resistant calli and transgenic plantlets were selected on the medium containing
50 mg/L hygromycin. Hygromycin-resistant plants were transplanted into paddy field after training for
several days in the shade. 15 and 4 independent transgenic lines were obtained for the plasmid pC8247
and pC8247S
>;Desc/Clms Page number 11;
respectively, and each line includes several to several hundreds single plantlet.
Southern blot analysis of genomic DNA of the transgenic rice plants revealed that two lines have 3
copies of the MOC1 transgene and the other lines have only one copy.
3. Phenotype analysis of the MOCI transgenic rice plants
The tillering number restored normal in almost all the plasmid pC8247transformants, but all the
plasmid pC8247S transformants still remained the monoculm phenotype ofthe mocl mutant (Figure 6).
This indicated that the entire MOCI gene can restore the normal tillering ability, but cannot the mutated
MOCI gene. T2 plants of the pC8247 single copy transgenic lines separated for the normal and
monoculm phenotype basically in a 3: 1 ratio. This result strongly confirmed that ORF1 is indeed the
MOC1 gene controlling rice tiller.
4. Function analysis of the MOCI gene
In the MOCI transgenic rice plants, the? ! oc7 mutant recovered the monoculm phenotype, and the
tillering number thereof increased to 3-5 times of that of the wild typeH89025 plants (Figures 6-7).
Careful observation revealed several characteristics of the MOCI transgenic plants tillering pattern.
First, transgenic plants sometimes form 2 or more tillers at a same node, whereas wild type plants only
form one tiller.
Second, most tiller buds formed on the elongated upperinternodes of the transgenic plants and tiller
buds of higher orders (tertiary, quaternary, and quinternary) usually grow out into tillers, but these tiller
buds were usually arrested in wild-type plants.
These characteristics indicate that the MOCI gene is not only required for tiller bud formation, but also
promotes the subsequent development of tiller buds. This also suggested that rice tillering number can
be increased by over-expression of the MOCI gene using transgenic technique and be decreased by
reducing the expression level of the MOCI gene using antisense orRNAi transgenic techniques.
Example 3. Expression of the MOC1 protein in E. coli 1. Construction of E. coli expression vector
The MOC1 gene was amplified from wild-type genomic DNA using primers containing designed
BamHI andEcoRI site (Sense:5'-ggatccATgCTCC
>;Desc/Clms Page number 12;
ggTCACTCCAC-3' ; Antisense, 5'-gaattcgTCgTCTTCgTCgCCCgC-3'). PCR products were ligated
with T-easy vector (Promeag), and then transformed intoDH10B competent cells by electroporation
method. Positive recombinants were screened and sequenced to confirm no mutations present in the
MOC1 coding region.
The above T-easy construct and E. coli expression vector pGEX2T (4.9lcb,Amersham Pharmacia
Biotech UK Limited,Amersham Place, Little Chalfont,Buckinghamshire, HP79NA, England. 27-480101) were both double digested with BamHI andEcoRI. The interesting digestion products were
recovered, ligated using T4 DNA ligase, and then transformed into DH10B competent cells. Positive
recombinants were screened and sequenced to confirm that MOC1 and GST were in the same open
reading frame and can be expressed in fusion protein. The plasmid map of the E. coli expression
vectorpGEX-2T/MOC 1 was shown in Figure 8. Then, GEX- 2T/MOC1 was transformed into BL21
(DE3) competent cells for further inducible expression of the MOC1 protein.
8/503
2. Inducible expression of the GST-MOC1 fusion protein
A single colony is inoculated into 5 ml 2xYTA medium and cultured at37 C overnight. The overnight
culture was diluted with 2xYTA medium at a ratio of 1: 100 and continues to grow at37 C until
OD6oo=0. 6-1.0. Then IPTG (Sigma) with a final concentration of 0.4 mM was added into the culture,
and the cells were allowed to grow at30 C for another1, 2,4, 6, and 8 hours. As shown in Figure 9,
expression of the GST-MOC1 fusion protein reached the highest level after induction for 6 hours.
3. Purification of the GST-MOC1 fusion protein
Cell culture for purification of the GST-MOC1 fusion protein was prepared as described above. The
cells were centrifuged at 3000 rpm for 15 minutes and then washed once with1 xPBS. The cell pellets
were resuspended with 1 XPBS at a ratio of 50 mllXPBS/L culture medium, and DTT (Sigma) and
EDTA (Sigma) were added to a final concentration of 5 mM and 1 mM respectively. The cells were
repeatedly frozen and thawed for 2-3 times, and then sonicated for 6 times with a mode of 15 seconds
on and 20 seconds off. To the cells were addedTritonx 100 (sigma) to a final concentration of 1% and
agitated gently to mix well. The cells were placed on ice for
>;Desc/Clms Page number 13;
30 minutes, then centrifuged at 10000 rpm for 15 minutes, and transfered the supernatant into a new
tube. A proper amount of 50% gluthione-coupled dextran beads (Pharmacia) were added to the
supernatant at the ratio of 1 xbed volume per liter culture, then incubated on a rotator with a speed of
50 rpm at room temperature for 1 hour. Centrifuged to collect beads, discarded the supernatant, and
washed the beads 3 times with 10xbed volumes oflxPBS (containing 1% Triton). The GST-MOC1
fusion proteins were eluted from the beads using 10 mM reduced gluthione elution buffer (pH 8. 0) at
the ratio of 1 ml elution buffer per bed volume. Repeat the elution for 3 times. The collected eluents
were run on SDS-PAGE (12% separation gel) at 10 V/cm for 4 hours to separate the GST-MOC1
fusion proteins. As shown in Figure10a, besides the 72 KDa GST-MOC1 fusion proteins, there are still
other proteins mixed in the affinity-purified protein fractions. Therefore, the GST-MOC1 fusion
proteins were further recovered from the gel. Stain the gel in cooled 0.25 M KC1 solution, cut down
the 72 KDa GST-MOC1 protein band, pound it to pieces and transfered into a electronic elution tube
(BioRad). The GST-MOC1 fusion protein was electronically eluted from the gel at the constant
currency of 10 mA for 4 to 6 hours. The eluted proteins solution was dialysed overnight in 0.1 mM
NaCl and 10 mM Tris pH 7.5 buffer. The GST-MOC1 fusion proteins were confirmed on 10% SDS
PAGE gel after electronical elution and dialysis, and only a single band of 72 KDa can be detected
(Figure1 Ob). The recovery rate of the GST-MOC 1 fusion proteins is about 20%. The purified MOC
1-GST fusion proteins were storedat-70 C.Data supplied from the esp@cenet database - Worldwide
Claims:
Claims of corresponding document: WO2004018508
Claims 1. A protein controlling rice tiller or branching, characterized by having a amino acid sequence
shown by SEQ ID No: 2 or a functional analog sequence thereof obtained by substitution, deletion, or
addition of one or more amino acids of SEQ
ID No: 2, wherein the functional analog is still able to control rice tiller or branching.
2. The protein according to claim 1, characterized by having the amino acid sequence shown by SEQ
ID No: 2.
3. A nucleotide sequence, characterized by encoding the amino acid sequence shown by SEQ ID No: 2
or the functional analog sequence thereof obtained by substitution, deletion, or addition of one or more
amino acids of SEQ ID No: 2, wherein the functional analog is still able to control rice tiller or
branching.
4. The nucleotide sequence according to claim 3, characterized by having the sequence shown by SEQ
ID No: 1.
5. A vector containing a nucleotide sequence, wherein the nucleotide sequence encodes the amino acid
sequence shown by SEQ ID No: 2 or the functional analog sequence thereof obtained by substitution,
9/503
deletion, or addition of one or more amino acids of SEQ ID No: 2, wherein the functional analog is still
able to control rice tiller or branching.
6. The vector according to claim 5, which is plasmid pC8247 or pC8247S.
7. A transformant, characterized by comprising the vector of claim 5 or claim 6.
8. A method of manipulating rice tiller or branching, comprising transformation of plant cells with the
vector of claim 5 or claim 6 and cultivation of the plants from the transformed plant cells.Data supplied
from the esp@cenet database - Worldwide
10/503
2. CN1268182
- 9/27/2000
RANK1, AN ANKYRIN-REPEAT CONTAINING PEPTIDE FROM RICE
ASSOCIATED WITH DISEASE RESISTANCE
URL EPO =
http://v3.espacenet.com/textdoc?F=3&CY=ep&LG=en&IDX=CN1268182
Inventor(s):
CHAOZU HE (SG); GUO-LIANG WANG (SG)
Applicant(s):
INST OF MOLECULAR AGROBIOLOGY (SG)
IP Class 4 Digits: C07K; C12N; C12Q; A01H
IP Class:C07K14/415; C12Q1/68; C12N15/82; A01H5/00; C12N15/29; C12N5/10
Application Number:
CN19970182376 (19970915)
Priority Number: CN19970182376 (19970915)
Family: CN1268182
Abstract:
Abstract not available for CN1268182
11/503
3. CN1324817
- 12/5/2001
RICE GLUTATHION PHOSPHOLIPID HYDROGEN PEROXIDAS GENE,
PROTEIN AND THEIR APPLICATION
URL EPO =
http://v3.espacenet.com/textdoc?F=3&CY=ep&LG=en&IDX=CN1324817
Inventor(s):
LIU JINYUAN (CN); LI WENJUN (CN); ZHAO NANMING (CN)
Applicant(s):
UNIV QINGHUA (CN)
IP Class 4 Digits: C07K; C12N; A01H; C07H
IP Class:C07K14/415; C12N15/63; C12N15/82; C12N15/11; C07H21/00; C12N15/74; C12N15/79;
A01H1/00
Application Number:
CN20000109313 (20000519)
Priority Number: CN20000109313 (20000519)
Family: CN1324817
Equivalent:
CN1159339C
Abstract:
Abstract of CN1324817
The present invention relates to a rice glutathione phosphatide hydroperoxidase gene and its coded
glutathione phosphatide hydroperoxidase protein. Said invention also provides the recombinant
expression vector containing the above-mentioned gene and host cell containing this expression vector.
Said invented rice glytathione phosphatide hydroperoxidase gene can be used for protecting cell
membrane agent injury due to phosphatide hydroperoxidation, making transgenic plant delaying
senility, specially making transgenic rice capable of delaying senility and raising photosynthetic
efficiency.
12/503
4. CN1398299
- 2/19/2003
BZIP TYPE TRANSCRIPTON FACTORS REGULATING EXPRESSION OF RICE
STORAGE PROTEIN
URL EPO =
http://v3.espacenet.com/textdoc?F=3&CY=ep&LG=en&IDX=CN1398299
Inventor(s):
FUMIOL TAKAIWA (JP); YOASUYUKI ONODERA (JP)
Applicant(s):
BIO ORIENTED TECH RES ADVANCEM (JP)
IP Class 4 Digits: C07K; C12N; A01H
IP Class:C07K14/415; A01H5/00; C12N15/29; C12N5/14
Application Number:
CN20010804789 (20011011)
Priority Number: JP20000311295 (20001011)
Family: AU781150
Equivalent:
EP1327685; WO0231154; US2004072159; JP2002119282; CA2394018; AU781150
Abstract:
Abstract not available for CN1398299
Abstract of corresponding document: EP1327685
cDNAs (RISBZ1, RISBZ4, and RISBZ5) encoding bZIP transcription factors were isolated from a
cDNA library originating in rice plant seed. The cDNAs encode novel proteins and have binding
activity to the GCN4 motif. Among them, RISBZ1 activated transcription mediated by the GCN4 motif
by 100-fold or more. Since the expression of RISBZ1 precedes the expression of a seed storage protein
gene and is expressed only in maturing seeds, it is suggested that RISBZ1 controls the expression of
rice seed storage proteins. In addition, by linking the recognition sequence of the transcription factor,
the GCN4 motif, in tandem and introducing it into the promoter for a gene encoding seed storage
protein to facilitate its binding to the transcription factor RISBZ1, expression of a foreign gene under
the control of the modified promoters is greatly enhanced.Description:
Description of corresponding document: EP1327685
Technical Field
[0001] The present invention relates to a novel transcription factor and its use pertaining to the
endosperm-specific expression of the storage protein in the rice plant seed.
Background Art
[0002] Seed storage protein is expressed in seeds only during the maturing stage, and the expression
of genes encoding this protein is analyzed as a suitable model for investigating the transcription
regulatory mechanism of plant genes (Goldberg, R.B. et al., Science 266: 605-614, 1994). The
expression of a gene that codes for a seed storage protein is known to be regulated by the cooperation
of a plurality of cis factors in a promoter. The binding of a transcription factor to a specific cis
regulatory factor is important in the initiation of transcription and the tissue- and time-specific
expression. It can be explained that the expression of a seed storage protein is induced by several types
13/503
of cis regulatory factors relating to the regulation of seed-specific expression when transcription factors
that recognize specific cis regulatory factor bind and aggregate. Functional analyses of cis regulatory
factors and transcription factors of crop storage protein genes have been conducted in order to elucidate
the molecular mechanism of the expression of seed storage proteins (Thomas, T.L. , Plant Cell 5: 14011410, 1993; Morton, R.L. et al., in Seed Development and Germination, pp. 103-138, Marcel Dekker,
Inc., 1995).
[0003] However, despite considerable research, analyses using transformed plants failed to identify
the cis regulatory factors essential for gene expression regulation in nearly all crops studied, and the
gene expression regulatory mechanism has still not been clearly understood. In the case of
monocotyledons in particular, the promoter analyses using stable transformed plants has been
performed in only the seed storage protein, glutelin, of the rice plants. On the other hand, in the case of
maize, wheat and barley, analyses have been conducted using particle guns or tobacco transformants
(Muller, M. and Knudsen, S., Plant J. 6: 343-355, 1993; Albani, D. et al., Plant Cell 9: 171-184, 1997;
Marzabal, P.M. et al., Plant J. 16: 41-52, 1998).
[0004] It has been shown that the endosperm-specific expression of the seed storage protein gene of
grains is controlled by the collaborative action of several types of cis regulatory factors. The Prolamin
box (TGTAAAG), GCN4 motif (TGA(G/C)TCA), AACA motif (AACAAAA), and ACGT motif,
which are conserved in the seed storage protein gene promoters of numerous grains, have been
characterized as cis regulatory factors involved in endosperm-specific expression by loss-of-function
and gain-of-function analyses (Morton, R.L. et al., In: Seed Development and Germination, pp. 103138, Marcel Dekker Inc., 1995).
[0005] The GCN4 motif has been frequently found not only from seed storage protein gene, but also
from promoters of genes involved in the metabolism (Muller, M. and Knudsen, S., Plant J. 6: 343-355,
1993). Recently, a polymer of the GCN4 motif of rice plant glutelin gene has been found to reproduce
endosperm-specific expression in transformed rice plants, and remarkable decrease in promoter activity
and changes in its expression pattern have been found due to the substitution or deletion of nucleotides
in the GCN4 motif. These facts prove that the GCN4 motif plays an important role in endospermspecific expression (Wu, C.Y. et al., Plant J. 14: 673-683, 1998). The GCN4 motif is coupled to a
Prolamin box (TGTAAAG) via a plurality of bases in many cases, and is one of the constituents of the
two-factor endosperm box found in the prolamin gene promoters of nearly all grains, including wheat
glutenin, barley hordein, rye secalin, sorghum cafulin and adlay coixin. The AACA motif is involved in
the expression of nearly all rice glutelin genes. Although the combination of two motifs (GCN4 motif
and Prolamin box or GCN4 motif and AACA motif) is required for gene expression, in order to
adequately function as an endosperm-specific promoter, an additional motif is essential (Takaiwa, F. et
al., Plant Mol. Biol. 30: 1207-1221, 1996; Yoshihara, T. et al., FEBS Letts. 383: 213-218, 1996; Wu,
C.Y. et al., Plant J. (in press)). Recently, it has been demonstrated that, in order to function as a
minimum promoter capable of reproducing endosperm-specific expression in glutelin genes (GluB1) of
rice plant, at least three constituents, the GCN4 motif, the AACA motif, and the ACGT motif, present
in the -197 bp promoter region, are essential (Wu, C.Y. et al., Plant J. 14: 673-683, 1998; Wu, C.Y. et
al., Plant J. 23: 415-421, 2000).
[0006] Opaque2 (02) of maize is an endosperm-specific transcription factor of the bZIP type, and this
O2 binds to the ACGT motif in the 22 kDa alpha -zein gene promoter of maize to activate
transcription (Schmidt, R.J. et al., Plant Cell 4: 689-700, 1992). O2 has been reported to be involved in
endosperm-specific transcription of b-32 ribosome deactivating protein gene by binding to the
(Ga/tTGAPyPuTGPu) sequence (Lohmer, S. et al., EMBO J. 10: 617-624, 1991). O2 is thus considered
to have a wide-ranging binding capability. Reportedly, the GCN4 motif is recognized by O2, and
transcription is activated through the binding of O2 to the GCN4 motif (Wu, C.Y. et al., Plant J. 14:
673-683, 1998; Holdsworth, M.J. et al., Plant Mol. Biol. 29: 711-720, 1995). In seeds, during the
maturing stage, in vivo footprint analysis showed that the nuclear protein binds to the GCN4 motif and
Prolamin box present in wheat low molecular weight glutenin gene promoter (Vicente-Carbajos, J. et
al., Plant J. 13: 629-640, 1998) and maize gamma -zein gene promoter (Marzabal, P.M. et al., Plant J.
16: 41-52, 1998). In addition, the results of an in vitro DNaseI footprint analysis showed that the
nuclear protein of maturing rice plant seeds as well as GST-O2 fused protein specifically recognize the
GCN4 motif of the rice glutelin gene promoter (Wu, C.Y., et al., Plant J. 14: 673-683, 1998; Kim, S.Y.
and Wu, R., Nucl. Acids Res. 18: 6845-6852, 1990). These findings indicate that an O2-like
14/503
transcription factor is present in grain seeds, and that it controls the endosperm-specific expression of
numerous seed storage protein genes mediated by the GCN4 motif.
[0007] Recently, cDNA clones of transcription factors that recognize the GCN4 motif have been
isolated in wheat (Albani, D. et al., Plant Cell 9: 171-184, 1997) and barley (Vicente-Carbajos, J. et al.,
Plant J. 13: 629-640, 1998; Onate, L. et al., J. Biol. Chem. 274: 9175-9182, 1999), and have been
named SPA, BLZ1 and BLZ2. These transcription factors have been determined to activate the
transcription of seed storage protein genes mediated by the GCN4 motif in wheat low molecular weight
glutenin and barley B1 hordein gene promoter. Interestingly, these transcription factors were expressed
seed-specifically. Although cDNA that codes for a transcription factor having a high homology with
the bZIP domain of O2 has previously been isolated from rice plants, it remains to be confirmed
whether or not it activates transcription of seed storage protein gene mediated by the GCN4 motif
(Izawa, T. et al., Plant Cell 6: 1277-1287, 1994; Nakase, M. et al., Plant Mol. Biol. 33: 513-522, 1997).
Disclosure of the Invention
[0008] An object of the present invention is to provide a novel transcription factor that regulates the
expression of rice seed storage protein by binding to the GCN4 motif, a gene that codes for the factor,
plant cells and plant bodies in which the gene has been introduced, and a method for production and
use thereof.
[0009] The present inventors conducted research to resolve the above problems. As mentioned above,
the GCN4 motif is a sequence that is highly conserved in the promoters of grain seed storage protein
genes, and plays a central role in the endosperm-specific expression of the genes. This GCN4 motif is
recognized by the bZIP transcription factor family that is closely related to the Opaque2 (O2) protein of
maize. Therefore, the present inventors thought that, by isolating bZIP transcription factor from the rice
seeds, it would be possible to identify the transcription factor that binds to the GCN4 motif to control
the expression of rice seed storage protein.
[0010] First, the present inventors screened a cDNA library originating in rice seed and isolated
cDNA that codes for five types of bZIP transcription factors (RISBZ1, RISBZ2, RISBZ3, RISBZ4, and
RISBZ5). Based on the homology of the presumed amino acid sequences, RISBZ2 and RISBZ3 were
identical to RITA1 (Izawa, T. et al., Plant Cell 6: 1277-1287, 1994) and REB (Nakase, M. et al., Plant
Mol. Biol. 33: 513-522, 1997), respectively, and the remaining RISBZ1, RISBZ4, and RISBZ5 were
revealed to code for novel proteins. When the binding ability of RISBZ1, RISBZ2, RISBZ3, RISBZ4,
and RISBZ5 to GCN4 motif was investigated, they all exhibited binding activity to the GCN4 motif.
Furthermore, the transcription activation ability of the five proteins by binding to the GCN4 motif was
investigated. As a result, only RISBZ1 activated transcription 100-fold or more by binding to the
GCN4 motif. In addition, an analysis using the GAL4 DNA binding domain of yeast revealed that
proline-rich, 27 amino acid residues of the N-terminal side of RISBZ1 functioned as a the
transcription-activating domain. The difference in transcription activation ability between RISBZ1 and
the other RISBZ proteins was primarily due to the mutation of 7 amino acid residues (for RISBZ2) or
deletion of the transcription-activating domain (for RISBZ3, RISBZ4, and RISBZ5). This finding
suggests that the difference in transcription activation ability between RISBZ1 and other RISBZ
proteins occur due to a structural mutation of the transcription activating domain. In addition, RISBZ1
was found to form not only a homodimer, but also heterodimers with other RISBZ proteins. Since the
expression of RISBZ1 precedes the expression of seed storage protein gene and is expressed only in
maturing seeds, RISBZ1 may control the expression of seed storage protein. In order to investigate the
expression of RISBZ1 gene, the promoter of the RISBZ1 gene was coupled to a GUS reporter gene,
and this construct was introduced into a rice plant . In this rice plant the GUS gene was strongly
expressed in the aleurone layer.
[0011] As described above, the present inventors demonstrated that the novel proteins RISBZ1,
RUSBZ4, and RISBZ5 actually bind to the GCN4 motif, and clarified that RISBZ1 is a transcription
activation factor involved in endosperm-specific expression of the rice seed storage protein gene.
15/503
[0012] The present inventors also produced a transformed plant that contained a DNA construct in
which the RISBZ1 of the present invention was connected downstream of a promoter and a DNA
construct in which a reporter gene was connected downstream of a promoter containing the target
sequence of RISBZ1. The inventors then succeeded in measuring the transcription activity of RISBZ1
in the transformed plant by using the expression of the reporter gene as an indicator. These findings
enable high level expression of a useful, highly value-added foreign gene within the transformed plant
cells in which the foreign gene is connected downstream of a promoter containing the target sequence
of RISBZ1 instead of the above reporter gene.
[0013] The present invention relates to a novel transcription factor that regulates the expression of
rice seed storage protein by binding to the GCN4 motif, a gene encoding the factor, plant cells and
plants in which the gene has been introduced, and methods for production and use thereof. More
specifically, the present invention provides the following:
[1] a DNA selected from the following (a) through (d):
(a) a DNA encoding a protein comprising the amino acid sequence set forth in any one of SEQ ID
NOs: 2, 5, and 7;
(b) a DNA comprising a coding region of the nucleotide sequence set forth in any one of SEQ ID
NOs: 1, 3, 4, and 6;
(c) a DNA comprising the amino acid sequence set forth in any one of SEQ ID NOs: 2, 5, and 7, in
which one or more amino acids are substituted, deleted, added, and/or inserted, and encoding a protein
that is functionally equivalent to a protein comprising the amino acid sequence set forth in any one of
SEQ ID NOs: 2, 5, and 7; and
(d) a DNA hybridizing under stringent conditions with a DNA comprising the nucleotide sequence
set forth in any one of SEQ ID NOs: 1, 3, 4, and 6, and encoding a protein functionally equivalent to a
protein comprising the amino acid sequence set forth in any one of SEQ ID NOs: 2, 5, and 7;
[2] the DNA according to [1], which encodes a protein that binds to the GCN4 motif or activates
expression of rice seed storage protein;
[3] the DNA according to [1] or [2], which is derived from rice plant;
[4] a DNA encoding antisense RNA complementary to a transcription product of the DNA according
to any one of [1] through [3];
[5] a DNA encoding an RNA having ribozyme activity that specifically cleaves a transcription
product of the DNA according to any one of [1] through [3];
[6] a DNA encoding an RNA that suppresses the expression of the DNA according to any one of [1]
through [3] in plant cells by co-inhibition effects, and having 90% or more homology with the DNA
according to any one of [1] through [3];
[7] a DNA encoding a protein having a dominant negative phenotype of a protein encoded by the
DNA according to any one of [1] through [3] which is endogenous in plant cells;
[8] a vector containing the DNA according to any one of [1] through [3];
[9] a transformed cell retaining the DNA according to any one of [1] through [3] or the vector
according to [8];
[10] a protein that is encoded by the DNA according to any one of [1] through [3];
[11] a method of producing the protein according to [10], the method comprising steps of culturing
the transformed cell according to [9] and collecting the expressed protein from said transformed cell or
their culture supernatant;
[12] a vector containing the DNA according to any one of [4] through [7];
[13] a transformed plant cell retaining the DNA according to any one of [1] through [7] or the vector
according to [8] or [12];
[14] a transformed plant containing the transformed plant cell according to [13];
[15] a transformed plant that is a progeny or clone of the transformed plant according to [14];
[16] a reproductive material of the transformed plant according to [14] or [15];
[17] an antibody that binds to the protein according to [10];
[18] a plant having on its genome a DNA construct in which the DNA according to [1] is operably
connected downstream of an expression control region and a DNA construct in which a foreign gene is
operably connected downstream of an expression control region having the target sequence of the
protein according to [10];
16/503
[19] the plant according to [18], wherein the target sequence is a sequence containing the GCN4
motif;
[20] the plant according to [19], wherein the GCN4 motif has the sequence set forth in any one of
SEQ ID NOs: 8, 13, and 14;
[21] the plant according to [18], wherein the target sequence is a sequence containing a G/C box; and,
[22] a method of producing the plant according to any one of [18] through [21], the method
comprising a step of crossing a plant having on its genome a DNA construct in which the DNA
according to [1] is operably connected downstream of an expression control region, with a plant having
on its genome a DNA construct in which a foreign gene is operably connected downstream of an
expression control region containing the target sequence of the protein according to [10].
[0014] The present invention provides DNAs encoding RISBZ1, RISBZ4, and RISBZ5 protein
originating in the rice plant. The nucleotide sequence of the cDNA of RISBZ1 is shown in SEQ ID
NO: 1, the amino acid sequence of the protein encoded by the cDNA is shown in SEQ ID NO: 2, and
the nucleotide sequence of the genome DNA is shown in SEQ ID NO: 3 (the genome DNA sequence
set forth in SEQ ID NO: 3 contains introns and is composed of six exons). The nucleotide sequences of
the cDNAs of RISBZ4 and RISBZ5 proteins are shown in SEQ ID NO: 4 and 6, respectively, while the
amino acid sequences of the proteins encoded by the cDNAs of RISBZ4 and RISBZ5 proteins are
shown in SEQ ID NO: 5 and 7, respectively. In the present specification, the RISBZ1, RISBZ4, and
RISBZ5 of the present invention are collectively referred to as RISBZ.
[0015] The RISBZ proteins of the present invention are thought to be bZIP transcription factors
having the ability to bind the GCN4 motif. Among these, RISBZ1 remarkably activates transcription
by binding to the GCN4 motif. Since the promoter of the RISBZ1 gene is activated in the aleurone
layer of rice seeds, RISBZ1 is thought to be a transcription-activating factor that controls the
expression of rice seed storage protein.
[0016] In addition, it has been reported that bZIP transcription factors form various
homo/heterodimers through the combination of various factors belonging to the bZIP transcription
factor family. As a result, control factors with various functions are formed, which control gene
transcription. In the Examples described below, RISBZ2 and RISBZ3 were shown to form a
heterodimer with RISBZ1. In addition, RISBZ4 and RISBZ5 have extremely high homology (96% and
82.7%; respectively) with the bZIP domain of RISBZ3, and these factors would also form heterodimers
with RISBZ1. These facts suggest that RISBZ4 and RISBZ5 of the present invention would form, with
the RISBZ1 and other RISBZ members of the present invention, heterodimers having various
transcription activating abilities and DNA binding properties depending on the maturation stage and
tissue to control the expression of seed storage protein.
[0017] Thus, the DNA encoding the RISBZ protein of the present invention, or a molecule that
controls the expression of the DNA, would be useful in, for example, regulating the expression of seed
storage protein. Regulation of the expression of seed storage protein has various industrial advantages.
For example, it would be possible to accumulate abundant foreign gene products in the endosperm by
deleting seed storage protein in the endosperm. On the other hand, by highly accumulating seed storage
protein in the endosperm, it would be possible to produce seeds (e.g., rice) having greater nutritional
value.
[0018] The DNA encoding the RISBZ protein of the present invention includes genomic DNA,
cDNA, and chemically synthesized DNA. A genomic DNA and cDNA can be prepared according to
conventional methods known to those skilled in the art. More specifically, a genomic DNA can be
prepared, for example, as follows: (1) extracting genomic DNA from plant cells or tissues; (2)
constructing a genomic library (utilizing a vector, such as plasmid, phage, cosmid, BAC, PAC, and so
on) ; (3) spreading the library; and (4) conducting colony hybridization or plaque hybridization using a
probe prepared based on the DNA encoding the protein of the present invention (e.g. SEQ ID NO: 1, 3,
4, or 6) . Alternatively, a genomic DNA can be prepared by PCR, using primers specific to the DNA
encoding the protein of the present invention (e.g. SEQ ID NO: 1, 3, 4, or 6). On the other hand, cDNA
can be prepared, for example, as follows: (1) synthesizing cDNAs based on mRNAs extracted from
plant cells or tissues; (2) preparing a cDNA library by inserting the synthesized cDNA into vectors,
17/503
such as lambda ZAP; (3) spreading the cDNA library; and (4) conducting colony hybridization or
plaque hybridization as described above. Alternatively, cDNA can also be prepared by PCR.
[0019] The present invention includes DNAs encoding proteins functionally equivalent to the RISBZ
protein of SEQ ID NO: 2, 5, or 7. Herein, the term "functionally equivalent to the RISBZ protein"
means that the object protein has the biological function equivalent to those of RISBZ protein of SEQ
ID NO: 2, 5, or 7, such as the function of binding to GCN4 motif and/or regulating the expression of
rice seed storage proteins. The rice seed storage proteins include, for example, rice glutelins.
[0020] Examples of such DNAs include those encoding mutants, derivatives, alleles, variants, and
homologues comprising the amino acid sequence of SEQ ID NO: 2, 5, or 7 wherein one or more amino
acids are substituted, deleted, added, and/or inserted.
[0021] Examples of methods for preparing a DNA encoding a protein comprising altered amino acids
well known to those skilled in the art include the site-directed mutagenesis (Kramer, W. and Fritz, H. J., Oligonucleotide-directed construction of mutagenesis via gapped duplex DNA. Methods in
Enzymology, 154: 350-367, 1987). The amino acid sequence of a protein may also be mutated
spontaneously due to the mutation of a nucleotide sequence. A DNA encoding proteins having the
amino acid sequence of a natural RISBZ protein (SEQ ID NOs: 2, 5, or 7) wherein one or more amino
acids are substituted, deleted, and/or added are also included in the DNA of the present invention, so
long as they encode a protein functionally equivalent to the natural RISBZ protein. Additionally,
nucleotide sequence mutants that do not give rise to amino acid sequence changes in the protein
(degeneracy mutants) are also included in the DNA of the present invention. The numbers of
nucleotide mutations in the object DNA at amino acid level is typically 100 amino acids or less,
preferably 50 amino acids or less, more preferably 20 amino acids or less, and most preferably 10
amino acids or less (for example, 5 amino acids or less or 3 amino acids or less).
[0022] Whether or not a certain DNA codes for a protein having the function of binding to the GCN4
motif can be determined by, for example, gel shift assay usually used by those skilled in the art. More
specifically, this assay can be carried out as follows: First, the detected DNA is incorporated into a
vector so that its gene product forms a fused protein with GST and the vector is allowed to express the
fused protein. The expression product is purified using GST as an indicator followed by mixing with a
labeled DNA probe containing the GCN4 motif. This mixed solution is analyzed by electrophoresis
using nondenaturing acrylamide gel. Binding activity can then be evaluated based on the locations of
the detected bands on the gel.
[0023] In addition, whether or not a certain DNA codes for a protein having the function of activating
expression of rice seed storage protein can be determined by, for example, a reporter assay. More
specifically, this assay can be carried out as follows. First, a vector is constructed so that a reporter
gene is connected to and downstream of the promoter of rice seed storage protein. This vector and a
vector that expresses the gene product of a test DNA are introduced into the cells for the reporter assay,
and the transcription activity of the test DNA gene product is evaluated by measuring the activity of the
reporter gene product. An example of the promoter of rice seed storage protein that can be used for the
reporter assay is the rice glutelin gene promoter. There are no particular restrictions to the reporter gene
provided its expression can be detected, and any reporter gene that are usually used in various assay
systems by those skilled in the art, can be used. A preferable example of the reporter gene is the beta glucuronidase (GUS) gene.
[0024] A DNA encoding a protein functionally equivalent to the RISBZ protein set forth in SEQ ID
NO: 2, 5, or 7 can be produced by, for example, methods well known to those skilled in the art
including: methods using hybridization techniques (Southern, E.M., Journal of Molecular Biology, Vol.
98, 503, 1975); and polymerase chain reaction (PCR) techniques (Saiki, R. K. et al. Science, 230,
1350-1354, 1985; Saiki, R. K. et al. Science, 239, 487-491, 1988). It is routine for a person skilled in
the art to isolate a DNA with high homology to the RISBZ gene from rice and so forth using the
RISBZ gene (SEQ ID NO: 1, 3, 4, or 6) or parts thereof as a probe, and oligonucleotides hybridizing
specifically to the gene as a primer. Such a DNA encoding a protein functionally equivalent to the
RISBZ protein, isolable by hybridization techniques or PCR techniques, is included in the DNA of this
invention.
18/503
[0025] Hybridization reactions to isolate such DNAs are preferably conducted under stringent
conditions. Stringent hybridization conditions of the present invention include conditions such as: 6 M
urea, 0.4% SDS, and 0.5x SSC; and those which yield a similar stringency to the conditions. DNAs
with higher homology are expected to be isolated efficiently when hybridization is performed under
conditions with higher stringency, for example, 6 M urea, 0.4% SDS, and 0.1x SSC. These DNAs
isolated under such conditions are expected to encode a protein having a high amino acid level
homology with RISBZ protein (SEQ ID NO: 2, 5, or 7). Herein, high homology means an identity of at
least 50% or more, more preferably means an identity of at least 70% or more, and most preferably
means an identity of at least 90% or more (e.g., 95% or more) throughout the entire amino acid
sequence. The degree of sequence identity can be determined by FASTA search (Pearson W.R. and
D.J. Lipman Proc. Natl. Acad. Sci. USA. 85:2444-2448, 1988) or BLAST search.
[0026] The DNA of the present invention can be used, for example, to prepare recombinant proteins
and to produce transgenic plants as described above.
[0027] A recombinant protein is usually prepared by inserting a DNA encoding a protein of the
present invention into an appropriate expression vector, introducing the vector into an appropriate cell,
culturing the transformed cells, and purifying expressed proteins. A recombinant protein can be
expressed as a fusion protein with other proteins so as to be easily purified, for example, as a fusion
protein with maltose binding protein in Escherlchia coli (New England Biolabs, USA, vector pMAL
series), as a fusion protein with glutathione-S-transferase (GST) (Amersham Pharmacia Biotech, vector
pGEX series) , or tagged with histidine (Novagen, pET series). The host cell is not limited so long as
the cell is suitable for expressing the recombinant protein. It is possible to utilize, for example, yeast,
plant, insect cells or various other animal cells besides the above-described E. coli. A vector can be
introduced into a host cell by a variety of methods known to one skilled in the art. For example, a
transformation method using calcium ions (Mandel, M. and Higa, A. Journal of Molecular Biology, 53,
158-162,1970; Hanahan, D. Journal of Molecular Biology, 166, 557-580, 1983) can be used to
introduce a vector into E. coli. A recombinant protein expressed in the host cells can be purified and
recovered from the host cells or the culture supernatant thereof by known methods in the art. When a
recombinant protein is expressed as a fusion protein with maltose binding protein or other partners, the
recombinant protein can be easily purified via affinity chromatography.
[0028] The resulting protein can be used to prepare an antibody that binds to the protein. For
example, a polyclonal antibody can be prepared by immunizing immune animals, such as rabbits, with
a purified protein of the present invention or its portion, collecting blood after a certain period, and
removing clots. A monoclonal antibody can be prepared by fusing myeloma cells with the antibodyforming cells of animals immunized with the above protein or its portion, isolating a monoclonal cell
expressing a desired antibody (hybridoma), and recovering the antibody from the cell. The antibody
thus obtained can be utilized to purify or detect a protein of the present invention. Accordingly, the
present invention includes antibodies that bind to proteins of the invention.
[0029] A plant transformant expressing DNAs of the present invention can be created by inserting a
DNA encoding a protein of the present invention into an appropriate vector, introducing this vector into
a plant cell, and then, regenerating the resulting transformed plant cell.
[0030] On the other hand, a plant transformant in which the expression of the DNA of the present
invention is suppressed can be created using a DNA that suppresses the expression of a DNA encoding
a protein of the present invention: wherein the DNA is inserted into an appropriate vector, the vector is
introduced into a plant cell, and then, the resulting transformed plant cell is regenerated. The phrase
"suppression of expression of a DNA encoding a protein of the present invention" includes suppression
of gene transcription as well as suppression of translation to protein. Furthermore, it also includes the
complete inability of expression of DNA as well as reduction of expression.
[0031] The expression of a specific endogenous gene in plants can be suppressed by methods
utilizing antisense technology conventional to the art. Ecker et al. were the first to demonstrate the
antisense effect of an antisense RNA introduced by electroporation into plant cells by using the
transient gene expression method (J. R. Ecker and R. W. Davis Proc. Natl. Acad. Sci. USA 83: 5372,
1986). Thereafter, the target gene expression was reportedly reduced in tobacco and petunias by
19/503
expressing antisense RNAs (A. R. van der Krol et al. Nature 333: 866, 1988). The antisense technique
has now been established as a means of suppressing target-gene expression in plants.
[0032] Multiple factors cause antisense nucleic acid to suppress the target-gene expression. These
include the following: inhibition of transcription initiation by triple strand formation; suppression of
transcription by hybrid formation at the site where the RNA polymerase has formed a local open loop
structure; transcription inhibition by hybrid formation with the RNA being synthesized; suppression of
splicing by hybrid formation at the junction between an intron and an exon; suppression of splicing by
hybrid formation at the site of spliceosome formation; suppression of mRNA translocation from the
nucleus to the cytoplasm by hybrid formation with mRNA; suppression of splicing by hybrid formation
at the capping site or at the poly(A) addition site; suppression of translation initiation by hybrid
formation at the binding site for the translation initiation factors; suppression of translation by hybrid
formation at the site for ribosome binding near the initiation codon; inhibition of peptide chain
elongation by hybrid formation in the translated region or at the polysome binding sites of mRNA; and
suppression of gene expression by hybrid formation at the sites of interaction between nucleic acids
and proteins. These factors suppress the target gene expression by inhibiting the process of
transcription, splicing, or translation (Hirashima and Inoue, "Shin Seikagaku Jikken Koza (New
Biochemistry Experimentation Lectures) 2, Kakusan (Nucleic Acids) IV, Idenshi No Fukusei To
Hatsugen (Replication and Expression of Genes)," Nihon Seikagakukai Hen (The Japanese
Biochemical Society), Tokyo Kagaku Dozin, pp. 319-347, (1993)).
[0033] An antisense sequence of the present invention can suppress the target gene expression by any
of the above mechanisms. In one embodiment, if an antisense sequence is designed to be
complementary to the untranslated region near the 5' end of the gene's mRNA, it will effectively inhibit
translation of a gene. It is also possible to use sequences complementary to the coding regions or to the
untranslated region on the 3' side. Thus, the antisense DNA used in the present invention includes a
DNA having antisense sequences against both the untranslated regions and the translated regions of the
gene. The antisense DNA to be used is connected downstream of an appropriate promoter, and,
preferably, a sequence containing the transcription termination signal is connected on the 3' side. The
DNA thus prepared can be transfected into the desired plant by known methods. The sequence of the
antisense DNA is preferably a sequence complementary to the endogenous gene of the plant to be
transformed or a part thereof, but it need not be perfectly complementary so long as it can effectively
inhibit the gene expression. The transcribed RNA is preferably 90% or more, and most preferably 95%
or more complementary to the transcribed products of the target gene. The complementary of
sequences can be determined by the above-described search methods. In order to effectively inhibit the
expression of the target gene by means of an antisense sequence, the antisense DNA should be at least
15 nucleotides long or more, preferably 100 nucleotides long or more, and still more preferably 500
nucleotides long or more. The antisense DNA to be used is generally shorter than 5 kb, and preferably
shorter than 2.5 kb.
[0034] DNA encoding ribozymes can also be used to suppress the expression of endogenous genes. A
ribozyme means an RNA molecule that has catalytic activities. There are many ribozymes having
various activities. Research on the ribozymes as RNA cleaving enzyme has enabled the design of a
ribozyme that site-specifically cleaves RNA. While some ribozymes of the group I intron type or the
M1RNA contained in RNaseP consist of 400 nucleotides or more, others belonging to the hammerhead
type or the hairpin type have an activity domain of about 40 nucleotides (Makoto Koizumi and Eiko
Ohtsuka Tanpakushitsu Kakusan Kohso (Nucleic acid, Protein, and Enzyme) 35: 2191, 1990).
[0035] The self-cleavage domain of a hammerhead type ribozyme cleaves at the 3' side of C15 of the
sequence G13U14C15. Formation of a nucleotide pair between U14 and A at the ninth position is
considered important for the ribozyme activity. It has been shown that the cleavage also occurs when
the nucleotide at the 15th position is A or U instead of C (M. Koizumi et al. FEBS Lett. 228: 225,
1988). If the substrate binding site of the ribozyme is designed to be complementary to the RNA
sequences adjacent to the target site, one can create a restriction-enzyme-like RNA cleaving ribozyme
which recognizes the sequence UC, UU, or UA within the target RNA (M. Koizumi et al. FEBS Lett.
239: 285, 1988; Makoto Koizumi and Eiko Ohtsuka Tanpakushitsu Kakusan Kohso (Protein, Nucleic
acid, and Enzyme), 35: 2191, 1990; M. Koizumi et al. Nucleic Acids Res. 17: 7059, 1989). For
example, in the coding region of the RISBZ gene (SEQ ID NO: 1, 3, 4, or 6), there are pluralities of
sites that can be used as the ribozyme target.
20/503
[0036] The hairpin-type ribozyme is also useful in the present invention. A hairpin-type ribozyme
can be found, for example, in the minus strand of the satellite RNA of tobacco ringspot virus (J. M.
Buzayan, Nature 323: 349,1986). This ribozyme has also been shown to target-specifically cleave RNA
(Y. Kikuchi and N. Sasaki (1992) Nucleic Acids Res. 19: 6751; Yo Kikuchi (1992) Kagaku To
Seibutsu (Chemistry and Biology) 30: 112).
[0037] The ribozyme designed to cleave the target is fused with a promoter, such as the cauliflower
mosaic virus 35S promoter, and with a transcription termination sequence, so that it will be transcribed
in plant cells. If extra sequences have been added to the 5' end or the 3' end of the transcribed RNA, the
ribozyme activity can be lost. In this case, one can place an additional trimming ribozyme, which
functions in cis to perform the trimming on the 5' or the 3' side of the ribozyme portion, in order to
precisely cut the ribozyme portion from the transcribed RNA containing the ribozyme (K. Taira et al.
(1990) Protein Eng. 3: 733; A. M. Dzaianott and J. J. Bujarski (1989) Proc. Natl. Acad. Sci. USA 86:
4823; C. A. Grosshands and R. T. Cech (1991) Nucleic Acids Res. 19: 3875; K. Taira et al. (1991)
Nucleic Acid Res. 19: 5125). Multiple sites within the target gene can be cleaved by arranging these
structural units in tandem to achieve greater effects (N. Yuyama et al., Biochem. Biophys. Res.
Commun. 186: 1271 (1992)). By using such ribozymes, it is possible to specifically cleave the
transcription products of the target gene in the present invention, thereby suppressing the expression of
the gene.
[0038] Endogenous gene expression can also be suppressed by co-suppression through the
transformation by DNA having a sequence identical or similar to the target gene sequence. "Cosuppression" refers to the phenomenon in which, when a gene having a sequence identical or similar to
the target endogenous gene sequence is introduced into plants by transformation, expression of both the
introduced exogenous gene and the target endogenous gene becomes suppressed. Although the detailed
mechanism of co-suppression is unknown, it is frequently observed in plants (Curr. Biol. 7: R793,
1997, Curr. Biol. 6: 810, 1996). For example, if one wishes to obtain a plant body in which the RISBZ
gene is co-suppressed, the plant in question can be transformed via a vector DNA designed so as to
express the RISBZ gene or DNA having a similar sequence to select a plant having the RISBZ mutant
character, for example, a plant with modified expression level of storage proteins in seeds, among the
resultant plants. The gene to be used for co-suppression need not be identical to the target gene, but it
should have at least 70% or more sequence identity, preferably 80% or more sequence identity, and
more preferably 90% or more (e.g., 95% or more) sequence identity. Sequence identity can be
determined by using the above-described search.
[0039] In addition, endogenous gene expression in the present invention can also be suppressed by
transforming the plant with a gene encoding a protein having the dominant negative phenotype of the
expression product of the target gene. "A DNA encoding a protein having the dominant negative
phenotype" as used herein means a DNA encoding a protein, which upon expression, can eliminate or
reduce the activity of the protein encoded by endogenous gene inherent to the plant. An example
thereof is a DNA that codes for a peptide having GCN4 binding ability and having no transcription
activating domain of the protein of the present invention (for example, the peptide missing the 1st to
40th amino acids of the amino acid sequence of SEQ ID NO: 2 or a peptide of other proteins
corresponding thereto).
[0040] The vector used to transform plant cells is not particularly restricted as long as it is capable of
expressing an inserted gene in the cells. For example, a vector having a promoter for performing
constitutive gene expression in plant cells (e.g., the 35S promoter of cauliflower mosaic virus), or a
vector having a promoter that is inductively activated by an external stimulus can be used. In addition,
a promoter that guarantees tissue-specific expression can also be suitably used. Examples of tissuespecific promoters include a promoter of glutelin gene (Takaiwa, F. et al., Plant Mol. Biol. 17: 875885, 1991) or a promoter of the RISBZ1 of the present invention for the expression in the seeds of rice
plants, and a promoter of glycinin gene for the expression in the seeds of leguminous crops such as
kidney beans, broad beans and green peas or oil seed crops such as peanuts, sesame seeds, rape seeds,
cottonseeds, sunflower seeds and safflower seeds, or a promoter of the major storage protein of each of
the above crops such as a promoter of phaseolin gene in the case of kidney beans (Murai, N. et al.,
Science 222: 476-482, 1993) or a promoter of the gluciferrin gene in the case of rape seed (Rodin, J. et
al., Plant Mol. Biol. 20: 559-563, 1992) , a promoter of the patatin gene (Rocha-Sosa, M. et al., EMBO
21/503
J. 8: 23-29, 1989) for the expression in the root tuber of potatoes,, a promoter of the sporamin gene for
the expression in the root tuber of sweet potatoes (Hattori, T. and Nakamura, K., Plant Mol. Biol. 11:
417-426, 1988), and a promoter of the ribulose-1,5-bisphosphate decarboxylase gene for the expression
in the leaves of spinach and other vegetables (Orozco, B.M. and Ogren, W.L., Plant Mol. Biol. 23:
1129-1138, 1993).
[0041] The plant cell to which a vector is introduced used herein includes various forms of plant
cells, such as cultured cell suspensions, protoplasts, leaf sections, and callus.
[0042] A vector can be introduced into plant cells by known methods, such as the polyethylene
glycol method, electroporation, Agrobacterium-mediated transfer, and particle bombardment. Plants
can be regenerated from transformed plant cells by known methods depending on the type of the plant
cell (Toki et al., (1995) Plant Physiol. 100:1503-1507). For example, transformation and regeneration
methods for rice plants include: (1) introducing genes into protoplasts using polyethylene glycol and
regenerating the plant body (suitable for indica rice cultivars) (Datta,S.K. (1995) in "Gene Transfer To
Plants", Potrykus I and Spangenberg Eds., pp66-74); (2) introducing genes into protoplasts using
electric pulse, and regenerating the plant body (suitable for japonica rice cultivars)(Toki et al (1992)
Plant Physiol. 100, 1503-1507); (3) introducing genes directly into cells by the particle bombardment,
and regenerating the plant body (Christou et al. (1991) Bio/Technology, 9: 957-962); (4) introducing
genes using Agrobacterium, and regenerating the plant body (Hiei et al. (1994) Plant J. 6: 271-282);
and so on. These methods are already established in the art and are widely used in the technical field of
the present invention. Such methods can be suitably used for the present invention.
[0043] Once a transformed plant with the DNA of the present invention integrated into the genome is
obtained, it is possible to gain progenies from that plant body by sexual or vegetative propagation.
Alternatively, plants can be mass-produced from breeding materials (for example, seeds, fruits, ears,
tubers, tubercles, tubs, callus, protoplast, etc.) obtained from the plant, as well as progenies or clones
thereof. Plant cells transformed with the DNA of the present invention, plant bodies including these
cells, progenies and clones of the plant, as well as breeding materials obtained from the plant, its
progenies and clones, are all included in the present invention. The plant body of the present invention
is preferably a monocotyledon, more preferably a plant of the Poaceae, and most preferably a rice
plant.
[0044] In addition, the present invention provides a plant body in which a foreign gene product has
been highly expressed using the RISBZ gene of the present invention. The plant body of the present
invention has in its genome a DNA construct in which the DNA of the present invention is operably
connected downstream of an expression control region, and a DNA construct in which a foreign gene is
operably connected downstream of an expression control region having a target sequence.
[0045] The DNA of the present invention or a foreign gene being "operably connected" downstream
of an expression control region means that the DNA of the present invention or a foreign gene binds to
an expression control region so as to induce the expression of the DNA of the present invention or a
foreign gene by the binding of a transcription factor to the expression control region.
[0046] The target sequence refers to a DNA sequence to which the RISBZ protein of the present
invention, which is a transcription factor, binds, and is preferably a DNA sequence that contains the
GCN4 motif or G/C box. Examples of the GCN4 motif include the sequences shown below which have
been found in various genes:
GCN4 Motif (name of gene containing GCN4 motif)
EMI20.1
EMI21.1
[0047] Preferable GCN4 motif sequences for use as target sequences include "GCTGAGTCATGA/
SEQ ID NO: 8", GATGAGTCATGC/ SEQ ID NO: 13" and "AATGAGTCATCA/ SEQ ID NO: 14".
Specific examples of a G/C box include the sequence, "AGCCACGTCACA/ SEQ ID NO: 15".
22/503
Sequences in which the above GCN4 motif or G/C box is repeated in tandem are also included in the
target sequence of the present invention, and a preferable example is a sequence in which the GCN4
motif or G/C box are repeated in tandem four times.
[0048] Examples of foreign genes include genes coding for antibodies, enzymes, and physiologically
active peptides.
[0049] Moreover, the present invention provides a method of producing a plant body in which a
foreign gene product is highly expressed using the RISBZ gene of the present invention. Examples of
the methods for producing the plant body include a method of crossing "a plant body having a DNA
construct in its genome, in which the DNA of the present invention is operably connected downstream
of an expression control region," and "a plant body having a DNA construct in its genome, in which a
foreign gene is operably connected downstream of an expression control region having the target
sequence of the protein of the present invention."
[0050] The above-described "DNA construct in which the DNA of the present invention is operably
connected downstream of an expression control region," and "the DNA construct in which a foreign
gene is operably connected downstream of an expression control region having a target sequence" can
be introduced into the plant genome by a conventional method by those skilled in the art, such as a
method that uses the above-mentioned agrobacterium.
[0051] In addition, crossing of plant bodies can be carried out by a conventional method for those
skilled in the art. For example, in order to prevent self-propagation, only the pollen is sterilized by
demasculating using the tip shearing method on the day of crossing or by demasculating using hot
water on the day of crossing to shake pollinate the ear of the pollen mother.
Brief Description of the Drawings
Fig. 1 is a drawing representing a genealogical tree based on the homology of the amino acid
sequence of RISBZ protein and O2-like bZIP protein. The entire amino acid sequences of these
proteins are compared to understand the similarity and the evolutionary relationship of these proteins.
Fig. 2 compares the amino acid sequences of RISBZ protein and O2-like bZIP protein. Outline letters
on a black background shows the amino acids that retained 50% or more. The presumed nuclear
migration signal (NLSA: SV40-like motif) (Varagona, M.J. et al., Plant Cell 4: 1213-1227, 1992) and
the serine-rich phosphorylation sites are indicated with double lines and broken lines, respectively. The
bold lines indicate the basic domain, which has a two-factor nuclear migration signal (NLSB) structure.
Downward arrows indicate the leucine repeats. The primer used for the production of the rice bZIP
probe was designed based on the amino acid sequences indicated by rightward and leftward arrows.
BLZ1 (Vicente-Carbojos, J. et al., Plant J. 13: 629-640, 1998) and BLZ2 (Onate, L. et al., J. Biol.
Chem. 274: 9175-9182, 1999) represent O2-like bZIP proteins isolated from barley, O2 (Hartings, H. et
al., EMBO J. 8: 2795-2801, 1989) and OHP1 (Pysh, L.D. et al., Plant Cell 5: 227-236, 1993) from
maize, SPA from wheat (Albani D. et al., Plant Cell 9: 171-184, 1997), O2-sorg from sorghum
(Pirovano, L. et al., Plant Mol. Biol. 24: 515-523, 1994), and O2-coix from adlay (Vettore, A.L. et al.,
Plant Mol. Biol. 36: 249-263, 1998).
Fig. 3 is a continuation of Figure 2.
Fig. 4 shows the structure of a gene that codes for O2-like bZIP protein. The structures of the
intron/exon region of the BLZ1 gene of barley and the Opaque2 gene of maize (O2) (Hartings, H. et
al., EMBO J. 8: 2795-2801, 1989), sorghum (O2-sorg) and adlay (O2-coix) are shown. The thick bars
and thin lines represent exons and introns, respectively. The numbers indicate the number of
nucleotides of the exons and introns.
Fig. 5 is a photograph representing the result of a Northern blot showing the transcription patterns of
the RISBZ genes. Northern blotting analysis was performed on the whole RNA extracted from the root,
seedling, and maturing seeds (5, 10, 15, 20, and 30 DAF) using a unique nucleotide sequence of a
region downstream of the bZIP domain for the probe. In order to compare transcription patterns, the
analysis was also conducted using the GluB-1 gene-coding region as the probe. The stained images of
25S rRNA obtained using ethidium bromide are shown as a control.
23/503
Fig. 6 represents the results of histological analysis of the RISBZ1 promoter/GUS reporter gene in a
transformed rice plant.
(A) is a schematic drawing of the RISBZ1 promoter/GUS reporter gene. (a) and (b) show the
sequence from the -1674>;th; to +4>;th; nucleotides counting from the transcription initiation point of
the RISBZ1 gene and the sequence from the -1674>;th; to +213>;th; gene that contains uORF,
respectively, both connected to the GUS reporter gene on a binary vector. (c) shows the GluB1
promoter (-245 to +18) sequence binding to the GUS reporter gene on a plasmid vector.
(B) are photographs showing the expression of GUS reporter gene in a seed during the maturation
process. After cutting the seed (10 DAF) of a rice plant, into which the reporter gene was introduced, in
the longitudinal direction, the cut seed was immersed in X-gluc solution and incubated at 37 DEG C.
EN indicates the endosperm, while EM indicates the embryo.
(C) is a graph showing the GUS activity of a seed extract of a transformed rice plant. 15 DAF seeds
were used for analysis. The promoter structures of the introduced genes are as shown in (a) and (b) of
(A), respectively. Vertical lines indicate the mean value. MU represents 4-methylumbelliferone.
Fig. 7 shows photographs of gel electrophoretic patterns as determined from a methylation
interference experiment for identifying the RISBZ1 protein-binding site on the GluB1 promoter Each
of the strands (top and bottom) of the promoter fragment of the GluB1 gene (-245 to +18) was labeled.
After partially methylating each strand, they were incubated with GST-RISBZ1 protein, the fragments
that did not bind to the protein and the fragment that bound to the protein were each collected and
subjected to electrophoresis after chemically cleaved by piperidine. The sites (indicated by asterisks)
that were not cleaved by piperidine were only found in the GCN4 motif.
Fig. 8 shows the result of electrophoresis in gel shift analysis to investigate the binding capability of
RISBZ1 protein to the GCN4 motif.
(A) shows 21-bp DNA fragments that contain the GCN4 motif of a WILD:GluB-1 promoter
sequence (-175 to -155) of an oligonucleotide used as the probe and competitor. M1 to M7 are a series
of 21-bp DNA fragments that were mutated every 3 bp. The GCN4 motif is underlined.
(B) through (F) show the results of gel shift analysis of the GST-RISBZ fused protein. A 21-bp DNA
fragment (WILD) was added as the probe. (B) is for GST-RISBZ1, (C) for GST-RISBZ2, (D) for GSTRISBZ3, (E) for GST-RISBZ4, and (F) for GST-RISBZ5. The competitor was added to a
stoichiometric ratio of 100 times or more against the probe. Lane 1: No protein; Lane 2: No competitor;
and Lanes 3 to 10: With Competitor (wild type (W) and M1 to M7).
Fig. 9 represents heterodimer forming ability of RISBZ1 with other RISBZ proteins.
(A) shows the vector structure used as the in vitro transcription/translation reaction template. The
vectors contain DNA coding for full-length RISBZ1 protein, short-form RISBZ2 protein (sRISBZ2:
218 to 329), or short-form RISBZ3 protein (sRISBZ3: 126 to 237).
(B) shows photographs of gel electrophoretic patterns representing the results of a DNA binding
assay. In lanes 2, 4, 6, and 8, DNA complexes that bound to the full length or short-form protein were
detected. In lanes 3 and 7, DNA complexes that bound to the heterodimer of full length RISBZ1
protein and short-form protein were detected.
Fig. 10 shows the results of identification of the transcription-activating domain determined by
transient analysis.
(A) shows the structure of the reporter and effector plasmid. A GUS gene in which 9 copies of
GAL4-DNA binding sites and CaMV35S core promoter sequence are linked was used for the reporter.
The effector plasmid contained DNA coding for a protein in which the GAL4 DNA binding domain
was linked to the N-terminal side of truncated RISBZ1 protein.
(B) is a graph showing GUS activity when the reporter and effector plasmid were used.
Fig. 11 shows the hydropathy patterns of the N-terminal region of RISBZ1 (WT) and mutant RISBZ1
(M1 to 8) proteins determined by the formula of Kyte and Doolittle (Kyte, J. and Doolittle, R.F.J., Mol.
Biol. 157: 105-132, 1982). Positive values indicate hydropathy.
Fig. 12 schematically shows the transcription activity measurement system of RIZBZ1 using GUS
activity as the indicator, photographs of Northern blot analysis, and a graph showing GUS activity
24/503
measurement results. The ordinate of the graph represents GUS activity that is the indicator of the
strength of the transcription activity of each transcription factor.
Fig. 13 is a graph showing the recognition sequences of transcription factors RISBZ1, Opaque2,
SPA, and RISBZ3 (RITA1). The ordinate of the graph represents GUS activity that is the indicator of
the strength of the transcription activity of each transcription factor. The sequences used in the
experiment are shown below the graph.
Fig. 14 is a graph showing the transcription activating ability of the RISBZ1 of the present invention
relative to GCN4 motifs originating in various genes. The ordinate of the graph represents GUS
activity, which is the indicator of the strength of the transcription activity of each transcription factor.
The nucleotide sequences of the GCN4 motifs used in the experiment are shown below the graph.
Best Mode for Carrying out the Invention
[0053] The present invention will be described in more detail below with reference to Examples, but
is not to be construed as being limited thereto.
[Example 1] Isolation of cDNA clones encoding the bZIP transcription factor from seed cDNA
libraries
[0054] Fourteen-day leaves and roots of rice plant (Oryza sativa L. c. v. Mangetumochi) cultivated by
hydroponics were frozen in liquid nitrogen and kept at -80 DEG C until use. Maturing rice seeds were
collected from rice plants cultivated in the fields.
[0055] Using oligonucleotide primers designed from highly conserved amino acid sequences
(SNRESA and KVKMAED) within the bZIP domain of the Opaque 2 (O2)-like protein, RT-PCR was
performed by using poly(A)>;+; mRNA as a template, which was prepared from the rice seeds. From
poly (A) RNA extracted from seeds at 6 to 16 days after flowering (DAF) (Takaiwa F. et al. Mol. Gen.
Genet. 208: 15-22, 1987), single-stranded cDNA was synthesized by reverse transcription using
oligo(dT)20 as a primer and Superscript reverse transcriptase (Gibco BRL, Paisly, UK) . Next, cDNA
was amplified using a pair of primers (5'-TCC AAC/T A/CGI GAA/G A/TCI GC-3'; SEQ ID NO: 16,
and 5'-GTC CTC C/TGC CAT CTT CAC CTT-3'; SEQ ID NO: 17). These primers were designed
based on highly conserved amino acid sequences within the bZIP-type transcription factors that were
expressed in cereal seeds. After dissolving the single-stranded cDNA in a PCR reaction mixture
containing 10 mM Tris-HCl pH 8.3, 1.5 mM MgCl2, 50 mM KCl, 0.01% (w/v) gelatin, 200 mu M
dNTPs, 1 mu M oligonucleotide primers, TaqI polymerase was added to the mixture and the resulting
mixture was incubated in a thermal cycler at 94 DEG C for 5 min. cDNA was then synthesized and
amplified by three-cycle PCR (for 1 min at 94 DEG C, for 1 min at 40 DEG C, and then for 2 mins at
72 DEG C) followed by 30-cycle PCR (for 1 min at 94 DEG C, for 1 min at 55 DEG C, and then for 2
mins at 72 DEG C). The amplified DNA fragment was cloned into a TA cloning vector (pCR2.1;
Invitrogen), and subjected to sequencing by using the ABI PRISM dye terminator sequence system.
The reaction products were analyzed by ABI PRISM 310 Genetic Analyzer (Perkin Elmer-Applied
Biosystems) to determine the nucleotide sequences of at least 50 clones. The obtained nucleotide
sequence data was analysed and searched on databases by using the GENETYX and BLAST algorisms.
As a result, five distinct DNA fragments with 213-bp were found. Two of these were identical to the
bZIP domain sequences of REB (Izawa T. et al. Plant Cell 6: 1277-1287, 1994) and the RITA1
(Nakase M. et al. Plant Mol. Biol. 33: 513-522, 1997). Using the five DNA fragments with 213-bp as
primers, a cDNA library was prepared from mRNA of maturing (6-16 DAF) seeds (ZAPII;
STRATAGENE). This was then screened to obtain their full-length cDNAs corresponding to each of
the fragments under high stringent conditions. [ alpha ->;32;P]-dCTP was incorporated into the DNA
fragments by random priming (Amersham Pharmacia Biotech) and the resulting fragments were used
as probes. As a pre-hybridisation solution, a mixture containing 5x SSC, 5x Denhard's solution, 0.1%
SDS, 50% formamide, 100 mu g/ml salmon sperm DNA was used. After hybridization, filters were
washed once at 55 DEG C with a mixture consisting of 2x SSC and 0.1% SDS, and then twice at 55
DEG C with a mixture consisting of 0.1x SSC and 0.1% SDS.
25/503
[0056] Based on the homologies to each nucleotide sequence, the cDNA clones obtained were termed
as RISBZ1 (rice seed b-Zipper 1) (SEQ ID NO: 1), RISBZ2, RISBZ3, RISBZ4 (SEQ ID NO: 4), and
RISBZ5 (SEQ ID NO: 6). Among them, RISBZ2 and RISBZ3 were identical to REB (Izawa T. et al.
Plant Cell 6: 1277-1287, 1994) and RITA1 (Nakase M. et al. Plant Mol. Biol. 33: 513-522, 1997),
respectively, which have previously been isolated from cDNA libraries of seeds and leaves.
[Example 2] Identification of RISBZ cDNA
[0057] The newly identified RISBZ cDNAs (RISBZ1, RISBZ4, and RISBZ5) were characterized in
detail as described below. RISBZ1 cDNA was the longest, which had 1742 bp in length excluding
poly(A), and contained a reading frame encoding 436 amino acids that had 46,491 Dal of an estimated
molecular weight. RISBZ4 and RISBZ5 have reading frames encoding 278 and 295 amino acids; their
estimated molecular weights are 29,383 Dal and 31,925 Dal respectively.
[0058] RISBZ1 mRNA has a longer leader sequence (245 bases long) than average leader sequences.
Interestingly, a small open reading frame, encoding 31 amino acid residues, was found within the
leader sequence in the upstream of the actual initiation codon of the RISBZ1 protein. Similar small
upstream open reading frames (uORF) have previously been found in maize Opaque 2 (O2) (Hartings
H. et al. EMBO J. 8: 2795-2801, 1989), wheat SPA (Albani D. et al. Plant Cell 9: 171-184, 1997), and
barley BLZ1 and BLZ2 (Vincente-Carbojos J. et al. Plant J. 13: 629-640, 1998; Onate L. et al. J. Biol.
Chem. 274: 9175-9182, 1999), but these uORFs have little homology with each other. It has previously
been reported that uORF of the maize O2 mRNA is involved in translational control. uORF was found
only in RISBZ1 mRNA but not in other RISBZ mRNA.
[0059] The flanking sequence of the initiation codon is GCAATGG. This sequence coincided with
eukaryotic translational initiation sequence, c(a/c)(A/G)(A/C)cAUGGCG, derived from
monocotyledonous plants. There were 100 bps between the initiation codon and uORF. The open
reading frame encoding RISBZ1 had two identical termination codons (TAG) . There were 229 bps
between the termination codon and poly(A) sequence. The polyadenylation signal sequence
(AATATA) was found in the region at -19 to -24 from the site to which poly(A) was added.
[0060] RISBZ1 is closely related to rice REB (Nakase M. et al. Plant Mol. Biol. 33: 513-522, 1997),
maize OHP-1 and OHP-2 (Pysh L. D. et al. Plant Cell 5: 227-236, 1993), and barley BLZ1 (VincenteCarbojos J. et al. Plant J. 13: 629-640, 1998) (Figure 1), and showed the homologies of 48.2% (rice
REB), 45.7% (barley BLZ1), and 46.6% (maize OHP1), respectively, at the amino acid level.
Furthermore, these bZIP domains were highly conserved (73.7% to 76.3%). At the amino acid level,
the homologies of RITA1 (RISBZ3) with RISBZ4 and RISBZ5 were 88.8% and 47.6% respectively.
By contrast, the homology of RISBZ4 with RISBZ5 was 48.2%. RISBZ3, RISBZ4, and RISBZ5
comprise a unique group among the 02-like transcription factors that were previously reported.
Furthermore, the five RISBZ cDNAs isolated from the seed cDNA library could be classified into two
groups based upon the amino acid homology (Figure 1). The RISBZ3, RISBZ4, and RISBZ5 lacked
the N- and C-terminal regions present in RISBZ1 and RISBZ2, and their sizes reduced about 100 to
150 amino acid residues compared with those of RISBZ1 and RISBZ2 (Figures 2 and 3).
[0061] RISBZ1 and RISBZ2 were rich in proline residues at their N-terminal region, which lacked in
other RISBZ proteins (Figures 2 and 3). RISBZ1 and RISBZ2 were also rich in acidic amino acids at
the peripheral region of the 60>;th; amino acid residue from their N-termini and at the intermediate
region located in the upstream of their bZIP domains. These proline-rich or acidic amino acid-rich
regions were found in other 02-like transcription factors.
[0062] Since serine-rich sequence (SGSS) was found in the region ranging from 207>;th; to 210>;th;
residues of RISBZ1, the protein was considered to be a target sequence of casein kinase II (Hunter T.
and Karin M. Cell 70: 375-387, 1992) (Figures 2 and 3). Similar sequence (SSSS) was also found in
RISBZ2. However, it was missing in the other RISBZ proteins (Figures 2 and 3).
26/503
[0063] So far, two nuclear transition signals (NLSA: an SV-40-like motif and NLSB: a 2-factor
motif) have been identified, which are involved in transport of maize Opaque2 (O2) proteins from
cytoplasm into nucleus (Varagona M. J. et al. Plant Cell 4: 1213-1227, 1992). These motifs were
searched on RISBZ1 and sequences homologous to NLSA and NLSB were found at the same sites as
O2 (101 to 135 and 232 to 264).
[Example 3] Genomic structure of the RISBZ1 gene
[0064] Using primers designed from the nucleotide sequence of the RISBZ1 cDNA, the genomic
region encoding promoter and RISBZ1 protein was isolated. The PCR reaction was performed using
rice genomic DNA as a template and two pairs of oligonucleotide primers (RIS1f: 5'ATGGGTTGCGTAGCCGTAGCT-3' /SEQ ID NO: 18 and RELr5: 5'TTGCTTGGCATGAGCATCTGT-3' /SEQ ID NO: 19) and (RELf2: 5'-GAGGATCAGGCCCATAT3' / SEQ ID NO: 20 and RIS1r: 5'-TCGCTATATTAAGGGAGACCA-3' / SEQ ID NO: 21). DNA
fragments were amplified using TAKARA LA Taq polymerase (TAKARA) in a thermal cycler through
30-cycle reactions for 10 sec at 98 DEG C, for 30 sec at 56 DEG C and for 5 min at 68 DEG C. The
promoter region of the RISBZ1 gene was also amplified by thermal asymmetric interlaced (TAIL)
PCR, based on the method by Liu et al, in which three oligonucleotides were used as specific primers,
tail1: 5'-TGCTCCATTGCGCTCTCGGACGAG-3' / SEQ ID NO: 22, tail2: 5'ATGAATTCGCGAGGGGTTTTCGA-3' / SEQ ID NO: 23, and tail3: 5'GTTTGGGAGAAATTCGATCAAATGC-3' / SEQ ID NO: 24.
[0065] The results revealed that the RISBZ1 gene comprises of six exons and five introns (Figure 4).
The constitution of exon/intron in this RISBZ1 gene was identical to that of the maize O2 (Hartings H.
et al. EMBO J. 8: 2795-2801, 1989), Sorghum O2 (Pirovano L. et al. Plant Mol. Biol. 24: 515-523,
1994), adlay O2 (Vettore A. L. et al. Plant Mol. Biol. 36: 249-263, 1998), and barley BLZ1 (VicenteCarbojos J. et al. Plant J. 13: 629-640, 1998) genes (Figure 4).
[0066] The transcription initiation site of the RISBZ1 gene was determined by the primer extension
analysis according to the method of Sambrook et al. (Sambrook J. et al. Molecular Cloning: A
Laboratory Manual, 2nd Ed., pp. 7.79-7.83, Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
NY). Specifically, a primer, 5'-ATGGTATGGTGTTCCTAGCACAGGTGTAGC-3' (SEQ ID NO: 25),
was produced by labelling with T4 kinase, the 5' end of the oligonucleotide comprising 30 nucleotides,
which was complementary to a sequence immediately downstream of a desired region. Reverse
transcription reaction was conducted using this primer and 5 mu g of mRNA as a template, and a
Superscript reverse transcriptase kit (Gibco BRL, Paisly, UK). This reaction was carried out in a
mixture comprising 20 mM Tris-HCl, 50 mM MgCl2, 10 mM DTT, 500 mu M dNTP, 100,000 cpm
primer, 5 mu g mRNA, and 200-unit Superscript reverse transcriptase (Gibco BRL, Paisly, UK), for 50
min at 42 DEG C.
[0067] As a result, the transcription initiation site was mapped to the 245-nt upstream region from the
translation initiation codon of the RISBZ1 gene. A 'TATA' box was localized at -30 to -35-nt from the
transcription initiation site. Three 'ACGT' motifs were found in the 63-, 123-, and 198-bp upstream
regions from the transcription initiation site but none of motifs responsible for expression of seedspecific genes, such as, GCN4 and 'AACA' were found. In contrast, a number of the recognition
sequences for Dof domain protein, 'AAAG', were found. These motifs may be involved in stage- and/or
tissue-specific expression of the RISBZ1 gene. For example, if the 'ACGT' motif is a target sequence of
the RISBZ1 protein, the RISBZ1 gene may be autoregulated by itself. However, when the RISBZ1
promoter/GUS reporter gene and the 35S CaMV promoter/RISBZ1 gene were introduced into
protoplast cells, no transcriptional activation of the reporter gene was observed. These data suggest that
the RISBZ1 promoter has no target sequence for the RISB21 protein; namely, the 'ACGT' motif found
in the RISBZ1 promoter is not a target sequence of the protein. Therefore, the RISBZ1 gene is
probably not autoregulated. In contrast, upon overexpression of the rice prolamin box binding factor
(RPBF) gene (which recognizes the Dof domain) transcription of the RISBZ1 promoter/GUS reporter
gene is activated. This suggests that the recognition sequences of the Dof domain proteins are involved
in specific expression of the RISBZ1 gene.
27/503
[Example 4] Tissue-specificity of the RISBZ mRNA
[0068] Northern blotting was carried out to analyze the expression of the RIABZ gene. According to
the method by Takaiwa et al. (Varagona M. J. et al. Plant Cell 4: 1213-1227, 1992), total RNA was
extracted from 5 to 30 DAF seeds, roots, and seedling (5-, 10-, 15-, 20- and 30-DAF), and was
transferred to membrane filters after fractionation by agarose gel electrophoresis. As probes, the
following DNA fragments ranging from the downstream sequence of the bZIP domain-encoding region
to the 3' non-coding region in the RISBZ cDNA were used:
RISBZ1, 354-bp ranging from 1388>;th; to 1742>;nd; nucleotides;
RISBZ2, 346-bp ranging from 1351>;st; to 1696>;th; nucleotides;
RISBZ3, 486-bp ranging from 741>;st; to 1226>;th; nucleotides; and
RISBZ5, 621-bp ranging from 742>;nd; to 1362>;nd; nucleotides.
[0069] Hybridization was carried out in a solution containing 5x SSC, 5x Denhard's solution, 0.1%
SDS, and 50% formamide, at 45 DEG C. After the hybridization, the membrane filters were washed
twice for 30 min with a mixed solution comprising 2x SSC and 0.1% SDS, and then twice for 30 min
with a mixture comprising 0.1x SSC and 0.1% SDS.
[0070] As shown in Figure 5, the RISBZ1 gene was expressed only in seeds, not in other tissues
analyzed. The largest amount of the RISBZ1 mRNA was accumulated in seeds harvested from 5 DAF
to 10 DAF. Such a high accumulation of mRNA was maintained until 15 DAF, and gradually
decreased towards maturing. The peak of the RISBZ1 gene expression appeared at an earlier stage than
that of the glutelin gene. The glutelin mRNA expression was detected from 5 DAF, had a peak at 15
DAF, and was then gradually decreased (Figure 5). This result suggests that the RISBZ1 acts as an
activator of the glutelin gene. Similar expression patterns have also been reported in the maize O2
(Hartings H. et al. EMBO J. 8: 2795-2801, 1989), wheat SPA (Albani D. et al. Plant Cell 9: 171-184,
1997), and barley BLZ2 genes (Onate L. et al. J. Biol. Chem. 274: 9175-9182, 1999).
[0071] The RISBZ2 was expressed in all the tissues analyzed. The RISBZ3 and RISBZ 4 were
expressed specifically in seeds at later stages of maturing (Figure 5). The RISBZ3 and RISBZ 4 mRNA
levels gradually increased until 20 DAF and then decreased. The expression level of RISBZ5 was
extremely low, compared with other RISBZ genes, and its mRNA peak was at 10 DAF.
[Example 5] Expression of the RISBZ1 promoter/GUS reporter gene construct in transformants
[0072] To examine an expression pattern of the RISBZ1 gene, the sequence fragment ranging from 1674 to +213 nt numbering from the transcription initiation site, was ligated upstream of GUS gene.
This reporter gene was introduced into rice plant by using Agrobacterium (Figure 6A). Transformed
rice plant (Oryza sativa L. c. v. kitaake) was constructed as follows. Two oligonucleotide primers with
the PstI or BamHI restriction site at its 5' end, 5'-AAAACTGCAGTTTTCTGA-3' (SEQ ID NO: 26)
and 5'-AATGGATCCGCGAGGGGTTTTCGAA-3' (SEQ ID NO: 27), were used to amplify the 5'-end
regions (from -1674>;th; to +4>;th; and from -1674>;th; to +213>;rd;) of the RISBZ1 gene by PCR.
The PCR reaction was carried out in a reaction mixture (10 mM Tris-HCl pH 8.3, 1.5 mM MgCl2, 50
mM KCl, 0.01% (w/v) gelatine, 200 mu M dNTPs, 1 mu M primers, 0.5 mu g template DNA, and
2.5-unit TaqI polymerase) by 30 cycles of incubation for 1 min at 94 DEG C, for 1 min at 50 DEG C
and for 2 min at 72 DEG C. After digestion with restriction enzymes, PstI and BamHI, the PCR
product was cloned into the plasmid vector pBI201, and was cleaved with restriction enzymes, PstI and
SacI. The resulting DNA fragment containing the RISBZ1 promoter/GUS gene was inserted between
the Sse8387I and SacI sites of the binary vector p8cHm, which contains the CaMV35S
promoter/hygromycin phosphotransferase (HPT) gene. Transformation was performed according to the
method described in Goto F. et al. Nature Biotech. 17: 282-286.
28/503
[0073] The reporter plasmid was constructed as follows, 1x 21 bp, 3x 21 bp, and 5x 21 bp of GCN4
motifs/GUS genes, as constructed by Wu et al. (Wu C. Y. et al. Plant J. 14: 673-683, 1998), were used
as the reporter. A pair of 48-bp oligonucleotides with overhanged (ACGT) 5' ends, which were
complementary to each other, was associated to construct tetramers comprising 12-bp wild-type GCN4
motif (GCTGAGTCATGA/ SEQ ID NO: 8) and mutant GCN4 motif (GCTTCCTCATGA/ SEQ ID
NO: 28). These double-stranded oligonucleotide were inserted into the SalI and StuI sites of the 46CaMV/GUS reporter gene.
[0074] Transient assay for rice callus protoplast was carried out according to the method described by
Wu et al. The GUS activity was measured according to the method of Jefferson (Jefferson R. A. Plant
Mol. Biol. Rep. 5: 387-405, 1987), by measuring fluorescence intensity of 4-methyl-umbelliferone
derived from the glucuronide precursor. Using Bio Rad Kit, the concentration of proteins was
measured. Bovine serum albumin was used as a standard protein.
[0075] As shown in Figure 6B, high GUS activities was observed in the aleulon and sub aleulon
layers of maturing seeds, but not in germs. The GUS activity was not detected in roots , leaves , and
stems even by highly sensitive fluorescence measurement. These results indicate that the RISBZ1 gene
is expressed exclusively in the aleulon and sub aleulon layers. To examine the role of the 5'-end
untranslated region and uORF, the GUS activity was compared with that of a plant, which lacked
uORF ranging from -1674>;th; to +4>;th; numbering from the transcription initiation site (Figure 6A).
As a result, no change in the expression site was observed due to the lack of uORF (Figure 6B), but 5to 10-fold weaker promoter activities were observed (Figure 6C) . These data suggest that the 5'
untranslated region may play a role in upregulation of the translation, in contrast to the results in the
maize O2 in which uORF functions as a suppressor of the translation (Lohmer S. et al. Plant Cell 5: 6573).
[Example 6] Transcription activating ability of five RISBZ proteins through their binding to the GCN4
motif
[0076] Transcription activating ability of the five RISBZ proteins through their binding to the GCN4
motif was measured by transient assay. The plasmids, into which each RISBZ1 protein-encoding
sequences were ligated downstream of CaMV35S promoter as an effector, were prepared. Effector
plasmids were prepared as follows. The plasmid that encodes RISBZ1 lacking its N-terminal region
was prepared by PCR. In order to amplify cDNA encoding the regions ranging from 41>;st;, 81>;st;,
121>;st;, and 161>;st; amino acids numbering from the N-terminus of RISBZ1 to its C-terminus the
following primers were designed:
Forward primers
EMI34.1
Reverse primer
EMI34.2
[0077] These primers were designed to have an NcoI or BamHI restriction site at their 5' end. Since a
translational initiation codon was lost by deletion of its N-terminal region, ATG of the NcoI restriction
site was utilized. cDNAs were amplified by PCR comprising incubation for 2 min at 94 DEG C, 30cycle reaction for 1 min at 94 DEG C, for 1 min at 50 DEG C, and for 2 min at 72 DEG C, followed by
incubation for 5 min at 72 DEG C. The PCR products were digested with restriction enzymes, NcoI
and BamHI, and then purified through agarose gel electrophoresis. The purified cDNA fragments were
finally inserted into the pRT100 vector (Topfer R. et al. Nucl. Acids Res. 15: 5890, 1987).
[0078] Plasmids encoding the fusion proteins comprising GAL4 DNA-binding domain (amino acid
residues from 1>;st; to 147>;th;) and the RISBZ1 or RISBZ2 gene were also constructed. In order to
amplify the cDNA region encoding various N-terminal region of RISBZ1 and RISBZ2 by PCR using
Pfu Taq polymerase (STRATAGENE), the following reverse primers, to which a BamHI site, a
29/503
terminal codon, and an SstI site were added at its 5'-end, were prepared as well as the following
forward primers:
Forward primers
EMI35.1
Reverse primers
EMI35.2
[0079] cDNAs encoding various N-terminal regions of RISBZ1 and RISBZ2 were amplified by PCR
comprising incubation for 2 min at 94 DEG C, 30 cycles of reaction for 1 min at 94 DEG C, for 1 min
at 50 DEG C, and for 1 min at 72 DEG C, and then incubation for 5 min at 72 DEG C, using the abovedescribed primers. The amplified cDNAs were digested with BamHI and SacI restriction enzymes, and
were purified by 2% agarose gel electrophoresis. The purified cDNA fragments were ligated
downstream of the GAL4 DNA domain-encoding region in the 35S-564 vector digested with the same
restriction enzymes so that their reading frames were matched. Mutations were also introduced into the
N-terminal regions of RISBZ1 by PCR mutagenesis. The cDNA sequences were confirmed, and their
partial sequence from 1>;st; to 57>;th; amino acid residues was amplified by PCR. The products were
ligated downstream of the GAL4 DNA domain-encoding region in their reading frames.
[0080] In addition, reporter plasmids, into which the GUS gene, and one or three repeat(s) of the 12bp GCN4 motif or one or five repeat(s) of the 21-bp GCN4 motif were inserted, were constructed. For
negative control experiments, a reporter plasmid comprising four repeats of a mutant 12-bp GCN4
motif and the GUS reporter gene was used. The mutant 12-bp GCN4 motif has a mutation in the target
sequence that is recognized by the RISBZ1 and O2. These plasmid constructs were introduced alone or
in combination with other reporter or effector plasmid into rice protoplast cells prepared from its callus
culture, and the GUS activity was assayed. When the reporter plasmid or effector plasmid was
introduced alone into the protoplast, the GUS activity was detected at a low level. As shown in Table 1,
however, in the presence of 35S/RISBZ1 or 35S/02, which were introduced as effector plasmids, the
transcription of the reporter gene was activated. Even in the presence of these effector plasmids, the
transcriptional activity of the GUS gene downstream of the mutant 12-bp GCN4 motif was the same
level as that of background. These results indicate that the RISBZ1 gene product activates the reporter
gene mediated by the GCN4 motif. The transcriptional activity of the reporter gene induced by the
RISBZ1 gene product was slightly higher than that induced by the O2 gene product. As shown in Table
2, the activity induced by RISBZ1 was enhanced depending on the copy number of the GCN4 motif. 1
to 12 copies of 21-bp GCN motif were assayed, and the transcriptional activity was enhanced
proportionately up to 9 copies . However, even though the other RISBZ genes were expressed under
the control of the 35S CaMV promoter, the transcriptional activity of the reporter gene was less than or
equal to 1.4% of that induced by the RISBZ1 or O2 gene product. Thus, it was revealed that only the
RISBZ1 protein can activate the transcription through its binding to the GCN4 motif.
>;tb;>;TABLE; Id=Table 1 Columns=2
>;tb;
>;tb;Head Col 1: Effector
>;tb;Head Col 2: GUS activity (pM 4-MU/min/mg protein)
>;tb;>;SEP;35S/Opaque2>;SEP;2658 +/- 318
>;tb;>;SEP;35S/RISBZ1>;SEP;2994 +/- 157
>;tb;>;SEP;35S/RISBZ2>;SEP;44 +/- 7
>;tb;>;SEP;35S/RISBZ3>;SEP;1.3 +/- 1.2
>;tb;>;SEP;35S/RISBZ4>;SEP;17.3 +/- 0.9
>;tb;>;SEP;35S/RISBZ5>;SEP;31 +/- 8.8
>;tb;>;/TABLE; The 4x 12-bp GCN4 motifs/GUS reporter gene was introduced into protoplast cells
together with the effector plasmid, and the GUS activity was measured. Data were obtained from three
independent measurements.
>;tb;>;TABLE; Id=Table 2 Columns=4
>;tb;
>;tb;Head Col 1:
>;tb;Head Col 2 to 4: Effector GUS Activity (pM 4-MU/min/mg protein)
30/503
>;tb;
>;tb;SubHead Col 1: Reporter
>;tb;SubHead Col 2: (-)
>;tb;SubHead Col 3: (+) RISBZ1
>;tb;SubHead Col 4: (+) Opaque2
>;tb;1x 12-bp GCN4>;SEP;32 +/- 1.5>;SEP;295 +/- 4.5 (9.2*)>;SEP;182 +/- 6 (5.6*)
>;tb;4x 12-bp GCN4>;SEP;21>;SEP;604 +/- 24.5 (28.7*)>;SEP;452 +/- 7.5 (21.5*)
>;tb;1x 21-bp GCN4>;SEP;30 +/- 3>;SEP;1318 +/- 55.5 (43.9*)>;SEP;1139 +/- 22.5 (37.9*)
>;tb;5x 21-bp GCN4>;SEP;104>;SEP;13222 +/- 1094 (127.1*)>;SEP;11932 +/- 22.5 (114.7*)
>;tb;>;/TABLE; As a reporter, the 1x 12-bp, 4x 12-bp, 1x 21-bp or 5x 21-bp GCN4 motif/GUS gene
was used. This table shows the GUS activity induced by the expression of RISBZ1 (+RISBZ1) gene or
by Opaque2 (+Opaque2) gene.
[Example 7] Binding site of the RISBZ1 protein
[0081] The present inventors have previously discovered that the 02 protein recognizes the GCN4
motif (TGAGTCA) that is present in the promoter region ranging from -165>;th; to -160>;th; of GluB1, a glutelin gene (Wu C. Y. et al. Plant J. 14: 673-683, 1998). By a methylation interference
experiment, the present inventors have also determined the binding site of the RISBZ1 protein in the
promoter region of the GluB-1 gene.
[0082] Production and purification of the GST-RISBZ1 fusion protein were performed as follows.
Five coding regions from RISBZ1 cDNA were amplified by PCR using oligonucleotide primers to
which the following appropriate restriction enzyme sites were added at their 5' end; BamHI-blunt ends
for RISBZ1, BamHI- XhoI for RISBZ2, BamHI-SalI for RISBZ3, BamHI- SalI for RISBZ4, and
BamHI- XhoI for RISBZ5. After digestion with the restriction enzymes, the PCR products were ligated
into the cloning sites of the pGEX-4T-3 vector (Amersham Pharmacia Biotech). The GST-RISBZ
fusion protein was expressed according to the method of Suzuki et al. (Suzuki A. et al. Plant Cell
Physiol. 39: 555-559, 1998). After affinity purification, the GST fusion protein was dialyzed against a
binding buffer comprising 20 mM HEPES-KOH pH 7.9, 50 mM KCl, 1 mM EDTA, and 10% glycerol,
for four hours, and immediately stored at -80 DEG C.
[0083] Methylation interference experiment was performed as described by Weinberger et al.
(Weinberger J. et al. Nature 322: 846-849, 1986). The 5'-flanking region (from -245>;th; to +18>;th;
nucleotides) of the GluB1 gene was digested with restriction enzymes, SalI and BamHI, and the ends
of the fragment was labeled with [ alpha ->;32;P] dCTP by a 'fill-in' reaction. The labelled fragment
was methylated by treating it with dimethyl sulphate, mixed with GST-RISBZ1, and then incubated.
Using non-denaturing acrylamide gel (5%, 0.25x TBE) electrophoresis, the DNA fragment complexed
with GST-RISBZ1 and free DNA fragments were separated from each other. These DNA fragments
were further purified by DEAE Sepharose column chromatography,were treated with piperidine, and
were fractionated by 6% denaturing acrylamide gel electrophoresis.
[0084] As shown in Figure 7, the GST-RISBZ1 fusion protein protected guanine residues that locate
in the -165>;th; to -160>;th; region of the GluB-1 promoter. The guanine residues protected were the
same residues protected in the O2 promoter (Albani D. et al. Plant Cell 9: 171-184, 1997). A guanine
residue present in the 'ACGT' motif (also termed as an A/G hybrid box) at the -79>;th; to -76>;th;
residues in the promoter region ranging from -197>;th; to +18>;th;, was not protected.
[0085] Furthermore, gel shift assay was conducted as described below to examine whether the
RISBZ1 protein can recognize the GCN4 motif.
[0086] A pair of oligonucleotides complementary to each other, which was prepared by adding
TCGA sequence was added to 21-nt fragment of GluB1 promoter region (from -175>;th; to -155>;th;),
was labeled at its ends with [ alpha ->;32;P] dCTP by 'fill-in' reaction for use as a probe. Seven pairs of
complementary oligonucleotides with mutations every three contiguous nucleotides (Figure 8A) were
also synthesized for use as mutant competitor fragments and were annealed. Gel shift analysis using the
GST fusion protein was carried out by a method described by Wu et al. (Wu C. Y. et al. Plant J. 14:
31/503
673-683, 1998) and by Suzuki et al. (Suzuki A. et al. Plant Cell Physiol. 39: 555-559, 1998). The
labeled oligonucleotide probe was mixed with 0.5 mu g of the GST-RISBZ fusion protein, and
incubated for 20 min at room temperature. In competition experiments, the competitor fragment was
added to the mixture at the 100-fold or higher molecular weight ratio. The reacted mixture was
analyzed by non-denaturing acrylamide gel (5%, 0.25x TBE) electrophoresis.
[0087] The detection of shift bands showed that the GST-RISBZ1 protein was able to bind to the 21bp DNA fragment containing the GCN4 motif (Figure 8B). Furthermore, as shown Figure 8A, the 21bp DNA fragments with mutation in every three contiguous nucleotides were used as competitors and
examined. When the DNA fragments with the mutations in the GCF motif were added as the
competitor, the binding of the DNA fragments that were added as probes was hardly or not inhibited at
all (Figures 8B to F). By contrast, when the DNA fragments with mutations in the franking sequence of
the GCN4 motif were added as the competitor, the shift bands disappeared (Figures 8B to F). Since the
mutation of the GCN4 motif markedly affects the binding of the RISBZ1 protein to the motif, it was
revealed that the RISBZ1 protein recognizes the GCN4 motif sequence specifically. The similar
experiments carried out using the other RISB2 proteins revealed that all the RISBZ proteins could
specifically recognize the GCN4 motif. As shown in Figures 8B to F, the affinity of each RISBZ
proteins for the GCN4 motif slightly varies. In the cases of RISBZ2 and RISBZ5, when the DNA
fragments with mutations in the franking sequence of the GCN motif were used as the competitor, the
shift bands were not disappeared completely (Figures 8C and F).
[0088] From these results, it was revealed that the RISBZ proteins specifically recognize the GCN4
motif with slightly variable affinities.
[Example 8] Ability of RISBZ1 protein to form a heterodimer
[0089] It was considered that the RISBZ1 protein, a bZIP-type transcription factor, binds to the
GCN4-like motif upon forming a heterodimer with other RISBZ proteins. Therefore, the ability of
RISBZ1 to heterodimerize with RISBZ2 or RISBZ3 was examined. The full-length RISBZ1 protein,
and short-form-RISBZ2 protein (sRISBZ2) and short-form RISBZ3 protein (sRISBZ3) were prepared
using wheat germ extracts (Figure 9A), and were used for DNA binding assay. The in vitro translation
was carried out as follows. The coding region of RISBZ1 cDNA and the bZIP domain-encoding
regions of RISBZ2 cDNA and RISBZ3 cDNA were amplified using the following forward primers
with the NcoI site at their 5' ends and reverse primers encoding a terminator codon and the BamHI site;
For RISBZ1
EMI40.1
For sRISBZ2,
EMI40.2
For sRISBZ3,
EMI40.3
[0090] PCR amplification was carried out in a reaction mixture comprising 10 mM Tris-HCl pH 8.3,
1.5 mM MgCl2, 50 mM KCl, 0.01% (w/v) gelatine, 200 mu M dNTPs, 1 mu M primers, 0.5 mg
template DNA, and 2.5-unit TaqI polymerase by 30 cycles of incubation for 1 min at 94 DEG C, for 1
min at 50 DEG C and for 2 min at 72 DEG C.
[0091] The PCR products were digested with restriction enzymes, NcoI and BamHI, and were ligated
into the pET8c cloning vector (Novagen) to construct plasmids. Using these plasmids as templates, in
vitro transcription/translation (TNT coupled wheat germ extract systems; Promega) was performed for
the production of the full-length RISBZ1 protein, and short-form-RISBZ2 (RISBZ2s) and -RISBZ3
(RISBZ3s). For gel shift assay, 4 mu l of the wheat germ extract that was used in the above reaction
was used.
[0092] Gel shift assay was employed to separate homodimers and heterodimers bound to the 21-bp
GCN4 motifs. After pre-incubating RISBZ1 with sRISBZ2 and sRISBZ3, the DNA probes comprising
the GCN4 motif were added to the incubation mixture. The results indicate that RISBZ homodimers as
32/503
well as heterodimers can bind to the GCN4 motif. Therefore, it was demonstrated that the RISBZ
proteins form heterodimers with the other members of the RISBZ family.
[Example 9] Involvement of the N-terminal region of the RISBZ1 proteins in the transcriptional
activation
[0093] Transient assay was performed to identify the domain of the RISBZ1 protein involved in
transcription activation. The GUS gene, to which three copies of the 21-bp GCN4 motif and the core
promoter sequence of CaMV35S were connected, was prepared as a reporter. Various domains of the
RISBZ1 proteins were expressed using the CaMV35S promoter in order to examine if these domains
can activate the reporter gene.
[0094] A series of effector plasmids encoding RISBZ1 proteins in which every 40 amino acids from
N-terminus to the basic domain were deleted (encoding the amino acids region ranging from 41>;st; to
436>;th;, 81>;st; to 436>;th;, 121>;st; to 436>;th;, 161>;st; to 436>;th;, 201>;st; to 436>;th;, or
235>;th; to 436>;th; in the amino acid sequence set forth in SEQ ID NO: 2), were constructed. When
the effector plasmid encoding the full-length RISBZ1 protein and the reporter plasmid (the GUS gene
to which four copies of the 12-bp GCN motif and the core promoter sequence of CaMV35S were
linked) were introduced into protoplasts, approximately 30-fold higher activity of GUS was detected
compared to that of protoplast into which the reporter plasmid alone was introduced. When the
transcriptional activity of this reporter gene was set as 100%, the activity of the gene with deletion of
the first 40-amino acid was decreased to 20%. Furthermore, the activity of the reporter gene was
decreased gradually to 10% by deleting each 40 amino acids. Hence, it was suggested that the Nterminal 40 amino acid residues of RISBZ1 are mainly involved in the transcription activation.
[0095] To further analyze the association of the N-terminal 40 amino acids of RISBZ1 with its
transcription activating ability, various fusion proteins between the DNA binding domain of the yeast
transcriptional activating factor GAL4 and various portions of the RISBZ1 protein were constructed
and expressed for the gain-of-function assay. As shown in Figure 10, a plasmid, in which the coding
sequences of fused proteins comprising the GAL4-DNA binding domain and various regions of
RISBZ1 were connected downstream of the CaMV35S promoter, was constructed and used as an
effector. These effector plasmids were introduced into protoplast together with a reporter construct (the
GUS gene, to which nine copies of the GAL4-DNA binding site and CaMV35S core promoter were
connected).
[0096] The significant difference was not found in transcription activating ability of the fusion
protein comprising the GAL4-DNA binding domain and the partial amino acid sequence from 1st to
235>;th; amino acids of RISBZ1, compared with that of a series of the fused proteins in which amino
acids were deleted towards the 27>;th; residue from the C-terminal residue of RISBZ1 (Figure 10). The
transcription activating ability of the fusion protein with the first 20 amino acid residues were
dramatically decreased (Figure 10). A fusion protein with deletion of the N-terminal eight residues of
RISBZ1 lost the transcriptional activity. In contrast, fusion proteins comprising the GAL4-DNA
binding domain and other region of RISBZ1 (from 27>;th; through 57>;th;, 81>;st; through 234>;th;,
161>;st; through 234>;th;, or 235>;th; through 436>;th; in SEQ ID NO: 2) had no effect on the
transcriptional activity of the reporter gen. These results suggest that the proline-rich domain within the
N-terminal 27 amino acid residues of the RISBZ1 protein, rather than the acidic domain, involves in
the transcription activation.
[Example 10] Difference between RISBZ1 and other RISBZ proteins in transcription activating ability
analyzed by domain swapping
[0097] Although all the members of the RISBZ protein family have similar affinity for the GCN4
motif sequence, only the RISBZ1 has the transcription activating ability. To find out the reason of this
difference, domain swapping between RISBZ1-, and RISBZ2- or RISBZ3-protein was carried out. The
N-terminal region at 1>;st; through 299>;th; of RISBZ1, which resides upstream of the bZIP domain,
33/503
was replaced with the N-terminal region, 1>;st; through 229>;th; of RISBZ2 or 1>;st; through 137>;th;
of RISBZ3.
[0098] Fusion proteins that have the N-terminal region of RISBZ1 together with the DNA binding
domain of RISBZ2 or RISBZ3 showed only approximately 15% or 38% of the transcription activating
ability, respectively, compared with that of the full-length RISBZ1. In contrast, fusion proteins that
have the N-terminal region of RISBZ2 or RISBZ3 together with the RISBZ1 DNA binding domain
showed a slightly higher transcription activity than that induced by the RISBZ1 DNA binding domain
alone.
[0099] These results indicate that the N-terminal region is mainly involved in the transcription
activation. The lower level of the RISBZ2 or RISBZ3 transcription activating ability may be due to
deletion or mutation of the region corresponding to RISBZ1 transcription activating domain during
evolution. Alternatively, the formation process of transcription activating domain may be responsible
for that. It is highly possible that the lower activity of RISBZ3 is due to the lack of the proline-rich
domain present in RISBZ1. This applies to RISBZ4 and RISBZ5. The results of the gel shift assay
probably exclude the possibility that the differences of affinity with GCN4 motif raise the differences
of transcription activating ability.
[0100] The proline-rich domain of RISBZ1 was also highly conserved in RISBZ2, but the
transcription activating ability of RISBZ2 was extremely low compared to that of RISBZ1. When an
effector plasmid that encodes a fused protein comprising the N-terminal 27 amino acid residues of
RISBZ2 including proline-rich domain and the GAL4-DNA binding domain was introduced together
with a reporter plasmid encoding the GCN4 motif connected to the GUS gene into protoplast, no
increased activity of GUS was observed.
[0101] Since only eight-residue differences among the N-terminal 27 residues were observed
between RISBZ1 and RISBZ2, the present inventors have examined which of the residues among the
eight are responsible for the difference in transcription activating ability. The eight amino acid residues
of RISBZ1, which were different from RISBZ2, were replaced one by one with the residues of
RISBZ2, and the resulting chimeric N-terminal sequences comprising 40 amino acids were fused with
the GAL4-DNA binding domain to construct effector plasmids encoding the fused proteins. These
effector plasmids were introduced into protoplast together with the reporter plasmid in which the
GCN4 motif was fused with the GUS gene. Among eight effector plasmids, all the effector constructs,
except for those encoding a protein with replacement of the seventh residue counting from the Nterminus of RISBZ1, did not activate the transcription of the reporter gene. It was presumed using the
Kyte and Doolittle formula that all these seven substitutions of amino acids, which were lost
transcription activating ability, would induce the change. of a hydropacy pattern (Figure 11).
[Example 11] Use of the transcription factor RISBZ1 for plant breeding
[0102] The present inventors have examined the possibility to use the transcription factor, RISBZ1,
which has a transcription activating ability for plant breeding. In order to specifically overexpress the
transcription factor in seeds, rice plants were transformed with a plasmid construct that encodes the
RISBZ1 gene under the control of the promoter of the rice prolamin gene, which encodes a seed
storage protein, with 13-kDa molecular masses. The DNA fragment ranging from the EcoRI site,
located at the -29>;th; position, to the poly (A) addition site of the RISBZ1 gene was linked to the
prolamin promoter encompassing from the -652>;nd; through -13>;th; from the translation initiation
site ATG of the gene. The construct was inserted into the binary pGTV-Bar vector, and the resulting
vector was introduced into rice plants using Agrobacterium. By this approach, 28 independent
transformed lines were established. Screening of rice plants that overexpress the RISBZ1 mRNA was
carried out by Northern hybridization of RNA extracted from maturing seeds using cDNA of RISBZ1
as a probe (Figure 12). These lines overexpressing RISBZ1 were crossed with the transformed rice
plants, in which a plasmid construct encoding five tandem repeats of the 21-bp GCN4 motif (5'GTTTGTCATGGCTGAGTCATG -3'/ SEQ ID NO: 52), a target of the RISBZ1 protein, linked to the
minimum promoter/GUS reporter had been introduced.
34/503
[0103] As a result, it was revealed that the expression level of GUS reporter genes were, due to
overexpression of RISBZ1, enhanced by 400-times or more (450 to 750 nmol/min/mg protein) than
that of controls, 5x GCN4 lines (11 to 14 nmol/min/mg protein) (Figure 12). These results suggest that
the transcription of foreign genes can be highly activated by connecting the foreign genes downstream
of the target sequence of the transcription factor RISBZ1 with transcription activating ability and
overexpressing RISBZ1.
[0104] The RISBZ1 proteins can activate not only the glutelin gene but also other storage protein
genes. The 35S CaMV promoter/RISBZ1 fusion construct together with the glutelin promoter/GUS,
glutelin promoter (-980>;th; to ATG)/GUS, or 13-Kd prolamin promoter (from -652>;nd; to 29>;th;)/GUS, was introduced into rice protoplast using electroporation, and the transient expressions
of them were examined.
[0105] The results indicated that the RISBZ1 protein bound to the target sequences containing GCN4
motifs in these promoters and activated the transcription of the foreign genes. It was revealed that the
transcriptions were activated 5 to 10-fold in the case of the 13-Kd prolamin promoter and 20 to 30-fold
in the case of the globulin promoter, higher than that of the background. Therefore, methylation
interference reaction was used to determine how RISBZ1 recognizes the nucleotide sequences of these
genes.
[0106] The results showed that three GCN4 motifs (TGACACA, GATGACTCA, and TGACTCAC)
of the prolamin gene and three motifs different from the GCN4 motif (GGTGACAC, GTATGTGGC,
and GATCCATGTCAC) of the globulin gene were recognized by the RISBZ1 protein. To determine
specific sequences in the promoters that are recognized by the RISBZ1, transient expression of the
GUS gene was examined by using a chimeric promoter sequence in which the G, A, C, G/C, A/G, or
C/A box, GCN4, 22-Kd zein binding site and four repeats of 12-bp sequence including the b-32
binding site were inserted in tandem into the -46 CaMV 35S core promoter/GUS reporter gene. The
results indicate that the RISBZ1 protein preferentially recognizes the G/C box and GCN4 motif (Figure
13).
[0107] Furthermore, it was studied to see if the RISBZ1 protein recognized various distinct GCN4
motifs present in the promoter for the storage protein genes. The results indicate that the flanking
sequences of the core sequence 'TGAGTCA' of GCN4 motif influence transcription activating ability,
and that the GCN4 motifs of the wheat gliadin gene and rye secalin gene have high transcription
activating ability (Figure 14).
Industrial Applicability
[0108] The present invention provides novel transcription factors that regulate the expression of rice
seed storage proteins, and genes that encode the transcription factors. It is expected that the expression
of many seed storage proteins regulated by the RISBZ1 protein of the present invention having
transcription activating ability can be enhanced by introducing the gene encoding the RISBZ1 protein
into cells to overexpress it. The present invention also provides novel gene expression systems in
which a useful foreign gene, encoding such as an antibody and an enzyme, can be highly expressed
using the transcription factor of the present invention, by linking the recognition sequence of the
transcription factor, the GCN4 motif, in tandem and introducing it into the promoter for a gene
encoding a seed storage protein to facilitate its binding to the transcription factor. Thus, expression of
the gene encoding storage protein and the useful foreign gene can be greatly enhanced under the
control of the modified promoter. This enables abundant accumulation of a seed storage protein in
endosperm, and more nutritious seeds (e.g. rice) and production of seeds in which useful proteins are
highly accumulated.
EMI98.1Data supplied from the esp@cenet database - Worldwide
Claims of corresponding document: EP1327685
1. A DNA selected from the group consisting of:
35/503
Claims:
(a) a DNA encoding a protein comprising the amino acid sequence set forth in any one of SEQ ID
NOs: 2, 5, and 7;
(b) a DNA comprising a coding region of the nucleotide sequence set forth in any one of SEQ ID
NOs: 1, 3, 4, and 6;
(c) a DNA comprising the amino acid sequence set forth in any one of SEQ ID NOs: 2, 5, and 7, in
which one or more amino acids are substituted, deleted, added, and/or inserted, and encoding a protein
that is functionally equivalent to a protein comprising the amino acid sequence set forth in any one of
SEQ ID NOs: 2, 5, and 7; and
(d) a DNA hybridizing under stringent conditions with a DNA comprising the nucleotide sequence
set forth in any one of SEQ ID NOs: 1, 3, 4, and 6, and encoding a protein functionally equivalent to a
protein comprising the amino acid sequence set forth in any one of SEQ ID NOs: 2, 5, and 7.
2. The DNA according to claim 1, which encodes a protein that binds to the GCN4 motif or activates
expression of rice seed storage protein.
3. The DNA according to claim 1 or 2, which is derived from rice plant.
4. A DNA encoding antisense RNA complementary to a transcription product of the DNA according to
any one of claims 1 through 3.
5. A DNA encoding an RNA having ribozyme activity that specifically cleaves a transcription product
of the DNA according to any one of claims 1 through 3.
6. A DNA encoding an RNA that suppresses the expression of the DNA according to any one of claims
1 through 3 in plant cells by co-inhibition effects, and having 90% or more homology with the DNA
according to any one of claims 1 through 3.
7. A DNA encoding a protein having a dominant negative phenotype of a protein encoded by the DNA
according to any one of claims 1 through 3 which is endogenous in plant cells.
8. A vector containing the DNA according to any one of claims 1 through 3.
9. A transformed cell retaining the DNA according to any one of claims 1 through 3 or the vector
according to claim 8.
10. A protein that is encoded by the DNA according to any one of claims 1 through 3.
11. A method of producing the protein according to claim 10, the method comprising steps of culturing
the transformed cell according to claim 9 and collecting the expressed protein from said transformed
cell or their culture supernatant.
12. A vector containing the DNA according to any one of claims 4 through 7.
13. A transformed plant cell retaining the DNA according to any one of claims 1 through 7 or the
vector according to claim 8 or 12.
14. A transformed plant containing the transformed plant cell according to claim 13.
15. A transformed plant that is a progeny or clone of the transformed plant according to claim 14.
16. A reproductive material of the transformed plant according to claim 14 or 15.
17. An antibody that binds to the protein according to claim 10.
18. A plant having on its genome a DNA construct in which the DNA according to claim 1 is operably
connected downstream of an expression control region and a DNA construct in which a foreign gene is
36/503
operably connected downstream of an expression control region having the target sequence of the
protein according to claim 10.
19. The plant according to claim 18, wherein the target sequence is a sequence containing the GCN4
motif.
20. The plant according to claim 19, wherein the GCN4 motif has the sequence set forth in any one of
SEQ ID NOs: 8, 13, and 14.
21. The plant according to claim 18, wherein the target sequence is a sequence containing a G/C box.
22. A method of producing the plant according to any one of claims 18 through 21, the method
comprising a step of crossing a plant having on its genome a DNA construct in which the DNA
according to claim 1 is operably connected downstream of an expression control region, with a plant
having on its genome a DNA construct in which a foreign gene is operably connected downstream of
an expression control region containing the target sequence of the protein according to claim 10.Data
supplied from the esp@cenet database - Worldwide
37/503
5. CN1451749
- 10/29/2003
RICE ZINC FINGER PROTEIN GENE FOR NEGATIVE REGULATING PLANT
APOPTOSIS AND PROMOTING GROWTH AND DIFFERENTIATION OF
TRANSGENE CALLUS
URL EPO =
http://v3.espacenet.com/textdoc?F=3&CY=ep&LG=en&IDX=CN1451749
Inventor(s):
HE CHAOZU (CN); WANG LIJUAN (CN); PEI ZHONGYOU (CN)
Applicant(s):
INST OF MICROBIOLOGY CHINESE A (CN)
IP Class 4 Digits: C07K; C12N; A01H
IP Class:C07K14/415; C12N15/63; A01H5/00; C12N15/29; C12N15/74; A01H1/00; C12N15/70
Application Number:
CN20030125167 (20030513)
Priority Number: CN20030125167 (20030513)
Family: CN1451749
Abstract:
Abstract of CN1451749
A zinc finger protein gene OsLSD1 of paddy rice contains 3 zinc finger structure domains and can code
a protein containing 143 amino acids. Its expression is fully suppressed by rice blast bacteria. Said
OsLSD1 protein is a negative regulatory factor of programmed cell death and can promote the growth
differentiation of transgenic celli of rice. The transgenic tobacco expressing OsLSD1 has high
tolerance to cancerogenic microbial toxin fumonisin B1 (FB1).
38/503
6. CN1488642
- 4/14/2004
PADDY RICE ETHYLENE RECEPTOR PROTEIN, CODED GENE AND USE
THEREOF
URL EPO =
http://v3.espacenet.com/textdoc?F=3&CY=ep&LG=en&IDX=CN1488642
Inventor(s):
ZHANG JINGSONG (CN); CHEN SHOUYI (CN); CAO WANHONG (CN)
Applicant(s):
GENETICS AND BREEDING BIOLOGY (CN)
IP Class 4 Digits: C07K; C12N; A01H; C07H
IP Class:C07K14/415; C12N15/63; C12N15/29; C12N5/10; C07H21/00; A01H1/00
Application Number:
CN20020131154 (20021011)
Priority Number: CN20020131154 (20021011)
Family: CN1488642
Equivalent:
CN1218959C
Abstract:
Abstract of CN1488642
The invention discloses a kind of inverse correlation resistant ethane acceptor protein and the encrypt
gene and the application. The proteiní s name is OsPK1, which has 2 cistine residue series in series
table, or the derivant protein with the same activity to the former one. The encrypt gene is one of
following nucleic acid series: 1)the DNA series in series table 1; 2) DAN series which has 90%
similarity to the one limited in table 1 and the same encrypt function.
39/503
7. CN1488643
- 4/14/2004
PADDY RICE FRAGILE STRAW CONTROLLING GENE BC1 AND USE
THEREOF
URL EPO =
http://v3.espacenet.com/textdoc?F=3&CY=ep&LG=en&IDX=CN1488643
Inventor(s):
LI JIAYANG (CN); QIAN QIAN (CN); LI YUNHAI (CN)
Applicant(s):
GENETICS AND BREEDING BIOLOGY (CN)
IP Class 4 Digits: C07K; C12N; A01H
IP Class:C07K14/415; C12N15/63; C12N15/29; C12N5/10; A01H1/00; C12N15/87
Application Number:
CN20020131417 (20021010)
Priority Number: CN20020131417 (20021010)
Family: CN1488643
Equivalent:
WO2004033492; AU2003275510
Abstract:
Abstract of CN1488643
The invention clones and identifies the gene of control rice stem fragility from rice brisk stem brittle
culml(bcl), the gene is named as BCl. Transgenics function complementary experiment testifies that
BCl has the function of control rice stem mechanism intensity. The gene series analysis testifies that
the protein has 60.7 homologisation with the COBRA protein encoded by COB. The observation and
the physical standards also testify that the cloned gene has function of adjusting the thickness of the
plant cell wall and the supporting quality of plant stem.
40/503
8. CN1491960
- 4/28/2004
RICE DREB TRANSCRIPTION FACTOR AND ITS ENCODING GENE AND
USE
URL EPO =
http://v3.espacenet.com/textdoc?F=3&CY=ep&LG=en&IDX=CN1491960
Inventor(s):
CHEN SHOUYI (CN); LIU QIANG (CN); CHEN FENG (CN)
Applicant(s):
UNIV TSINGHUA (CN)
IP Class 4 Digits: C07K; C12N; A01H
IP Class:C07K14/415; C12N15/29; A01H1/00
Application Number:
CN20020129518 (20020829)
Priority Number: CN20020129518 (20020829)
Family: CN1491960
Abstract:
Abstract of CN1491960
The present invention discloses rice DREB transcription factor and its encoding gene and application,
and aims at providing transcription factor with regulation effect in plant cold and drought reaction. The
DREB transcription factor, named OsDREB, has the amino acid residue sequence of the Sequence 2 in
the sequence list or protein derived from the Sequence 2 with the amino acid residue sequence
possessing one or several amino acid residues substituted, defaulted or added and thus the same activity
as the amino acid residue sequence of Sequence 2. The encoding gene of OsDREB is one of the
nucleotide sequences: the DNA sequence of Sequence 1 in the sequence list, and DNA sequence with
homology over 90 % with the DNA sequence of Sequence 1 in the sequence list and encoding protein
of the same function. The OsDREB gene of the present invention has important significance in
breeding cold and drought resisting plant variety.
41/503
9. CN1528786
- 9/15/2004
METHOD FOR EXTRACTING RICE PROTEIN BY ALKALINE PROCESS
URL EPO =
http://v3.espacenet.com/textdoc?F=3&CY=ep&LG=en&IDX=CN1528786
Inventor(s):
SUN QINGJIE (CN); TIAN ZHENGWEN (CN); YIN QIRONG (CN)
Applicant(s):
JINJIAN RICE INDUSTRY CO LTD H (CN)
IP Class 4 Digits: C07K; A23J
IP Class:C07K14/415; C07K1/14; A23J1/12
Application Number:
CN20030134972 (20030930)
Priority Number: CN20030134972 (20030930)
Family: CN1528786
Abstract:
Abstract of CN1528786
The invention discloses a method to rice protein by alkali, including the technical step in sequence: rice
washing, lye soaking, slurry milling, stir-extracting, separating, acid precipitation, separating and
drying; NaOH solution soaking: concentration 0.05-0.15mol/L, solid-liquid ratio 1 to 6-8 and soaking
time for 2-3 hours; the stir-extracting is to stir by keeping mixed liquor pH 11, the acid precipitation is
isoelectric precipitation, i.e. it adjusts pH value by HCl to 5.5 to precipitate protein; the drying
temperature is limited below 50 deg.C. It can continuously extract rice protein on a large scale. Its
extraction rate is high and its fat content is low.
42/503
10. CN1546665
- 11/17/2004
RICE BLAST RESISTANCE RELATED GENE OF WILD RICE, PROTEIN AND
USES
URL EPO =
http://v3.espacenet.com/textdoc?F=3&CY=ep&LG=en&IDX=CN1546665
Inventor(s):
DONG HAITAO JIANG (CN)
Applicant(s):
UNIV ZHEJIANG (CN)
IP Class 4 Digits: C07K; C12N; C12Q
IP Class:C07K14/415; C12N15/63; C12Q1/68; C12N15/29
Application Number:
CN200310109145 (20031205)
Priority Number: CN200310109145 (20031205)
Family: CN1546665
Abstract:
Abstract of CN1546665
The invention provides a rice blast resistance related gene of wild rice, protein and uses, the open
reading frame sequences of the OsBTB gene is also disclosed, wherein the sequences possesses
polynucleotide sequences represented by SEQ No.1-4, these cDNA fragments are closely related to the
rice blast resistance. The invention also provides the polynucleotide recombinant vector containing
OsBTB encoding genes and the gene engineering host cell, the method for cloning the OsBTB genes,
and the chromosome orientation of the OsBTB genes.
43/503
11. CN1546666
- 11/17/2004
BACTERIAL LEAF SPOT RESISTANCE RELATED GENE OF RICE, PROTEIN
AND ITS USES
URL EPO =
http://v3.espacenet.com/textdoc?F=3&CY=ep&LG=en&IDX=CN1546666
Inventor(s):
DONG HAITAO JIANG (CN)
Applicant(s):
UNIV ZHEJIANG (CN)
IP Class 4 Digits: C07K; C12N; C12Q
IP Class:C07K14/415; C12N15/63; C12Q1/68; C12N15/29
Application Number:
CN200310109146 (20031205)
Priority Number: CN200310109146 (20031205)
Family: CN1546666
Abstract:
Abstract of CN1546666
The invention provides a Xanthomonas oryzea pv.oryzae resistance related gene of wild rice, protein
and uses, the multiple transcription polynucleotide sequences produced by RIX-4 gene alternative
splicing and the corresponding open reading frame sequences, wherein the sequences possesses
polynucleotide sequences represented by SEQ No.1-10, these cDNA fragments are closely related to
the Xanthomonas oryzea pv.oryzae. The invention also provides the polynucleotide recombinant vector
containing RIX-4 encoding genes and the gene engineering host cell, the method for cloning the RIX-4
genes, and the chromosome orientation of the RIX-4 genes.
44/503
12. CN1548453
- 11/24/2004
FRIGOSTABLE CORRELATIVE TRANSCRIPTIVE FACTOR OF RICE AND ITS
CODING GENE AND APPLICATION
URL EPO =
http://v3.espacenet.com/textdoc?F=3&CY=ep&LG=en&IDX=CN1548453
Inventor(s):
ZHANG JINGSONG (CN); CEN SHOUYI (CN); WANG YUJUN (CN)
Applicant(s):
INST OF HEREDITARY AND AUXETIC (CN)
IP Class 4 Digits: C07K; C12N; A01H
IP Class:C07K14/415; C12N15/63; C12N15/29; A01H1/00
Application Number:
CN20030123913 (20030520)
Priority Number: CN20030123913 (20030520)
Family: CN1548453
Abstract:
Abstract of CN1548453
The present invention discloses frigostable correlative transcription factor of rice and its encoding gene
and application, and aims at providing transcription factor with frigostable characteristic and its
encoding gene. The frigostable correlative transcription factor, named OsbHLH1, of the present
invention has the SEQ ID No. 2 amino acid residue sequence in the sequence list, or is SEQ ID No. 2
derivative protein with the SEQ ID No. 2 amino acid residue sequence through substitution, deletion or
addition of amino acid residue(s) and possessing the same activity as the SEQ ID No. 2. The encoding
gene of the frigostable correlative transcription factor OsbHLH1 is one of the following nucleotide
sequence: the SEQ ID No. 1 in the sequence list; the SEQ ID No. 2 in the sequence list; and the DNA
sequence with over 90 % homology to that of the SEQ ID No. 1 and encoding the same function
protein. The present invention has important significance of raising crop yield.
45/503
13. CN1570110
- 1/26/2005
RICE GRAIN GELATINIZATION TEMPERATURE MAIN CONTROL GENE
ALK AND ITS USES
URL EPO =
http://v3.espacenet.com/textdoc?F=3&CY=ep&LG=en&IDX=CN1570110
Inventor(s):
LI JIAYANG (CN); QIAN QIAN (CN); GAO ZHENYU (CN)
Applicant(s):
INST OF GENETICS AND DEVELOPME (CN)
IP Class 4 Digits: C07K; C12N; A01H
IP Class:C07K14/415; C12N15/63; A01H5/00; C12N15/29; C12N5/10; A01H1/00
Application Number:
CN20030132810 (20030721)
Priority Number: CN20030132810 (20030721)
Family: CN1570110
Abstract:
Abstract of CN1570110
The invention relates to a waste gas measuring device comprising a gas sampling device, a gas analysis
device and at least one gas guiding member through which the waste gas can be guided along a gas
path from the gas sampling device to the gas analysis device.
46/503
14. CN1618804
- 5/25/2005
PADDY RICE POTASSIUM, SODIUM ION TRANSPORT GENE AND ITS
APPLICATION
URL EPO =
http://v3.espacenet.com/textdoc?F=3&CY=ep&LG=en&IDX=CN1618804
Inventor(s):
LIN HONGXUAN (CN); REN ZHONGHAI (CN); GAO JIPING (CN)
Applicant(s):
SHANGHAI INST OF LIFE SCIENCE (CN)
IP Class 4 Digits: C07K; C12N; A01H
IP Class:C07K14/415; C12N15/63; C12N15/29; A01H1/00
Application Number:
CN200310108681 (20031119)
Priority Number: CN200310108681 (20031119)
Family: CN1618804
Abstract:
Abstract of CN1618804
A novel plant gene-paddy rice K+/Na+ transporter gene, its coding protein and its application in
improving plant variety and culturing cross variety to change the salt resistance of plant are disclosed.
47/503
15. CN1629293
- 6/22/2005
A RICE BLAST RESISTANCE GENE, ITS ENCODED PROTEIN AND USE
THEREOF
URL EPO =
http://v3.espacenet.com/textdoc?F=3&CY=ep&LG=en&IDX=CN1629293
Inventor(s):
ZHU LIHUANG (CN); CHEN XUEWEI (CN); LI SHIGUI (CN)
Applicant(s):
INST OF GENETICS AND DEVELOPME (CN)
IP Class 4 Digits: C07K; C12N; C12Q; A01H; C07H; C12P
IP Class:C12N15/63; C12Q1/68; C12N15/29; C07H21/00; A01H1/00; C12N15/33; C07K14/405;
C12P19/34
Application Number:
CN200310118433 (20031216)
Priority Number: CN200310118433 (20031216)
Family: CN1629293
Abstract:
Abstract of CN1629293
The invention provides a rice blast resistance gene, its encoding protein and use thereof, wherein rice
blast resistance gene provided by the invention is one of the following nucleic acid sequences, (1) SEQ
ID No.1 in the sequence table, (2) SEQ ID No.2 in the sequence table, (3) polynucleotide of SEQ ID
No. 3 protein sequence in the sequence table, (4) DNA sequence having over 90% homology with
DNA sequences defined by SEQ ID No.1 or SEQ ID No. 2 in the sequence table and encoding the
same functional protein, the encoding protein of rice blast resisting gene is the protein of amino acid
residue No3 sequence in the sequence table, or SEQ ID No3 derived protein by the substitution,
deletion or addition of one or several amino acid residual radicals to the SEQ ID No. 3 amino acid
residual radical sequence, and having the same activity with the SEQ ID No.3 amino acid residual
radical sequence.
48/503
16. DE4428933
- 2/22/1996
RECOVERING STARCH AND PROTEIN FROM RICE
URL EPO =
http://v3.espacenet.com/textdoc?F=3&CY=ep&LG=en&IDX=DE4428933
Inventor(s):
BARTSCH WILFRIED (DE); CUPERUS PIETER LAMMERT DR (NL);
LAMEIJER ENGEL FRANS (NL)
Applicant(s):
BRAUNSCHWEIGISCHE MASCH BAU (DE)
IP Class 4 Digits: C07K; A23J; C12P; C08B
IP Class:C07K14/415; A23J1/12; C12P21/00; C12P19/04; C08B30/00
E Class: A23J1/12; C08B30/04B
Application Number:
DE19944428933 (19940816)
Priority Number: DE19944428933 (19940816); BE19960000120 (19960213); IT1996MI00275
(19960213)
Family: DE4428933
Equivalent:
BE1011421
Abstract:
Abstract of DE4428933
Recovery of native starch (I) and native or modified protein (II) from (broken) rice comprises: (a)
comminuting the rice (under wet or dry conditions); (b) loosening the (I)-(II) matrix by soaking with
addn. of water at less than 45 deg C and without application of pressure, and (c) centrifuging the slurry
to separate (I), suspended (II) and fibres. This process is now improved by: (1) carrying out the soaking
step at pH >;= 9; (2) adding enzymes (before or during soaking), which act on the matrix (and opt. also
(II)) and (3) homogenising the slurry, during or after soaking, by application of shearing
forces.Description:
Description of DE4428933
Die Erfindung betrifft ein Verfahren zur Gewinnung von nativer Stärke und nativem oder
modifiziertem Protein aus Reis oder Bruchreis, wobei der Reis oder Bruchreis zuerst trocken oder nass
zerkleinert, dann zur Lockerung der Proteinstärkematrix unter Zusatz von Wasser im drucklosen
Zustand bei Temperaturen >; 45 DEG C eingeweicht und die so erhaltene Slurry durch Zentrifugieren
in Stärke, suspendiertes Protein und Fasern getrennt wird.
Ein derartiges Verfahren lässt sich der Fachliteratur entnehmen (Rice: Chemistry and Technology
Second edition, Bienvenido O. Juliano, The American Association of Cereal Chemists, Inc., St. Paul,
Minnesota/USA Library of Congress Catalog Card No.: 85-073192 International Standard Book No.:
0-913250-41-4 Published 1972, Second edition 1985; The Starch Industry, J.W. Knight, Pergamon
Press Ltd., Library of Congress Catalog Card No.: 68-57889, First edition: 1969). Dabei ist es
grundsätzlich bekannt, die Reiszerkleinerung im Trocken- oder Nassverfahren durchzuführen. Der
Wasserzusatz zum Einweichen des Reismehls liegt bei etwa 60 bis 90% der so hergestellten Slurry.
Bekannt geworden ist ferner ein Verfahren zur Gewinnung von Stärke aus Reis, bei dem das Protein in
denaturierter Form abgetrennt wird. Die Einweichung des Reises erfolgt diskontinuierlich unter
Anwendung eines hohen alkalischen pH-Wertes von etwa 11. Erforderlich sind dabei eine
Reaktionszeit von vier bis sechs Stunden und eine Temperatur von 5 bis 40 DEG C zur Erreichung
49/503
derjenigen Lockerung der Struktur der Stärkekörner, dem Protein und den Fasern, die für die Trennung
von Stärke und suspendiertem Protein zum Zwecke der Stärkeraffination notwendig ist. Anschliessend
findet dann die Vermahlung des Reises zwecks Freilegung der Stärke und der übrigen
Reiskornkomponenten statt.
Nachteilig bei den vorbekannten Verfahren ist die Einstellung eines hohen alkalischen pH-Wertes, der
für die Lockerung der Kornstruktur erforderlich ist, jedoch zu einer teilweisen Zerstörung der
Proteinstruktur führt mit der Folge, dass wichtige funktionelle Eigenschaften, die für ein nicht
denaturiertes Protein zwingend erforderlich sind, irreversibel verändert werden.
Der Erfindung liegt die Aufgabe zugrunde, das eingangs beschriebene Verfahren hinsichtlich der
Stärkequalität und -ausbeute zu verbessern.
Diese Aufgabe wird gemäss der Erfindung dadurch gelöst, dass das Einweichen des Reismehls bei pHWerten von @ 9 vorgenommen wird, dass vor oder während des Einweichens Enzyme zugegeben
werden, die auf die Proteinstärkematrix oder auf die Proteinstärkematrix und das Protein einwirken,
und dass während oder nach dem Einweichen durch Einbringen von Scherkräften eine Homogenisation
der Slurry erfolgt.
Durch die erfindungsgemässe Anwendung eines pH-Wertes @ 9 wird die Entstehung von
Alkalischäden an den Proteinen vermieden.
Ausserdem muss für die Enzymreaktion keine Neutralisierung des Reaktionsgemisches vorgenommen
werden. Dadurch ergibt sich im Proteinendprodukt ein vernachlässigbar geringer Aschegehalt.
Ausserdem reduzieren sich die Verbrauchsmittel an Säure.
Aufgrund der geringen alkalischen Belastung des Reaktionsgemisches sowie der niedrigen
Reaktionstemperatur von @ 45 DEG C lässt sich der Verlust an Stärke nahezu vollständig vermeiden.
Die Behandlungsweise führt zu niedrigen Viskositäten während der Reaktion und der weiteren
Prozessschritte, wodurch sowohl die mechanische Behandlungsfähigkeit als auch die Enzymreaktion
begünstigt werden.
Durch entsprechende Menge der Enzymzugabe lässt sich erfindungsgemäss erreichen, dass das
Einweichen @ zwei Stunden dauert.
Erfindungsgemäss ist es vorteilhaft, wenn für die genannten Enzyme Mischungen von Proteasen und
Peptidasen mit Cellulasen verwendet werden. Dabei ist es zweckmässig, wenn als Enzyme ausserdem
Glucanase, Xylanase, Hemicellulase, Alpha-Galactosidase, Phospholipase, Pectinase, Cellobiase,
Arabinase oder Mischungen hiervon verwendet werden.
Durch gezielten Einsatz dieser Enzyme können funktionelle Gruppen des Proteins erzeugt werden, die
sich vorteilhaft für bestimmte Applikation in der Lebensmittel- wie auch in der Futtermittelindustrie
eignen. Hierfür ist das erfindungsgemässe Verfahren insbesondere durch eine Enzymbehandlung
gekennzeichnet die den für das Einweichen eingestellten pH-Wert von @ 9 auf einen Wert @ 7,5
verringert.
Die Homogenisation kann erfindungsgemäss mittels Ultraschall, einer Kolloidmühle, einer
Mikrokavitationsaufschlussmaschine, Sieben und Verdrängerpumpen oder mittels Hochdruck erfolgen.
Bei allen diesen Verfahren geht es um das Einbringen von Scherkräften in die Slurry.
Zur weiteren Verbesserung des erfindungsgemässen Verfahrens wird ferner vorgeschlagen, dass durch
das genannte Zentrifugieren der Slurry im Unterlauf ein Grossteil der Stärke und Fasern und im
Oberlauf die Proteinfraktion mit einem geringen Stärkeanteil erhalten werden, und dass anschliessend
aus dem Oberlauf durch einen zweiten Zentrifugiervorgang der Stärkeanteil reduziert wird.
Die Trennung der Hauptkomponenten Stärke und Protein im Zentrifugalfeld des ersten
Zentrifugiervorganges wird mit geeigneten Standardmaschinen so ausgeführt, dass die anfallende
Oberlauffraktion einen Proteinanteil von 40% bezogen auf Trockensubstanz beinhaltet. Die in den
50/503
beiden Zentrifugiervorgängen anfallenden Unterläufe werden zusammengeführt und in herkömmlicher
Weise zu einer handelsüblichen Stärke weiterverarbeitet. Das während der späteren Eindampfung
entstehende Abwas (Brüdenkondensat) ist niedrig belastet und somit umweltverträglicher.
Das erfindungsgemässe Verfahren wird nachfolgend an einem Beispiel erläutert:
600 kg gemahlener Bruchreis mit einer Trockensubstanz von ca. 88% werden mittels einer
Injektionsdüse in 1000 l Wasser eingemischt und in einen beheizbaren Rührwerksbehälter eingebracht.
Die Temperatur dieser Suspension wird mittels Warmwasserbeheizung auf 40 DEG C eingestellt.
Durch Zugabe von ca. 8 l 16%iger NaOH wird die Suspension auf einen pH-Wert von 8,5 justiert.
Anschliessend wird ein Enzymcoktail aus Protease, Cellulase, Glucanase, Xylanase und Hemicellulase
von 0,2% auf Trockensubstanz Reismehl dazugegeben. Während einer eineinhalbstündigen
Reaktionszeit erfolgt ein durch Messungen nachzuweisendes Absinken des pH-Wertes von 8,5 bis auf
einen pH-Wert von 7,4.
Während der Reaktion wird die Suspension über einen Ultraschallhomogenisator zirkuliert.
Anschliessend erfolgt eine Trennung der einzelnen Fraktionen mit einem Dekanter mit einem
Trommeldurchmesser von 180 mm, der für eine Leistung von ca. 1m>;3;/h Zulauf ausgelegt und mit
variabler Differenzdrehzahl einer Räumschnecke ausgerüstet ist.
Vor der Zugabe auf den Dekanter wird die Suspension im Rührwerksbehälter durch Wasserzugabe auf
insgesamt 2800 kg verdünnt.
Das vom Dekanter ablaufende Filtrat wird zur Vermeidung von Sedimentationen gerührt und hierfür in
einem Rührwerksbehälter zwischengelagert. Durch die vorhergehende, eine Lockerung der
Proteinstärkematrix hervorrufende Reaktion im Rührwerksbehälter kann in einer Dekanterstufe die
Trennung in die Fraktionen Stärke, Fasern (Unterlauf) und Protein (Oberlauf) erfolgen. Die entwässerte
Stärkefraktion weist einen Trockensubstanzgehalt von ca. 52% auf. Durch erneute Verdünnung der
Stärkefraktion werden die Fasern nach einer Verdünnung und Siebung in der Stärkeraffinationsstufe
abgetrennt.
Der in einem Rührwerksbehälter gesammelte Oberlauf des Dekanters wird anschliessend in einem
Separator in einen stärkereduzierten proteinhaltigen Oberlauf und einen stärkeangereicherten Unterlauf
getrennt. Die Proteinfraktion (Oberlauf) wird anschliessend pasteurisiert, eingedampft und
sprühgetrocknet. Das getrocknete Produkt hat einen Proteingehalt von 65% auf Trockensubstanz, ein
elfenbeinfarbenes Aussehen und eine puderförmige Konsistenz.Data supplied from the esp@cenet
database - Worldwide
51/503
17. EP0969092
- 1/5/2000
RICE GENE RESISTANT TO BLAST DISEASE
URL EPO =
http://v3.espacenet.com/textdoc?F=3&CY=ep&LG=en&IDX=EP0969092
Inventor(s):
YANO MASAHIRO (JP); IWAMOTO MASAO (JP); KATAYOSE YUICHI (JP);
SASAKI TAKUJI (JP); WANG ZI-XUAN (JP); YAMANOUCHI UTAKO (JP); ISHIMARU LISA
(JP)
Applicant(s):
JAPAN AS REPRESENTED BY DIR GE (JP)
IP Class 4 Digits: C07K; C12N
IP Class:C07K14/415; C12N15/29; C12N5/04; C07K16/16
E Class: C07K14/415; C12N15/82C8B6B
Application Number:
EP19990111443 (19990611)
Priority Number: JP19980181455 (19980612)
Family: EP0969092
Equivalent:
US6274789; JP11346783; CA2272599; EP0969092; AU753646
Cited Document(s):
US5674993; WO9705165; XP002900641; XP002900642
Abstract:
Abstract of EP0969092
A blast disease-resistance gene (Pi-b), a functionally equivalent gene thereof and proteins encoded by
the genes are provided. The gene is useful for creating a plant resistant to the blast disease and can
confer a resistance to a broad range of the rice blast fungi on plants. Therefore, it is useful for
controlling the disease and increasing crop yields.Description:
Description of EP0969092
[0001] The present invention relates to a gene controlling resistance to blast disease in plants, a
protein encoded by said gene, and their use.
[0002] Blast disease is a serious disease in plants such as rice and is caused by the rice blast fungi,
Magnaporthe grisea. The disease has substantially damaged the rice yields in Japan and many other
rice-breeding countries. The damage is particularly severe at low temperatures and in high humidity.
The disease has been obviated by breeding resistant varieties as well as applying agricultural
chemicals. Originally, there were rice strains resistant to the disease. These strains and varieties carry
genes resistant to a specific race of the blast fungi, and these genes have been analyzed for a long time.
Presently, about 30 genes have been identified as being blast-disease resistant (Kinoshita, Rice Genet.
Newsl. 7:16-57 (1990), Iwata, Rice Genet. Newsl. 13:12-35 (1996), Iwata, Rice Genet. Newsl. 14:7-22
(1997)). These genes have been utilized to breed highly resistant varieties, and in consequence, a
number of resistant varieties have been bred. However, the introduced resistance genes are becoming
ineffective due to the emergence of novel races of the blast fungi (collapse of resistant varieties).
Furthermore, the molecular mechanisms of expression of the blast disease resistance and the interaction
between the rice blast fungi and resistance genes remain unknown.
The resistance gene Pi-b is located at the end of the long arm of rice chromosome 2 and displays
resistance to all races of blast fungi identified in Japan except for 033b (Table 1).
>;tb;>;TABLE; Id=Table 1 Columns=12
52/503
>;tb;
>;tb;Head Col 1 AL=L: Variety
>;tb;Head Col 2:
>;tb;Head Col 3 to 12: Fungal strain
>;tb;
>;tb;SubHead Col 1:
>;tb;SubHead Col 2:
>;tb;SubHead Col 3: Ine 84-91A #003
>;tb;SubHead Col 4: Cho 69-150 #007
>;tb;SubHead Col 5: 2101 -4 #013
>;tb;SubHead Col 6: Ine 72 #031
>;tb;SubHead Col 7: TH89 -41 #033
>;tb;SubHead Col 8: Cho 68-182 #035
>;tb;SubHead Col 9: F67-57 #047
>;tb;SubHead Col 10: Ine 168 #101
>;tb;SubHead Col 11: P-2b #303
>;tb;SubHead Col 12: Ai74 -134 #477
>;tb;Shin 2>;SEP;>;SEP;S>;SEP;S>;SEP;S>;SEP;S>;SEP;S>;SEP;S>;SEP;S>;SEP;S>;SEP;S>;SEP;S
>;tb;Aichiasahi>;SEP;Pia>;SEP;S>;SEP;S>;SEP;S>;SEP;R>;SEP;S>;SEP;R>;SEP;S>;SEP;R>;SEP;S>;SEP;S
>;tb;Inabawase>;SEP;Pii>;SEP;R>;SEP;S>;SEP;R>;SEP;R>;SEP;R>;SEP;S>;SEP;S>;SEP;R>;SEP;R>;SEP;S
>;tb;Kanto 51>;SEP;Pik>;SEP;R>;SEP;R>;SEP;S>;SEP;S>;SEP;S>;SEP;S>;SEP;R>;SEP;R>;SEP;R>;SEP;S
>;tb;Tsuyuake>;SEP;Pikm>;SEP;R>;SEP;R>;SEP;R>;SEP;S>;SEP;S>;SEP;S>;SEP;R>;SEP;R>;SEP;R>;SEP;S
>;tb;Fukunishik i>;SEP;Piz>;SEP;R>;SEP;R>;SEP;R>;SEP;R>;SEP;R>;SEP;R>;SEP;S>;SEP;R>;SEP;R>;SEP;S
>;tb;Yashiromoc hi>;SEP;Pita>;SEP;R>;SEP;R>;SEP;R>;SEP;R>;SEP;R>;SEP;R>;SEP;R>;SEP;R>;SEP;S>;SEP;R
>;tb;Pi No.4>;SEP;Pita2>;SEP;R>;SEP;R>;SEP;R>;SEP;R>;SEP;R>;SEP;R>;SEP;R>;SEP;R>;SEP;S>;SEP;R
>;tb;Toride 1>;SEP;Pizt>;SEP;R>;SEP;R>;SEP;R>;SEP;R>;SEP;R>;SEP;R>;SEP;R>;SEP;R>;SEP;R>;SEP;S
>;tb;Ouu 316>;SEP;Pib>;SEP;R>;SEP;R>;SEP;R>;SEP;R>;SEP;S>;SEP;R>;SEP;R>;SEP;R>;SEP;R>;SEP;R
R: resistant
S: susceptible
>;tb;>;/TABLE;
[0003] The gene has been carried in Indica varieties such as Engkatek, Milek Kuning, Tjina, and
Tjahaja in Indonesia and Malaysia. In Japan, TohokuIL9, a strain homozygous for the Pi-b and having
a genetic background of the sensitive variety Sasanishiki, has been bred at the Miyagi Prefectural
Furukawa Agriculture Experimental Station. However, the mechanism of the resistance expression has
not been clarified, nor has the Pi-b gene been isolated.
[0004] An objective of the present invention is to provide Pi-b, a resistance gene to the blast disease,
a functionally equivalent gene, and proteins encoded by the genes. Another objective is to create a
plant resistant to the blast disease by utilizing the gene.
[0005] In accordance with the present invention, the rice blast disease resistance gene has been
isolated by using map-based cloning to isolate the gene Pi-b from a large chromosomal region.
Specifically, linkage analysis has been performed using molecular markers. First, the Pi-b locus was
assigned to a chromosomal region between specific markers. Next, a physical map was constructed by
aligning cosmid clones near the assigned region. The nucleotide sequences of the clones were then
determined to find the region of the Pi-b candidate gene containing the nucleotide binding site (NBS)
that is commonly found in the resistance genes of several plants. A cDNA library was then constructed
53/503
from a variety resistant to the blast disease. The library was screened using the above candidate
genomic region as a probe, and a cDNA corresponding to said genomic region was isolated. Using
oligonucleotide primers prepared based on the nucleotide sequence of the isolated cDNA, RT-PCR was
performed on each mRNA fraction prepared from varieties sensitive and resistant to the blast disease to
analyze the expression pattern of the isolated Pi-b candidate cDNA. The cDNA was specifically
amplified in the resistant variety. In accordance with the present invention, it was thus found that the
isolated cDNA clone is the Pi-b gene. In accordance with the present invention it was also found that
plants resistant to the blast disease can be created by utilizing the isolated gene or genes homologous
thereto because there is a close relationship between the isolated gene and the resistance to the blast
disease.
[0006] Accordingly, the present invention relates to the rice blast disease resistance gene Pi-b,
homologous genes, and proteins encoded by the genes. The invention also relates to a method of
producing a plant resistant to the blast disease by using the genes. More specifically, the present
invention relates to the following:
(1) A protein that confers on plants resistance to the blast disease, wherein the protein comprises the
amino acid sequence of SEQ ID NO: 1, or its modified sequence in which one or more amino acids are
substituted, deleted, and/or added,
(2) A protein that confers on plants resistance to the blast disease, wherein the protein is encoded by a
DNA that hybridizes with a DNA comprising the nucleotide sequence of SEQ ID NO: 2 and/or No: 3,
(3) A DNA encoding the protein of (1) or (2),
(4) A vector comprising the DNA of (3),
(5) A host cell carrying the vector of (4),
(6) The host cell of (5), wherein said host cell is a plant cell,
(7) A method of producing the protein of (1) or (2), wherein the method comprises cultivating the
host cell of (5),
(8) A transformed plant comprising the host cell of (6),
(9) The plant of (8), wherein said plant is the Poaceae,
(10) The plant of (8), wherein said plant is P. oryza,
(11) The plant of any one of (8), (9), or (10), wherein said plant displays resistance to the blast
disease,
(12) An antibody that specifically binds to the protein of (1) or (2), and
(13) A DNA comprising at least 15 nucleotides, wherein the DNA hybridizes specifically to the DNA
of (3).
[0007] The figures show:
Figure 1 schematically shows the presumed region of the Pi-b locus by crude-scale linkage analysis.
Figure 2 schematically shows the presumed region of the Pi-b locus by fine-scale linkage analysis.
Figure 3 shows a photograph of electrophoretic patterns indicating the result of RT-PCR analysis for
the expression of the Pi-b candidate cDNA in varieties sensitive and resistant to the blast disease. In A,
primers encompassing the second intron of the cDNA clone c23 were used. In B, primers specific to
the 4.6 kb fragment, which contains the NBS adjacent to the region c23, were used. The template used
was composed of genomic DNAs from Sasanishiki and TohokuIL9 in lanes 1 and 2; cosmid clones #40
and #147 originating from TohokuIL9 in lanes 3 and 4, respectively; plasmid DNA containing the
cDNA c23 from TohokuIL9 in lane 5; mRNA (2000ng; the same amount shall apply for mRNA
hereinafter) prepared from untreated leaves of TohokuIL9 in lane 6; mRNA prepared from leaves of
TohokuIL9 12 hours, 24 hours, or 4 days after inoculation with the rice blast fungi in lanes 7, 8, and 9,
respectively; mRNA from untreated leaves of Sasanishiki in lane 10; mRNA prepared from leaves of
Sasanishiki 12 and 24 hours after inoculation with the fungi in lanes 10 and 11, respectively; and
sterilized water in lane 12. The size markers are 1.4 K, 1.0 K, 0.9 K, and 0.6 K from the top.
Figure 4 compares the Pi-b gene and the conserved regions of known resistance genes.
[0008] The present invention relates to a protein that confers on plants a phenotype resistant to the
blast disease. The amino acid sequence of a protein encoded by the "Pi-b" gene (hereinafter called the
Pi-b protein), which is included in a protein of the present invention, is shown in SEQ ID NO: 1. The
54/503
Pi-b gene, which encodes a protein that confers on rice a phenotype resistant to the blast disease, was
known to be located somewhere within a large region of rice chromosome 2. In accordance with the
present invention, its locus could be identified for the first time and the gene was isolated as a single
gene. The Pi-b protein confers resistance to all races of the rice blast fungi in Japan except 033b on
rice. This is the broadest range of resistance among the genes identified so far (Table 1). These
characteristics of the Pi-b protein suggest that the Pi-b protein or a protein functionally equivalent
thereto is quite suitable for creating plant varieties resistant to the blast disease.
It is possible to produce a protein functionally equivalent to the Pi-b protein by, for example, the
method described below. A method of introducing mutations into the amino acid sequence of the Pi-b
protein is well known to one skilled in the art. Namely, one skilled in the art can alter the amino acid
sequence of the Pi-b protein (SEQ ID NO: 1) by site-directed mutagenesis (Kramer, W. and Fritz, H. J. Oligonucleotide-directed construction of mutagenesis via gapped duplex DNA, Methods in
Enzymology 154:350-367, (1987)) to produce a mutant protein, which is functionally equivalent to the
Pi-b protein. Mutations of amino acids can occur spontaneously. The protein of the present invention
includes a protein having an amino acid sequence of the wild type Pi-b protein with one or more amino
acids being substituted, deleted, or added, and functionally equivalent to the wild type Pi-b protein. The
site and number of altered amino acid residues in a protein is not limited as long as the altered protein
is functionally equivalent to the wild type Pi-b protein. There are usually not more than 50 altered
amino acid residues, preferably not more than 30, more preferably not more than 10, and most
preferably not more than 3. The phrase "functionally equivalent to the wild type Pi-b protein" used
herein means that the altered protein confers resistance to the blast disease on plants. The phrase "to
confer resistance to the blast disease on plants " means that the protein confers resistance to at least one
race of the rice blast fungi on at least one plant variety. The plant on which resistance is to be conferred
is preferably the Poaceae, and more preferably Poaceae oryza. Whether a protein confers resistance to
the blast disease on plants can be judged by, for example, (i) inoculating the rice blast fungi on juvenile
plants (from three to four-week-old seedlings of rice, for example) by directly spraying with a
suspension of spores formed by a certain race of the rice blast fungi, (ii) incubating the inoculated plant
at 25 DEG C in 100% humidity for 24 hours immediately after inoculation, then cultivating under
normal conditions for about two weeks, (iii) observing whether local lesions will stop outgrowth due to
specific necrosis as a result of hypersensitive reaction (a plant carrying a resistance gene), or the local
lesions will continue to outgrow causing plant death (a plant without a resistance gene).
Also, the hybridization technique (Southern, E. M., J. Mol. Biol. 98, 503 (1975)) and the polymerase
chain reaction (PCR) technique (Saiki, R. K. et al., Science 230:1350-1354, (1985); Saiki, R. K. et al.,
Science 239:487-491, (1988)) are known to one skilled in the art as other methods to produce a
functionally equivalent protein. Namely, one skilled in the art can usually isolate a DNA that is highly
homologous to the Pi-b gene from rice or other plants, using the nucleotide sequence of the Pi-b gene
(SEQ ID NO: 2 or No: 3) or its portion as a probe, or using oligonucleotide primers that hybridize
specifically to the Pi-b gene (SEQ ID NO: 2 or No: 3), to obtain a protein functionally equivalent to the
Pi-b protein from said DNA. The protein of the present invention includes a protein functionally
equivalent to the Pi-b protein that is isolated by the hybridization technique or the PCR technique. The
phrase "functionally equivalent to the Pi-b protein" used herein means that the protein isolated by the
hybridization technique or the PCR technique confers resistance to the blast disease on plants. The
plants to be used for isolating a gene by the above technique include, besides rice, crops that are
possible hosts of the blast fungi, such as Hordeum, Triticum, Setaria, Panicum, Echinochloa, and Coix
(Crop Disease Encyclopedia, (1988), Kishi, K. ed. Japan Agriculture Education Association).
Normally, a protein encoded by the isolated gene has a high homology to the Pi-b protein at the amino
acid level when the protein is functionally equivalent to the Pi-b protein. The high homology means
preferably a homology of 30% or more, more preferably of 50% or more, still more preferably of 70%
or more, and most favorably of 90% or more.
The protein of the present invention can be produced as a recombinant protein using methods known
to one skilled in the art by means of the recombinant DNA technology, or as a natural protein. For
example, a recombinant protein can be produced by inserting a DNA encoding the protein of the
present invention into an appropriate expression vector, introducing said vector into appropriate cells,
and then purifying the protein from said transformed cells. A natural protein can be prepared by, for
example, exposing the extracts of cells (rice cells, for example) expressing the protein of the present
invention to an affinity column packed with an antibody prepared by immunizing an appropriate
immune animal with a recombinant protein or its portion, and purifying bound proteins from said
column.
55/503
The present invention also relates to a DNA encoding the protein of the present invention. The DNA
of the present invention is not limited and includes a genomic DNA, a cDNA, and a chemically
synthesized DNA as long as the DNA encodes a protein of the present invention. The nucleotide
sequences of the Pi-b cDNA and the Pi-b genomic DNA of the present invention are shown in SEQ ID
NO: 2 and NO: 3, respectively. One skilled in the art can prepare a genomic DNA or a cDNA using the
standard methods. For example, a genomic DNA can be prepared in two steps. First, construct a
genomic library (utilizing a vector such as plasmid, phage, cosmid, or BAC) using genomic DNA
extracted from leaves of a rice variety (TohokuIL9, for example) carrying a resistance gene to the blast
disease. Second, perform colony hybridization or plaque hybridization on the spread library using a
probe prepared based on the nucleotide sequence of a DNA encoding a protein of the present invention
(SEQ ID NO: 1 or NO: 2, for example). Alternatively, a genomic DNA can be prepared by performing
PCR using specific primers to a DNA encoding a protein of the present invention (SEQ ID NO: 1 or
NO: 2, for example). A cDNA can also be prepared by, for example, synthesizing cDNA from mRNA
extracted from leaves of a rice variety (TohokuIL9, for example) carrying a resistance gene to the blast
disease, inserting the cDNA into a vector such as lambda ZAP to construct a cDNA library, and
performing colony hybridization or plaque hybridization on the spread library, or by performing PCR
as described above.
A DNA of the present invention can be utilized for preparing a recombinant protein or creating
transformed plants resistant to the blast disease. A recombinant protein is usually prepared by inserting
a DNA encoding a protein of the present invention into an appropriate expression vector, introducing
said vector into an appropriate cell, culturing the transformed cells, and purifying expressed proteins. A
recombinant protein can be expressed as a fusion protein with other proteins so as to be easily purified,
for example, as a fusion protein with maltose binding protein in Escherichia coli (New England
Biolabs, USA, vector pMAL series), as a fusion protein with glutathione-S-transferase (GST)
(Amersham Pharmacia Biotech, vector pGEX series), or as being tagged with histidine (Novagen, pET
series). The host cell is not limited as long as the cell is suitable for expressing the recombinant protein.
It is possible to utilize yeasts or various animal, plant, or insect cells besides the above described E.
coli. A vector can be introduced into host cells by various methods known to one skilled in the art. For
example, a transformation method using calcium ions (Mandel, M. and Higa, A., J. Mol. Biol. 53:158162, (1970); Hanahan, D., J. Mol. Biol. 166:557-580, (1983)) can be used to introduce a vector into E.
coli. A recombinant protein expressed in host cells can be purified by known methods. When a
recombinant protein is expressed as a fusion protein with maltose binding protein or other partners, the
recombinant protein can be easily purified by affinity chromatography.
A transformed plant resistant to the blast disease can be created using a DNA of the present invention.
Namely, a DNA encoding a protein of the present invention is inserted into an appropriate vector, the
vector is introduced into a plant cell, and the resulting transformed plant cell is regenerated. The vector
is not limited as long as the vector can express inserted genes in plant cells. For example, vectors
containing a promoter for constitutive gene expression in plant cells (such as cauliflower mosaic virus
35S promoter, for example), or a promoter inducible by exogenous stimuli can be used. The plant cell
to be transfected with the vector is not limited, but Poaceae cells are favorable. Besides rice, examples
of the cells include Hordeum, Triticum, Setaria, Panicum, Echinochloa, and Coix. The term "plant cell"
used herein includes various forms of plant cells, such as a cultured cell suspension, a protoplast, a leaf
section, and a callus. A vector can be introduced into plant cells by a known method such as the
polyethylene glycol method, electroporation, Agrobacterium mediated transfer, and particle
bombardment. Plants can be regenerated from transformed plant cells depending on the type of the
plant cell by a known method (Toki et al., (1995) Plant Physiol. 100:1503-1507).
Furthermore, the present invention relates to an antibody that binds specifically to a protein of the
present invention. The antibody of the present invention can be either a polyclonal antibody or a
monoclonal antibody. A polyclonal antibody can be prepared by immunizing immune animals such as
rabbits with a purified protein of the present invention or its portion, collecting blood after a certain
period, and removing clots. A monoclonal antibody can be prepared by fusing myeloma cells and the
antibody-forming cells of animals immunized with the above protein or its portion, isolating a
monoclonal cell expressing a desired antibody (hybridoma), and recovering the antibody from the said
cell. The obtained antibody can be utilized for purifying or detecting a protein of the present invention.
Furthermore, the present invention relates to a DNA that specifically hybridizes to a DNA encoding a
protein of the present invention and comprises at least 15 nucleotide residues. The phrase "specifically
hybridizes" used herein means that the DNA hybridizes with a DNA encoding a protein of the present
invention but not with any DNA encoding other proteins in standard hybridization conditions, and
preferably in stringent hybridization conditions. Such hybridization conditions are described, for
56/503
example, in Sambrook et al., Molecular Cloning; A Laboratory Manual, 2>;nd; Edition (1989), Cold
Spring Harbour Laboratory Press, Cold Spring Harbour, NY. The DNA can be used, for example, as a
probe to detect or isolate a DNA encoding a protein of the present invention, or as a primer for PCR
amplification. An example is DNA consisting of at least 15 nucleotides complementary to the
nucleotide sequence of SEQ ID NO: 2 or NO: 3.
The present invention provides the blast disease resistance gene Pi-b, functionally equivalent genes
thereof, and proteins encoded by the genes. The disease resistance gene of the present invention can
confer a resistance to a broad range of the rice blast fungi on plants. Therefore, the gene will greatly
contribute to controlling the disease and increasing crop yields, for example, when introduced into
beneficial crops such as rice.
The present invention is illustrated in detail below with reference to examples but is not to be
construed as being limited thereto.
EXAMPLE 1: Crude-scale linkage analysis
[0009] To identify the approximate region of the Pi-b gene on the linkage map of rice chromosome 2,
linkage analysis using DNA markers was first performed. The source used was a segregating
population of 94 plants, resulting from self-fertilization of the F1 progeny derived from two back
crosses between Sasanishiki and the F1 progeny from a cross between Sasanishiki and TohokuIL9.
This linkage analysis revealed that the Pi-b gene was located between RFLP markers C2782 and C379
in chromosome 2 and cosegregated with R1792, R257, and R2821 (Japanese Society of Breeding, the
87th meeting, Figure 1).
EXAMPLE 2: Fine-scale linkage analysis
[0010] A large segregating population was analyzed to isolate the gene. From the above population of
94 plants, 20 plants that are heterozygous for the Pi-b locus were selected, and a segregating population
of about 20,000 seeds, including self-fertilized seeds, was used for the analysis (Japanese Society of
Breeding, the 89th meeting). In the analysis, the pool sampling method was applied to minimize the
task (Churchill et al., Proc. Natl. Acad. Sci. USA 90:16-20 (1993)).
To increase the accuracy of linkage analysis, it is necessary to increase the number of DNA markers
near the target gene and to enlarge the sampling population. Accordingly, YAC clones carrying the Pib locus, which was determined by the crude-linkage analysis, were subcloned to increase the number of
DNA markers near the Pi-b gene (Monna et al., Theor. Appl. Genet. 94:170-176 (1997)). This linkage
analysis using a large population narrowed the Pi-b locus down to a region between RFLP markers
S1916 and G7030. In addition, the Pi-b gene was co-segregated with three RFLP markers (G7010,
G7021, and G7023; Figure 2).
EXAMPLE 3: Alignment of the Pi-b locus using cosmid clones
[0011] To further narrow down the Pi-b locus, cosmid clones were used for alignment. Genomic
DNA was extracted from TohokuIL9 carrying the resistance gene by the CTAB method. The DNA was
then partially digested with restriction endonuclease Sau3A. From the digestion product, fragments of
about 30 to 50 kb were fractionated by sucrose density gradient centrifugation. The resulting DNA
fragments and the cosmid vector SuperCos (Stratagene, Wahl et al., Proc. Natl. Acad. Sci. USA
84:2160-2164 (1987)) were used to construct a cosmid library. The cosmid library was screened using
five DNA clones near the Pi-b locus (S1916, G7010, G7021, G7023, and G7030) as probes. As a
result, six cosmid clones (COS140, COS147, COS117, COS137, COS205, and COS207) were selected.
Construction of the restriction maps of these clones and examination of their overlapping regions
revealed that the Pi-b locus is in the genome region covered by three clones (COS140, COS147, and
COS117; Figure 2).
57/503
EXAMPLE 4: Determination of the candidate genomic region by sequence analysis
[0012] Three aligned cosmid clones, which are presumed to contain the Pi-b gene, were subcloned,
and their nucleotide sequences were partially analyzed. The obtained nucleotide sequences were
analyzed by BLAST homology search on the public nucleotide database. As a result, partial nucleotide
sequences of a 2.3 kb clone obtained from COS140, and of a 4.6 kb clone from COS147 were revealed
to contain a nucleotide binding site (NBS) that is commonly found in the resistance genes of several
plants, such as the RPM1 disease resistance gene in Arabidopsis. Therefore, these nucleotide sequences
were expected to be candidate regions for the Pi-b gene.
EXAMPLE 5: Isolation of cDNA and sequence analysis
[0013] The cDNA was isolated to examine whether the candidate regions revealed by the nucleotide
sequence analysis are expressed in resistant variety TohokuIL9. The resistant variety TohokuIL9 was
seeded, and the seedlings of the 4-leaf stage were inoculated with the rice blast fungi TH68-141 (race
003) according to the standard method. The leaves were then collected at three time points, 6 hours, 12
hours, and 24 hours after inoculation. Messenger RNA was extracted from the samples and a cDNA
library was constructed. A 1 kb fragment (from positions 3471 to 4507 in SEQ ID NO: 3), obtained by
further subcloning the 2.3 kb fragment of the candidate genomic region, was used as a probe to screen
the library. As a result, eight cDNA clones were selected. Sequence analysis of the clones revealed that
the nucleotide sequence of c23 completely matches that of the cosmid clone COS140. Thus, the
candidate genomic region was confirmed to be expressed in TohokuIL9. The selected c23 clone is
approximately 4 kb and is assumed to contain almost the entire region of the gene. The complete
nucleotide sequence of this clone was determined (SEQ ID NO: 2).
EXAMPLE 6: Analysis of the candidate cDNA expression pattern
[0014] Differences in expression patterns of the candidate cDNA region were revealed in a sensitive
variety (Sasanishiki) and a resistant variety (TohokuIL9). The above two varieties were inoculated with
the race 003 of the rice blast fungi at the 4-leaf stage, and leaves were collected at 6 hours, 12 hours
and 24 hours after inoculation. mRNA was then extracted and used as a template for RT-PCR. Primers
SEQ ID NO: 4/5'-AGGGAAAAATGGAAATGTGC-3' (antisense) and SEQ ID NO: 5/ 5'AGTAACCTTCTGCTGCCCAA-3' (sense)) based on the nucleotide sequence of the cDNA clone c23
were designed for RT-PCR to specifically amplify the region. PCR was performed with a cycle of 94
DEG C for 2 minutes; 30 cycles of 94 DEG C for 1 minute, 55 DEG C for 2 minutes, and 72 DEG C
for 3 minutes; and a cycle of 72 DEG C for 7 minutes. After PCR, a specific amplification was detected
in a resistant variety of TohokuIL9, but no amplification was detected using mRNA from a sensitive
variety (Sasanishiki; Figure 3). This suggests that cDNA clone c23 is specifically expressed in resistant
varieties. Also, RT-PCR was performed using primers SEQ ID NO: 6/5'TTACCATCCCAGCAATCAGC-3' (sense) and SEQ ID NO: 7/ 5'-AGACACCCTGCCACACAACA3' (antisense), based on the nucleotide sequence of the 4.6 kb fragment which contains the NBS and is
adjacent to the c23 region. The region of the 4.6 kb fragment was not amplified in either a sensitive
variety (Sasanishiki) or a resistant variety (TohokuIL9; Figure 3). It is strongly suggested that the
genomic region corresponding to clone c23 is the Pi-b locus.
EXAMPLE 7: Sequence analysis of the genomic DNA of the Pi-b candidate gene
[0015] The complete nucleotide sequence of the genomic region corresponding to cDNA clone c23
was determined. The cosmid clone COS140 was subcloned by cleaving with five different restriction
enzymes, and the nucleotide sequences of the resulting subclones were determined from both ends as
much as possible. The regions that were not accessible by the above analysis were cut shorter by
58/503
deletion, and subjected to DNA sequencing. The determined region extends to 10.3 kb (SEQ ID NO:
3).
EXAMPLE 8: Structure of the Pi-b gene
[0016] The Pi-b candidate cDNA c23 is 3925 base pairs in full-length and has an ORF of 3618 base
pairs containing three exons separated by two introns. The Pi-b translated product is a protein of 1205
amino acid residues (SEQ ID NO: 1), having two NBSs (P-loop at amino acid positions 386-395 and
Kinase 2 at positions 474-484) and three conserved regions (domain 1 at amino acid positions 503-513,
domain 2 at positions 572-583, and domain 3 at positions 631-638) which are found in many resistance
genes. These domains show a high homology to the conserved regions of known resistance genes such
as RPM1 (Figure 4). Also, the gene has 12 incomplete, leucine-rich repeats (LRR at amino acid
positions 755-1058) in the 3' side. These structures show an extremely high homology to the resistance
genes of the NBS-LRR class previously reported. Based on the above results, the present inventors
concluded that the analyzed cDNA and the corresponding genomic region are the rice blast disease
resistance gene Pi-b.
EMI18.1
EMI48.1Data supplied from the esp@cenet database - Worldwide
Claims of EP0969092
Claims:
1. A protein that confers on plants resistance to the blast disease, wherein
(a) the protein comprises the amino acid sequence of SEQ ID NO: 1 or its modified sequence in
which one or more amino acids are substituted, deleted, and/or added; or
(b) the protein is encoded by a DNA that hybridizes with a DNA comprising the nucleotide sequence
of SEQ ID NO: 2 and/or No: 3.
2. A DNA encoding the protein of claim 1.
3. A vector comprising the DNA of claim 2.
4. A host cell carrying the vector of claim 3.
5. The host cell of claim 4, wherein said host cell is a plant cell.
6. A method of producing the protein of claim 1, wherein the method comprises cultivating the host
cell of claim 4.
7. A transformed plant comprising the host cell of claim 5.
8. The plant of claim 7, wherein said plant is the Poaceae.
9. The plant of any one of claim 6 or 7, wherein said plant is P. oryza.
10. The plant of any one of claims 7 to 9, wherein said plant displays the resistance to the blast disease.
11. An antibody that binds specifically to the protein of claim 1.
12. A DNA comprising at least 15 nucleotides, wherein the DNA hybridizes specifically to the DNA of
claim 2.Data supplied from the esp@cenet database - Worldwide
59/503
18. EP1421196
- 5/26/2004
RICE REGULATORY SEQUENCES FOR GENE EXPRESSION IN DEFINED
WHEAT TISSUE
URL EPO =
http://v3.espacenet.com/textdoc?F=3&CY=ep&LG=en&IDX=EP1421196
Inventor(s):
URBAN MARTIN (GB); STRATFORD REBECCA (GB); HAMMOND-KOSACK
KIM (GB); LECOCQ PIERRE (GB); KEMP RICHARD (GB)
Applicant(s):
MONSANTO UK LTD (GB)
IP Class 4 Digits: C07K; C12N; A01H
IP Class:C07K14/415; C12N15/82; C12N15/29; A01H5/10
E Class: C07K14/415; C12N15/82B20B6; C12N15/82B20A2
Application Number:
EP20020767435 (20020823)
Priority Number: WO2002EP09533 (20020823); EP20010307298 (20010828); EP20020767435
(20020823)
Family: EP1421196
Equivalent:
EP1421196
Abstract:
Abstract not available for EP1421196
60/503
19. EP1437409
- 7/14/2004
METHOD OF IMPARTING OR CONTROLLING FERTILITY WITH THE USE
OF FERTILITY RESTORING GENE FOR RICE BT-MALE STERILITY
CYTOPLASM AND METHOD OF JUDGING THE EXISTENCE OF FERTILITY
RESTORING GENE
URL EPO =
http://v3.espacenet.com/textdoc?F=3&CY=ep&LG=en&IDX=EP1437409
Inventor(s):
YUKOH (JP)
KOMORI TOSHIYUKI (JP); OHTA SHOZO (JP); MURAI NOBUHIKO (JP); HIEI
Applicant(s):
JAPAN TOBACCO INC (JP); SYNGENTA LTD (GB)
IP Class 4 Digits: C07K; C12N; C12Q
IP Class:C07K14/415; C12Q1/68; C12N15/82; C12N15/29
E Class: C07K14/415; C12N15/82C8D2
Application Number:
EP20020799470 (20020913)
Priority Number: WO2002JP09429 (20020913); JP20010285247 (20010919); JP20010309135
(20011004); JP20020185709 (20020626)
Family: EP1437409
Equivalent:
WO03027290; CA2460872
Cited Document(s):
WO0214506; EP1310553; WO2004005515; XP008004139; XP002972418;
XP009041654; XP002310740
Abstract:
Abstract not available for EP1437409Description:
Description of EP1437409
FIELD OF THE INVENTION
[0001] The present invention relates to a method for providing and inhibiting the rice fertility, and
discerning the presence of the rice restorer gene by using the rice restorer gene to the rice BT type
cytoplasmic male sterility.
[0002] The present application claims priority based on Japanese Patent Application No. 2001285247 filed on September 19, 2001, Japanese Patent Application No. 2001-309135 filed on October 4,
2001 and Japanese Patent Application No. 2002-185709 filed on June 26, 2002. The entire disclosures
of the three patent applications are incorporated herein.
PRIOR ART
[0003] Rice is a self-fertilizing plant, so in order to perform crossing between varieties, selffertilization must first be avoided by removing all stamens in a glumaceous flower just before
61/503
flowering and, then fertilization is effected with pollens from the parent variety with which it is to be
crossed. However, this manual crossing method is entirely unsuitable for producing a large quantity of
hybrid seeds on a commercial scale.
[0004] Accordingly, hybrid rice is produced by the triple-crossing system which makes use of
cytoplasmic male sterility. In the triple-crossing system, the following three lines are employed, i.e., a
sterile line having male sterile cytoplasm, a restorer line having Rf-1 gene and a maintainer line having
the same nuclear gene as that of the sterile line but not having any sterile cytoplasm. By using these
three lines, (i) hybrid seeds can be obtained through fertilization of the sterile line with the pollen of the
restorer line whereas (ii) the sterile line can be maintained through its fertilization with the pollen of the
maintainer line.
[0005] When employing the BT type male sterile cytoplasm in the triple-crossing system, it is
important to breed rice of the restorer line and to this end, it is necessary to ensure that the rice at every
stage of breeding maintains Rf-1 gene and that the Rf-1 gene is homozygous at the final stage. It also
becomes necessary in the triple-crossing system to check to ensure that the variety used as the restorer
line possesses Rf-1 gene, or to check for the presence of Rf-1 gene in order to ensure that the resulting
hybrid seeds have restored fertility.
[0006] In order to genotype the locus of Rf-1 gene in a plant, it has been necessary that F1 plants be
first formed from hybrid seeds obtained by crossing the plant to be genotyped to a standard line and
then self-fertilized, followed by investigating the incidence of individuals that can produce seeds at a
frequency higher than a certain level (e.g. 70 SIMILAR 80% or more). The standard line refers to the
maintainer line, the sterile line or a set of the two lines, and it is appropriately chosen depending upon
whether the cytoplasm of the individual under test is of BT type or normal type or unknown. If the
standard line is a sterile line, it is crossed to the individual under test as the female parent and if the
standard line is a maintainer line, it is crossed as the male parent.
[0007] However, these techniques require a huge amount of labor and time to carry out. As a further
problem, fertilization for seed production is sensitive to environmental factors and if an investigation is
made in an unfavorable environment such as cold climate or insufficient daylight, sterility may be
caused irrespective of the genotype constitution, with the result that genotyping of the locus of Rf-1
gene cannot be performed accurately.
[0008] With a view to solving these problems, it has recently been proposed that Rf-1 gene be
checked for its presence by a technique of molecular biology. The technical idea of this technique lies
in checking for the presence or absence of Rf-1 gene by detecting base sequences linked to Rf-1 gene
(such sequences are hereunder referred to as DNA markers). Note that it is not possible to directly
detect Rf-1 gene since the DNA sequence of Rf-1 gene has not been clarified so far.
[0009] For example, it has been reported that the locus of Rf-1 gene in rice is present on chromosome
10 and located between DNA marker (RFLP marker) loci G291 and G127 which can be used in
restriction fragment length polymorphism analysis (RFLP) (Fukuta et al., 1992, Jpn J. Breed. 42 (supl.
1) 164-165). This is a known method of genotyping the locus of Rf-1 gene by investigating the
genotypes of DNA marker loci G291 and G127 which are linked to Rf-1 gene.
[0010] However, the conventional molecular biology techniques have several problems. First, they
use RFLP markers which need to be detected by Southern blot analysis. In order to perform Southern
blot analysis, DNA at the microgram level needs to be purified from the individual under test and, in
addition, there is a need to carry out a sequence of steps comprising treatment with restriction enzymes,
electrophoresis, blotting, hybridization with a probe and signal detection; this not only involves
considerable labor but it also takes about one week to obtain the test results.
[0011] The second problem is that since the gene map distance between RFLP marker loci G291 and
G127 is as long as about 30 cM (corresponding to about 9000 kbp in rice DNA), the probability for the
occurrence of double recombination in the region would be a few percent and hence, it is not always
guaranteed that the genotype of the locus of Rf-1 gene can be estimated correctly by the markers.
62/503
[0012] Thirdly, when the presence of Rf-1 gene is estimated by detecting RFLP marker loci G291
and G127, not only Rf-1 gene but also the gene region between those loci are introduced into the
fertility restorer line selected as the result of breeding. As a consequence, the introduced DNA
sequence will have a chromosomal region of 30 cM or longer from the Rf-1 gene donor parent, and this
presents the risk of introducing a deleterious gene that may potentially be present within that region.
[0013] In order to solve these problems, there have been developed a dominant DNA marker
(Japanese Patent Public Disclosure No. 222588/1995) and a co-dominant DNA marker (Japanese
Patent Public Disclosure No. 313187/1997), both of which are linked to the locus of Rf-1 gene. These
markers are linked to the locus of Rf-1 gene, their genetic distances from Rf-1 gene respectively being
1.6 +/- 0.7 cM (corresponding to about 480 kbp in rice DNA) and 3.7 +/- 1.1 cM (corresponding to
about 1110 kbp in rice DNA), and their loci being on opposite sides of the locus of Rf-1 gene. Hence,
the presence of Rf-1 gene can be estimated by detecting the presence of both the locus of the dominant
PCR marker and that of the co-dominant PCR marker. The use of the co-dominant PCR marker also
enables us to estimate as to whether the locus of Rf-1 gene is homozygous or heterozygous.
[0014] However, the use of these PCR markers still involve several problems. The co-dominant
marker has a genetic distance of 3.7 +/- 1.1 cM from the locus of Rf-1 gene, and the problem of
potentially high frequency of recombination with the locus of Rf-1 gene has not been fully dissolved.
As a result, speaking of the co-dominant marker itself, correct detection can be made as to whether it is
homozygous or a heterozygous. However, if recombination occurs between the locus of the codominant marker and that of Rf-1 gene, the genotype of Rf-1 gene locus cannot be determined
correctly, particularly as to whether it is homozygous or heterozygous. On the other hand, if the
dominant marker is used to genotype the locus of Rf-1 gene, the marker will detect individuals
indiscriminately irrespective of whether they are homozygous (Rf-1/Rf-1) or heterozygous (Rf-1/rf-1)
with respect to Rf-1 gene. Therefore, even if the co-dominant marker is used in combination with the
dominant marker in order to genotype the locus of Rf-1 gene, it is not possible to correctly distinguish
individuals having Rf-1 gene homozygously from those having the gene heterozygously. Further, if no
amplification product is obtained in PCR using the dominant marker, one cannot deny the possibility
that this is due to some problems in the experimental procedure. As a further problem, since the genetic
distance between the co-dominant marker and the dominant marker is as great as about 5.3 cM (around
1590 kbp), the size of the chromosomal region introduced from the Rf-1 gene donor parent cannot be
limited to a sufficiently small value to prevent any concomitant introduction of a deleterious gene
which may be contained in that region.
[0015] Japanese Patent Public Disclosure No. 139465/2000 describes co-dominant PCR markers that
were developed on the basis of the base sequences of RFLP markers located in the neighborhood of Rf1 gene on chromosome 10 of rice. However, most of those PCR markers are spaced from the Rf-1 gene
by a genetic distance greater than about 1 cM.
SUMMARY OF THE INVENTION
[0016] An object of the present invention is to provide methods for restoring rice fertility. A method
of the present invention comprises introducing a nucleic acid into rice, wherein the nucleic acid has the
base sequence of SEQ ID NO.27, or has a base sequence which is identical to at least 70% of the base
sequence of SEQ ID NO.27, and which functions to restore fertility. Another method of the present
invention comprises introducing a nucleic acid into rice, wherein the nucleic acid has the base sequence
of bases 38538-54123 of SEQ ID NO.27, or has a base sequence which is identical to at least 70% of
the base sequence of bases 38538-54123 of SEQ ID NO.27, and which functions to restore fertility.
Still another method of the present invention comprises introducing a nucleic acid into rice, wherein
the nucleic acid has the base sequence of bases 42357-53743, more preferably, bases 42132-48883 of
SEQ ID NO.27, or has a base sequence which is identical to at least 70% of the base sequence of bases
42357-53743, more preferably, bases 42132-48883 of SEQ ID NO.27, and which functions to restore
fertility. In an embodiment of the methods of the present invention, a base sequence which is identical
to at least 70% of the base sequence of SEQ ID NO.27 or of the base sequence of bases 38538-54123
of SEQ ID NO.27 meets at least one of the following requirements 1) and 2):
63/503
1) a base corresponding to the base 45461 of SEQ ID NO.27 is A; and
2) a base corresponding to the base 49609 of SEQ ID NO.27 is A.
[0017] Another object of the present invention is to provide a method for discerning whether or not a
subject rice individual or a seed thereof has the Rf-1 gene or not. The discerning method of the present
invention utilizes a fact that a sequence determining the presence of the function of the rice restorer
gene (the Rf-1 gene) positions between the polymorphism detection marker loci P4497 MboI and
B56691 Xab I on rice chromosome 10.
[0018] In an embodiment of the methods of the present invention, the subject rice individual or the
seed thereof is determined to have the Rf-1 gene, in the case that the nucleic acid having a base
sequence which is identical to at least 70% of the base sequence of SEQ ID NO.27 or of the base
sequence of bases 38538-54123 of SEQ ID NO.27, meets at least one of the following requirements 1)
and 2):
1) a base corresponding to the base 45461 of SEQ ID No.27 is A; and
2) a base corresponding to the base 49609 of SEQ ID NO.27 is A.
[0019] Another object of the present invention is to provide a method for inhibiting the function of
the Rf-1 gene to restore fertility. The inhibition method of the present invention comprises, in an
embodiment, introducing an antisense having at least 100 continuous bases in length, and having a base
sequence complementary to a nucleic acid having the base sequence of SEQ ID NO.27, or to a nucleic
acid having a base sequence which is identical to at least 70% of the base sequence of SEQ ID NO.27,
and which functions to restore fertility. In another embodiment, the inhibition methods of the present
invention comprise introducing an antisense having at least 100 continuous bases in length, and having
a base sequence complementary to a nucleic acid having the base sequence of bases 38538-54123 of
SEQ ID NO.27, or to a nucleic acid having a base sequence which is identical to at least 70% of the
base sequence of bases 38538-54123 of SEQ ID NO.27, and which functions to restore fertility.
[0020] Another object of the present invention is to provide a nucleic acid having the base sequence
of SEQ ID NO.27, or a nucleic acid having a base sequence which is identical to at least 70% of the
base sequence of SEQ ID NO.27, and which functions to restore fertility. The present invention also
provides a nucleic acid having the base sequence of bases 38538-54123 of SEQ ID NO.27, or a nuclei
acid having a base sequence which is identical to at least 70% of the base sequence of bases 3853854123 of SEQ ID NO.27, and which functions to restore fertility. The present invention also provides a
nucleic acid having the base sequence of bases 42357-53743, more preferably, bases 42132-48883 of
SEQ ID NO.27, or a nucleic acid having a base sequence which is identical to at least 70% of the base
sequence of bases 42357-53743, more preferably, bases 42132-48883 of SEQ ID NO.27, and which
functions to restore fertility.
BRIEF DESCRIPTION OF THE DRAWING
Fig. 1 shows the results of chromosomal walking started from the RFLP marker locus S12564.
Fig. 2 shows an alignment of lambda clone contigs in relation to the BAC clone AC068923.
Fig. 3 shows the chromosomal organization of recombinant pollens proximal to the Rf-1 locus (all
fertile) as mapped in close proximity to the Rf-1 locus based on the genotypes at the marker loci of 10
individuals (RS1, RS2, RC1-8) generated from the pollens. White bars represent japonica regions and
black bars represent indica regions.
Fig. 4 is a gene map in which the locus of Rf-1 gene on chromosome 10 of rice is positioned on a
linkage map in relation to various markers; the values of map distance were calculated from the
segregation data from 1042 F1 individuals.
Fig. 5 shows fragments from 10 genomic clones used for the identification of the Rf-1 region by
complementation assays. Lambda clones obtained by chromosomal walking (thin lines) were used for
64/503
complementation assays of the chromosomal regions shown by bold lines. XSF18 was found to contain
a deletion shown by dotted line.
Fig. 6 shows the results of complementation assays using a 15.7 kb fragment from XSG16 (Example
10) and a 16.2 kb fragment from XSF18 (Example 8). The plant transformed with the 15.7 kb fragment
from XSG16 has restored fertility as proved by ears bowing.
BEST MODES FOR PERFORMING THE INVENTION
[0022] We began by restricting the Rf-1 locus to a very small region on chromosome 10. On this
basis, we developed PCR markers proximal to the Rf-1 locus and found a method for detecting the Rf1 gene by utilizing on the linkage of these PCR markers to the Rf-1 locus. Specifically, the presence of
the Rf-1 gene is tested and individuals homozygous for the Rf-1 gene are selected by genotyping at the
novel PCR marker loci proximal to the Rf-1 locus on the basis that the Rf-1 locus is mapped between
the PCR marker loci S12564 Tsp509I and C1361 MwoI on chromosome 10 of rice. We previously
filed a patent application for the method for detecting the Rf-1 gene under Japanese Patent Application
No. 2000-247204 on August 17, 2000. The entire disclosure of the patent application is incorporated
herein by reference.
I. Methods for estimating the genotype at the Rf-1 locus described in Japanese Patent Application No.
2000-247204
[0023] Japanese Patent Application No. 2000-247204 describes methods for determining whether or
not a rice individual or seed under test has the Rf-1 gene on the basis that the Rf-1 locus is mapped
between the PCR marker loci S12564 Tsp509I and C1361 MwoI on chromosome 10 of rice.
Markers
[0024] Primer pairs designed to be specific to particular regions near the locus of Rf-1 gene are used
in PCR and the amplification products are treated with particular restriction enzymes; upon
electrophoresis, rice of indica lines in some cases provide an observable band of a different size from
that of rice of Japonica lines. This band which is characteristic of indica lines is herein referred to as
the Rf-1 linked band. Now that it has been made clear by the present inventors that the locus of Rf-1
gene is located between PCR markers S12564 Tsp509I and C1361 MwoI on chromosome 10 of rice,
the skilled artisan can appropriately develop and employ PCR markers that are present in the
neighborhood of Rf-1 gene.
[0025] For instance, according to the invention, a rice individual under test is checked to see if its
genome contains at least one of the PCR markers listed below, thereby determining whether the
individual under test has Rf-1 gene linked to those PCR markers:
(1) marker 1: PCR marker R1877 EcoRI which, when rice genomic DNA is subjected to PCR with
DNA primers having the sequences of SEQ ID NO:1 and SEQ ID NO:2, can detect polymorphisms
between rice individuals of the japonica and indica lines depending on whether the amplification
products have a recognition site for restriction enzyme EcoRI;
(2) marker 2: PCR marker G4003 HindIII (SEQ ID NO:19) which, when rice genomic DNA is
subjected to PCR with DNA primers having the sequences of SEQ ID NO:3 and SEQ ID NO:4, can
detect polymorphisms between rice individuals of the japonica and indica lines depending on whether
the amplification products have a recognition site for restriction enzyme HindIII;
(3) marker 3: PCR marker C1361 MwoI (SEQ ID NO:20) which, when rice genomic DNA is
subjected to PCR employing DNA primers having the sequences of SEQ ID NO:5 and SEQ ID NO:6,
can detect polymorphisms between rice individuals of the japonica and indica lines depending on
whether the amplification products have a recognition site for restriction enzyme MwoI;
65/503
(4) marker 4: PCR marker G2155 MwoI (SEQ ID NO:21) which, when rice genomic DNA is
subjected to PCR with DNA primers having the sequences of SEQ ID NO:7 and SEQ ID NO:8, can
detect polymorphisms between rice individuals of the japonica and indica lines depending on whether
the amplification products have a recognition site for restriction enzyme MwoI;
(5) marker 5: PCR marker G291 MspI (SEQ ID NO:22) which, when rice genomic DNA is subjected
to PCR with DNA primers having the sequences of SEQ ID NO:9 and SEQ ID NO:10, can detect
polymorphisms between rice individuals of the japonica and indica lines depending on whether the
amplification products have a recognition site for restriction enzyme MspI;
(6) marker 6: PCR marker R2303 BslI (SEQ ID NO:23) which, when rice genomic DNA is subjected
to PCR with DNA primers having the sequences of SEQ ID NO:11 and SEQ ID NO:12, can detect
polymorphisms between rice individuals of the japonica and indica lines depending on whether the
amplification products have a recognition site for restriction enzyme Bs1I;
(7) marker 7: PCR marker S10019 BstUI (SEQ ID NO:24) which, when rice genomic DNA is
subjected to PCR with DNA primers having the sequences of SEQ ID NO:13 and SEQ ID NO:14, can
detect polymorphisms between rice individuals of the japonica and indica lines depending on whether
the amplification products have a recognition site for restriction enzyme BstUI;
(8) marker 8: PCR marker S10602 KpnI (SEQ ID NO:25) which, when rice genomic DNA is
subjected to PCR with DNA primers having the sequences of SEQ ID NO:15 and SEQ ID NO:16, can
detect polymorphisms between rice individuals of the japonica and indica lines depending on whether
the amplification products have a recognition site for restriction enzyme KpnI; and
(9) marker 9: PCR marker S12564 Tsp509I (SEQ ID NO:26) which, when rice genomic DNA is
subjected to PCR with DNA primers having the sequences of SEQ ID NO:17 and SEQ ID NO:18, can
detect polymorphisms between rice individuals of the japonica and indica lines depending on whether
the amplification products have a recognition site for restriction enzyme Tsp509I.
[0026] Assuming that the locus of Rf-1 gene was highly likely to be located near the nine RFLP
marker regions R1877, G291, R2303, S12564, C1361, S10019, G4003, S10602 and G2155 on
chromosome 10 of rice (see the results of RFLP linkage analysis described in Fukuta et al., 1992, Jpn.
J. Breed. 42 (supl. 1) 164-165 and the RFLP linkage map of rice described in Harushima et al., 1998,
Genetics, 148, 479-494), the present inventors converted those RFLP markers to co-dominant PCR
markers such as CAPS markers or dCAPS markers as described below in Reference example 1
(Michaels and Amasino, 1998, The Plant Journal, 14(3), 381-385; Neff et al., 1998, The Plant Journal,
14(3), 387-392). As a result of this conversion, the PCR markers above have been obtained.
[0027] Among these PCR markers, one group consisting of PCR markers R1877 EcoRI, G291 MspI
(SEQ ID NO:22), R2303 BslI (SEQ ID NO:23) and S12564 Tsp509I (SEQ ID NO:26) and the other
group consisting of PCR markers C1361 MwoI (SEQ ID NO:20), S10019 BstUI (SEQ ID NO:24),
G4003 HindIII (SEQ ID NO:19), S10602 KpnI (SEQ ID NO:25) and G2155 MwoI (SEQ ID NO:21)
are on opposite sides of the locus of Rf-1 gene on chromosome 10 of rice.
[0028] Therefore, in one embodiment, the presence of the Rf-1 gene is detected by detecting Rf-1
linked bands by (a) at least one PCR marker selected from the group consisting of PCR markers R1877
EcoRI, G291 MspI, R2303 BslI and S12564 Tsp509I, and (b) at least one PCR marker selected from
the group consisting of PCR markers C1361 MwoI, S10019 BstUI, G4003 HindIII, S10602 KpnI and
G2155 MwoI. In this case, at least S12564 Tsp509I from group (a) and at least C1361 MwoI from
group (b) are preferably used as the closest PCR markers to the Rf-1 gene. If Rf-1 linked bands are
detected with PCR markers of both (a) and (b) in the genome of the rice under test, it can be estimated
with a high probability that the rice contains Rf-1 gene.
[0029] In another embodiment, Rf-1 linked bands are detected by at least two PCR markers of group
(a) and at least two PCR markers of group (b) above. For example, a rice individual carrying the Rf-1
gene with a minimum of unwanted gene regions can be selected by picking up an individual in which
Rf-1 linked bands are detected by markers of groups (a) and (b) more proximal to the Rf-1 gene but not
detected by markers of groups (a) and (b) more distal from the Rf-1 gene on the gene map shown in
Fig. 1. Again, it is preferred that at least one PCR marker of group (a) is S12564 Tsp509I and at least
one PCR marker of group (b) is C1361 MwoI. Thus, the two PCR marker loci S12564 Tsp509I and
C1361 MwoI are separated by a genetic distance of 0.3 cM. By utilizing this characteristic, the
chromosomal region that is introduced from the Rf-1 gene donor parent can be narrowed down to a size
66/503
of about 1 cM. This helps minimize the possibility of introducing into the restorer line a deleterious
gene that may be present in the neighborhood of Rf-1 gene in the donor parent.
Detection of the Rf-1 gene
[0030] In order to detect Rf-1 gene in the genome of a rice under test, any one of the above PCR
markers is amplified from the genome of the rice by PCR using primers of SEQ ID NOS: 1-18 above
and then detected by the polymerase chain reaction-restriction fragment length polymorphism method
(PCR-RFLP). PCR-RFLP is a method that is applicable to the case where polymorphisms exist among
variety lines at recognition sites of restriction enzymes in the sequences of PCR amplified DNA
fragments and by which specific polymorphisms can conveniently be identified on the basis of
cleavage patterns with those restriction enzymes (D.E. Harry et al., Theor. Appl. Genet. (1998),
97:327-336)
[0031] Restriction enzyme cleavage patterns show the bands as shown in Table 1 below on a
visualized gel depending on the primer pair used.
>;tb;>;TABLE; Id=Table 1 Columns=2
>;tb;
>;tb;Head Col 1:
>;tb;Head Col 2: Approximate size (bp) of detected band
>;tb;
>;tb;SubHead Col 1: Detection of marker 1 (R1877 EcoRI) with primer pair 1
>;tb;When the genome of test rice has Rf-1 gene homozygously>;SEP;1500 and 1700
>;tb;When the genome of test rice has Rf-1 gene heterozygously>;SEP;1500, 1700 and 3200
>;tb;When the genome of test rice has no Rf-1 gene>;SEP;3200
>;tb;
>;tb;SubHead Col 2: Detection of marker 2 (G4003 HindIII) with primer pair 2
>;tb;When the genome of test rice has Rf-1 gene homozygously>;SEP;362
>;tb;When the genome of test rice has Rf-1 gene heterozygously>;SEP;95, 267 and 362
>;tb;When the genome of test rice has no Rf-1 gene>;SEP;95 and 267
>;tb;
>;tb;SubHead Col 3: Detection of marker 3 (C1361 MwoI) with primer pair 3
>;tb;When the genome of test rice has Rf-1 gene homozygously>;SEP;50 and 107
>;tb;When the genome of test rice has Rf-1 gene heterozygously>;SEP;25, 50, 79 and 107
>;tb;When the genome of test rice has no Rf-1 gene>;SEP;25, 50 and 79
>;tb;
>;tb;SubHead Col 4: Detection of marker 4 (G2155 MwoI) with primer pair 4
>;tb;When the genome of test rice has Rf-1 gene homozygously>;SEP;25, 27 and 78
>;tb;When the genome of test rice has Rf-1 gene heterozygously>;SEP;25, 27, 78 and 105
>;tb;When the genome of test rice has no Rf-1 gene>;SEP;25 and 105
>;tb;
>;tb;SubHead Col 5: Detection of marker 5 (G291 MspI) with primer pair 5
>;tb;When the genome of test rice has Rf-1 gene homozygously>;SEP;25, 49 and 55
>;tb;When the genome of test rice has Rf-1 gene heterozygously>;SEP;25, 49, 55 and 104
>;tb;When the genome of test rice has no Rf-1 gene>;SEP;25 and 104
>;tb;
>;tb;SubHead Col 6: Detection of marker 6 (R2303 BslI) with primer pair 6
>;tb;When the genome of test rice has Rf-1 gene homozygously>;SEP;238, 655 and 679
>;tb;When the genome of test rice has Rf-1 gene heterozygously>;SEP;238, 655, 679 and 1334
>;tb;When the genome of test rice has no Rf-1 gene>;SEP;238 and 1334
>;tb;
>;tb;SubHead Col 7: Detection of marker 7 (S10019 BstUI) with primer pair 7
>;tb;When the genome of test rice has Rf-1 gene homozygously>;SEP;130, 218 and 244
>;tb;When the genome of test rice has Rf-1 gene heterozygously>;SEP;130, 218, 244 and 462
>;tb;When the genome of test rice has no Rf-1 gene>;SEP;130 and 462
>;tb;
>;tb;SubHead Col 8: Detection of marker 8 (S10602 KpnI) with primer pair 8
67/503
>;tb;When the genome of test rice has Rf-1 gene homozygously>;SEP;724
>;tb;When the genome of test rice has Rf-1 gene heterozygously>;SEP;117, 607 and 724
>;tb;When the genome of test rice has no Rf-1 gene>;SEP;117 and 607
>;tb;
>;tb;SubHead Col 9: Detection of marker 9 (S12564 Tsp509I) with primer pair 9
>;tb;When the genome of test rice has Rf-1 gene homozygously>;SEP;41 and 117
>;tb;When the genome of test rice has Rf-1 gene heterozygously>;SEP;26, 41, 91 and 117
>;tb;When the genome of test rice has no Rf-1 gene>;SEP;26. 41 and 91
>;tb;>;/TABLE;
II. Identification of the Rf-1 locus
[0032] As described above, Japanese Patent Application No. 2000-247204 discloses RFLP-PCR
markers based on our finding that the Rf-1 locus is mapped between DNA marker loci S12564 Tsp509I
and C1361 MwoI. Fertility-restoring lines are established by backcrossing the Rf-1 gene into a normal
japonica variety not containing the Rf-1 gene. If the method for identifying the Rf-1 locus described in
Japanese Patent Application No. 2000-247204 is used during this process, not only the restoring lines
can be established efficiently (within 2-3 years) but also the length of insert fragments can be
controlled.
[0033] However, introduction by crossing inevitably introduce regions proximal to Rf-1 at the same
time. Japanese Patent Application No. 2000-247204 showed that the Rf-1 locus is mapped between
DNA marker loci S12564 Tsp509I and C1361 MwoI, but the distance between both loci is about 0.3
cM, i.e. about 90 kbp. If a deleterious gene existed proximal to Rf-1, it would be undeniable that the
deleterious gene might be inserted together with the Rf-1 gene.
[0034] Thus, we searched for regions linked to the Rf-1 gene between DNA marker loci S12564
Tsp509I and C1361 MwoI by chromosomal walking and genetic analysis based on the close linkage
between the Rf-1 locus and the DNA marker locus S12564 Tsp509I. As a result, we successfully
identified the region of the Rf-1 locus including the Rf-1 gene upto about 76 kb and determined the
entire base sequence of said region. According to the present invention, it is possible to introduce the
function of a fertility restorer gene into BT male sterile cytoplasms by genetic engineering techniques.
[0035] Specifically, in Japanese Patent Application No. 2000-247204, linkage analyses on a
population of 1042 individuals prepared by pollinating MS Koshihikari with MS-FR Koshihikari
(heterozygous at the Rf-1 locus) revealed one recombinant between the Rf-1 and S12564 Tsp509I loci
and two recombinants between the Rf-1 and C1361 MwoI loci (Reference examples 1-2 herein). In the
present invention, 4103 individuals were added to the population to analyze a total of 5145 individuals.
As a result, one recombinant between the Rf-1 and S12564 Tsp509I loci and six recombinants between
the Rf-1 and C1361 MwoI loci were newly found with a total of 2 and 8 recombinants. These 10
individuals were tested by the high-precision segregation analysis of the present invention as
recombinants proximal to the Rf-1 locus (Example 1).
[0036] The frequency of 8 recombinants between the Rf-1 and C1361 MwoI loci as compared with 2
recombinants between the Rf-1 and S12564 Tsp509I loci means that the S12564 Tsp509I locus is
genetically closer to the Rf-1 locus than the C1361 MwoI locus. Genetic distance (expressed in
recombination frequency: cM) and physical distance (expressed in the number of base pairs: bp) are not
always proportional to each other, but it can be normally expected that physical distance decreases with
genetic distance.
[0037] Thus, we tried to isolate the Rf-1 locus by chromosomal walking started from the S12564
Tsp509I locus (Example 2). Chromosomal walking was performed on a genomic library prepared from
lambda DASH II vector using the genomic DNA of an indica variety IR24 and a japonica variety
Asominori. IR24 is a variety carrying Rf-1, while Asominori is a variety not carrying Rf-1. As a result
of chromosomal walking, contigs covering a chromosomal region of about 76 kb (ordered sets of
overlapping clones on a chromosome) were able to be prepared from genomic clones of IR24, and the
entire base sequence (76363 bp) thereof was determined.
68/503
[0038] Then, 12 markers were newly developed on the basis of the base sequence data or the like
obtained and a high-precision segregation analysis was performed on the 10 recombinants proximal to
Rf-1 locus described above (Example 3). As a result, a 65 kb sequence included in the chromosomal
region of about 76 kb above was shown to contain a sequence determining the presence of the function
of the Rf-1 gene. This region is covered by a contig consisting of 8 genomic clones. Each clone has a
length of about 12-22 kb and has overlapping domains of at least 4.7 kb. Genes for rice are known to
have a wide range of lengths (from short ones to large ones), but most of them seem to have a length of
several kbs or less. Thus, at least one of these 8 genomic clones is expected to contain the full-length
Rf-1 gene.
[0039] We further restricted the Rf-1 gene region in the chromosomal region of about 76 kb above
and performed complementation assays to directly demonstrate the presence of a fertility restoring
ability.
[0040] Specifically, 10 partial fragments (each 10-21 kb) in the above region of 76 kb were
separately introduced into immature seeds of a male sterility line MS Koshihikari by genetic
engineering techniques (Fig. 5). Of the 10 partial fragments used, 8 fragments are derived from 8
genomic clones previously obtained by chromosomal walking (XSE1, XSE7, XSF4, XSF20, XSG22,
XSG16, XSG8 and XSH18 shown in Fig. 1 and described in Example 3). Additionally, fragments
derived from 2 clones XSF18 and XSX1 were also analyzed by complementation assays. XSF18 is
identical to XSF20 at the 5' and 3' ends (bases 20328 and 41921 of SEQ ID NO: 27, respectively), but
lacks internal bases 33947-38591. This is because clone XSF18 was initially isolated but found to
contain the above deletion during amplification after isolation, and therefore, the amplification step was
freshly taken to isolate a complete clone designated XSF20 (Example 8). XSX1 is a clone freshly
prepared from clones XSG8 and XSH18 by restriction enzyme treatment and ligation to contain
sufficient overlapping domains because of the overlapping domains of both clones are relatively small
(about 7 kb) (Example 13).
[0041] If the insert fragment completely contains the Rf-1 gene, transformed individuals at this
generation restore fertility because Rf-1 is a dominant gene. In complementation assays plants
transformed with each fragment were evaluated for seed fertility to find that those transformed with a
15.6 kb fragment (including bases 38538-54123 of SEQ ID NO: 27) derived from the lambda phage
clone XSG16 restored seed fertility (Example 10). Plants transformed with the other fragments were all
sterile. These results showed that the above 15.6 kb fragment completely contains the Rf-1 gene.
Moreover, a method for introducing the Rf-1 gene by genetic engineering techniques was provided by
the present invention and demonstrated to be effective.
[0042] To further specify the region of the lambda phage clone XSG16 in which the Rf-1 gene is
contained, we evaluated seed fertility of shorter fragments than the 15.6 kb fragment (including bases
38538-54123 of SEQ ID NO: 27) by complementation assays. As a result, plants transformed with a
11.4 kb fragment derived from XSG16 (including bases 42357-53743 of SEQ ID NO: 27) were shown
to restore seed fertility (Example 10(2)). Plants transformed with a further shorter 6.8 kb fragment
(including bases 42132-48883 of SEQ ID NO: 27) also restored seed fertility (Example 10(3)). These
results showed that the above 6.8 kb fragment contains the Rf-1 gene.
III. Nucleic acids containing the Rf-1 locus
[0043] The present invention provides nucleic acids containing the locus of a fertility restorer gene
(Rf-1). The nucleic acids containing the locus of a fertility restorer gene (Rf-1) of the present invention
include a nucleic acid having the base sequence of SEQ ID NO.27, or a nucleic acid having a base
sequence which is identical to at least 70% of the base sequence of SEQ ID NO.27, and which
functions to restore fertility.
[0044] As described in Example 10, it was confirmed that the Rf-1 gene is completely contained in
especially bases 38538-54123 of the base sequence of SEQ ID NO: 27. Accordingly, the present
invention especially provides a nucleic acid having the base sequence of bases 38538-54123 of SEQ ID
69/503
NO.27, or has a base sequence which is identical to at least 70% of the base sequence of bases 3853854123 of SEQ ID NO.27, and which functions to restore fertility. As used herein, the term "the base
sequence of SEQ ID NO: 27" refers to the entire sequence of SEQ ID NO: 27 or a part thereof
participating in fertility restoring function, especially bases 38538-54123 according to the context.
More preferably, it refers to bases 42357-53743, still more preferably bases 42132-48883.
[0045] In the examples below, a nucleic acid was isolated from a genomic library of indica rice IR24
containing the Rf-1 gene as a nucleic acid containing a fertility restorer gene (Rf-1) and determined to
have the base sequence of SEQ ID NO: 27. However, the nucleic acid containing a fertility restorer
gene (Rf-1) of the present invention can be derived from any indica variety carrying the RF-1 gene.
The indica varieties carrying the Rf-1 gene include, but not specifically limited to, e.g. IR24, IR8,
IR36, IR64, Chinsurah and BoroII. Known japonica varieties not carrying the Rf-1 gene include, but
not limited to, Asominori, Koshihikari, Kirara 397, Akihikari, Akitakomachi, Sasanishiki, Kinuhikari,
Nipponbare, Hatsuboshi, Koganebare, Hinohikari, Mineasahi, Aichinokaori, Hatsushimo, Akebono,
Fujihikari, Minenoyukimochi, Kokonoemochi, Fukuhibiki, Dontokoi, Gohyakumangoku, Hanaechizen,
Todorokiwase, Haenuki, Domannaka, Yamakikari, etc. The "indica" and "japonica" varieties are well
known to those skilled in the art and the rice varieties encompassed by the present invention can be
readily determined by those skilled in the art.
[0046] Nucleic acids of the present invention include DNA in both single-stranded and doublestranded forms, as well as the RNA complement thereof. DNA includes, for example, genomic DNA
(including corresponding cDNA), chemically synthesized DNA, DNA amplified by PCR, and
combinations thereof.
[0047] Nucleic acids containing the Rf-1 gene of the present invention preferably have the base
sequence of SEQ ID NO: 27. More than one codon may encode the same amino acid, and this is called
degeneracy of the genetic code. Thus, a DNA sequence not completely identical to SEQ ID NO: 27
may encode a protein having an amino acid sequence completely identical to SEQ ID NO: 27. Such a
variant DNA sequence may result from silent mutation (e.g., occurring during PCR amplification), or
can be a product of deliberate mutagenesis of a native sequence.
[0048] It is well known for those skilled in the art that even proteins having the same function may
have different amino acid sequences depending on the varieties from which they are derived. The Rf-1
gene of the present invention includes such homologs and variants of the base sequence of SEQ ID
NO: 27 so far as they functions to restore fertility. The expression "function to restore fertility" means
that fertility is conferred on a rice individual or seed when such a DNA fragment is introduced. Fertility
restoration may result from the expression of a protein by the Rf-1 gene or some function of the nucleic
acid (DNA or RNA) per se of the Rf-1 gene in conferring fertility.
[0049] Whether or not a homolog or variant of the Rf-1 gene functions to restore fertility can be
examined by, but not limited to, the following method, for example. A nucleic acid fragment under test
is introduced into immature seeds obtained by pollinating MS Koshihikari (sterile line) with MS-FR
Koshihikari according to the method of Hiei et al. (Plant Journal (1994), 6(2), p. 272-282). As the
resulting transformants are cultured under normal conditions, the seeds mature only when the nucleic
acid fragment under test functions to restore fertility.
[0050] The nucleic acid derived from a corresponding region of japonica Asominori not carrying the
Rf-1 gene has the base sequence shown in SEQ ID NO: 28. Corresponding parts of SEQ ID NO: 28
and SEQ ID NO: 27 have an overall identity of about 98%. Thus, nucleic acids containing the locus of
a fertility restorer gene (Rf-1) of the present invention are at least about 70%, preferably about 80% or
more, more preferably 90% or more, still more preferably 95% or more, most preferably 98 or more%
identical to SEQ ID NO: 27.
[0051] The percent identity may be determined by visual inspection and mathematical calculation.
Alternatively, the percent identity of two nucleic acid sequences can be determined by comparing
sequence information using the GAP computer program, version 6.0 described by Devereux et al.,
Nucl. Acids Res., 12:387 (1984) and available from the University of Wisconsin Genetics Computer
Group (UWGCG). The preferred default parameters for the GAP program include: (1) a unary
comparison matrix (containing a value of 1 for identities and 0 for non-identities) for bases, and the
70/503
weighted comparison matrix of Gribskov and Burgess, Nucl. Acids Res., 14:6745 (1986), as described
by Schwartz and Dayhoff, eds., Atlas of Protein Sequence and Structure, National Biomedical
Research Foundation, pp. 353-358 (1979); (2) a penalty of 3.0 for each gap and an additional 0.10
penalty for each symbol in each gap; and (3) no penalty for end gaps. Other programs used by those
skilled in the art of sequence comparison may also be used.
[0052] Nucleic acids of the present invention also include nucleic acids which are capable of
hybridizing to the base sequence of SEQ ID NO: 27 under conditions of moderately stringent
conditions and functions to restore fertility, and nucleic acids which are capable of hybridizing to the
base sequence of SEQ ID NO: 27 under conditions of highly stringent conditions and functions to
restore fertility.
[0053] As used herein, conditions of moderate stringency can be readily determined by those having
ordinary skill in the art based on, for example, the length of the DNA. The basic conditions are set forth
by Sambrook et al. Molecular Cloning: A Laboratory Manual, 2nd. Vol. 1, pp. 1.101-104, Cold Spring
Harbor Laboratory Press, (1989), and include use of a prewashing solution for the nitrocellulose filters
5 x SSC, 0.5% SDS, 1.0 mM EDTA (pH 8.0), hybridization conditions of about 1 x SSC to 6 x SSC at
about 40 DEG C to 60 DEG C (or other similar hybridization solution, such as Stark's solution, in
about 50% formamide at about 42 DEG C), and washing conditions of about 60 DEG C, 0.5 x SSC,
0.1% SDS. The hybridization temperature is about 15-20 DEG C lower when the hybridization solution
contains about 50% formamide. Conditions of high stringency can also be readily determined by the
skilled artisan based on, for example, the length of the DNA. Generally, conditions of high stringency
include hybridization and/or washing conditions at higher temperatures and/or lower salt
concentrations than in the conditions of moderate stringency described above. For example, such
conditions include hybridization conditions of 0.1 x SSC to 0.2 x SSC at about 60-65 DEG C and/or
washing conditions of 0.2 x SSC, 0.1% SDS at about 65-68 DEG C. The skilled artisan will recognize
that the temperature and wash solution salt concentration can be adjusted as necessary according to
factors such as the length of the probe.
[0054] DNAs of the present invention also include nucleic acids that differ from the base sequence of
SEQ ID NO: 27 due to deletions, insertions or substitutions of one or more bases while retaining a
fertility restoring function. So far as a fertility restoring function is retained, the number of bases to be
deleted, inserted or substituted is not specifically limited, but preferably 1 to several thousands, more
preferably 1-1000, still more preferably 1-500, even more preferably 1-200, most preferably 1-100.
[0055] Once the Rf-1 gene is further specified on the basis of the descriptions herein, it can be used
by those skilled in the art after nucleic acids such as other regions than the Rf-1 gene or intron regions
in the Rf-1 gene are removed. A given amino acid may be replaced, for example, by a residue having
similar physiochemical characteristics. Examples of such conservative substitutions include changes
from one aliphatic residue to another, such as changes from one to another of Ile, Val, Leu, or Ala;
changes from one polar residue to another, such as changes between Lys and Arg, Glu and Asp, or Gln
and Asn; or changes from one aromatic residue to another, such as changes from one to another of Phe,
Trp, or Tyr. Other well-known conservative substitutions include e.g. changes between entire regions
having similar hydrophobic characteristics. Those skilled in the art can introduce desired deletions,
insertions or substitutions by well-known gene engineering techniques using e.g. site-specific
mutagenesis as described in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd edition,
Cold Spring Harbor Laboratory Press, (1989).
[0056] We compared an indica variety IR24 carrying the Rf-1 gene (SEQ ID NO: 27) with japonica
varieties not carrying it such as Asominori (SEQ ID NO: 28) and a Nipponbare BAC clone deposited
with GenBank (Accession No. AC068923). As a result, we found that the Rf-1 region of the indica
variety containing the Rf-1 gene has at least the following single bases polymorphisms (SNP).
1) a base corresponding to the base 1239 of SEQ ID NO: 27 is A;
2) a base corresponding to the base 6227 of SEQ ID NO: 27 is A;
3) a base corresponding to the base 20680 of SEQ ID NO: 27 is G;
4) a base corresponding to the base 45461 of SEQ ID NO: 27 is A;
5) a base corresponding to the base 49609 of SEQ ID NO: 27 is A;
6) a base corresponding to the base 56368 of SEQ ID NO: 27 is T;
71/503
7) a base corresponding to the base 57629 of SEQ ID NO: 27 is C; and
8) a base corresponding to the base 66267 of SEQ ID NO: 27 is G.
[0057] Thus, nucleic acids containing the Rf-1 region of the present invention preferably meet one to
all of the requirements 1)-8) above.
[0058] In Example 3 below, the chromosomal organizations of recombinants proximal to the Rf-1
gene (RS1-RS2, RC1-RC8) were tested in the Rf-1 region. The results showed that a sequence
determining the presence of the function of the Rf-1 gene is contained in the base sequence of bases
1239-66267 of SEQ ID NO: 27, i.e. in a region from the P4497 MboI to B56691 XbaI loci (about 65
kb) as estimated at maximum (Fig. 3). However, there is a possibility that it is important for the
expression of the genetic function of the Rf-1 gene that the Rf-1 gene is partially of the indica
genotype, and that the genetic function may not be significantly changed whether the remaining regions
are of the japonica or indica genotype. There may be an extreme case that the coding region is
completely identical and only the promoter region is different between japonica and indica, and that the
promoter region and the coding region are only partially included in the region from P4497 the MboI to
B56691 XbaI loci (about 65 kb). Therefore, it cannot be concluded that the common indica region
above (bases 1239-66267 of SEQ ID NO: 27) completely contains the entire Rf-1 gene. However, it is
thought that at least SEQ ID NO: 27 completely contains the entire Rf-1 gene for the following
reasons:
1) the size of a gene is normally several kilobases, and rarely exceeds 10 kb;
2) the genomic base sequence of IR24 determined by the present invention (SEQ ID NO: 27)
completely contains the common indica region above;
3) the 5' end of SEQ ID NO: 27 is located 1238 bp upstream of the 5' end of the common indica
region above and forms a part of another gene (S12564); and
4) the 3' end of SEQ ID NO: 27 is located 10096 bp downstream of the 3' end of the common indica
region above.
[0059] In this way, we first succeeded in restricting the region of the Rf-1 gene to 76 kb. Thus,
nucleic acids containing the region of the Rf-1 gene of the present invention are extremely less likely to
contain other genes proximal to the Rf-1 gene as compared with those selected with the co-dominant
marker locus at a genetic distance of about 1 cM (about 300 kb) from the Rf-1 gene described in a prior
documents such as Japanese Patent Public Disclosure No. 2000-139465. Moreover, they are less likely
to contain other genes than those selected with the DNA marker loci S12564 Tsp509I and C1361
MwoI (at a distance of about 0.3 cM between them) described in our prior Japanese Patent Application
No. 2000-247204.
[0060] We further confirmed by complementation assays that the Rf-1 gene is completely contained
in especially bases 38538-54123 of the base sequence of SEQ ID NO: 27. In an embodiment of the
present invention, therefore, the base sequence at least 70% identical to the base sequence of SEQ ID
NO: 27 or to the base sequence of bases 38538-54123 of SEQ ID NO: 27 meets at least one of the
following requirements 1) and 2):
1) a base corresponding to the base 45461 of SEQ ID NO: 27 is A;
2) a base corresponding to the base 49609 of SEQ ID NO: 27 is A.
IV. Method for restoring rice fertility
[0061] The present invention provides a method for restoring rice fertility comprising introducing a
nucleic acid into rice, wherein the nucleic acid has the base sequence of SEQ ID NO.27, or has a base
sequence which is identical to at least 70% of the base sequence of SEQ ID NO.27, and which
functions to restore fertility. The methods of the present invention may comprise introducing a nucleic
acid into rice, wherein the nuclei acid has a portion of SEQ ID NO: 27, especially bases 38538-54123,
72/503
preferably bases 42357-53743, more preferably bases 42132-48883 of SEQ ID NO: 27 or has a base
sequence which is identical to at least 70% identical of the base sequence of bases 38538-54123,
preferably bases 42357-53743, more preferably bases 42132-48883 of SEQ ID NO: 27 and, which
functions to restore fertility.
[0062] In the present invention, the nucleic acid containing the locus of a fertility restorer gene (Rf-1)
that can be introduced into rice can be any one of the nucleic acids described above in "III. Nucleic
acids containing the Rf-1 locus". The method for introducing the nucleic acid into rice is not
specifically limited but can be any known method. Nucleic acids of the present invention can be
introduced by known genetic engineering techniques or crossing. Genetic engineering techniques are
preferably used because inclusion of other neighboring genes can be prevented and the period for
establishing a line can be shortened.
[0063] Any suitable expression system for transduction by genetic engineering techniques can be
employed. Recombinant expression vectors comprise a nucleic acid containing a fertility restorer gene
(Rf-1) of the invention that can be introduced into rice, operably linked to suitable transcriptional or
translational regulatory base sequences, such as those derived from a mammalian, microbial, viral, or
insect gene.
[0064] Examples of regulatory sequences include transcriptional promoters, operators, or enhancers,
an mRNA ribosomal binding site, and appropriate sequences which control transcription and
translation initiation and termination. Base sequences are operably linked to a regulatory sequence
when the regulatory sequence is functionally associated with the DNA sequences. Thus, a promoter
base sequence is operably linked to a DNA sequence if the promoter base sequence controls the
transcription of the DNA sequence. An origin of replication that confers the ability to replicate in rice,
and a selection gene by which transformants are identified, are generally incorporated into expression
vectors. As for selectable markers, those commonly used can be used by standard methods. Examples
are genes resistant to antibiotics such as tetracycline, ampicillin, kanamycin, neomycin, hygromycin or
spectinomycin.
[0065] In addition, a sequence encoding an appropriate signal peptide (native or heterologous) can be
incorporated into expression vectors. A DNA sequence for a signal peptide (secretory leader) may be
fused in frame to a nucleic acid sequence of the invention so that the DNA is initially transcribed, and
the mRNA translated into a fusion protein containing the signal peptide.
[0066] The present invention also provides recombinant vectors containing a gene of the present
invention. Methods for integrating a DNA fragment of a gene of the present invention into a vector
such as a plasmid are described in e.g. Sambrook, J. et al, Molecular Cloning, A Laboratory Manual
(2nd edition), Cold Spring Harbor Laboratory, 1.53 (1989). Commercially available ligation kits (e.g.
available from TAKARA) can be conveniently used. Thus obtained recombinant vectors (e.g.
recombinant plasmids) are transferred into host rice cells.
[0067] Vectors can be conveniently prepared by linking a desired gene to a recombinant vector
available in the art (e.g. plasmid DNA) by standard methods. Plant transforming vectors are especially
useful for conferring fertility on rice using a nucleic acid fragment of the present invention. Vectors for
plants are not specifically limited so far as they can express the gene of interest in plant cells to produce
the protein, but preferably include pBI221, pBI121 (Clontech), and vectors derived therefrom.
Especially, examples of vectors for transforming rice belonging to monocotyledons include pIG121Hm
and pTOK233 (Hiei et al., Plant J., 6, 271-282 (1994)), and pSB424 (Komari et al., Plant J., 10, 165174 (1996)).
[0068] Transgenic plants can be prepared by replacing the beta -glucuronidase (GUS) gene in the
above vectors with a nucleic acid fragment of the present invention to construct a plant transforming
vector and transfecting it into a plant. The plant transforming vector preferably comprises at least a
promoter, a start codon, a desired gene (a nucleic acid sequence of the present invention or a part
thereof), a stop codon and a terminator. It may also contain a DNA encoding a signal peptide, an
enhancer sequence, non-translated 5' and 3' regions of the desired gene, a selectable marker region, etc.,
as appropriate. Promoters and terminators are not specifically limited so far as they are functional in
73/503
plant cells, among which constitutive expression promoters include the 35S promoter initially
contained in the above vectors as well as promoters for actin and ubiquitin genes.
[0069] Suitable methods for introducing a plasmid into a host cell include the use of calcium
phosphate or calcium chloride/rubidium chloride, electroporation, electroinjection, chemical treatment
with PEG or the like, the use of a gene gun described in Sambrook, J. et al., Molecular Cloning, A
Laboratory Manual (2nd edition), Cold Spring Harbor Laboratory, 1.74(1989). Plant cells can be
transformed by e.g. the leaf disc method [Science, 227, 129 (1985)] or electroporation [Nature, 319,
791 (1986)].
[0070] Methods for transferring a gene into a plant include the use of Agrobacterium (Horsch et al.,
Science, 227,129(1985); Hiei et al., Plant J., 6, 271-282(1994)), electroporation (Fromm et al., Nature,
319, 791(1986)), PEG (Paszkowski et al., EMBO J., 3, 2717(1984)), microinjection (Crossway et al.,
Mol. Gen. Genet., 202, 179 (1986)), particle bombardment (McCabe et al., Bio/Technology, 6,
923(1988)). Methods are not specifically limited so far as they are suitable for transfecting a nucleic
acid into a desired plant.
[0071] Transduction by crossing can be performed as follows, for example. First, F1 obtained by
crossing an Rf-1 donor parent and a japonica variety is backcrossed with the japonica variety. The
resulting individuals are screened for those homozygous for japonica at the S12564 Tsp509I locus and
heterozygous at the P4497 MboI and B53627 BstZ17I loci and further backcrossed. The resulting
individuals are screened for those heterozygous at the P4497 MboI and B56691 XbaI loci and
homozygous for japonica at the B53627 BstZ17I locus and further backcrossed. Subsequently, about
10 cycles of screening each backcrossed generation for individuals heterozygous at the P4497 MboI
and B56691 XbaI loci and subjecting them to the subsequent backcrossing are repeated. Finally,
individuals heterozygous at the P4497 MboI and B56691 XbaI loci are self-fertilized and the resulting
individuals are screened for those homozygous for indica at both loci, whereby a restorer line inheriting
a limited chromosomal region from the P4497 MboI to B56691 XbaI loci from the Rf-1 donor parent
can be obtained.
[0072] According to the present invention, nucleic acids containing a fertility restorer gene (Rf-1)
were isolated, whereby the Rf-1 gene can be introduced into a rice variety using genetic engineering
techniques to establish a restorer line. The present invention succeeded in restricting the Rf-1 region to
76 kb or less. Therefore, nucleic acids containing the Rf-1 locus of the present invention are extremely
less likely to contain other genes neighboring the Rf-1 gene than those of the prior art. Moreover, the
entire base sequence of the region containing the Rf-1 gene was determined by the present invention.
Those skilled in the art can proceed with analysis of the Rf-1 gene itself on the basis of the description
herein. Thus, only the Rf-1 gene can be introduced without including any neighboring gene. This is
especially important when neighboring genes bring deleterious traits. Furthermore, restorer lines can be
established in a shorter period such as 1-2 years than obtained by crossing.
[0073] In complementation assays described in Examples 4-13 herein, MS Koshihikari (having BT
cytoplasm and a core gene substantially identical to Koshihikari) was actually transformed by an
Agrobacterium-mediated method using fragments from 10 clones described in Fig. 5. The results
demonstrated that fertility restorer lines are established from a nucleic acid containing the base
sequence of bases 38538-54123, preferably bases 42357-53743, more preferably bases 42132-48883 of
SEQ ID NO: 27.
[0074] Agrobacterium-mediated methods for establishing rice restorer lines are described in, but not
limited to, Hiei et al., Plant J.,6, pp. 271-282(1994), Komari et al., Plant J.,10, p.165-174(1996), Ditta
et al., Proc. Natl. Acad. Sci. USA 77: pp. 7347-7351(1980), etc.
[0075] First, a plasmid vector containing a nucleic acid fragment of interest to be inserted is prepared.
Suitable plasmid vectors include e.g. pSB11, pSB22 and the like having a plasmid map described in
Komari et al., Plant J., 10, pp. 165-174 (1996), supra. Alternatively, those skilled in the art can also
construct an appropriate vector by themselves on the basis of plasmid vectors such as pSB11, pSB22
described above. In the examples herein below, an intermediate vector pSB200 having a hygromycinresistant gene cassette was prepared on the basis of pSB11, and used. Specifically, a nopaline synthase
terminator (Tnos) was first fused to a ubiquitin promoter and a ubiquitin intron (Pubi-ubiI). A
74/503
hygromycin-resistant gene (HYG(R)) was inserted between ubiI and Tnos of the resulting Pubi-ubiITnos complex to give a Pubi-ubiI-HYG(R)-Tnos assembly. This assembly was fused to a
HindIII/EcoRI fragment of pSB11 (Komari et al., supra.) to give pKY205. Linker sequences for adding
restriction enzyme sites NotI, NspV, EcoRV, KpnI, SacI, EcoRI were inserted into the Hind III site
upstream of Pubi of this pKY205 to give pSB200 having a hygromycin-resistant gene cassette.
[0076] Then, E. coli cells (e.g. DH5a, JM109, MV1184, all commercially available from e.g.
TAKARA) are transformed with the recombinant vector containing the nucleic acid inserted.
[0077] Thus transformed E. coli cells are used for triparental mating with an Agrobacterium strain
preferably in combination with a helper E. coli strain according to e.g. the method of Ditta et al. (1980).
Suitable Agrobacterium strains include Agrobacterium tumefaciens strains such as LBA4404/pSB1,
LBA4404/pNB1, LBA4404/pSB3, etc. They all have a plasmid map described in Komari et al., Plant
J., 10, pp. 165-174 (1996), supra. and can be used by those skilled in the art by constructing a vector by
themselves. Suitable helper E. coli strains include, but not limited to, e.g. HB101/pRK2013 (available
from Clontech). A report shows that E. coli cells carrying pRK2073 can also be used as helper E. coli
though they are less common (Lemas et al., Plasmid 1992, 27, pp. 161-163).
[0078] Then, the Agrobacterium cells mated as intended are transformed into male sterility rice
according to e.g. the method of Hiei et al (1994). Necessary immature rice seeds for transformation can
be prepared by e.g. pollinating male sterility rice with a japonica variety.
[0079] Fertility restoration in transformed plants can be assessed by e.g. evaluating seed fertility in
standing plants about one month after heading. Evaluation on standing plants means observation of
plants grown in a field or the like. An alternative method is a laboratory study of grain ripening
percentages in the ear.
V. Methods for discerning the presence of the Rf-1 gene
[0080] According to the present invention, it was shown that a sequence determining the presence of
the function of the Rf-1 gene is located between the polymorphism-detecting marker loci P4497 MboI
and B56691 XbaI on rice chromosome 10. Moreover, complementation assays confirmed that the Rf-1
gene is completely contained in especially bases 38538-54123 of the base sequence of SEQ ID NO: 27.
[0081] Comparison of the base sequence of an indica variety carrying the Rf-1 gene (IR24) (SEQ ID
NO: 27) with those of japonica varieties not carrying said gene (Asominori (SEQ ID NO: 28) and
Nipponbare BAC clone AC068923) revealed the presence of polymorphisms between both varieties.
As a result, it became possible to conveniently, rapidly and exactly discern whether or not a rice plant
or seed under test carries the Rf-1 gene on the basis of polymorphisms in base sequence in regions
neighboring the Rf-1 gene.
[0082] Therefore, the present invention also provides a method for discerning whether or not a
subject rice individual or a seed thereof has the Rf-1 gene or not, wherein the method utilizing a fact
that a sequence determining the presence of the function of the Rf-1 gene positions between the
polymorphism detection marker loci P4497 MboI and B56691 Xba I on rice chromosome 10.
[0083] Polymorphisms can be detected by any known method. For example, known methods include
assays for restriction fragment length polymorphisms (RFLPs); direct determination by sequencing;
cutting a genomic DNA with a 8-base recognizing restriction enzyme, and then radioactivelly labeling
the ends and further cutting the labeled digest with 6-base and 4-bases recognizing restriction enzyme
and then developing the digest by two-dimensional electrophoresis (RLGS, Restriction Landmark
Genome Scanning); etc. AFLP analysis (amplified fragment length polymorphism; P. Vos et al.,
Nucleic Acids Res. Vol. 23, pp. 4407-4414 (1995)) has also been developed wherein RFLP is
amplified/detected by polymerase chain reaction (PCR).
75/503
[0084] For example, conventional methods involved detecting RFLPs via PCR amplification
(conversion of RFLP markers into PCR markers) or detecting polymorphisms in microsatellites via
PCR amplification (microsatellite markers) as illustrated below.
Conversion of RFLP markers into PCR markers
A. PCR markers based on polymorphisms in genomic regions corresponding to RFLP probes (D.E.
Harry, B.Temesgen, D.B. Neale; Codominant PCR-based markers for Pinus taeda developed from
mapped cDNA clones, Theor. Appl. Genet. (1998) 97: pp. 327-336). After performing genomic PCR
using primers designed for an RFLP marker probe sequence ("RFLP" is a polymorphism observed by
Southern analysis using a DNA fragment as a probe. The base sequence of the DNA fragment used as a
probe is called "RFLP marker probe sequence"), a PCR marker can be prepared by either of the
following two procedures. A first procedure involves treating the products with a series of restriction
enzymes to search for a restriction enzyme causing a fragment length polymorphism, and a second
procedure involves searching for a polymorphism by varietal comparison of the base sequences of the
products and preparing a PCR marker based on the polymorphism.
B. PCR markers based on identification of RFLP-causing sites. A PCR marker can be obtained by
identifying an RFLP-causing site (a restriction enzyme recognition site carried by only one of two
varieties compared) present in or near (normally within several kbs) an RFLP marker probe sequence.
Microsatellite markers
[0086] Microsatellites are repeat sequences of about 2 to 4 bases such as (CA)n that are present in
great numbers in genomes. If a varietal polymorphism occurs in repetition number, a polymorphism
can be observed in PCR product length by PCR using primers designed in adjacent regions, whereby
the DNA polymorphism can be detected. Markers for detecting polymorphisms using microsatellites
are called microsatellite markers (O. Parnaud, X. Chen, S.R. McCouch, Mol. Gen. Genet. (1996) 252:
pp. 597-607).
[0087] Methods for detecting polymorphisms in the present invention are not specifically limited.
From the viewpoint of efficiency and convenience, PCR-RFLP is preferred, which is a combination of
PCR and RFLP to identify polymorphisms from their restriction enzyme cleavage patterns in cases
where they exist among variety lines at restriction enzyme recognition sites in the sequences of DNA
fragments amplified by PCR. PCR-RFLP is also called CAPS (cleaved amplified polymorphic
sequence). If any suitable restriction enzyme recognition site is not present in a region showing
polymorphisms, a modified CAPS called dCAPS (derived cleaved amplified polymorphic sequence)
can also be used wherein restriction enzyme sites are introduced during PCR (Michaels, S.D. and
Amasino, R.M. (1998), The Plant Journal 14(3) 381-385; A. Konieczny et al.,(1993), Plant J.4(2) pp.
403-410; Neff, M.M., Neff, J.D., Chory, J. and Pepper, A.E. (1998), The Plant Journal 14(3) 387-392).
These methods are explained in more detail below.
CAPS, dCAPS
[0088] The method for discerning of the present invention comprise, but not limited to:
i) preparing a pair of primers based on the base sequences of a site showing a polymorphism in the
base sequences between indica and japonica varieties at the Rf-1 locus and its adjacent regions to
amplify said base sequences;
ii) performing nucleic acid amplification reaction(s) using the genomic DNA of the subject rice
individual or the seed thereof as a template; and
76/503
iii) discerning whether or not the subject rice individual or the seed thereof has the Rf-1 gene based
on the polymorphism found in the nucleic acid amplification product.
[0089] The step of preparing a primer pair in i) preferably comprises any of the following means:
a) when a change containing a deleted region exists in the polymorphism in the nucleic acid
amplification product, preparing a pair of primers for nucleic acid amplification to flank the deleted
region to form a marker for detecting the polymorphism;
b) when a base change causing a difference in restriction enzyme recognition exists in the
polymorphism in the nucleic acid amplification product, preparing a pair of primers for nucleic acid
amplification to flank the base change site to form a marker for detecting the polymorphism; or
c) when a base change causing no difference in restriction enzyme recognition exists in the
polymorphism in the nucleic acid amplification product, preparing a pair of primers for introducing a
mismatch, wherein pair of primers contain the base change site and alters a region containing the base
change site into a base sequence causing a difference in restriction enzyme recognition in the nucleic
acid amplification product to form a marker for detecting the polymorphism.
[0090] Suitable polymorphic sites for discerning the presence of the Rf-1 gene in the present
invention can be appropriately selected so that a polymorphism detecting marker can be prepared as
described below on the basis of comparison of, but not limited to, the base sequence of an indica
variety carrying the Rf-1 gene (IR24) (SEQ ID NO: 27) with those of japonica varieties not carrying
said gene (Asominori (SEQ ID NO: 28) and Nipponbare BAC clone AC068923).
[0091] If the polymorphism found causes a difference in restriction enzyme recognition, for example,
a pair of primers for nucleic acid amplification are prepared to flank the polymorphic site and used for
detecting the polymorphism. Primers are preferably designed not to be specific for highly repeated
sequences to avoid undesired products. If the polymorphism found does not cause a difference in
restriction enzyme recognition, markers can be prepared by applying the dCAPS method described
above. Primers for dCAPS markers are preferably designed not to be specific for repeat sequences and
to provide a product length of preferably 50-300 bases, more preferably about 100 bases to ease
identification of polymorphisms.
[0092] If the polymorphism found involves a microsatellite, nucleic acid amplification primers are
prepared to flank the microsatellite and used to detect the polymorphism. Again, the primers are
preferably designed not to be specific for repeat sequences.
1) Nucleic acid amplification
[0093] In the present invention, a pair of primers are preferably prepared for amplifying adjacent
regions containing polymorphisms on the basis of the determined base sequence of the nucleic acid of a
subject rice individual or seed at the Rf-1 locus. The primer pair is used to perform a nucleic acid
amplification reaction with the genomic DNA of the subject rice individual or seed as a template. The
nucleic acid amplification reaction is preferably polymerase chain reaction (PCR) (Saiki et al., 1985,
Science 230, pp. 1350-1354).
[0094] The pair of primers for nucleic acid amplification can be prepared by any known method on
the basis of the base sequence of a polymorphic site and adjacent regions thereto. Specifically, a primer
pair can be prepared on the basis of the base sequence of a polymorphic site and adjacent regions
thereto by a process comprising generating a single-stranded DNA having the same base sequence as
the base sequence of the polymorphic site and adjacent regions thereto or a base sequence
complementary to said regions or, if necessary, generating the single-stranded DNA containing a
modification without affecting the binding specificity to the base sequence of the polymorphic site and
adjacent regions thereto provided that the following conditions are satisfied:
1) the length of each primer should be 15-30 bases;
77/503
2) the proportion of G+C in the base sequence of each primer should be 30-70%;
3) the distribution of A, T, G and C in the base sequence of each primer should not be partially
largely uneven;
4) the length of the nucleic acid amplification product amplified by the primer pair should be 50-3000
bases, preferably 50-300 bases; and
5) any complementary sequence segment should not occur with the base sequence of each primer or
between the base sequences of the primers.
[0095] As used herein, the "adjacent regions" to a polymorphic site mean that an area containing both
of a polymorphic site and adjacent regions thereto is within a distance suitable for nucleic acid
amplification, preferably PCR. The adjacent regions amplified preferably have a length within the
range of, but not limited to, about 50 bases to about 3000 bases, more preferably about 50 bases to
about 2000 bases. To facilitate identification of polymorphisms, the product length is preferably 50-300
bases, more preferably about 100 bases. The adjacent regions preferably have a length within the range
of, but not limited to, about 0 to about 3000 bases, more preferably about 0 to about 2000 bases, still
more preferably about 0 to about 1000 bases on the 5' or 3' side of a polymorphic site.
[0096] Procedures and conditions for the nucleic acid amplification reaction are not specifically
limited and are well known to those skilled in the art. Appropriate conditions can be applied by those
skilled in the art depending on various factors such as the base sequence of the polymorphic site and
adjacent regions thereto, the base sequence and length of the primer pair, etc. Generally, the nucleic
acid amplification reaction can be performed under more stringent conditions (annealing reaction and
nucleic acid elongation reaction at higher temperatures and less cycles) as the primer pair is longer or
the proportion of G+C is higher or the distribution of A, T, G and C is evener. The use of more
stringent conditions allows an amplification reaction with higher specificity.
[0097] The amplification reaction can be performed under conditions of, but not limited to, one cycle
of 94 DEG C for 2 min, 30 cycles of 94 DEG C for 1 min, 58 DEG C for 1 min and 72 DEG C for 2
min, and finally one cycle of 72 DEG C for 2 min using 50 ng of a genomic DNA as a template, 200
mu M of each dNTP and 5 U of ExTaq TM (TAKARA). The reaction can also be performed under
conditions of one cycle of 94 DEG C for 2 min, 30 cycles of 94 DEG C for 1 min, 58 DEG C for 1 min
and 72 DEG C for 1 min, and finally one cycle of 72 DEG C for 2 min. In another embodiment, the
reaction can also be performed under conditions of one cycle of 94 DEG C for 2 min, 35 cycles of 94
DEG C for 30 sec, 58 DEG C for 30 sec and 72 DEG C for 30 sec, and finally one cycle of 72 DEG C
for 2 min.
[0098] The subject rice (test rice) genomic DNA used as a template for PCR can be easily extracted
from individuals or seeds by the method of Edwards et al. (Nucleic Acids Res. 8(6):1349, 1991). More
preferably, DNA purified by standard techniques is used. An especially preferred extraction method is
the CTAB method (Murray, M.G. et al., Nucleic Acids Res. 8(19):4321-5, 1980). The DNA is
preferably used as a template for PCR at a final concentration of 0.5 ng/ mu L.
2) Preparation of markers for detecting polymorphisms
[0099] After examining whether or not a polymorphism is detected in the amplification product by
the nucleic acid amplification reaction with a pair of primers, a marker for detecting the polymorphism
is prepared on the basis of the polymorphism found. Non-limiting examples of polymorphisms that can
be detected in the amplification product are as follows.
a) A change containing a deleted region exists in the polymorphism in the nucleic acid amplification
product.
[0100] In this case, a pair of primers for nucleic acid amplification are prepared to flank the deleted
region to form a marker for detecting the polymorphism. If the deleted region has a sufficient size, the
78/503
polymorphism can be detected from the difference in mobility by electrophoresing the amplification
product on an agarose gel or an acrylamide gel, for example. The polymorphism can be detected when
the difference in base pair numbers is about 5% or more in the case of agarose gel electrophoresis or
when the difference in length is about 1 base or more in the case of sequencing acrylamide gel
electrophoresis, for example. Alternatively, the polymorphism can be detected by hybridizing the
nucleic acid amplification product using an oligobase or a DNA fragment having a complementary
sequence to the base sequence excluding the deleted region as an analytical probe. Alternatively, the
polymorphism can be confirmed by determining the base sequence of the amplification product, if
desired. Known techniques for electrophoresis of nucleic acids, hybridization, sequencing and the like
can be used as appropriate by those skilled in the art. In this case, the difference in the length of the
amplification product directly reflects the polymorphism and markers for detecting polymorphisms on
this basis are called ALP (amplicon length polymorphism) markers.
b) A base change causing a difference in restriction enzyme recognition exists in the polymorphism in
the nucleic acid amplification product.
[0101] In this case, a pair of primers for nucleic acid amplification are prepared to flank the base
change site to form a marker for detecting the polymorphism. In this case, a base change causing a
difference in restriction enzyme recognition occurs in the polymorphism of the nucleic acid
amplification product, i.e. the nucleic acid amplification product may be cleaved or not with one or
more specific restriction enzymes. Thus, the amplification product can be treated with the restriction
enzymes and electrophoresed on e.g. an agarose gel to detect the polymorphism from the difference in
mobility. The polymorphism can be confirmed by determining the base sequence of the amplification
product, if desired.
[0102] In this case, the difference in the length of the restriction fragment of the amplification
product by PCR or the like reflects the polymorphism and markers for detecting polymorphisms on this
basis are called CAPS markers or PCR-RFLP markers (A. Konieczny et al., supra.)
[0103] This is exemplified by primer pairs P4497 MboI, P23945 MboI, P41030 TaqI, P45177 BstUI,
B59066 BsaJI and B56691 XbaI in Example 1 below. Even if the polymorphism can be detected by the
length of the nucleic acid amplification product as described in a) above, the polymorphism can be
more easily detected by combination with restriction enzyme treatment.
c) A base change causing no difference in restriction enzyme recognition exists in the polymorphism in
the nucleic acid amplification product.
[0104] In this case, a pair of primers for introducing a mismatch are prepared that contains the base
change site and alters a region containing the base change site into a base sequence causing a difference
in restriction enzyme recognition in the nucleic acid amplification product to form a marker for
detecting the polymorphism.
[0105] Specifically, a pair of primers based on the base sequences of regions naturally proximal to
the Rf-1 gene cause a polymorphism in the nucleic acid amplification product but no difference in
restriction enzyme recognition, and therefore, a mismatch is introduced into one or both of the primers
to alter a region containing the base change site (polymorphism) into a base sequence causing a
difference in restriction enzyme recognition in the nucleic acid amplification product. For example, the
method described in Mikaelian et al., Nucl. Acids. Res. 20:376.1992 can be used as a standard
technique for substituting, deleting or adding a specific base by PCR-mediated site-specific
mutagenesis. The amplification product using the mismatch-introducing primers as a marker for
detecting the polymorphism may be cleaved or not with one or more specific restriction enzymes
because it has a difference in restriction enzyme recognition at the mismatch-introducing site.
Therefore, the amplification product can be treated with the restriction enzymes and electrophoresed on
e.g. an agarose gel to detect the polymorphism from the difference in mobility, as described in b)
above.
79/503
[0106] The introduction of a mismatch must not affect not only the binding of the primers to a target
plant genome but also the polymorphic base change. The polymorphic base change is used to introduce
a mismatch near it so that a difference in restriction enzyme recognition occurs by a combination of
both base change and mismatch. Methods for introducing such a mismatch are known to those skilled
in the art and described in detail in Michaels, S.D. and Amasino, R.M. (1998), Neff, M.M., Neff, J.D.,
Chory, J. and Pepper, A.E. (1998), for example.
[0107] Markers in this case are improved CAPS markers described in b) above and called dCAPS
(derived CAPS) markers. This is exemplified by P9493 BslI in Example 3 below.
[0108] If there are many extra restriction sites unrelated to varietal polymorphisms in the case of b)
or c) above, it may be difficult to discern any difference in restriction site recognition based on
polymorphisms. In this case, a mismatch may be introduced into a primer as appropriate to abolish
unnecessary restriction sites. For example, a mismatch was introduced into the R-primer to abolish the
MspI site unrelated to polymorphisms in B60304 MspI in Example 3.
[0109] Although the invention is not limited to any specific method, CAPS or dCAPS methods have
several advantages over other RFLP methods. Specifically, analyses can be made with smaller amounts
of samples than in RFLP, for example. Another advantage is that the time and labor required for
analyses can be greatly reduced. Polymorphisms detected with PCR markers can be visualized by
agarose gel electrophoresis that is easier than acrylamide gel electrophoresis used for microsatellite
markers.
Preferred embodiments of the discerning method of the present invention
[0110] Preferred embodiments of the method for discerning whether or not a subject rice has the Rf-1
gene are described below for illustrative purposes. In the examples herein, it was found that the base
sequence of an indica variety IR24 carrying the Rf-1 gene (SEQ ID NO: 27) has at least the following
polymorphisms 1)-8) as compared with corresponding regions of japonica varieties:
1) a base corresponding to the base 1239 of SEQ ID NO: 27 is A;
2) a base corresponding to the base 6227 of SEQ ID NO: 27 is A;
3) a base corresponding to the base 20680 of SEQ ID NO: 27 is G;
4) a base corresponding to the base 45461 of SEQ ID NO: 27 is A;
5) a base corresponding to the base 49609 of SEQ ID NO: 27 is A;
6) a base corresponding to the base 56368 of SEQ ID NO: 27 is T;
7) a base corresponding to the base 57629 of SEQ ID NO: 27 is C; and
8) a base corresponding to the base 66267 of SEQ ID NO: 27 is G.
[0111] In preferred embodiments of the present invention, therefore, the subject rice individual or
seed is judged as carrying the Rf-1 gene when one to all of the requirements 1)-8) above are met.
[0112] We further verified that a region essential for the expression of the function of the Rf-1 gene
is contained in especially bases 38538-54123, preferably bases 42357-53743, more preferably bases
42132-48883 in the base sequence of SEQ ID NO: 27. In an embodiment of the present invention,
therefore, the subject rice individual or seed is determined to have the Rf-1 gene in the case that the
nucleic acid having a base sequence which is identical to at least 70% of the base sequence of SEQ ID
NO.27 or of the base sequence of bases 38538-54123 of SEQ ID NO.27, meets at least one of the
following requirements 1) and 2):
1) a base corresponding to the base 45461 of SEQ ID NO.27 is A; and
2) a base corresponding to the base 49609 of SEQ ID NO.27 is A.
80/503
[0113] Known polymorphism detecting methods can be used to determine whether or not the above
requirements are met. The base sequence of adjacent regions containing said sequence can also be
directly determined. However, CAPS or dCAPS methods described above are preferably used because
they are rapid and convenient. CAPS or dCAPS methods can be performed by a protocol comprising,
for example:
i) preparing a pair of primers based on a base sequence of adjacent regions including any one of the
following base;
1) a base corresponding to the base 1239 of SEQ ID NO: 27;
2) a base corresponding to the base 6227 of SEQ ID NO: 27;
3) a base corresponding to the base 20680 of SEQ ID NO: 27;
4) a base corresponding to the base 45461 of SEQ ID NO: 27;
5) a base corresponding to the base 49609 of SEQ ID NO: 27;
6) a base corresponding to the base 56368 of SEQ ID NO: 27;
7) a base corresponding to the base 57629 of SEQ ID NO: 27; and
8) a base corresponding to the base 66267 of SEQ ID NO: 27 is G.
to amplify both the base of the above and adjacent regions thereto;
ii) performing nucleic acid amplification reaction(s) using the genome DNA of the subject rice
individual or the seed thereof as a template; and
iii) discerning the presence of the Rf-1 in the subject rice individual or the seed thereof based on
polymorphism found in said nucleic acid amplification product.
[0114] The detection of polymorphisms in the nucleic acid amplification product is performed by, but
not limited to, discerning the subject rice individual or seed to have the Rf-1 gene when one to all of
the requirements 1)-8) below are met:
1) a region including a base corresponding to the base 1239 of SEQ ID NO: 27 does not have any
MboI recognition sequence;
2) a region including a base corresponding to the base 6227 of SEQ ID NO: 27 does not have any
BslI recognition sequence;
3) a region including a base corresponding to the base 20680 of SEQ ID NO: 27 does not have any
MboI recognition sequence;
4) a region including a base corresponding to the base 45461 of SEQ ID NO: 27 does not have any
TaqI recognition sequence;
5) a region including a base corresponding to the base 49609 of SEQ ID NO: 27 does not have any
BstUI recognition sequence;
6) a region including a base corresponding to the base 56368 of SEQ ID NO: 27 does not have any
MspI recognition sequence;
7) a region including a base corresponding to the base 57629 of SEQ ID NO: 27 does not have any
BsaJI recognition sequence; and
8) a region including a base corresponding to the base 66267 of SEQ ID NO: 27 does not have any
XbaI recognition sequence.
[0115] However, the present invention is not limited to the restriction enzymes above so far as each
polymorphism in the specific regions 1)-8) above can be detected.
[0116] Preferably, identification methods of the present invention comprise:
i) preparing a pair of primers based on a base sequence of adjacent regions including any one of the
following base;
1) a base corresponding to the base 45461; or
2) a base corresponding to the base 49609; to amplify both the base of the above and adjacent regions
thereto;
81/503
ii) performing nucleic acid amplification reaction(s) using the genome DNA of the subject rice
individual or the seed thereof as a template; and
iii) discerning the presence of the Rf-1 in the subject rice individual or the seed thereof based on
polymorphism found in said nucleic acid amplification product. The subject rice individual or seed
thereof is determined to have the Rf-1 gene in step iii), although not limited to, when at least one of the
following requirements 1) and 2) is met:
1) a region including a base corresponding to the base 45461 of SEQ ID NO: 27 does not have any
TaqI recognition sequence;
2) a region including a base corresponding to the base 49609 of SEQ ID NO: 27 does not have any
BstUI recognition sequence.
[0117] Primer pairs used for the amplification reaction can be appropriately selected by those skilled
in the art to preferably satisfy the conditions above on the basis of the base sequence of SEQ ID NO:
27. Preferably, any primer pair having a base sequence selected from the group consisting of SEQ ID
NOS: 39 and 40, SEQ ID NOS: 41 and 42, SEQ ID NOS: 43 and 44, SEQ ID NOS: 45 and 46, SEQ ID
NOS: 47 and 48, SEQ ID NOS: 49 and 50, SEQ ID NOS: 51 and 52, and SEQ ID NOS: 53 and 54 is
used. More preferably, the primer pair is selected from the group consisting of SEQ ID NOS: 45 and
46, and SEQ ID NOS: 47 and 48. If necessary, the sequences of the above primer pairs containing
substitutions, deletions or additions while retaining the binding specificity for the base sequence of the
polymorphic site and adjacent regions thereto can also be used as primers.
[0118] To examine the resulting PCR product for restriction fragment length polymorphisms, it is
cleaved with restriction enzymes corresponding to the restriction sites present in PCR markers. Such
cleavage is accomplished by incubation for several hours to a day at the recommended reaction
temperature for the restriction enzymes used. The PCR amplified sample cleaved with the restriction
enzymes can be analyzed by electrophoresis on an about 0.7% - 2% agarose gel or an about 3%
MetaPhor TM agarose gel. The gel is visualized under UV light in ethidium bromide, for example.
[0119] In the most preferred embodiments of the present invention, restriction enzyme cleavage
patterns show the bands as shown in Table 2 below on the visualized gel depending on the primer pair
used.
>;tb;>;TABLE; Id=Table 2 Columns=2
>;tb;
>;tb;Head Col 1:
>;tb;Head Col 2: Approximate size (bp) of detected band
>;tb;
>;tb;SubHead Col 1: Amplified with P4497 MobI (SEQ ID NOS: 39 and 40) Restriction enzyme MboI
>;tb;SubHead Col 2: 730
>;tb;Test rice genome having the Rf-1 gene (homozygous)
>;tb;no>;SEP;385, 345
>;tb;Amplified with P9493 BslI (SEQ ID NOS: 41 and 42) Restriction enzyme BslI>;SEP;126
>;tb;
>;tb;SubHead Col 3: Test rice genome having the Rf-1 gene (homozygous)
>;tb;no>;SEP;100, 26
>;tb;
>;tb;SubHead Col 4: Amplified with P23945 MboI (SEQ ID NOS: 43 and 44) Restriction enzyme
MboI
>;tb;Test rice genome having the Rf-1 gene (homozygous)>;SEP;160, 100
>;tb;no>;SEP;260
>;tb;
>;tb;SubHead Col 5: Amplified with P41030 TaqI (SEQ ID NOS: 45 and 46) Restriction enzyme TaqI
>;tb;Test rice genome having the Rf-1 gene (homozygous)>;SEP;280
>;tb;no>;SEP;90, 190
>;tb;
>;tb;SubHead Col 6: Amplified with P45177 BstUI (SEQ ID NOS: 47 and Restriction enzyme BstUI
>;tb;SubHead Col 7: 48)
82/503
>;tb;Test rice genome having the Rf-1 gene (homozygous)>;SEP;20,65,730
>;tb;no>;SEP;20,65,175,555
>;tb;
>;tb;SubHead Col 8: Amplified with B60304 MspI (SEQ ID NOS: 49 and 50) Restriction enzyme
MspI
>;tb;Test rice genome having the Rf-1 gene (homozygous)>;SEP;330
>;tb;no>;SEP;220, 110
>;tb;
>;tb;SubHead Col 9: Amplified with B59066 BsaJI (SEQ ID NOS: 51 and Restriction enzyme BsaJI
52)
>;tb;Test rice genome having the Rf-1 gene (homozygous)>;SEP;420
>;tb;no>;SEP;65, 355
>;tb;
>;tb;SubHead Col 10: Amplified with B56691 XbaI (SEQ ID NOS: 53 and 54) Restriction enzyme
XbaI
>;tb;Test rice genome having the Rf-1 gene (homozygous)>;SEP;670
>;tb;no>;SEP;140, 530
>;tb;>;/TABLE;
[0120] In Example 3 below, recombinants proximal to the Rf-1 gene having pollen fertility (RS1RS2, RC1-RC8) were tested for the chromosomal organization of the Rf-1 region using 14
polymorphic markers including the 8 primer pairs described above. As a result, it was confirmed that
all the plants carry the Rf-1 gene derived from the indica variety between P9493 BslI and 59066 BsaJI.
This result showed that recombinant pollens having the chromosomal organization as shown in Fig. 3
have pollen fertility, i.e. the Rf-1 gene is functional in these pollens. This means that a sequence
determining the presence of the function of the Rf-1 gene is included in the indica region common to
these recombinant pollens, i.e. in a region from the P4497 MboI to B56691 XbaI loci (about 65 kb) as
estimated at maximum.
[0121] In the present invention, chromosomal walking was started on the presumption that the
S12564 Tsp509I locus should be vary proximal to the Rf-1 locus as judged from the frequency of
appearance of individuals by crossing. In fact, the genetic distance between both loci has been
calculated to be about 0.04 cM as the result of the high-precision segregation analysis of the present
invention. Even one of markers known to be most closely linked to the Rf-1 locus as described in
Japanese Patent Public Disclosure No. 2000-139465 is reported to have a genetic distance of 1 cM
from the Rf-1 locus. Considering that 1 cM is estimated to be equivalent to 300 kb on average in rice, a
considerable time should be required to restrict the Rf-1 gene region if chromosomal walking were
started from the marker described in Japanese Patent Public Disclosure No. 2000-139465.
VI. Method for inhibiting the function of Rf-1 gene to restore fertility
[0122] According to the present invention, the nucleic acid containing the locus of a fertility restorer
gene (Rf-1) including the nucleic acids which function to restore fertility was isolated. The entire base
sequence thereof was determined, whereby the fertility restoring function of the Rf-1 gene can be
controlled by genetic engineering techniques. Thus, the present invention further provides a method for
inhibiting the function of Rf-1 to restore fertility.
[0123] A method for inhibiting the function of the Rf-1 gene to restore fertility according to one
embodiment of the present invention comprises introducing an antisense having at least 100 continuous
bases in length, and having a base sequence complementary to a nucleic acid having the base sequence
of SEQ ID NO.27, or to a nucleic acid having a base sequence which is identical to at least 70% of the
base sequence of SEQ ID NO.27, and which functions to restore fertility.
[0124] In an embodiment, the method for inhibiting the function of the Rf-1 gene to restore fertility
according to the present invention comprises introducing an antisense having at least 100 continuous
bases in length, and being selected from base sequences complementary to a nucleic acid having the
base sequence of bases 38538-54123, preferably bases 42357-53743, more preferably bases 42132-
83/503
48883 of SEQ ID NO: 27, or to a nucleic acid having a base sequence which is identical to at least 70%
of the base sequence of bases 38538-54123, preferably bases 42357-53743, more preferably bases
42132-48883 of SEQ ID NO: 27 and, which functions to restore fertility.
[0125] The antisense has a length of at least 100 bases or more, more preferably 500 bases or more,
most preferably 1000 bases or more. From the viewpoint of technical convenience of introduction, it
preferably has a length of 10000 bases or less, more preferably 5000 bases or less. The antisense can be
synthesized by known methods. The antisense can be introduced into rice by known methods as
described in e.g. Terada et al. (Plant Cell Physiol. 2000 Jul, 41(7), pp. 881-888).
[0126] It is also anticipated that Rf-1 disrupted lines can be established by screening variant lines
containing a transposable element such as, but not limited to, Tos17 (Hirochika H. et al. 1996, Proc.
Natl. Acad. Sci. USA 93, pp. 7783-7788) for a line containing the transposable element in the base
sequence of SEQ ID NO: 27. In plants, gene disruption by homologous recombination has been
studied. It may also be possible to inhibit fertility restoring function by establishing such a line in
which the Rf-1 gene has been replaced by a variant Rf-1 gene using a nucleic acid having the base
sequence of SEQ ID NO.27, or a nucleic acid having a base sequence which is identical to at least 70%
of the base sequence of SEQ ID NO.27.
References
1. Fukuta et al. 1992, Jpn J. Breed. 42 (supl.1) p.164-165.
2. Japanese Patent Public Disclosure No. HEI7(1995)-222588.
3. Japanese Patent Public Disclosure No. HEI9(1997)-313187.
4. Japanese Patent Public Disclosure No. 2000-139465.
5. Harushima et al. 1998, Genetics 148 p.479-494.
6. Michaels and Amasino 1998, The Plant Journal 14(3) p.381-385.
7. Neff et al. 1998, The plant Journal 14(3) p.387-392.
8. D.E. Harry, et al., Theor Appl Genet (1998) 97:p.327-336.
9. Hiei et al., Plant Journal (1994),6(2),p.272-282.
10. Komari et al., Plant Journal (1996) 10, p.165-174.
11. Ditta et al., Proc.Natl.Acad.Sci. USA (1980), 77: p.7347-7351,
12. P. Vos et al., Nucleic Acids Res. Vol.23, p. 4407-4414 (1995).
13. O.Parnaud,X. et al, Mol.Gen.Genet.(1996) 252:p.597-607.
14. A.Konieczny et al.,(1993),Plant J.4(2)p.403-410.
15. Edwards et al.,Nucleic Acids Res. 8(6): 1349, 1991.
16. Murray M.G. et al., Nucleic Acids Res. 8(19):4321-5, 1980.
17. Terada et al., Plant Cell Physiol. 2000 Jul, 41(7), p.881-888.
18. Hirochika H. et al. 1996, Proc.Natl.Acad.Sci.USA 93, p.7783-7788.
Examples
[0128] The following examples further illustrate the present invention but are not intended to limit
the technical scope of the invention. Those skilled in the art can readily add modifications/changes to
the present invention on the basis of the description of the specification, and those
modifications/changes are included in the technical scope of the present invention.
Reference examples
[0129] The following reference examples are based on the examples described in our prior
application (Japanese Patent Application No. 2000-247204 filed August 17, 2000).
84/503
Reference example 1: Conversion of RFLP markers around Rf-1 gene to PCR markers
[0130] In this reference example, nine RFLP markers (i.e., R1877, G291, R2303, S12564, C1361,
S10019, G4003, S10602 and G2155) around the locus of Rf-1 gene were converted to PCR markers.
(1) Materials and methods
[0131] The following nine RFLP markers, R1877, G291, R2303, S12564, C1361, S10019, G4003,
S10602 and G2155, were purchased from the National Institute of Agrobiological Sciences, the
Ministry of Agriculture, Forestry and Fisheries of Japan. After determining the base sequences of the
inserts in the vectors, experiments were conducted according to the following procedures. Among rice
varieties herein, Asominori belongs to japonica, and IR24 belongs to indica.
(2) Preparation of Asominori genomic library
[0132] Total DNA was extracted from green leaves of Asominori by the CTAB method. After partial
digestion with MboI, the DNA was fractionated according to size by NaCl density gradient
centrifugation (6-20% linear gradient, 20 DEG C, 37,000 rpm, 4 hr, total volume = 12 mL). A portion
of each fraction (about 0.5 mL) was subjected to electrophoresis and fractions containing 15-20 kb
DNA were collected and purified. A library was constructed using Lambda DASH II (Stratagene) as a
vector in accordance with the attached protocol. Giga Pack III Gold (Stratagene) was used for
packaging. After packaging, 500 mu L of SM Buffer and 20 mu L of chloroform were added. After
centrifugation, 20 mu L of chloroform was added to the supernatant to make a library solution.
[0133] XL-1 Blue MRA (P2) was infected with 5 mu L of a 50-fold dilution of the library solution,
whereupon 83 plaques were formed. This corresponded to 4.15 x 10>;5; pfu per library, and hence, it
was calculated that the plaques covered 8.3 x 10>;9; bp assuming that the average length of the inserted
fragments was 20 kb. The library was therefore considered to have an adequate size for the rice
genome (4 x 10>;8; bp).
(3) Isolation of genomic clones containing R1877-, C1361- and G4003-marker regions.
[0134] As for C1361 and G4003, plasmids containing the RFLP marker probe were isolated and
subjected to restriction enzyme treatment and electrophoresis to separate the RFLP marker probe
portion; the desired DNA was recovered on a DNA recovery filter (Takara SUPREC-01). As for
R1877, primers were designed that were specific to both ends of the marker probe and PCR was
performed with the total DNA of Asominori used as a template; the amplification products were
electrophoresed and recovered by the method described above. The recovered DNA was labelled with a
Rediprime DNA Labelling System (Amersham Pharmacia) to prepare a probe for screening the library.
PCR was performed in the usual manner (this also applies to the following description).
[0135] Screening of the library was performed in the usual manner after blotting the plaques onto
Hybond-N+ (Amersham Pharmacia). After primary screening, areas of positive plaques were
individually punched out, suspended in SM buffer and subjected to the second round of screening.
After the second screening, the positive plaques were punched out and subjected to the third round of
screening to isolate a single plaque.
[0136] The isolated plaque of interest was suspended in SM buffer and primary multiplication of the
phage was performed by the plate lysate method. The resulting phage-enriched solution was subjected
85/503
to secondary multiplication by shake culture and the phage DNA was purified with Lambda starter kit
(QIAGEN).
[0137] For each marker, primary screening was conducted on eight plates. A 10 mu L aliquot of the
library solution was employed per plate. After the primary, second and third rounds of screening, four
genomic clones in association with R1877 were isolated and three were isolated in association with
each of C1361 and G4003.
(4) Conversion of R1877 to PCR marker
[0138] The isolated genomic clones were analyzed to identify the causative site of RFLP, or the
EcoRI site that exists in IR24 (indica rice) but not in Asominori (japonica rice), thereby converting
R1877 to a PCR marker.
[0139] Specifically, the four isolated clones were subjected to the following analyses. First, T3 and
T7 primers were used to determine the base sequences at both ends of the insert in each clone. Then,
primers extending outwardly from both ends of the marker probe were designed. They were combined
with T3 and T7 primers to give a combination of four primers in total, and employed in PCR with each
clone used as the template.
[0140] In a separate step, each clone was digested with NotI and EcoRI, and electrophoresed to
estimate the insert size and the length of each EcoRI fragment.
[0141] These analyses revealed the relative positions of the individual clones. In RFLP analysis,
marker probe R1877 was reported to detect an EcoRI fragment of 20 kb in Nipponbare (japonica rice)
and one of 6.4 kb in Kasalath (indica rice) (ftp://ftp.staff.or.jp/pub/geneticmap98/parentsouthern/chrl
0/R1877.JPG). This fact, taken together with the results of analysis described above, gave a putative
position for the EcoRI site that existed in IR24 but not in Asominori. Hence, a primer combination
(SEQ ID NO:1 x SEQ ID NO:2) that was designed to amplify the nearby region was employed to
perform genomic PCR over 30 cycles, each cycle consisting of 94 DEG C x 1 min, 58 DEG C x 1 min
and 72 DEG C x 2 min. The PCR product was treated with EcoRI and subjected to electrophoresis on
0.7% agarose gel.
[0142] As a result, the expected polymorphisms were observed between Asominori and IR24. By
treatment with EcoRI, the PCR product ( SIMILAR 3200 bp) was cleaved to yield 1500 bp and 1700
bp fragments in IR24 but not in Asominori. Mapping of the marker was made with an RIL
(recombinant inbred line) of Asominori-IR24 with the results that the PCR marker was located in the
same region as that of RFLP marker locus R1877, thereby confirming the conversion of RFLP marker
R1877 to a PCR marker, which was named R1877 EcoRI in the present invention.
(5) Conversion of G4003 to PCR marker
[0143] The isolated genomic clones were analyzed to identify the causative site of RFLP, or the
HindIII site that existed in Asominori but not in IR24, thereby converting G4003 to a PCR marker.
[0144] By performing analyses similar to those employed for R1877, the relative positions of the
three isolated clones were revealed. In RFLP analysis, marker probe G4003 was reported to detect a
HindIII fragment of 3 kb in Nipponbare (japonica rice) and one of 10 kb in Kasalath (indica rice)
(ftp://ftp.staff.or.jp/pub/geneticmap98/parentsouthern/chrl 0/R1877.JPG). This report, taken together
with the analyses described above, led to a temporary conclusion that the HindIII site that existed in
Asominori but not in IR24 would be at either one of two candidate sites. Hence, a primer combination
(SEQ ID NOS: 3 and 4) that was designed to amplify the area in the neighborhood of each HindIII site
was employed to perform genomic PCR over 35 cycles, each cycle consisting of 94 DEG C x 30 sec,
58 DEG C x 30 sec and 72 DEG C x 30 sec. The PCR product was treated with HindIII and subjected
to electrophoresis on 2% agarose gel. As a result, the HindIII site within the marker probe was found to
86/503
have polymorphisms. By treatment with HindIII, the PCR product (362 bp) was cleaved to yield a 95
bp fragment and a 267 bp fragment in Asominori but not in IR24. Mapping of the site demonstrated the
conversion of RFLP marker G4003 to a PCR marker, which was named G4003 HindIII (SEQ ID
NO:19) in the present invention.
(6) Conversion of C1361 to PCR marker
[0145] Primers were designed on the basis of the base sequence information of the isolated genomic
clones. PCR was performed with the total DNAs of Asominori and IR24 being used as a template and
the PCR product was recovered by known methods after electrophoresis. Using the recovered DNA as
a template, the inventors analyzed the base sequence of each of the rice varieties with ABI Model 310
in search of mutations that would cause polymorphisms.
[0146] By performing analyses similar to those employed for R1877, approximate relative positions
of the three isolated clones could be established. As it turned out, however, regions around the C1361
marker would be difficult to amplify by PCR or determine their base sequences, and hence, it would
not be easy to identify the causative site of RFLP. Hence, the inventors took notice of the region
capable of yielding a comparatively long PCR product (2.7 kb) and made an attempt to create a dCAPS
marker.
[0147] Specifically, upon comparing the base sequences of the genomic PCR products of said region
using Asominori and Koshihikari (both japonica rice) and Kasalath and IR24 (both indica rice), the
inventors found six sites of polymorphism between japonica and indica. One of these six sites was used
to create a dCAPS marker. To this end, with SEQ ID NO:5 and SEQ ID NO:6 used as primers, PCR
was performed over 35 cycles, each cycle consisting of 94 DEG C x 30 sec, 58 DEG C x 30 sec and 72
DEG C x 30 sec. The PCR product was treated with MwoI and analyzed by electrophoresis on 3%
MetaPhor TM agarose gel. In Asominori, cleavage occurred at two sites to give three observable bands
of about 25 bp, 50 bp and 79 bp, but in IR24 cleavage occurred at one site to give two observable bands
of about 50 bp and 107 bp. Mapping demonstrated the conversion of RFLP marker C1361 to a PCR
marker, which was named C1361 MwoI (SEQ ID NO:20) in the present invention.
(7) Conversion of G2155 to PCR marker
[0148] Primers specific to both ends of the marker probe were designed and PCR was performed with
the total DNA of Asominori, Koshihikari, IR24 or IL216 (a line produced by introducing Rf-1 gene
into Koshihikari by back crossing; its genotype was Rf-1/Rf-1) being used as a template. Purification
of the PCR product and searching for a mutation that would be useful for providing restriction
fragment polymorphisms were performed by the methods already described above.
[0149] Specifically, as a result of comparing the base sequences of corresponding regions of the
varieties under test, mutations were found at three sites between the variety/line (IR24 and IL216)
having Rf-1 gene and the variety (Asominori and Koshihikari) not having Rf-1 gene. One of the three
sites was utilized to create a dCAPS marker. To this end, SEQ ID NO:7 and SEQ ID NO:8 were used
as primers to perform PCR over 35 cycles, each cycle consisting of 94 DEG C x 30 sec, 58 DEG C x
30 sec and 72 DEG C x 30 sec. The PCR product was treated with MwoI and analyzed by
electrophoresis on 3% MetaPhor TM agarose gel. In Asominori, cleavage occurred at one site to give
two observable bands of about 25 bp and 105 bp, but in IR24, cleavage occurred at two sites to give
three observable bands of about 25 bp, 27 bp and 78 bp. Mapping demonstrated the conversion of
RFLP marker G2155 to a PCR marker, which was named G2155 MwoI (SEQ ID NO:21) in the present
invention.
(8) Conversion of G291 to PCR marker
87/503
[0150] Primers specific to internal sequences of the marker probe were designed and used in various
combinations to perform PCR to find a primer combination that could yield an amplification product of
the expected size. Using the selected primer combination, the inventors performed PCR with the total
DNA of Asominori, Koshihikari, IR24 and IL216 used as a template. Purification of the PCR product
and searching for a mutation that could be utilized in providing restriction fragment polymorphisms
were performed by the methods already described above.
[0151] Specifically, using the primers designed to be specific for the marker probe sequence, the
inventors performed genomic PCR of each variety under test and compared the base sequences of the
products. As a result, mutations were found at four sites between the variety/line having Rf-1 gene
(IR24 and IL216) and the variety (Asominori and Koshihikari) not having Rf-1 gene. One of the four
sites was used to create a dCAPS marker. To this end, SEQ ID NO:9 and SEQ ID NO:10 were used as
primers to perform PCR over 35 cycles, each cycle consisting of 94 DEG C x 30 sec, 58 DEG C x 30
sec and 72 DEG C x 30 sec. The PCR product was treated with MspI and analyzed by electrophoresis
on 3% MetaPhor TM agarose gel. In the varieties/lines having Rf-1 gene, cleavage occurred at two
sites to give three observable bands of about 25 bp, 49 bp and 55 bp, but in the varieties not having Rf1 gene, cleavage occurred at one site to give two observable bands of about 25 bp and 104 bp. Mapping
demonstrated the conversion of RFLP marker G291 to a PCR marker, which was named G291 MspI
(SEQ ID NO:22) in the present invention.
(9) Conversion of R2303 to PCR marker
[0152] Primers specific to internal sequences of the marker probe were designed and PCR was
performed with the total DNA of Asominori (japonica rice) and IR24 and Kasalath (indica rice) used as
a template. Purification of the PCR product and searching for a mutation that could be used for
providing restriction fragment polymorphisms were performed by the methods already described
above.
[0153] As a result of comparing the base sequences of corresponding regions of the varieties under
test, a mutation was found between japonica rice and indica rice. Since the mutation occurred at the
BslI recognition site, the site was directly used to create a CAPS marker. To this end, SEQ ID NO:11
and SEQ ID NO:12 were used as primers and PCR was performed over 30 cycles, each cycle
consisting of 94 DEG C x 1 min, 58 DEG C x 1 min and 72 DEG C x 2 min. The PCR product was
treated with BslI and analyzed by electrophoresis on 2% agarose gel. In japonica rice, cleavage
occurred at one site to give two observable bands of about 238 bp and 1334 bp, but in indica rice,
cleavage occurred at two sites to give three observable bands of about 238 bp, 655 bp and 679 bp.
Mapping demonstrated the conversion of RFLP marker R2303 to a PCR marker, which was named
R2303 BslI (SEQ ID NO:23) in the present invention.
(10) Converting S10019 to PCR marker
[0154] S10019 was converted to a PCR marker in accordance with the method (9) of converting
R2303 to a PCR marker.
[0155] Specifically, as a result of comparing the base sequences of corresponding regions of the
varieties under test, a mutation was found between japonica rice and indica rice. Since the mutation
occurred at the BstUI recognition site, the site was directly used to create a CAPS marker. To this end,
SEQ ID NO:13 and SEQ ID NO:14 were used as primers and PCR was performed over 30 cycles, each
cycle consisting of 94 DEG C x 1 min, 58 DEG C x 1 min and 72 DEG C x 1 min. The PCR product
was treated with BstUI and analyzed by electrophoresis on 2% agarose gel. In japonica rice, cleavage
occurred at one site to give two observable bands of about 130 bp and 462 bp, but in indica rice,
cleavage occurred at two sites to give three observable bands of about 130 bp, 218 bp and 244 bp.
Mapping demonstrated the conversion of RFLP marker S10019 to a PCR marker, which was named
S10019 BstUI (SEQ ID NO:24) in the present invention.
88/503
(11) Conversion of S10602 to PCR marker
[0156] S10602 was converted to a PCR marker in accordance with the method (9) of converting
R2303 to a PCR marker.
[0157] Specifically, as a result of comparing the base sequences of corresponding regions of the
varieties under test, a mutation was found between japonica rice and indica rice. The mutation was
used to create a CAPS marker. To this end, SEQ ID NO:15 and SEQ ID NO:16 were used as primers
and PCR was performed over 33 cycles, each cycle consisting of 94 DEG C x 1 min, 58 DEG C x 1
min and 72 DEG C x 1 min. The PCR product was treated with KpnI and analyzed by electrophoresis
on 2% agarose gel. In japonica rice, cleavage occurred at one site to give two observable bands of
about 117 bp and 607 bp, but in indica rice, no cleavage occurred, giving only an observable band of
724 bp.
Mapping demonstrated the conversion of RFLP marker S10602 to a PCR marker, which was named
S10602 KpnI (SEQ ID NO:25) in the present invention.
(12) Conversion of S12564 to PCR marker
[0158] S12564 was converted to a PCR marker in accordance with the method of converting R2303
to a PCR marker.
[0159] Specifically, as a result of comparing the base sequences of corresponding regions of the
varieties under test, a mutation was found between japonica rice and indica rice. The mutation was
used to create a dCAPS marker. To this end, SEQ ID NO:17 and SEQ ID NO:18 were used as primers
and PCR was performed over 35 cycles, each cycle consisting of 94 DEG C x 30 sec, 58 DEG C x 30
sec and 72 DEG C x 30 sec. The PCR product was treated with Tsp509I and analyzed by
electrophoresis on 3% MetaPhor TM agarose gel. In japonica rice, cleavage occurred at two sites to
give three observable bands of 26 bp, 41 bp and 91 bp, but in indica rice, cleavage occurred at one site
to give two observable bands of 41bp and 117 bp. Mapping demonstrated the conversion of RFLP
marker S12564 to a PCR marker, which was named S12564 Tsp509I (SEQ ID NO:26) in the present
invention.
Reference example 2: Mapping of Rf-1 Gene Locus
[0160] DNA was extracted from 1042 seedlings of the F1 population produced by pollinating MS
Koshihikari with MS-FR Koshihikari, and the DNA extract was used in the analysis. MS Koshihikari
(generation: BC10F1) was created by replacing the cytoplasm of Koshihikari with BT type male
sterility cytoplasm. MS-FR Koshihikari was a line created by introducing Rf-1 gene from IR8 (supplied
from National Institute of Agrobiological Sciences) into MS Koshihikari (the locus of Rf-1 gene being
heterozygous).
[0161] First, each individual was investigated for the genotype at two marker loci R1877 EcoRI and
G2155 MwoI described in Reference example 1 that would presumably be located on opposite sides of
the locus of Rf-1 gene. Japonica type homozygotes with respect to either locus R1877 EcRI or G2155
MwoI were regarded as recombinants between these two marker loci. Then, each of such recombinants
was investigated for the genotypes of G291 MspI, R2303 BslI, S12564 Tsp 509I, C1361 MwoI,
S10019 BstUI, G4003 HindIII and S10602 KpnI loci, and the positions of recombination were
identified.
[0162] The genotype investigation with respect to R1877 EcoRI and G2155 MwoI loci revealed that
46 individuals were recombinants around the locus of Rf-1 gene. Genotypes of the marker loci around
the locus of Rf-1 gene were investigated and the results are shown in Table 3.
EMI80.1
89/503
[0163] As shown in Table 3, recombinant 8 homozygous for japonica at the S12564 Tsp509I marker
locus and recombinants 9 and 10 homozygous for japonica at the C1361 Mwo marker locus were
obtained. As all of these recombinants restored fertility, the former was regarded as a recombinant
between the Rf-1 and S12564 Tsp509I loci while the latter were regarded as recombinants between the
Rf-1 and C1361 MwoI loci, showing that the Rf-1 gene is located between the S12564 Tsp509I and
C1361 MwoI loci. Based on the report that only pollens carrying the Rf-1 gene have fertility in
individuals having the BT type male sterile cytoplasm in the cross above (C.Shinjyo,
JAPAN.J.GENETICS Vol.44, No.3:149-156(1969)), the Rf-1 gene locus could be located on a detailed
linkage map (Fig. 4).
Example 1: Acquisition of recombinant individuals proximal to the Rf-1 locus
(Materials and Methods)
[0164] DNA was extracted from each of 4103 individuals of BC10F1 population produced by
pollinating MS Koshihikari (generation: BC10F1) with MS-FR Koshihikari (generation: BC9F1,
heterozygous at the Rf-1 locus), and genotyped at the S12564 Tsp509I and C1361 MwoI loci in the
same manner as described in Reference example 2 above. Individuals having a genotype homozygous
for Koshihikari at the S12564 Tsp509I locus were regarded as those generated by recombination
between the Rf-1 and S12564 Tsp509I loci, while individuals having a genotype homozygous for
Koshihikari at the C1361 MwoI locus were regarded as those generated by recombination between the
Rf-1 and C1361 MwoI loci.
(Results and Discussion)
[0165] A survey of 4103 individuals revealed one recombinant individual between the Rf-1 and
S12564 Tsp509I loci and 6 recombinant individuals between the Rf-1 and C1361 MwoI loci. The
previous survey of 1042 individuals obtained by crossing in Reference example 2 above had already
revealed one recombinant individual between the Rf-1 and S12564 Tsp509I loci and 2 recombinant
individuals between the Rf-1 and C1361 MwoI loci as shown in Table 3.
[0166] Thus, a total of 2 recombinant individuals between the Rf-1 and S12564 Tsp509I loci and 8
recombinant individuals between the Rf-1 and C1361 MwoI loci were able to be oabtained from 5145
individuals. These 10 individuals were tested by high-precision segregation analysis in the examples
below.
Example 2 chromosomal walking
(1) First chromosomal walking
(Materials and Methods)
[0167] A genomic library was constructed from the genomic DNA of Asominori japonica (not
carrying Rf-1) using Lambda DASH II vector as described in Reference example 1 and tested by
chromosomal walking.
90/503
[0168] PCR was routinely performed using total DNA of Asominori as a template in combination
with the following primer pair:
EMI82.1
and
EMI82.2
designed for a partial base sequence (Accession No. D47284) of RFLP probe S12564. The resulting
amplification products of about 1200 bp were electrophoresed on an agarose gel and then purified by
QIAEXII (QIAGEN). The purified DNA was labeled with a rediprime DNA labelling system
(Amersham Pharmacia) to give a library screening probe (probe A, Fig. 1).
[0169] The library was routinely screened after plaques were blotted onto Hybond-N>;+; (Amersham
Pharmacia). Single plaques were separated, after which phage DNA was purified by the plate lysate
method using Lambda Midi kit (QIAGEN).
(Results and Discussion)
[0170] The results of terminal base sequence analysis and restriction enzyme fragment length
analysis showed that two (WSA1 and WSA3) of 4 clones obtained by screening were in a relative
position as shown in Fig. 1. The Asominori genomic base sequences corresponding to WSA1 and
WSA3 were determined by primer walking (DNA Sequencer 377, ABI).
(2) Second chromosomal walking
(Materials and Methods)
[0171] In addition to the Asominori genomic library described above, an IR24 genomic library was
similarly constructed from the genomic DNA of an indica variety IR24 (carrying Rf-1) and tested by
chromosomal walking.
[0172] PCR was routinely performed using DNA of WSA3 as a template in combination with the
following primer pair:
EMI83.1
and
EMI83.2
designed for the Asominori genomic base sequence determined in (1). The resulting amplification
products of 524 bp were purified and labeled by the method described above to give a library screening
probe (probe E, Fig. 1).
[0173]
above.
Library screening and phage DNA purification were performed by the method described
(Results and Discussion)
[0174] The results of terminal base sequence analysis and restriction enzyme fragment length
analysis showed that one (WSE8) of 15 clones obtained by screening of the Asominori genomic library
was in a relative position as shown in Fig. 1. The Asominori genomic base sequence corresponding to
WSE8 was determined by primer walking.
[0175] The results of terminal base sequence analysis and restriction enzyme fragment length
analysis showed that two (XSE1 and XSE7) of 7 clones obtained by screening of the IR24 genomic
91/503
library were in a relative position as shown in Fig. 1. The IR24 genomic base sequences corresponding
to XSE1 and XSE7 were determined by primer walking.
(3) Third chromosomal walking
(Materials and Methods)
[0176] The Asominori genomic library and IR24 genomic library described above were tested by
chromosomal walking.
[0177] PCR was routinely performed using DNA of WSE8 as a template in combination with the
following primer pair:
EMI84.1
and
EMI84.2
designed for the Asominori genomic base sequence determined in (2). The resulting amplification
products of 1159 bp were purified and labeled by the method described above to give a library
screening probe (probe F, Fig. 1).
[0178]
above.
Library screening and phage DNA purification were performed by the method described
(Results and Discussion)
[0179] The results of terminal base sequence analysis and restriction enzyme fragment length
analysis showed that two (WSF5 and WSF7) of 8 clones obtained by screening of the Asominori
genomic library were in a relative position as shown in Fig. 1. The Asominori genomic base sequences
corresponding to WSF5 and WSF7 were determined by primer walking.
[0180] The results of terminal base sequence analysis and restriction enzyme fragment length
analysis showed that two (XSF4 and XSF20) of 13 clones obtained by screening of the IR24 genomic
library were in a relative position as shown in Fig. 1. The IR24 genomic base sequences corresponding
to XSF4 and XSF20 were determined by primer walking.
(4) Fourth chromosomal walking
(Materials and Methods)
[0181] The Asominori genomic library and IR24 genomic library described above were tested by
chromosomal walking.
[0182] PCR was routinely performed using DNA of WSF7 as a template in combination with the
following primer pair:
EMI85.1
and
EMI85.2
designed for the Asominori genomic base sequence determined in (3). The resulting amplification
products of 456 bp were purified and labeled by the method described above to give a library screening
probe (probe G, Fig. 1).
92/503
[0183]
above.
Library screening and phage DNA purification were performed by the method described
(Results and Discussion)
[0184] The results of terminal base sequence analysis and restriction enzyme fragment length
analysis showed that two (WSG2 and WSG6) of 6 clones obtained by screening of the Asominori
genomic library were in a relative position as shown in Fig. 1. The Asominori genomic base sequences
corresponding to WSG2 and WSG6 were determined by primer walking.
[0185] The results of terminal base sequence analysis and restriction enzyme fragment length
analysis showed that three (XSG8, XSG16 and XSG22) of 14 clones obtained by screening of the IR24
genomic library were in a relative position as shown in Fig. 1. The IR24 genomic base sequences
corresponding to XSG8, XSG16 and XSG22 were determined by primer walking.
(5) Fifth chromosomal walking
(Materials and Methods)
[0186] The IR24 genomic library described above was tested by chromosomal walking.
[0187] We perused the public website of TIGR (The Institute for Genomic Research) and found that
a BAC (Bacterial Artificial Chromosome) clone (Accession No. AC068923) containing RFLP marker
S12564 had been deposited with a public database (GenBank). This BAC clone contains the genomic
DNA of Nipponbare japonica and it was shown from base sequence comparison to completely include
the contig regions of Asominori and IR24 prepared in (1)-(4) (Fig. 2).
[0188] Thus, PCR was routinely performed using total DNA of IR24 as a template in combination
with the following primer pair:
EMI86.1
and
EMI86.2
designed to amplify a part of this BAC clone. The resulting amplification products of about 600 bp
were purified and labeled by the method described above to give a library screening probe (probe H,
Fig. 1).
[0189]
above.
Library screening and phage DNA purification were performed by the method described
(Results and Discussion)
[0190] The results of terminal base sequence analysis and restriction enzyme fragment length
analysis showed that one (XSH18) of 15 clones obtained by screening of the IR24 genomic library was
in a relative position as shown in Fig. 1. The IR24 genomic base sequence corresponding to XSH18
was determined by primer walking.
Example 3: High precision segregation analysis
93/503
(1) Development of PCR marker P4497 MboI
[0191] Comparison between the genomic base sequence corresponding to the IR24 contig (SEQ ID
NO: 27) and the genomic base sequence corresponding to the Asominori contig (SEQ ID NO: 28)
determined in Example 2 revealed that the 1239th base,of SEQ ID NO: 27 is A while the 12631st base
of SEQ ID NO: 28 corresponding to said position is G.
[0192] For detecting this change, fragments of about 730 bp are first amplified by PCR from a region
surrounding said position using the following primer pair: P4497 MboI F:
EMI87.1
(corresponding to bases 853-876 of SEQ ID NO: 27)
(corresponding to bases 12247-12270 of SEQ ID NO: 28) and
P4497 MboI R:
EMI88.1
(corresponding to bases 1583-1560 of SEQ ID NO: 27)
(corresponding to bases 12975-12952 of SEQ ID NO: 28).
The amplification products can be visualized by electrophoresis on an agarose gel after treatment with
MboI. Thus, the change can be detected as a difference in mobility in the agarose gel due to the
difference in the length of DNA after MboI treatment because the amplification products from
Asominori DNA having an MboI recognition sequence (GATC) are cleaved with MboI while the
amplification products from IR24 DNA are not cleaved with MboI for the lack of the MboI recognition
sequence.
(2) Development of PCR marker P9493 BslI
[0193] Comparison between the genomic base sequence corresponding to the IR24 contig (SEQ ID
NO: 27) and the genomic base sequence corresponding to the Asominori contig (SEQ ID NO: 28)
determined in Example 2 revealed that the 6227th base of SEQ ID NO: 27 is A while the 17627th base
of SEQ ID NO: 28 corresponding to said position is C.
*[0194] For detecting this change, fragments of 126 bp are first amplified by PCR from a region
surrounding said position using the following primer pair:
P9493 BslI F:
EMI88.2
(corresponding to bases 6129-6152 of SEQ ID NO: 27)
(corresponding to bases 17529-17552 of SEQ ID NO: 28) and
P9493 BslI R:
EMI89.1
(corresponding to bases 6254-6231 of SEQ ID NO: 27)
(corresponding to bases 17654-17631 of SEQ ID NO: 28).
The amplification products can be visualized by electrophoresis on an agarose gel after treatment with
BslI. Thus, the change can be detected as a difference in mobility in the agarose gel due to the
difference in the length of DNA after BslI treatment because the amplification products from
Asominori DNA having a BslI recognition sequence (CCNNNNNNNGG) are cleaved with BslI while
the amplification products from IR24 DNA are not cleaved with BslI for the lack of the BslI
recognition sequence.
[0195] This marker was developed by applying the dCAPS method (Michaels and Amasino 1998,
Neff et al., 1998). Specifically, g is substituted for a at the base 6236 of SEQ ID NO: 27 and the base
17636 of SEQ ID NO: 28 by the use of P9493 BslI R primer described above. Thus, the fragments
from Asominori DNA come to have a sequence of CCtttccttGG at 17626-17636 of SEQ ID NO: 28 so
that they are cleaved with BslI.
94/503
(3) Development of PCR marker P23945 MboI
[0196] Comparison between the genomic base sequence corresponding to the IR24 contig (SEQ ID
NO: 27) and the genomic base sequence corresponding to the Asominori contig (SEQ ID NO: 28)
determined in Example 2 revealed that the 20680th base of SEQ ID NO: 27 is G while the 32079th
base of SEQ ID NO: 28 corresponding to said position is A.
[0197] For detecting this change, fragments of 260 bp are first amplified by PCR from a region
surrounding said position using the following primer pair: P23945 MboI F:
EMI90.1
(corresponding to bases 20519-20544 of SEQ ID NO: 27)
(corresponding to bases 31918-31943 of SEQ ID NO: 28) and
P23945 MboI R:
EMI90.2
(corresponding to bases 20778-20755 of SEQ ID NO: 27)
(corresponding to bases 32177-32154 of SEQ ID NO: 28).
The amplification products can be visualized by electrophoresis on an agarose gel after treatment with
MboI. Thus, the change can be detected as a difference in mobility in the agarose gel due to the
difference in the length of DNA after MboI treatment because the amplification products from IR24
DNA having an MboI recognition sequence (GATC) are cleaved with MboI while the amplification
products from Asominori DNA are not cleaved with MboI for the lack of the MboI recognition
sequence.
(4) Development of PCR marker P41030 TaqI
[0198] Comparison between the genomic base sequence corresponding to the IR24 contig (SEQ ID
NO: 27) and the genomic base sequence corresponding to the Asominori contig (SEQ ID NO: 28)
determined in Example 2 revealed that the 45461st base of SEQ ID NO: 27 is A while the 49164th base
of SEQ ID NO: 28 corresponding to said position is G.
[0199] For detecting this change, fragments of 280 bp are first amplified by PCR from a region
surrounding said position using the following primer pair:
P41030 TaqI F:
EMI91.1
(corresponding to bases 45369-45392 of SEQ ID NO: 27)
(corresponding to bases 49072-49095 of SEQ ID NO: 28) and
P41030 TaqI R:
EMI91.2
(corresponding to bases 45648-45625 of SEQ ID NO: 27)
(corresponding to bases 49351-49328 of SEQ ID NO: 28).
The amplification products can be visualized by electrophoresis on an agarose gel after treatment with
TaqI. Thus, the change can be detected as a difference in mobility in the agarose gel due to the
difference in the length of DNA after TaqI treatment because the amplification products from
Asominori DNA having a TaqI recognition sequence (TCGA) are cleaved with TaqI while the
amplification products from IR24 DNA are not cleaved with TaqI for the lack of the TaqI recognition
sequence.
(5) Development of PCR marker P45177 BstUI
[0200] Comparison between the genomic base sequence corresponding to the IR24 contig (SEQ ID
NO: 27) and the genomic base sequence corresponding to the Asominori contig (SEQ ID NO: 28)
determined in Example 2 revealed that the 49609th base of SEQ ID NO: 27 is A while the 53311st base
of SEQ ID NO: 28 corresponding to said position is G.
95/503
[0201] For detecting this change, fragments of 812 bp are first amplified by PCR from a region
surrounding said position using the following primer pair:
P45177 BstUI F:
EMI92.1
(corresponding to bases 49355-49378 of SEQ ID NO: 27)
(corresponding to bases 53057-53080 of SEQ ID NO: 28) and
P45177 BstUI R:
EMI92.2
(corresponding to bases 50166-50143 of SEQ ID NO: 27)
(corresponding to bases 53868-53845 of SEQ ID NO: 28).
The amplification products can be visualized by electrophoresis on an agarose gel after treatment with
BstUI. Thus, the change can be detected as a difference in mobility in the agarose gel due to the
difference in the length of DNA after BstUI treatment because the amplification products from IR24
DNA having a BstUI recognition sequence (CGCG) at two positions are cleaved into 3 fragments with
BstUI while the amplification products from Asominori DNA having the BstUI recognition sequence at
three positions are cleaved with BstUI into four fragments.
(6) Development of PCR marker B60304 MspI
[0202] Comparison between the genomic base sequence corresponding to the IR24 contig (SEQ ID
NO: 27) determined in Example 2 and the base sequence of the BAC clone described above (Accession
No. AC068923) revealed that the 56368th base of SEQ ID NO: 27 is T while the base of AC068923
corresponding to said position is C.
[0203] For detecting this change, fragments of about 330 bp are first amplified by PCR from a region
surrounding said position using the following primer pair:
B60304 MspI F:
EMI93.1
(corresponding to bases 56149-56172 of SEQ ID NO: 27) and
B60304 MspI R:
EMI93.2
(corresponding to bases 56479-56455 of SEQ ID NO: 27).
The amplification products can be visualized by electrophoresis on an agarose gel after treatment with
MspI. Thus, the change can be detected as a difference in mobility in the agarose gel due to the
difference in the length of DNA after MspI treatment because the amplification products from
Nipponbare DNA having an MspI recognition sequence (CCGG) are cleaved with MspI while the
amplification products from IR24 DNA are not cleaved with MspI for the lack of the MspI recognition
sequence.
[0204] This marker was developed by applying the dCAPS method. Specifically, t is substituted for g
at base 56463 of SEQ ID NO: 27 by the use of B60304 MspI R primer. As a result, the MspI
recognition sequence of bases 56460-56463 of SEQ ID NO: 27 changes from CCGG into ccgt so that
the fragments from SEQ ID NO: 27 become unable to be cleaved with MspI. Thus, the fragments from
IR24 have no MspI recognition sequence, while DNA from Nipponbare has the MspI recognition
sequence at one position in a region corresponding to bases 56367-56370 of SEQ ID NO: 27.
(7) Development of PCR marker B59066 BsaJI
[0205] Comparison between the genomic base sequence corresponding to the IR24 contig (SEQ ID
NO: 27) determined in Example 2 and the base sequence of the BAG clone described above (Accession
No. AC068923) revealed that the 57629th base of SEQ ID NO: 27 is C while the base of AC068923
corresponding to said position is CC.
[0206] For detecting this change, fragments of about 420 bp are first amplified by PCR from a region
surrounding said position using the following primer pair:
96/503
B59066 BsaJI F:
EMI94.1
(corresponding to bases 57563-57586 of SEQ ID NO: 27) and
B59066 BsaJI R:
EMI94.2
(corresponding to bases 57983-57960 of SEQ ID NO: 27).
The amplification products can be visualized by electrophoresis on an agarose gel after treatment with
BsaJI. Thus, the change can be detected as a difference in mobility in the agarose gel due to the
difference in the length of DNA after BsaJI treatment because the amplification products from
Nipponbare DNA having a BsaJI recognition sequence (CCNNGG) are cleaved with BsaJI while the
amplification products from IR24 DNA are not cleaved with BsaJI for the lack of the BsaJI recognition
sequence.
(8) Development of PCR marker B56691 XbaI
[0207] Comparison between the genomic base sequence corresponding to the IR24 contig (SEQ ID
NO: 27) determined in Example 2 and the base sequence of the BAC clone described above (Accession
No. AC068923) revealed that the 66267th base of SEQ ID NO: 27 is G while the base of AC068923
corresponding to said position is C.
[0208] For detecting this change, fragments of about 670 bp are first amplified by PCR from a region
surrounding said position using the following primer pair:
B56691 XbaI F:
EMI95.1
(corresponding to bases 66129-66152 of SEQ ID NO: 27) and
B56691 XbaI R:
EMI95.2
(corresponding to bases 66799-66776 of SEQ ID NO: 27).
The amplification products can be visualized by electrophoresis on an agarose gel after treatment with
XbaI. Thus, the change can be detected as a difference in mobility in the agarose gel due to the
difference in the length of DNA after XbaI treatment because the amplification products from
Nipponbare DNA having an XbaI recognition sequence (TCTAGA) are cleaved with XbaI while the
amplification products from IR24 DNA are not cleaved with XbaI for the lack of the XbaI recognition
sequence.
(9) Development of PCR marker B53627 BstZ17I
[0209] Comparison between the genomic base sequence corresponding to the IR24 contig (SEQ ID
NO: 27) determined in Example 2 and the base sequence of the BAC clone described above (Accession
No. AC068923) revealed that the 69331st base of SEQ ID NO: 27 is T while the base of AC068923
corresponding to said position is C.
[0210] For detecting this change, fragments of about 620 bp are first amplified by PCR from a region
surrounding said position using the following primer pair:
B53627 BstZ17I F:
EMI96.1
(corresponding to bases 68965-68988 of SEQ ID NO: 27) and
B53627 BstZ17I R:
EMI96.2
(corresponding to bases 69582-69559 of SEQ ID NO: 27).
The amplification products can be visualized by electrophoresis on an agarose gel after treatment with
BstZ17I. Thus, the change can be detected as a difference in mobility in the agarose gel due to the
difference in the length of DNA after BstZ17I treatment because the amplification products from IR24
DNA having a BstZ17I recognition sequence (GTATAC) are cleaved with BstZ17I while the
97/503
amplification products from Nipponbare DNA are not cleaved with BstZ17I for the lack of the BstZ17I
recognition sequence.
(10) Development of PCR marker B40936 MseI
[0211] Development of all the following PCR markers (10)-(12) relates to a study of the base
sequences corresponding to further downstream regions (3') of base 76363 at the 3'end of SEQ ID NO:
27.
[0212] The following primer pair was designed for the base sequence of the BAC clone described
above (Accession No. AC068923):
EMI97.1
and
EMI97.2
PCR was routinely performed using this primer pair in combination with total DNAs of MS-FR
Koshihikari (genotype of the Rf-1 locus: Rf-1 Rf-1) and Koshihikari as templates. The resulting
amplification products of about 1300 bp were electrophoresed on an agarose gel and then purified by
QIAEXII (QIAGEN). Analysis of the base sequence of the purified DNA by a DNA sequencer 377
(ABI) showed several polymorphisms.
[0213] One of them can be detected by PCR amplification of a region surrounding said position using
the following primer pair:
B40936 MseI F:
EMI97.3
and
B40936 MseI R:
EMI97.4
The amplification products can be visualized by electrophoresis on an agarose gel after treatment with
MseI. Thus, the change can be detected as a difference in mobility in the agarose gel due to the
difference in the length of DNA after MseI treatment because the amplification products from MS-FR
Koshihikari (Rf-1 Rf-1) DNA having an MseI recognition sequence (TTAA) are cleaved with MseI
while the amplification products from Koshihikari DNA are not cleaved with MseI for the lack of the
MseI recognition sequence.
[0214] This marker was developed by applying the dCAPS method.
(11) Development of PCR marker B19839 MwoI
[0215] The following primer pair was designed for the base sequence of the BAC clone described
above (Accession No. AC068923):
EMI98.1
and
EMI98.2
PCR was routinely performed using this primer pair in combination with total DNAs of MS-FR
Koshihikari (genotype of the Rf-1 locus: Rf-1 Rf-1) and Koshihikari as templates. The resulting
amplification products of about 1200 bp were electrophoresed on an agarose gel and then purified by
QIAEXII (QIAGEN). Analysis of the base sequence of the purified DNA by a DNA sequencer 377
(ABI) showed several polymorphisms.
[0216] One of them can be detected by PCR amplification of a region surrounding said position using
the following primer pair:
B19839 MwoI F:
EMI99.1
and
B19839 MwoI R:
98/503
EMI99.2
The amplification products can be visualized by electrophoresis on an agarose gel after treatment with
MwoI. Thus, the change can be detected as a difference in mobility in the agarose gel due to the
difference in the length of DNA after MwoI treatment because the amplification products from
Koshihikari DNA having an MwoI recognition sequence (GCNNNNNNNGC) are cleaved with MwoI
while the amplification products from MS-FR Koshihikari (Rf-1 Rf-1) DNA are not cleaved with
MwoI for the lack of the MwoI recognition sequence.
[0217] This marker was developed by applying the dCAPS method.
(12) Development of PCR marker B2387 BfaI
[0218] The following primer pair was designed for the base sequence of the BAC clone described
above (Accession No. AC068923):
EMI99.3
and
EMI99.4
PCR was routinely performed using this primer pair in combination with total DNAs of MS-FR
Koshihikari (genotype of the Rf-1 locus: Rf-1 Rf-1) and Koshihikari as templates. The resulting
amplification products of about 1300 bp were electrophoresed on an agarose gel and then purified by
QIAEXII (QIAGEN). Analysis of the base sequence of the purified DNA by a DNA sequencer 377
(ABI) showed several polymorphisms.
[0219] One of them can be detected by PCR amplification of a region surrounding said position using
the following primer pair:
B2387 BfaI F:
EMI100.1
and
B2387 BfaI R:
EMI100.2
The amplification products can be visualized by electrophoresis on an agarose gel after treatment with
BfaI. Thus, the change can be detected as a difference in mobility in the agarose gel due to the
difference in the length of DNA after BfaI treatment because the amplification products from
Koshihikari DNA having an BfaI recognition sequence (CTAG) are cleaved with BfaI while the
amplification products from MS-FR Koshihikari (Rf-1 Rf-1) DNA are not cleaved with BfaI for the
lack of the BfaI recognition sequence.
(13) Segregation analysis
[0220] Two recombinants between the Rf-1 and S12564 Tsp509I loci (RS1 and RS2) and 8
recombinants between the Rf-1 and C1361 MwoI loci (RC1 to RC8) obtained in Example 1 were
genotyped at the 12 DNA marker loci developed in (1) to (12) above. The results are shown in Table 4
along with the genotypes of each recombinant at the S12564 Tsp509I and C1361 MwoI loci.
>;tb;>;TABLE; Id=Table 4. Columns=11
>;tb;Title: Genotypes of recombinants proximal to the Rf-1 locus at various marker loci
>;tb;
>;tb;Head Col 1: Locus
>;tb;Head Col 2: RS1
>;tb;Head Col 3: RS2
>;tb;Head Col 4: RC1
>;tb;Head Col 5: RC2
>;tb;Head Col 6: RC3
>;tb;Head Col 7: RC4
>;tb;Head Col 8: RC5
>;tb;Head Col 9: RC6
99/503
>;tb;Head Col 10: RC7
>;tb;Head Col 11: RC8
>;tb;>;SEP;S12564
Tsp509I>;SEP;J>;SEP;J>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H
>;tb;>;SEP;P4497
MboI>;SEP;J>;SEP;J>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H
>;tb;>;SEP;P9493
BsII>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H
>;tb;>;SEP;P23945
MboI>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H
>;tb;>;SEP;P41030
TaqI>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H
>;tb;>;SEP;P45177
BstUI>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H
>;tb;>;SEP;B60304
MspI>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H
>;tb;>;SEP;B59066
BsaJI>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H
>;tb;>;SEP;B56691
XbaI>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;J>;SEP;H>;SEP;H
>;tb;>;SEP;B53627
BstZ17I>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;J>;SEP;H>;SEP;H
>;tb;>;SEP;B40936
MseI>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;J>;SEP;H>;SEP;H
>;tb;>;SEP;B19839
MwoI>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;J>;SEP;H>;SEP;J>;SEP;H>;SEP;H
>;tb;>;SEP;B2387
BfaI>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;H>;SEP;J>;SEP;R>;SEP;J>;SEP;H>;SEP;J
>;tb;>;SEP;C1361
MwoI>;SEP;H>;SEP;H>;SEP;J>;SEP;J>;SEP;J>;SEP;J>;SEP;J>;SEP;J>;SEP;J>;SEP;J
J: Homozygous for Koshihikari
H: Heterozygous for Koshihikari /MS-FR Koshihikari
>;tb;>;/TABLE;
[0221] Table 4 shows that all the recombinants have an indica-derived Rf-1 chromosomal region
between P9493 BslI and 59066 BsaJI. This result showed that recombinant pollens having the
chromosomal organization as shown in Fig. 3 have pollen fertility, i.e. the Rf-1 gene is functional in
these pollens. This means that a sequence determining the presence of the function of the Rf-1 gene is
included in the indica region common to these recombinant pollens, i.e. in a region from the P4497
MboI to B56691 XbaI loci (about 65 kb) as estimated at maximum.
[0222] However, there is a possibility that it is important for the expression of the genetic function of
the Rf-1 gene that the Rf-1 gene is partially of the indica genotype, and that the genetic function may
not be significantly changed whether the remaining regions are of the japonica or indica genotype.
Therefore, it cannot be concluded that the common indica region above (bases 1239-66267 of SEQ ID
NO: 27) completely contains the entire Rf-1 gene. However, it is thought that at least SEQ ID NO: 27
completely contains the entire Rf-1 gene for the following reasons:
1) the size of a gene is normally several kilobases, and rarely exceeds 10 kb;
2) the genomic base sequence of IR24 determined by the present invention (SEQ ID NO: 27)
completely contains the common indica region above;
3) the 5' end of SEQ ID NO: 27 is located 1238 bp upstream of the 5' end of the common indica
region above and forms a part of another gene (S12564); and
4) the 3' end of SEQ ID NO: 27 is located 10096 bp downstream of the 3' end of the common indica
region above.
100/503
Example 4: Complementation assay for a 9.7 kb fragment from XSE1
(Materials and Methods)
[0223] The lambda phage clone XSE1 (Figs. 1 and 5) was completely digested with NotI and
electrophoresed on an agarose gel. The separated 9.7 kb fragment (including bases 1-9657 of SEQ ID
NO: 27) was purified by QIAEXII (QIAGEN).
[0224] On the other hand, an intermediate vector pSB200 having a hygromycin-resistant gene
cassette was prepared on the basis of pSB11 (Komari et al., supra.). Specifically, a nopaline synthase
terminator (Tnos) was first fused to a ubiquitin promoter and a ubiquitin intron (Pubi-ubiI). A
hygromycin-resistant gene (HYG(R)) was inserted between ubiI and Tnos of the resulting Pubi-ubiITnos complex to give an assembly of Pubi-ubiI-HYG(R)-Tnos. This assembly was fused to a
HindIII/EcoRI fragment of pSB11 to give pKY205. Linker sites for adding restriction enzyme sites
NotI, NspV, EcoRV, KpnI, SacI, EcoRI were inserted into the Hind III site upstream of Pubi of this
pKY205 to give pSB200 having a hygromycin-resistant gene cassette.
[0225] After the plasmid vector pSB200 was completely digested with NotI, DNA was recovered by
ethanol precipitation. The recovered DNA was dissolved in TE solution and then dephosphorylated by
CIAP (TAKARA). The reaction solution was electrophoresed on an agarose gel, and then a vector
fragment was purified from the gel using QIAEXII (QIAGEN).
[0226] The two fragments prepared above, i.e. a 9.7 kb fragment from XSE1 and a vector fragment
were subjected to a ligation reaction using DNA Ligation Kit Ver. 1 (TAKARA). After the reaction,
DNA was recovered by ethanol precipitation. The recovered DNA was dissolved in pure water
(prepared by a Millipore system) and then mixed with E. coli DH5a cells, and the mixture was
electroporated. After electroporation, the solution was cultured with shaking in LB medium (37 DEG
C, 1 hr) and then plated on an LB plate containing spectinomycin and warmed (37 DEG C, 16 hr).
Plasmids were isolated from 24 of the resulting colonies. Their restriction enzyme fragment length
patterns and boundary base sequences were analyzed to select desired E. coli cells transformed with
recombinant plasmids.
[0227] The E. coli cells selected above were used for triparental mating with the Agrobacterium
tumefaciens strain LBA4404/pSB1 (Komari et al., 1996) and the helper E. coli strain HB101/pRK2013
(Ditta et al., 1980) according to the method of Ditta et al. (1980). Plasmids were isolated from 6 of the
colonies formed on an AB plate containing spectinomycin and their restriction enzyme fragment length
patterns were analyzed to select desired Agrobacterium cells.
[0228] The Agrobacterium cells selected above were used to transform MS Koshihikari (having BT
cytoplasm and a nucleus gene substantially identical to Koshihikari) according to the method of Hiei et
al. (1994). Necessary immature seeds of MS Koshihikari for transformation can be prepared by
pollinating MS Koshihikari with Koshihikari.
[0229] Transformed plants were transferred to a greenhouse under long-day conditions after
acclimation. 48 individuals grown to a stage suitable for transplantation were transplanted into 1/5000a
Wagner pots (4 individuals/pot), and transferred into a greenhouse under short-day conditions 3-4
weeks after transplantation. About one month after heading, seed fertility was tested on standing plants.
(Results and Discussion)
[0230] All of the 48 transformed individuals were sterile. This indicates that the 9.7 kb insert
fragment does not contain at least the full-length Rf-1 gene.
101/503
Example 5: Complementation assay for a 14.7 kb fragment from XSE7
(Materials and Methods)
[0231] The lambda phage clone XSE7 (Figs. 1 and 5) was completely digested with EcoRI and then
DNA was recovered by ethanol precipitation. The recovered DNA was dissolved in TE solution and
then blunted by DNA Blunting Kit (TAKARA). The reaction solution was electrophoresed on an
agarose gel to separate a 14.7 kb fragment (including bases 2618-17261 of SEQ ID NO: 27), which
was purified by QIAEXII (QIAGEN).
[0232] On the other hand, the plasmid vector pSB200 was completely digested with SacI and then
DNA was recovered by ethanol precipitation. The recovered DNA was dissolved in TE solution and
then dephosphorylated by CIAP (TAKARA) and DNA was recovered by ethanol precipitation. The
recovered DNA was dissolved in TE solution and then blunted by DNA Blunting Kit (TAKARA). The
reaction solution was electrophoresed on an agarose gel, and then a vector fragment was purified from
the gel using QIAEXII (QIAGEN).
[0233] The two fragments prepared above, i.e. the 14.7 kb fragment from XSE7 and the vector
fragment were subjected to a ligation reaction using DNA Ligation Kit Ver. 1 (TAKARA).
Subsequently, transformed plants were prepared and studied according to the method described in
Example 4.
(Results and Discussion)
[0234] All of the 48 transformed individuals were sterile. This indicates that the 14.7 kb insert
fragment does not contain at least the full-length Rf-1 gene.
Example 6: Complementation assay for a 21.3 kb fragment from XSF4
(Materials and Methods)
[0235] The lambda phage clone XSF4 (Figs. 1 and 5) was partially digested with NotI and
electrophoresed on an agarose gel. The separated 21.3 kb fragment (including bases 12478-33750 of
SEQ ID NO: 27) was purified by QIAEXII (QIAGEN).
[0236] On the other hand, the plasmid vector pSB200 was completely digested with NotI and then
DNA was recovered by ethanol precipitation. The recovered DNA was dissolved in TE solution and
then dephosphorylated by CIAP (TAKARA). The reaction solution was electrophoresed on an agarose
gel, and then a vector fragment was purified from the gel using QIAEXII (QIAGEN).
[0237] The two fragments prepared above, i.e. the 21.3 kb fragment from XSF4 and the vector
fragment were subjected to a ligation reaction using DNA Ligation Kit Ver. 1 (TAKARA).
Subsequently, transformed plants were prepared and studied according to the method described in
Example 4.
(Results and Discussion)
102/503
[0238] All of the 48 transformed individuals were sterile. This indicates that the 21.3 kb insert
fragment does not contain at least the full-length Rf-1 gene.
Example 7: Complementation assay for a 13.2 kb fragment from XSF20
(Materials and Methods)
[0239] The lambda phage clone XSF20 (Figs. 1 and 5) was completely digested with SalI and then
DNA was recovered by ethanol precipitation. The recovered DNA was dissolved in TE solution and
then blunted by DNA Blunting Kit (TAKARA). The reaction solution was electrophoresed on an
agarose gel to separate a 13.2 kb fragment (including bases 26809-40055 of SEQ ID NO: 27), which
was purified by QIAEXII (QIAGEN).
[0240] On the other hand, the plasmid vector pSB200 was completely digested with EcoRV and then
DNA was recovered by ethanol precipitation. The recovered DNA was dissolved in TE solution and
then dephosphorylated by CIAP (TAKARA). The reaction solution was electrophoresed on an agarose
gel, and then a vector fragment was purified from the gel using QIAEXII (QIAGEN).
[0241] The two fragments prepared above, i.e. the 13.2 kb fragment from XSF20 and the vector
fragment were subjected to a ligation reaction using DNA Ligation Kit Ver. 1 (TAKARA).
Subsequently, transformed plants were prepared and studied according to the method described in
Example 4.
(Results and Discussion)
[0242] All of the 44 transformed individuals were sterile. This indicates that the 13.2 kb insert
fragment does not contain at least the full-length Rf-1 gene.
Example 8: Complementation assay for a 16.2 kb fragment from XSF18
(Materials and Methods)
[0243] The lambda phage clone XSF18 is identical to XSF20 at the 5' and 3' ends (bases 20328 and
41921 of SEQ ID NO: 27, respectively), but lacks internal bases 33947-38591. Thus, it comprises
bases 20328-33946 and 38592-41921 of SEQ ID NO: 27. This is because clone XSF18 was initially
isolated but found to contain the above deletion during amplification after isolation, and therefore, the
amplification step was freshly taken to isolate a complete clone designated XSF20.
[0244] The lambda phage clone XSF18 (Fig. 5) was completely digested with NotI and
electrophoresed on an agarose gel. The separated 16.2 kb fragment (including bases 21065-33946 and
38592-41921 of SEQ ID NO: 27) was purified by QIAEXII (QIAGEN).
[0245] On the other hand, the plasmid vector pSB200 was completely digested with NotI and then
DNA was recovered by ethanol precipitation. The recovered DNA was dissolved in TE solution and
then dephosphorylated by CIAP (TAKARA). The reaction solution was electrophoresed on an agarose
gel, and then a vector fragment was purified from the gel using QIAEXII (QIAGEN).
[0246] The two fragments prepared above, i.e. the 16.2 kb fragment from XSF18 and the vector
fragment were subjected to a ligation reaction using DNA Ligation Kit Ver. 1 (TAKARA).
103/503
Subsequently, transformed plants were prepared and studied according to the method described in
Example 4.
(Results and Discussion)
[0247] All of the 48 transformed individuals were sterile (Fig. 6). This indicates that the 16.2 kb
insert fragment does not contain at least the full-length Rf-1 gene.
Example 9: Complementation assay for a 12.6 kb fragment from XSG22
(Materials and Methods)
[0248] The lambda phage clone XSG22 (Figs. 1 and 5) was partially digested with NotI and
electrophoresed on an agarose gel. The separated 12.6 kb fragment (including bases 31684-44109 of
SEQ ID NO: 27) was purified by QIAEXII (QIAGEN).
[0249] On the other hand, the plasmid vector pSB200 was completely digested with NotI and then
DNA was recovered by ethanol precipitation. The recovered DNA was dissolved in TE solution and
then dephosphorylated by CIAP (TAKARA). The reaction solution was electrophoresed on an agarose
gel, and then a vector fragment was purified from the gel using QIAEXII (QIAGEN).
[0250] The two fragments prepared above, i.e. the 12.6 kb fragment from XSG22 and the vector
fragment were subjected to a ligation reaction using DNA Ligation Kit Ver. 1 (TAKARA).
Subsequently, transformed plants were prepared and studied according to the method described in
Example 4.
(Results and Discussion)
[0251] All of the 48 transformed individuals were sterile. This indicates that the 12.6 kb insert
fragment does not contain at least the full-length Rf-1 gene.
Example 10: (1) Complementation assay for a 15.7 kb fragment from XSG16
(Materials and Methods)
[0252] The lambda phage clone XSG16 (Figs. 1 and 5) was partially digested with NotI and
electrophoresed on an agarose gel. The separated 15.7 kb fragment (including bases 38538-54123 of
SEQ ID NO: 27) was purified by QIAEXII (QIAGEN).
[0253] On the other hand, the plasmid vector pSB200 was completely digested with NotI and then
DNA was recovered by ethanol precipitation. The recovered DNA was dissolved in TE solution and
then dephosphorylated by CIAP (TAKARA). The reaction solution was electrophoresed on an agarose
gel, and then a vector fragment was purified from the gel using QIAEXII (QIAGEN).
[0254] The two fragments prepared above, i.e. the 15.7 kb fragment from XSG16 and the vector
fragment were subjected to a ligation reaction using DNA Ligation Kit Ver. 1 (TAKARA).
104/503
Subsequently, transformed plants were prepared and studied according to the method described in
Example 4.
(Results and Discussion)
[0255] Of the 47 transformed individuals, at least 37 individuals clearly restored fertility (Fig. 6).
This indicates that 15586 bases (bases 38538-54123 of SEQ ID NO: 27) derived from rice (IR24) in the
15.7 kb insert fragment include the full-length Rf-1 gene.
(2) Complementation assay for an internal 11.4 kb fragment in XSG16
(Materials and Methods)
[0256] The lambda phage clone XSG16 was completely digested with AlwNI and BsiWI and then
DNA was recovered by ethanol precipitation. The recovered DNA was dissolved in TE solution and
then blunted by DNA Blunting Kit (TAKARA). The reaction solution was electrophoresed on an
agarose gel to separate a 11.4 kb fragment, which was purified by QIAEXII (QIAGEN).
[0257] The plasmid vector pSB11 (Komari et al. Plant Journal, 1996) was completely digested with
SmaI and then DNA was recovered by ethanol precipitation. The recovered DNA was dissolved in TE
solution and then dephosphorylated by CIAP (TAKARA). The reaction solution was electrophoresed
on an agarose gel, and then a vector fragment was purified from the gel using QIAEXII (QIAGEN).
[0258] The two fragments prepared above were subjected to a ligation reaction using DNA Ligation
Kit Ver. 1 (TAKARA). After the reaction, DNA was recovered by ethanol precipitation. The recovered
DNA was dissolved in pure water (prepared by a Millipore system) and then mixed with E. coli DH5a
cells, and the mixture was electroporated. After electroporation, the solution was cultured with shaking
in LB medium (37 DEG C, 1 hr) and then plated on an LB plate containing spectinomycin and warmed
(37 DEG C, 16 hr). Plasmids were isolated from 14 of the resulting colonies, and their restriction
enzyme fragment length patterns and boundary base sequences were analyzed to select desired E. coli
cells.
[0259] The E. coli cells selected above were used for triparental mating with the Agrobacterium
tumefaciens strain LBA4404/pSB4U (Takakura et al., Japanese Patent Application No. 2001-269982
(WO02/019803 A1)) and the helper E. coli strain HB101/pRK2013 (Ditta et al., 1980) according to the
method of Ditta et al. (1980). Plasmids were isolated from 12 of the colonies formed on an AB plate
containing spectinomycin and their restriction enzyme fragment length patterns were analyzed to select
desired Agrobacterium cells.
[0260] The Agrobacterium cells selected above were used to transform MS Koshihikari (having BT
cytoplasm and a nucleus gene substantially identical to Koshihikari) according to the method of Hiei et
al. (1994). Necessary immature seeds of MS Koshihikari for transformation can be prepared by
pollinating MS Koshihikari with Koshihikari.
[0261] Transformed plants were transferred to a greenhouse under long-day conditions after
acclimation. 120 individuals grown to a stage suitable for transplantation were transplanted into
1/5000a Wagner pots (4 individuals/pot), and transferred into a greenhouse under short-day conditions
about one month after transplantation. About one month after heading, one typical ear was sampled
from each plant to evaluate seed fertility (the percentage of fertile paddies to total paddies).
(Results and Discussion)
105/503
[0262] Of the 120 transformed individuals, 59 individuals showed seed fertility of 10% or more,
among which 19 individuals showed seed fertility of 70% or more. This indicates that the 11.4 kb insert
fragment (bases 42357-53743 of SEQ ID NO: 27) contains an essential Rf-1 gene region for expressing
a fertility restoring function.
(3) Complementation assay for an internal 6.8 kb fragment in XSG16
(Materials and Methods)
[0263] The lambda phage clone XSG16 was completely digested with HpaI and AlwNI and
electrophoresed on an agarose gel. The separated 6.8 kb fragment was purified by QIAEXII
(QIAGEN).
[0264] The subsequent procedures including the preparation of the plasmid vector pSB11 were
performed according to the method in (2) above.
(Results and Discussion)
[0265] Of the 120 transformed individuals, 67 individuals showed seed fertility of 10% or more,
among which 26 individuals showed seed fertility of 70% or more. This indicates that the 6.8 kb insert
fragment (bases 42132-48883 of SEQ ID NO: 27) contains an essential Rf-1 gene region for expressing
a fertility restoring function.
Example 11: Complementation assay for a 16.9 kb fragment from XSG8
(Materials and Methods)
[0266] The lambda phage clone XSG8 (Figs. 1 and 5) was completely digested with NotI and
electrophoresed on an agarose gel. The separated 16.9 kb fragment (including bases 46558-63364 of
SEQ ID NO: 27) was purified by QIAEXII (QIAGEN).
[0267] On the other hand, the plasmid vector pSB200 was completely digested with NotI and then
DNA was recovered by ethanol precipitation. The recovered DNA was dissolved in TE solution and
then dephosphorylated by CIAP (TAKARA). The reaction solution was electrophoresed on an agarose
gel, and then a vector fragment was purified from the gel using QIAEXII (QIAGEN).
[0268] The two fragments prepared above, i.e. the 16.9 kb fragment from XSG8 and the vector
fragment were subjected to a ligation reaction using DNA Ligation Kit Ver. 1 (TAKARA).
Subsequently, transformed individuals were prepared and studied according to the method described in
Example 4.
(Results and Discussion)
[0269] All of the 48 transformed individuals were sterile. This indicates that the 16.9 kb insert
fragment does not contain at least the full-length Rf-1 gene.
106/503
Example 12: Complementation assay for a 20.0 kb fragment from XSH18
(Materials and Methods)
[0270] The lambda phage clone XSH18 (Figs. 1 and 5) was completely digested with NotI and
electrophoresed on an agarose gel. The separated 20.0 kb fragment (including bases 56409-76363 of
SEQ ID NO: 27) was purified by QIAEXII (QIAGEN).
[0271] On the other hand, the plasmid vector pSB200 was completely digested with NotI and then
DNA was recovered by ethanol precipitation. The recovered DNA was dissolved in TE solution and
then dephosphorylated by CIAP (TAKARA). The reaction solution was electrophoresed on an agarose
gel, and then a vector fragment was purified from the gel using QIAEXII (QIAGEN).
[0272] The two fragments prepared above, i.e. the 20.0 kb fragment from XSH18 and the vector
fragment were subjected to a ligation reaction using DNA Ligation Kit Ver. 1 (TAKARA).
Subsequently, transformed individuals were prepared and studied according to the method described in
Example 4.
(Results and Discussion)
[0273] All of the 44 transformed individuals were sterile. This indicates that the 20.0 kb insert
fragment does not contain at least the full-length Rf-1 gene.
Example 13: Complementation assay for a 19.7 kb fragment from an overlapping region of XSG8 and
XSH18
(Materials and Methods)
[0274] A plasmid (XSG8SB200F) isolated from desired E. coli cells obtained by ligation in Example
11 was completely digested with SalI and StuI and electrophoresed on an agarose gel. The separated
12.8 kb fragment (including bases 50430-63197 of SEQ ID NO: 27) was purified by QIAEXII
(QIAGEN).
[0275] On the other hand, a plasmid (XSH18SB200R) isolated from desired E. coli cells obtained by
ligation in Example 12 was completely digested with SalI, StuI and XhoI and electrophoresed on an
agarose gel to separate a 6.9 kb fragment (including bases 63194-70116 of SEQ ID NO: 27), which
was purified by QIAEXII (QIAGEN).
[0276] Further, the plasmid vector pSB200 was completely digested with EcoRV and then DNA was
recovered by ethanol precipitation. The recovered DNA was dissolved in TE solution and then
dephosphorylated by CIAP (TAKARA). The reaction solution was electrophoresed on an agarose gel,
and then a vector fragment was purified from the gel using QIAEXII (QIAGEN).
[0277] The three fragments prepared above, i.e. the 12.8 kb fragment from XSG8, the 6.9 kb
fragment from XSH18 and the vector fragment were subjected to a ligation reaction using DNA
Ligation Kit Ver. 1 (TAKARA). The ligation product contains a 19.7 kb fragment from an overlapping
region of XSG8 and XSH18 (including 50430-70116 of SEQ ID NO: 27) (XSX1 in Fig. 5).
Subsequently, transformed individuals were prepared and studied according to the method described in
Example 4.
107/503
(Results and Discussion)
[0278] All of the 40 transformed individuals were sterile. This indicates that the 19.7 kb insert
fragment does not contain at least the full-length Rf-1 gene.
EMI219.1Data supplied from the esp@cenet database - Worldwide
Claims:
Claims of EP1437409
1. A method for restoring rice fertility comprising introducing a nucleic acid into rice, wherein the
nucleic acid has the base sequence of SEQ ID NO.27, or has a base sequence which is identical to at
least 70% of the base sequence of SEQ ID NO.27, and which functions to restore fertility.
2. A method for restoring rice fertility comprising introducing a nucleic acid into rice, wherein the
nucleic acid has the base sequence of bases 38538-54123 of SEQ ID NO.27, or has a base sequence
which is identical to at least 70% of the base sequence of bases 38538-54123 of SEQ ID NO.27, and
which functions to restore fertility.
3. A method for restoring rice fertility comprising introducing a nucleic acid into rice, wherein the
nucleic acid has the base sequence of bases 42132-48883 of SEQ ID NO.27, or has a base sequence
which is identical to at least 70% of the base sequence of bases 42132-48883 of SEQ ID NO.27, and
which functions to restore fertility.
4. The method of any one of Claims 1-3, wherein the nucleic acid having a base sequence which is
identical to at least 70% of the base sequence of SEQ ID NO.27 or of the base sequence of bases
38538-54123 of SEQ ID NO.27, and which meets at least one of the following requirements 1) and 2):
1) a base corresponding to the base 45461 of SEQ ID NO.27 is A; and
2) a base corresponding to the base 49609 of SEQ ID NO.27 is A.
5. The method of any one of Claims 1-4, wherein the nucleic acid comprising the rice restorer gene
locus introduced into rice, does not comprise any constitutional gene other than the rice restorer gene.
6. A method for discerning whether or not a subject rice individual or a seed thereof has the rice
restorer gene (the Rf-1 gene) or not, wherein the method utilizing a fact that a sequence determining
the presence of the function of the Rf-1 gene positions between the polymorphism detection marker
loci P4497 MboI and B56691 Xba I on rice chromosome 10.
7. The method of Claim 6 wherein the Rf-1 gene exists in a nucleic acid having the base sequence of
SEQ ID NO.27, or a nucleic acid having a base sequence which is identical to at least 70% of the base
sequence of SEQ ID NO.27.
8. The method of Claim 6 wherein the Rf-1 gene exists in a nucleic acid having the base sequence of
bases 38538-54123 of SEQ ID NO.27, or a nucleic acid having a base sequence which is identical to at
least 70% of the base sequence of bases 38538-54123 of SEQ ID NO.27.
9. The method of claim 6 wherein the Rf-1 gene exists in a nucleic acid having the base sequence of
bases 42132-48883 of SEQ ID NO.27, or a nucleic acid having a base sequence which is identical to at
least 70% of the base sequence of bases 42132-48883 of SEQ ID NO.27.
10. The method of any one of claims 7-9 wherein the subject rice individual or the seed thereof is
determined to have the Rf-1 gene, in the case that the nucleic acid having a base sequence which is
identical to at least 70% of the base sequence of SEQ ID NO.27 or of the base sequence of bases
38538-54123 of SEQ ID NO.27, meets at least one of the following requirements 1) and 2):
1) a base corresponding to the base 45461 of SEQ ID NO.27 is A; and
108/503
2) a base corresponding to the base 49609 of SEQ ID NO.27 is A.
11. The method of any one of Claims 7-10, wherein the method comprises:
i) preparing a pair of primers based on a base sequence of adjacent regions including any one of the
following base;
1) a base corresponding to the base 45461; or
2) a base corresponding to the base 49609; to amplify both the base of the above and adjacent regions
thereto;
ii) performing nucleic acid amplification reaction(s) using the genome DNA of the subject rice
individual or the seed thereof as a template; and
iii) discerning the presence of the Rf-1 in the subject rice individual or the seed thereof based on
polymorphism found in said nucleic acid amplification product.
12. The method of Claim 11 wherein the subject rice individual or the seed thereof is determined to
have the Rf-1 gene, in the case that the step iii) meets least one of the following requirements 1) and 2):
1) a region including a base corresponding to the base 45461 of SEQ ID NO.27 does not have any
TaqI recognition sequence; and
2) a region including a base corresponding to the base 49609 of SEQ ID NO.27 does not have any
BstU recognition sequence.
13. The method of Claim 11 or 12 using a pair of primers having base sequences selected from the
group consisting of SEQ ID NO:45 and 46, and SEQ ID NO:47 and 48.
14. A method for inhibiting the function of the Rf-1 gene to restore fertility by introducing an antisense
having at least 100 continuous bases in length, and having a base sequence complementary to a nucleic
acid having the base sequence of SEQ ID NO.27, or to a nucleic acid having a base sequence which is
identical to at least 70% of the base sequence of SEQ ID NO.27, and which functions to restore
fertility.
15. A method for inhibiting the function of the Rf-1 gene to restore fertility by introducing an antisense
having at least 100 continuous bases in length, and being selected from base sequences complementary
to a nucleic acid having the base sequence of bases 38538-54123 of SEQ ID NO.27, or to a nucleic
acid having a base sequence which is identical to at least 70% of the base sequence of bases 3853854123 of SEQ ID NO.27, and which functions to restore fertility.
16. A nucleic acid having the base sequence of SEQ ID NO.27, or a nucleic acid having a base
sequence which is identical to at least 70% of the base sequence of SEQ ID NO.27, and which
functions to restore fertility.
17. A nucleic acid having the base sequence of bases 38538-54123 of SEQ ID NO.27, or a nucleic acid
having a base sequence which is identical to at least 70% of the base sequence of bases 38538-54123 of
SEQ ID NO.27, and which functions to restore fertility.
18. A nucleic acid having the base sequence of bases 42132-48883 of SEQ ID NO.27, or a nucleic acid
having a base sequence which is identical to at least 70% of the base sequence of bases 42132-48883 of
SEQ ID NO.27, and which functions to restore fertility.Data supplied from the esp@cenet database Worldwide
109/503
20. EP1548117
- 6/29/2005
RICE REGULATORY SEQUENCES FOR GENE EXPRESSION IN DEFINED
WHEAT TISSUE
URL EPO =
http://v3.espacenet.com/textdoc?F=3&CY=ep&LG=en&IDX=EP1548117
Inventor(s):
URBAN MARTIN (GB); STRATFORD REBECCA (GB); HAMMOND-KOSACK
KIM (GB); KEMP RICHARD (GB); LECOCQ PIERRE (BE)
Applicant(s):
MONSANTO UK LTD (GB)
IP Class 4 Digits: C07K; C12N; A01H
IP Class:C07K14/415; C12N15/82; A01H5/00; C12N15/29
E Class: C07K14/415; C12N15/82B20B6; C12N15/82B20A2
Application Number:
EP20050002479 (20020823)
Priority Number: EP20010307298 (20010828); EP20020767435 (20020823); EP20050002479
(20020823)
Family: EP1548117
Cited Document(s):
EP0913469; WO9822593; WO9909190; XP002326381
Abstract:
Abstract of EP1548117
The abundance of the 96 most abundant EST cluster sequences in a wheat lemma/palea cDNA library
was investigated in a range of cDNA libraries made from various wheat tissues. 30 cDNA sequences
showing highly enhanced abundance in lemma, palea and glume tissues over leaf, stem, embryo,
endosperm and root tissue were selected for further analysis. These wheat EST cluster sequences were
used to identify rice cDNA homologs. The abundance of the rice cDNA homologs was compared in
rice leaf and panicle (includes lemma and palea) cDNA libraries. Rice cDNAs showing preferential
expression in the panicle were then used to identify homologous rice genomic DNA clones, the
putative promoter sequences have been identified and cloned.Description:
Description of EP1548117
FIELD OF THE INVENTION
[0001] The present invention relates to isolated nucleic acid molecules, specifically regulatory
sequences, more specifically rice promoters and the use thereof for controlling gene expression in
predefined wheat tissue such as glume, lemma and/or palea. A method of isolating those regulatory
sequences is also disclosed.
BACKGROUND OF THE INVENTION
[0002] Fusarium head blight of small grains ("scab"), often referred to by the acronym "FHB", is
increasing world wide and is a tremendous problem for the production and yield of wheat. Within the
last dozen years there have been outbreaks of FHB in the midwestem and eastern states in the USA, as
110/503
well as in central and eastern Canada. The most extended recent episode has been in the spring grain
region of the upper midwest, centered on the Red River Valley of North Dakota, Minnesota, and
Manitoba. Here, there have been five consecutive years of severe disease. Losses have been large, and
accumulated loss has brought ruin to many farmers.
While several species of the soil- and residue-borne fungus Fusarium are capable of inciting FHB,
most of the damage in recent outbreaks in the US and Canada has been due to F. graminearum. In
addition to grain crops, this species has a wide host range among grasses. The name Fusarium, in fact,
means "of the grasses". This species was probably present in native grassland long before wheat or
barley arrived in North America. F.graminearum is also a superb colonizer of senescent plants;
especially corn stalks. F. graminearum is unique in another regard. It is the only common Fusarium
species infecting wheat which regularly and abundantly forms its sexual stage (Gibberella zeae) in
nature. Because the spores produced by this stage are forcibly shot into the air, they greatly increase the
ability of the fungus to disperse from colonized crop residue where the fruit-bodies (perithecia) of this
stage form.
[0003] F. graminearum has a complex life cycle which is easier to picture if it is divided in two parts:
a pathogenic cycle, and a 'hidden' cycle of saprophytic colonization. The effect of the pathogenic cycle
is seen as FHB. Aerial spores land on flowering heads during wet weather and FHB results.
F.graminearum survives on the residue; particularly on infected heads, and sporulates the next spring
and summer. In the saprophytic cycle mycelium superficially occupy cornstalks, often without causing
disease. At senescence, invasive colonization occurs and F. graminearum takes possession of most of
the corn stalk residue. One Minnesota study found over 80% of the corn stalk residue in fall was
occupied by F. graminearum and it covers over 60% the following spring . This colonized residue
provides a site for massive sporulation during the next growing season. Those airborne spores may
begin new saprophytic colonization or they may initiate pathogenic cycles resulting in FHB. The
saprophytic colonization cycle is the engine that drives the pathogenic part of the cycle.
The saprophytic life cycle of F.graminearum is fueled by corn stalk residue. There are a number of
observations that when corn production moves into a previously small grain area, the occurrence of F.
graminearum and the risk of FHB increase. Combine the extension of corn acreage into wheat and
barley country with large increases in reduced tillage and the stage is set for major epidemics of FHB
in small grains when the weather favoring disease occurs.
[0004] Thus Fusarium head blight disease can affect a number of cereal crops such as wheat, barley,
rice, rye and maize. It is caused by the phytopathogenic fungi Fusarium graminearum, F. moniliforme,
F. culmorum, F. nivale and Microdochium nivale. Moist environmental conditions during anthesis can
result in Fusarium epidemics and huge losses in crop revenues. The disease not only reduces crop yield
and grain quality but also leads to fungal mycotoxin accumulation in grain.
Kang et al., (Mycol.Res. 104(9): 1083-1093, 2000) disclose experimental evidence that penetration of
host tissues by Fusarium culmorum occurred on the inner surfaces of lemma, glume and palea as early
as 36 h after inoculation demonstrating that glume, lemma and/or palea are the key entry points for
start of the infection process by Fusarium in wheat.
[0005] One of the goals of plant genetic engineering is to produce plants with agronomically
important characteristics or traits. Recent advances in genetic engineering have provided the requisite
tools to transform plants to contain and express foreign genes (Kahl et al. , 1995, World Journal of
Microbiology and Biotechnology 11:449-460). Particularly desirable traits or qualities of interest for
plant genetic engineering would include, but are not limited to, resistance to insects, fungal diseases
such as the Fusarium head blight disease, and other pests and disease-causing agents, tolerances to
herbicides, enhanced yield stability or shelf-life, environmental tolerances, and nutritional
enhancements. The technological advances in plant transformation and regeneration have enabled
researchers to take pieces of DNA, such as a gene or genes from a heterologous source, or a native
source, but modified to have different or improved qualities, and incorporate the exogenous DNA into
the plant's genome. The gene or gene(s) can then be expressed in the plant cell to exhibit the added
characteristic(s) or trait(s). In one approach, expression of a novel gene that is not normally expressed
in a particular plant or plant tissue may confer a desired phenotypic effect. In another approach,
transcription of a gene or part of a gene in an antisense orientation may produce a desirable effect by
preventing or inhibiting expression of an endogenous gene.
111/503
[0006] Isolated plant promoters are useful for modifying plants through genetic engineering to have
desired phenotypic characteristics. In order to produce such a transgenic plant, a vector that includes a
heterologous gene sequence that confers the desired phenotype when expressed in the plant is
introduced into the plant cell. The vector also includes a plant promoter that is operably linked to the
heterologous gene sequence, often a promoter not normally associated with the heterologous gene. The
vector is then introduced into a plant cell to produce a transformed plant cell, and the transformed plant
cell is regenerated into a transgenic plant. The promoter controls expression of the introduced DNA
sequence to which the promoter is operably linked and thus affects the desired characteristic conferred
by the DNA sequence.
[0007] Because the promoter is a regulatory element that plays an integral part in the overall
expression of a gene or genes, it would be advantageous to have a variety of promoters to tailor gene
expression such that a gene or genes is transcribed efficiently at the right time during plant growth and
development, in the optimal location in the plant, and in the amount necessary to produce the desired
effect. In one case, for example, constitutive expression of a gene product may be beneficial in one
location of the plant, but less beneficial in another part of the plant. In other cases, it may be beneficial
to have a gene product produced at a certain developmental stage of the plant, or in response to certain
environmental or chemical stimuli. The commercial development of genetically improved germplasm
has also advanced to the stage of introducing multiple traits into crop plants, often referred to as a gene
stacking approach. In this approach, multiple genes conferring different characteristics of interest can
be introduced into a plant. It is important when introducing multiple genes into a plant, that each gene
is modulated or controlled for optimal expression and that the regulatory elements are diverse, to
reduce the potential of gene silencing that can be caused by recombination of homologous sequences.
In light of these and other considerations, it is apparent that optimal control of gene expression and
regulatory element diversity are important in plant biotechnology.
[0008] The proper regulatory sequences must be present in the proper location with respect to the
DNA sequence of interest for the newly inserted DNA to be transcribed and thereby, if desired,
translated into a protein in the plant cell. These regulatory sequences include, but are not limited to, a
promoter, a 5' untranslated leader, and a 3' polyadenylation sequence. The ability to select the tissues in
which to transcribe such foreign DNA and the time during plant growth in which to obtain transcription
of such foreign DNA is also possible through the choice of appropriate promoter sequences that control
transcription of these genes.
[0009] A variety of different types or classes of promoters can be used for plant genetic engineering.
Promoters can be classified on the basis of range of tissue specificity. For example, promoters referred
to as constitutive promoters are capable of transcribing operatively linked DNA sequences efficiently
and expressing said DNA sequences in multiple tissues. Tissue-enhanced or tissue-specific promoters
can be found upstream and operatively linked to DNA sequences normally transcribed in higher levels
in certain plant tissues or specifically in certain plant tissues. Other classes of promoters would include,
but are not limited to, inducible promoters that can be triggered by external stimuli such as chemical
agents, developmental stimuli, or environmental stimuli. Thus, the different types of promoters desired
can be obtained by isolating the regulatory regions of DNA sequences that are transcribed and
expressed in a constitutive, tissue-enhanced, or inducible manner.
[0010] The technological advances of high-throughput sequencing and bioinformatics has provided
additional molecular tools for promoter discovery. Particular target plant cells, tissues, or organs at a
specific stage of development, or under particular chemical, environmental, or physiological conditions
can be used as source material to isolate the mRNA and construct cDNA libraries. The cDNA libraries
are quickly sequenced, and the expressed sequences can be catalogued electronically. Using sequence
analysis software, thousands of sequences can be analyzed in a short period, and sequences from
selected cDNA libraries can be compared. The combination of laboratory and computer-based
subtraction methods allows researchers to scan and compare cDNA libraries and identify sequences
with a desired expression profile. For example, sequences expressed preferentially in one tissue can be
identified by comparing a cDNA library from one tissue to cDNA libraries of other tissues and
electronically "subtracting" common sequences to find sequences only expressed in the target tissue of
interest. The tissue enhanced sequence can then be used as a probe or primer to clone the
corresponding full-length cDNA. A genomic library of the target plant can then be used to isolate the
112/503
corresponding gene and the associated regulatory elements, including but not limited to promoter
sequences.
[0011] Despite all the technology currently available no monocotyledonous regulatory sequences
capable of regulating transcription of an operably linked nucleic acid sequence in lemma, palea and/or
glume monocotyledonous tissue are known. More specifically wheat promoters which could drive
expression of a gene in the palea, glume and/or lemma of wheat are unfortunately also unknown. Since
the palea, glume and/or lemma are the key entry points susceptible to Fusarium attack, it is highly
desirable to have access to specific promoters which can , for instance, drive expression of a
heterologous gene able to prevent and/or cure Fusarium attack and/or related disease in these specific
tissues.
SUMMARY OF THE INVENTION
[0012] The current invention discloses a solution to the above problems in the provision of newly
isolated monocotyledonous regulatory sequences capable of regulating transcription of an operably
linked nucleic acid sequence in lemma, palea and/or glume monocotyledonous tissue. In order to
isolate these new monocotyledonous regulatory sequences the following inventive non-obvious process
has been developed. Firstly, tissue specific EST's have been found; secondly specific homologues in
another species e.g. rice have been located. Subsequently for these specific homologues e.g. in rice, it
has been determined that they are expressed in the appropriate tissue specific manner. Using the
genomic DNA sequence the promoters have been cloned from the other species i.e. rice or maize.
More in detail the abundance of the 96 most abundant EST cluster sequences in a wheat lemma/palea
cDNA library was investigated in a range of cDNA libraries made from various wheat and maize
tissues. 30 cDNA sequences showing highly enhanced abundance in lemma, palea and glume tissues
over leaf, stem, embryo, endosperm and root tissue were selected for further analysis. These wheat EST
cluster sequences were used to identify e.g. rice cDNA homologs. The abundance of the rice cDNA
homologs was compared in rice leaf and panicle (includes lemma and palea) cDNA libraries. Rice
cDNAs showing preferential expression in the panicle were then used to identify homologous rice
genomic DNA clones; the putative promoter sequences have been identified and cloned.
The isolation of heterologous promoters via a homolog intermediate cDNA has two main advantages.
Firstly identification of promoters with a conserved gene expression pattern across species and,
secondly, confident identification of the correct gene family member for subsequent promoter isolation.
DETAILED DESCRIPTION OF THE INVENTION
[0013] The present invention thus provides isolated plant promoter sequences, preferably
monocotyledonous regulatory sequences that comprise nucleic acid regions located upstream of the 5'
end of structural coding sequences that are transcribed in defined monocot, more specifically in wheat
tissues such as lemma, palea and/or glume. Said promoter sequences are capable of modulating or
initiating transcription of DNA sequences to which they are operably linked in specific, well-defined
monocotyledonous tissue. In addition to regulatory elements or sequences located upstream (5') or
within a DNA sequence, there are downstream (3') sequences that affect gene expression and thus the
term "regulatory sequence" as used herein refers to any nucleotide sequence located upstream, within,
or downstream to a DNA sequence that controls, mediates, or affects expression of a gene product in
conjunction with the protein synthetic apparatus of the cell.
[0014] The present invention provides nucleic acid sequences comprising monocotyledonous
regulatory sequences exemplified in SEQ ID NOS: 1-3 that are located upstream of the 5' end of
structural coding sequences and transcribed in monocotyledonous tissue, more specifically in wheat
tissue preferably lemma, palea or glume.
[0015] In one aspect, the present invention provides nucleic acid sequences comprising a sequence
selected from the group consisting of SEQ ID NOS: 1-3 or any fragments or regions of the sequence or
113/503
cis elements of the sequence that are capable of regulating transcription of operably linked DNA
sequences.
[0016] The present invention also provides nucleic acid sequences comprising a sequence selected
from the group consisting of SEQ ID NOS: 1-3 that are promoters.
[0017] Another aspect of the present invention relates to the use of one or more cis elements, or
fragments thereof of the disclosed 5' promoter sequences that can be combined to create novel
promoters or used in a novel combination with another heterologous regulatory sequence to create a
chimeric or hybrid promoter capable of modulating transcription of an operably linked DNA sequence.
[0018] Hence, the present invention relates to the use of nucleic acid sequences disclosed in SEQ ID
NOS: 1-3 or any fragment, region, or cis element of the disclosed sequences that are capable of
regulating transcription of a DNA sequence when operably linked to the DNA sequence. Therefore, the
invention not only encompasses the sequences as disclosed in SEQ ID NOS: 1-3, but also includes any
truncated or deletion derivatives, or fragments or regions thereof that are capable of functioning
independently as a promoter including cis elements that are capable of functioning as regulatory
sequences in conjuction with one or more regulatory sequences when operably linked to a transcribable
sequence.
[0019] The present invention thus encompasses a novel promoter or chimeric or hybrid promoter
comprising a nucleic acid of SEQ ID NOS: 1-3. The chimeric or hybrid promoters can consist of any
length fragments, regions, or cis elements of the disclosed sequences of SEQ ID NOS: 1-3 combined
with any other transcriptionally active minimal or full-length promoter. For example, a promoter
sequence selected from SEQ ID NOS: 1-3 may be combined with a CaMV 35S or other promoter, such
as a rice actin promoter, to construct a novel chimeric or hybrid promoter. A minimal promoter can
also be used in combination with the nucleic acid sequences of the present invention. A novel promoter
also comprises any promoter constructed by engineering the nucleic acid sequences disclosed in SEQ
ID NOS: 1-3 or any fragment, region, or cis element of the disclosed sequences in any manner
sufficient to transcribe an operably linked DNA sequence.
[0020] Another aspect of the present invention relates to the ability of the promoter sequences of
SEQ ID NOS: 1-3 or fragments, regions, or cis elements thereof to regulate transcription of operably
linked transcribable sequences in specific floral tissues. Fragments, regions, or cis elements of SEQ ID
NOS: 1-3 that are capable of regulating transcription of operably linked DNA sequences in certain
tissues may be isolated from the disclosed nucleic acid sequences of SEQ ID NOS: 1-3 and used to
engineer novel promoters.
[0021] The present invention also encompasses DNA constructs comprising the disclosed sequences
as shown in SEQ ID NOS: 1-3 or any fragments, regions, or cis elements thereof, including novel
promoters generated using the disclosed sequences or any fragment, region, or cis element thereof.
[0022] The present invention also includes any transgenic plant cell and plants containing the DNA
disclosed in the sequences as shown in SEQ ID NOS: 1-3 or any fragments, regions, or cis elements
thereof.
[0023] The present invention also provides a method of regulating transcription of a DNA sequence
comprising operably linking the DNA sequence to any promoter comprising a nucleic acid sequence
comprising all or any fragment, region or cis element of a sequence selected from the group consisting
of SEQ ID NOS: 1-3 wherein said promoter confers enhanced or decreased expression of the operably
linked DNA sequence.
[0024] In another embodiment the present invention provides a method of regulating expression of
DNA sequences in monocotyledonous tissues preferably lemma, palea or glume of wheat by operably
linking a sequence selected from the group consisting of SEQ ID NOS: 1-3 or any fragment, region, or
cis element of the disclosed sequences to any transcribable DNA sequence. The fragments, regions, or
cis elements of the disclosed promoters as shown in SEQ ID NOS: 1-3 can be engineered and used
independently in novel combinations including multimers, or truncated derivatives and the novel
promoters can be operably linked with a transcribable DNA sequence. Alternatively the disclosed
114/503
fragments, regions, or cis elements of the disclosed sequences can be used in combination with a
heterologous promoter including a minimal promoter to create a novel chimeric or hybrid promoter and
the novel chimeric promoter can be operably linked to a transcribable DNA sequence.
[0025] The present invention also provides a method of producing a transgenic plant by introducing
into a plant cell a DNA construct comprising: (i) a promoter comprising a nucleic acid comprising a
sequence selected from the group consisting of SEQ ID NOS: 1-3 or fragment, region, or cis element
thereof, and operably linked to the promoter, (ii) a transcribable DNA sequence and (iii) a 3'
untranslated region. For transformation purposes in addition an appropriate selectable marker cassette
may be used in order to establish and recognize transformed plants. Useful markers are hereafter
exemplified in this application.
[0026] The present invention also encompasses differentiated plants, seeds and progeny comprising
above mentioned transformed plant cells. The plants thus obtained show tissue specific expression of
so-called reporter genes. Said promoters can thus be used in a proper construct to enable expression of
control genes against for instance Fusarium head blight diseaese in the right tissue. Such transformed
plants thus obtained exhibit novel properties of agronomic significance.
[0027] The present invention also provides a method of isolating 5' regulatory sequences of a desired
expression profile from a target plant of interest by evaluating a collection of nucleic acid sequences of
ESTs derived from one or more cDNA libraries prepared from a plant cell type of interest, comparing
EST sequences from at least one target plant cDNA library and one or more non-target cDNA libraries
of ESTs from a different plant cell type, subtracting common EST sequences found in both target and
non-target libraries, designing gene-specific primers from the remaining ESTs after the subtraction that
are representative of the targeted expressed sequences, and isolating the corresponding 5' flanking and
regulatory sequences, that includes promoter sequences from a genomic DNA database prepared from
the target plant using the gene specific primers.
[0028] The foregoing and other aspects of the invention will become more apparent from the
following detailed description of definitions and methods used and accompanying drawings as well.
Definitions and Methods
[0029] The following definitions and methods are provided to better define the present invention and
to guide those of ordinary skill in the art in the practice of the present invention. Unless otherwise
noted, terms are to be understood according to conventional usage by those of ordinary skill in the
relevant art. The standard one- and three-letter nomenclature for amino acid residues is used.
[0030] "Nucleic acid (sequence)" or "polynucleotide (sequence)" refers to single- or double-stranded
DNA or RNA of genomic or synthetic origin, i.e., a polymer of deoxyribonucleotide or ribonucleotide
bases, respectively, read from the 5' (upstream) end to the 3' (downstream) end. The nucleic acid can
represent the sense or complementary (antisense) strand.
[0031] "Native" refers to a naturally occurring ("wild-type") nucleic acid sequence.
[0032] "Heterologous" sequence refers to a sequence that originates from a foreign source or species
or, if from the same source, is modified from its original form.
[0033] An "isolated" nucleic acid sequence is substantially separated or purified away from other
nucleic acid sequences that the nucleic acid is normally associated with in the cell of the organism in
which the nucleic acid naturally occurs, i.e., other chromosomal or extrachromosomal DNA. The term
embraces nucleic acids that are biochemically purified so as to substantially remove contaminating
nucleic acids and other cellular components. The term also embraces recombinant nucleic acids and
chemically synthesized nucleic acids.
[0034] The term "substantially purified", as used herein, refers to a molecule separated from
substantially all other molecules normally associated with it in its native state. More preferably, a
115/503
substantially purified molecule is the predominant species present in a preparation. A substantially
purified molecule may be greater than 60% free, preferably 75% free, more preferably 90% free from
the other molecules (exclusive of solvent) present in the natural mixture. The term "substantially
purified" is not intended to encompass molecules present in their native state.
[0035] A first nucleic acid sequence displays "substantial identity" to a reference nucleic acid
sequence if, when optimally aligned (with appropriate nucleotide insertions or deletions totaling less
than 20 percent of the reference sequence over the window of comparison) with the other nucleic acid
(or its complementary strand), there is at least about 75% nucleotide sequence identity, preferably at
least about 80% identity, more preferably at least about 85% identity, and most preferably at least
about 90% identity over a comparison window of at least 20 nucleotide positions, preferably at least 50
nucleotide positions, more preferably at least 100 nucleotide positions, and most preferably over the
entire length of the first nucleic acid. Optimal alignment of sequences for aligning a comparison
window may be conducted by the local homology algorithm of Smith and Waterman (Adv. Appl.
Math. 2: 482, 1981); by the homology alignment algorithm of Needleman and Wunsch (J. Mol. Biol.
48:443, 1970); by the search for similarity method of Pearson and Lipman (Proc. Natl. Acad. Sci. USA
85:2444, 1988); preferably by computerized implementations of these algorithms (GAP, BESTFIT,
PASTA, and TFASTA) in the Wisconsin Genetics Software Package Release 7.0 (Genetics Computer
Group, 575 Science Dr., Madison, WI). The reference nucleic acid may be a full-length molecule or a
portion of a longer molecule. Alternatively, two nucleic acids have substantial identity if one
hybridizes to the other under stringent conditions, as defined below.
[0036] A first nucleic acid sequence is "operably linked" with a second nucleic acid sequence when
the sequences are so arranged that the first nucleic acid sequence affects the function of the second
nucleic acid sequence. Preferably, the two sequences are part of a single contiguous nucleic acid
molecule and more preferably are adjacent. For example, a promoter is operably linked to a gene if the
promoter regulates or mediates transcription of the gene in a cell.
[0037] A "recombinant" nucleic acid is made by an artificial combination of two otherwise separated
segments of sequence, e.g., by chemical synthesis or by the manipulation of isolated segments of
nucleic acids by genetic engineering techniques. Techniques for nucleic-acid manipulation are wellknown (see, e.g., Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, ed. Sambrook et al.,
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989, Sambrook et al., 1989; Current
Protocols in Molecular Biology, ed. Ausubel et al., Greene Publishing and Wiley-Interscience, New
York, 1992, with periodic updates, Ausubel et al., 1992; and PCR Protocols: A Guide to Methods and
Applications, Academic Press: San Diego, Innis et al., 1990). Methods for chemical synthesis of
nucleic acids are discussed, for example, in Beaucage and Carruthers (Tetra. Letts. 22:1859-1862,
1981), and Matteucci et al. (J. Am. Chem. Soc. 103:3185, 1981). Chemical synthesis of nucleic acids
can be performed, for example, on commercial automated oligonucleotide synthesizers.
[0038] A "synthetic nucleic acid sequence" can be designed and chemically synthesized for enhanced
expression in particular host cells and for the purposes of cloning into appropriate vectors. Synthetic
DNAs designed to enhance expression in a particular host should therefore reflect the pattern of codon
usage in the host cell. Computer programs are available for these purposes including but not limited to
the "BestFit" or "Gap" programs of the Sequence Analysis Software Package, Genetics Computer
Group, Inc. (University of Wisconsin Biotechnology Center, Madison, WI 53711).
[0039] "Amplification" of nucleic acids or "nucleic acid reproduction " refers to the production of
additional copies of a nucleic acid sequence and is carried out using polymerase chain reaction (PCR)
technologies. A variety of amplification methods are known in the art and are described, inter alia, in
U.S. Patent Nos. 4,683,195 and 4,683,202 and by Innis et al. (PCR Protocols: A Guide to Methods and
Applications, Academic Press, San Diego, 1990). In PCR, a primer refers to a short oligonucleotide of
defined sequence that is annealed to a DNA template to initiate the polymerase chain reaction.
[0040] "Transformed", "transfected", or "transgenic" refers to a cell, tissue, organ, or organism into
which has been introduced a foreign nucleic acid, such as a recombinant vector. Preferably, the
introduced nucleic acid is integrated into the genomic DNA of the recipient cell, tissue, organ or
organism such that the introduced nucleic acid is inherited by subsequent progeny. A "transgenic" or
"transformed" cell or organism also includes progeny of the cell or organism and progeny produced
116/503
from a breeding program employing such a "transgenic" plant as a parent in a cross and exhibiting an
altered phenotype resulting from the presence of a recombinant construct or vector.
[0041] The term "gene" refers to chromosomal DNA, plasmid DNA, cDNA, synthetic DNA, or other
DNA that encodes a peptide, polypeptide, protein, or RNA molecule, and regions flanking the coding
sequence involved in the regulation of expression. Some genes can be transcribed into mRNA and
translated into polypeptides (structural genes); other genes can be transcribed into RNA (e.g., rRNA,
tRNA); and other types of genes function as regulators of expression (regulator genes).
[0042] "Expression" of a gene refers to the transcription of a gene to produce the corresponding
mRNA and translation of this mRNA to produce the corresponding gene product, i.e., a peptide,
polypeptide, or protein. Gene expression is controlled or modulated by regulatory elements including 5'
regulatory elements such as promoters.
[0043] "Genetic component" refers to any nucleic acid sequence or genetic element that may also be
a component or part of an expression vector. Examples of genetic components include, but are not
limited to, promoter regions, 5' untranslated leaders, introns, genes, 3' untranslated regions, and other
regulatory sequences or sequences that affect transcription or translation of one or more nucleic acid
sequences.
[0044] The terms "recombinant DNA construct", "recombinant vector", "expression vector" or
"expression cassette" refer to any agent such as a plasmid, cosmid, virus, BAC (bacterial artificial
chromosome), autonomously replicating sequence, phage, or linear or circular single-stranded or
double-stranded DNA or RNA nucleotide sequence, derived from any source, capable of genomic
integration or autonomous replication, comprising a DNA molecule in which one or more DNA
sequences have been linked in a functionally operative manner.
[0045] "Complementary" refers to the natural association of nucleic acid sequences by base-pairing
(A-G-T pairs with the complementary sequence A-C-T). Complementarity between two singlestranded molecules may be partial, if only some of the nucleic acids pair are complementary, or
complete, if all bases pair are complementary. The degree of complementarity affects the efficiency
and strength of hybridization and amplification reactions.
[0046] "Homology" refers to the level of similarity between nucleic acid or amino acid sequences in
terms of percent nucleotide or amino acid positional identity, respectively, i.e., sequence similarity or
identity. Homology also refers to the concept of similar functional properties among different nucleic
acids or proteins.
[0047] "ESTs" or Expressed Sequence Tags are short sequences of randomly selected clones from a
cDNA (or complementary DNA) library that are representative of the cDNA inserts of these randomly
selected clones (McCombie et al., Nature Genetics, 1:124, 1992; Kurata et al., Nature Genetics, 8:
365,1994; Okubo et al., Nature Genetics, 2: 173, 1992).
[0048] The term "electronic Northern" refers to a computer-based sequence analysis that allows
sequences from multiple cDNA libraries to be compared electronically based on parameters the
researcher identifies including abundance in EST populations in multiple cDNA libraries, or
exclusively to EST sets from one or combinations of libraries.
[0049] "Subsetting" refers to a method of comparing nucleic acid sequences from different or
multiple sources that can be used to assess the expression profile of the nucleic acid sequences that
reflects gene transcription activity and message stability in a particular tissue, at a particular time, or
under particular conditions.
[0050] "Promoter" refers to a nucleic acid sequence located upstream or 5' to a translational start
codon of an open reading frame (or protein-coding region) of a gene and that is involved in recognition
and binding of RNA polymerase II and other proteins (trans-acting transcription factors) to initiate
transcription. A "plant promoter" is a native or non-native promoter that is functional in plant cells.
Constitutive promoters are functional in most or all tissues of a plant throughout plant development.
Tissue-, organ- or cell-specific promoters are expressed only or predominantly in a particular tissue,
117/503
organ, or cell type, respectively. Rather than being expressed "specifically" in a given tissue, organ, or
cell type, a promoter may display "enhanced" expression, i.e., a higher level of expression, in one part
(e.g., cell type, tissue, or organ) of the plant compared to other parts of the plant. Temporally regulated
promoters are functional only or predominantly during certain periods of plant development or at
certain times of day, as in the case of genes associated with circadian rhythm, for example. Inducible
promoters selectively express an operably linked DNA sequence in response to the presence of an
endogenous or exogenous stimulus, for example, by chemical compounds (chemical inducers) or in
response to environmental, hormonal, chemical, or developmental signals. Inducible or regulated
promoters include, for example, promoters regulated by light, heat, stress, flooding or drought,
phytohormones, wounding, or chemicals such as ethanol, jasmonate, salicylic acid, safeners, pests or
pathogens.
[0051] Any plant promoter can be used as a 5' regulatory sequence for modulating expression of a
particular gene or genes. One preferred promoter would be a plant promoter that recognizes and binds
RNA polymerase II. Such plant RNA polymerase type II promoters, like those of other higher
eukaryotes, have complex structures and are comprised of several distinct elements. One such element
is the TATA box or Goldberg-Hogness box, which is required for correct expression of eukaryotic
genes in vitro and accurate, efficient initiation of transcription in vivo. The TATA box is typically
positioned at approximately -25 to -35, that is, at 25 to 35 basepairs (bp) upstream (5') of the
transcription initiation site, or cap site, which is defined as position +1 (Breathnach and Chambon,
Ann. Rev. Biochem. 50:349-383, 1981; Messing et al., In: Genetic Engineering of Plants, Kosuge et
al., eds., pp. 211-227, 1983). Another common element, the CCAAT box, is located between -70 and 100 bp. In plants, the CCAAT box may have a different consensus sequence than the functionally
analogous sequence of mammalian promoters (the plant analogue has been termed the "AGGA box" to
differentiate it from its animal counterpart; Messing et al., In: Genetic Engineering of Plants, Kosuge et
al., eds., pp. 211-227, 1983). In addition, virtually all promoters include additional upstream activating
sequences or enhancers (Benoist and Chambon, Nature 290: 304-310,1981; Gruss et al., Proc. Natl.
Acad. Sci. USA 78:943-947, 1981; and Khoury and Gruss, Cell 27:313-314, 1983) extending from
around -100 bp to -1,000 bp or more upstream of the transcription initiation site. Enhancers have also
been found 3' to the transcriptional start site.
[0052] When fused to heterologous DNA sequences, such promoters typically cause the fused
sequence to be transcribed in a manner that is similar to that of the gene sequence that the promoter is
normally associated with. Promoter fragments that include regulatory sequences can be added (for
example, fused to the 5' end of, or inserted within, an active promoter having its own partial or
complete regulatory sequences (Fluhr et al., Science 232:1106-1112, 1986; Ellis et al., EMBO J. 6:1116, 1987; Strittmatter and Chua, Proc. Nat. Acad. Sci. USA 84:8986-8990, 1987; Poulsen and Chua,
Mol. Gen. Genet. 214:16-23, 1988; Comai et al., Plant Mol. Biol. 15:373-381, 1991). Alternatively,
heterologous regulatory sequences can be added to the 5' upstream region of an inactive, truncated
promoter, e.g., a promoter including only the core TATA and, sometimes, the CCAAT elements (Fluhr
et al., Science 232:1106-1112, 1986; Strittmatter and Chua, Proc. Nat. Acad. Sci. USA 84:8986-8990,
1987; Aryan et al., Mol. Gen. Genet. 225:65-71, 1991).
[0053] Promoters are typically comprised of multiple distinct "cis-acting transcriptional regulatory
elements," or simply "cis-elements," each of which appears to confer a different aspect of the overall
control of gene expression (Strittmatter and Chua, Proc. Nat. Acad. Sci. USA 84:8986-8990, 1987;
Ellis et al., EMBO J. 6:11-16, 1987; Benfey et al., EMBO J. 9:1677-1684, 1990). Cis elements bind
trans-acting protein factors that regulate transcription. Some cis elements bind more than one factor,
and trans-acting transcription factors may interact with different affinities with more than one cis
element (Johnson and McKnight, Ann. Rev. Biochem. 58:799-839, 1989). Plant transcription factors,
corresponding cis elements, and analysis of their interaction are discussed, for example, in Martin
(Curr. Opinions Biotech. 7:130-138, 1996), Murai (Methods in Plant Biochemistry and Molecular
Biology, Dashek, ed., CRC Press, 1997, pp. 397-422), and Maliga et al. (Methods in Plant Molecular
Biology, Cold Spring Harbor Press, 1995, pp. 233-300). The promoter sequences of the present
invention can contain "cis elements" that can confer or modulate gene expression.
[0054] Cis elements can be identified by a number of techniques, including deletion analysis, i.e.,
deleting one or more nucleotides from the 5' end or internal to a promoter; DNA binding protein
analysis using Dnase I footprinting; methylation interference; electrophoresis mobility-shift assays, in
118/503
vivo genomic footprinting by ligation-mediated PCR; and other conventional assays; or by sequence
similarity with known cis element motifs by conventional sequence comparison methods. The fine
structure of a cis element can be further studied by mutagenesis (or substitution) of one or more
nucleotides or by other conventional methods (see for example, Methods in Plant Biochemistry and
Molecular Biology, Dashek, ed., CRC Press, 1997, pp. 397-422; and Methods in Plant Molecular
Biology, Maliga et al., eds., Cold Spring Harbor Press, 1995, pp. 233-300).
[0055] Cis elements can be obtained by chemical synthesis or by cloning from promoters that include
such elements, and they can be synthesized with additional flanking sequences that contain useful
restriction enzyme sites to facilitate subsequent manipulation. In one embodiment, the promoters are
comprised of multiple distinct "cis-acting transcriptional regulatory elements," or simply "ciselements," each of which appears to confer a different aspect of the overall control of gene expression
(Strittmatter and Chua, Proc. Nat. Acad. Sci. USA 84:8986-8990, 1987; Ellis et al., EMBO J. 6:11-16,
1987; Benfey et al., EMBO J. 9:1677-1684, 1990). In a preferred embodiment, sequence regions
comprising "cis elements" of the nucleic acid sequences of SEQ ID NOS: 1-3 are identified using
computer programs designed specifically to identify cis elements, or domains or motifs within
sequences.
[0056] The present invention includes cis elements of SEQ ID NOS: 1-3 or homologues of cis
elements known to affect gene regulation that show homology with the nucleic acid sequences of the
present invention. A number of such elements are known in the literature, such as elements that are
regulated by numerous factors such as light, heat, or stress; elements that are regulated or induced by
pathogens or chemicals, and the like. Such elements may either positively or negatively regulated gene
expression, depending on the conditions. Examples of cis elements would include, but are not limited
to, oxygen responsive elements (Cowen et al., J. Biol. Chem. 268(36):26904, 1993), light regulatory
elements (see for example, Bruce and Quaill, Plant Cell 2(11): 1081, 1990; and Bruce et al., EMBO J.
10:3015, 1991), a cis element reponsive to methyl jasmonate treatment (Beaudoin and Rothstein, Plant
Mol. Biol. 33:835, 1997), salicylic acid responsive elements (Strange et al., Plant J. 11:1315, 1997),
heat shock response elements (Pelham et al., Trends Genet. 1:31, 1985), elements responsive to
wounding and abiotic stress (Loace et al., Proc. Natl. Acad. Sci. U. S. A. 89:9230, 1992; Mhiri et al.,
Plant Mol. Biol. 33:257, 1997), low temperature elements (Baker et al., Plant Mol. Biol. 24:701, 1994;
Jiang et al., Plant Mol. Biol. 30:679, 1996; Nordin et al., Plant Mol. Biol. 21:641, 1993; Zhou et al., J.
Biol. Chem. 267:23515, 1992), and drought responsive elements, (Yamaguchi et al., Plant Cell 6:251264, 1994; Wang et al., Plant Mol. Biol. 28:605, 1995; Bray, Trends in Plant Science 2:48, 1997).
[0057] The present invention therefore encompasses fragments or cis elements of the disclosed
nucleic acid molecules, and such nucleic acid fragments can include any region of the disclosed
sequences. The promoter regions or partial promoter regions of the present invention as shown in SEQ
ID NOS: 1-3 can contain one or more regulatory elements including but not limited to cis elements or
domains that are capable of regulating expression of operably linked DNA sequences, preferably in
wheat tissues such as lemma, palea or glume.
[0058] Plant promoters can include promoters produced through the manipulation of known
promoters to produce synthetic, chimeric, or hybrid promoters. Such promoters can also combine cis
elements from one or more promoters, for example, by adding a heterologous regulatory sequence to an
active promoter with its own partial or complete regulatory sequences (Ellis et al., EMBO J. 6:11-16,
1987; Strittmatter and Chua, Proc. Nat. Acad. Sci. USA 84:8986-8990, 1987; Poulsen and Chua, Mol.
Gen. Genet. 214:16-23, 1988; Comai et al., Plant. Mol. Biol. 15:373-381, 1991). Chimeric promoters
have also been developed by adding a heterologous regulatory sequence to the 5' upstream region of an
inactive, truncated promoter, i.e., a promoter that includes only the core TATA and, optionally, the
CCAAT elements (Fluhr et al., Science 232:1106-1112, 1986; Strittmatter and Chua, Proc. Nat. Acad.
Sci. USA 84:8986-8990, 1987; Aryan et al., Mol. Gen. Genet. 225:65-71, 1991).
[0059] The design, construction, and use of chimeric or hybrid promoters comprising one or more of
cis elements of SEQ ID NOS: 1-3 for modulating or regulating the expression of operably linked
nucleic acid sequences is also encompassed by the present invention.
119/503
[0060] The promoter sequences, fragments, regions or cis elements thereof of SEQ ID NOS: 1-3 are
capable of transcribing operably linked DNA sequences in specific well-defined wheat tissues such as
lemma, palea or glume and therefore can selectively regulate expression of those genes in these tissues.
[0061] The promoter sequences of the present invention are useful for regulating gene expression in
wheat tissues such as lemma, palea or glume. For a number of agronomic traits, transcription of a gene
or genes of interest is desirable in multiple tissues in order to confer the desired characteristic(s). The
availability of suitable promoters that regulate transcription of operably linked genes in selected target
tissues of interest is important because it may not be desirable to have expression of a gene in every
tissue, but only in certain tissues. Consequently, it is important to have a wide variety of choices of 5'
regulatory elements for any plant biotechnology strategy.
[0062] The advent of genomics, which comprises molecular and bioinformatics techniques, has
resulted in rapid sequencing and analyses of a large number of DNA samples from a vast number of
targets, including but not limited to plant species of agronomic importance. To identify the nucleic acid
sequences of the present invention from a database or collection of cDNA sequences, the first step
involves constructing cDNA libraries from specific plant tissue targets of interest. Briefly, the cDNA
libraries are first constructed from these tissues that are harvested at a particular developmental stage or
under particular environmental conditions. By identifying differentially expressed genes in plant tissues
at different developmental stages or under different conditions, the corresponding regulatory sequences
of those genes can be identified and isolated. Transcript imaging enables the identification of tissuepreferred sequences based on specific imaging of nucleic acid sequences from a cDNA library. By
transcript imaging as used herein is meant an analysis that compares the abundance of expressed genes
in one or more libraries. The clones contained within a cDNA library are sequenced and the sequences
compared with sequences from publicly available databases. Computer-based methods allow the
researcher to provide queries that compare sequences from multiple libraries. The process enables
quick identification of clones of interest compared with conventional hybridization subtraction methods
known to those of skill in the art.
[0063] Using conventional methodologies, cDNA libraries can be constructed from the mRNA
(messenger RNA) of a given tissue or organism using poly dT primers and reverse transcriptase
(Efstratiadis et al., Cell 7:279, 1976; Higuchi et al., Proc. Natl. Acad. Sci. U.S.A. 73:3146, 1976;
Maniatis et al., Cell 8:163, 1976; Land et al., Nucleic Acids Res. 9:2251, 1981; Okayama et al., Mol.
Cell. Biol. 2:161, 1982; Gubler et al., Gene 25:263, 1983).
[0064] Several methods can be employed to obtain full-length cDNA constructs. For example,
terminal transferase can be used to add homopolymeric tails of dC residues to the free 3' hydroxyl
groups (Land et al., Nucleic Acids Res. 9:2251, 1981). This tail can then be hybridized by a poly dG
oligo that can act as a primer for the synthesis of full length second strand cDNA. Okayama and Berg,
reported a method for obtaining full-length cDNA constructs (Mol. Cell Biol. 2:161, 1982). This
method has been simplified by using synthetic primer adapters that have both homopolymeric tails for
priming the synthesis of the first and second strands and restriction sites for cloning into plasmids
(Coleclough et al., Gene 34:305, 1985) and bacteriophage vectors (Krawinkel et al., Nucleic Acids Res.
14:1913, 1986; Han et al., Nucleic Acids Res. 15:6304, 1987).
[0065] These strategies can be coupled with additional strategies for isolating rare mRNA
populations. For example, a typical mammalian cell contains between 10,000 and 30,000 different
mRNA sequences (Davidson, Gene Activity in Early Development, 2nd ed., Academic Press, New
York, 1976). The number of clones required to achieve a given probability that a low-abundance
mRNA will be present in a cDNA library is N = (ln(1-P))/(ln(1-1/n)) where N is the number of clones
required, P is the probability desired, and 1/n is the fractional proportion of the total mRNA that is
represented by a single rare mRNA (Sambrook et al.,1989).
[0066] One method to enrich preparations of mRNA for sequences of interest is to fractionate by
size. One such method is to fractionate by electrophoresis through an agarose gel (Pennica et al.,
Nature 301:214, 1983). Another method employs sucrose gradient centrifugation in the presence of an
agent, such as methylmercuric hydroxide, that denatures secondary structure in RNA (Schweinfest et
al., Proc. Natl. Acad. Sci. U.S.A. 79:4997-5000, 1982).
120/503
[0067] ESTs can be sequenced by a number of methods. Two basic methods can be used for DNA
sequencing, the chain termination method (Sanger et al., Proc. Natl. Acad. Sci. U.S.A. 74: 5463, 1977)
and the chemical degradation method (Maxam and Gilbert, Proc. Nat. Acad. Sci. U.S.A. 74: 560,
1977). Automation and advances in technology, such as the replacement of radioisotopes with
fluorescence-based sequencing, have reduced the effort required to sequence DNA (Craxton, Methods,
2: 20, 1991; Ju et al., Proc. Natl. Acad. Sci. U.S.A. 92: 4347, 1995; Tabor and Richardson, Proc. Natl.
Acad. Sci. U.S.A. 92: 6339, 1995). Automated sequencers are available from a number of
manufacturers including Pharmacia Biotech, Inc., Piscataway, New Jersey (Pharmacia ALF); LI-COR,
Inc., Lincoln, Nebraska (LI-COR 4,000); and Millipore, Bedford, Massachusetts (Millipore
BaseStation).
[0068] ESTs longer than 150 bp have been found to be useful for similarity searches and mapping
(Adams et al., Science 252:1651, 1991). EST sequences normally range from 150-450 bases. This is
the length of sequence information that is routinely and reliably generated using single run sequence
data. Typically, only single run sequence data is obtained from the cDNA library (Adams et al.,
Science 252:1651, 1991). Automated single run sequencing typically results in an approximately 2-3%
error or base ambiguity rate (Boguski et al., Nature Genetics, 4:332, 1993).
[0069] EST databases have been constructed or partially constructed from, for example, C. elegans
(McCombrie et al., Nature Genetics 1:124, 1992); human liver cell line HepG2 (Okubo et al., Nature
Genetics 2:173, 1992); human brain RNA (Adams et al., Science 252:1651, 1991; Adams et al., Nature
355:632, 1992); Arabidopsis, (Newman et al., Plant Physiol. 106:1241, 1994); and rice (Kurata et al.,
Nature Genetics 8:365, 1994). The present invention uses ESTs from a number of cDNA libraries,
prepared from wheat tissues preferably from glume, lemma or palea, as a tool for the identification of
genes expressed in these target tissues, which then facilitates the isolation of 5' regulatory sequences
such as promoters that regulate the genes. In addition also EST libraries from floral tissues of rice are
required to help identify the gene specific homologue prior to promoter isolation as well as EST
libraries from other tissues are required as background libraries.
[0070] The ESTs generated from sequencing a range of cDNA libraries are stored in a computer
database and these "raw" ESTs are sorted in groups of contiguous ESTs, i.e. ESTs originating from
homologous mRNA transcripts in a process known as clustering.
[0071] A "cluster" is a group of sequences that share an identity of at least 90% over any 100 base
pair window. By aligning the members of a cluster and calculating the consensus, a single,
representative sequence for the cluster may be derived.
[0072] Computer-based sequence analyses can be used to identify differentially expressed sequences
including, but not limited to, those sequences expressed in one tissue compared with another tissue. For
example, a different set of sequences can be found from cDNA isolated from root tissue versus leaf
tissue. Accordingly, sequences can be compared from cDNA libraries prepared from plants grown
under different environmental or physiological conditions. Once the preferred sequences are identified
from the cDNA library of interest, the genomic clones can be isolated from a genomic library prepared
from the plant tissue, and corresponding regulatory sequences including but not limited to 5' regulatory
sequences can be identified and isolated.
[0073] In one preferred embodiment, expressed sequence tags (EST) sequences from a variety of
cDNA libraries are catalogued in a sequence database. This database is used to identify promoter
targets from a particular tissue of interest. The selection of expressed sequence tags for subsequent
promoter isolation is reflective of the presence of one or more sequences among the representative
ESTs from a random sampling of an individual cDNA library or a collection of cDNA libraries.
[0074] For example, the identification of regulatory sequences that direct the expression of transcripts
in tissue of interest is conducted by identifying ESTs found in tissues of interest such as lemma, palea
or glume, and absent or in lower abundance in other cDNA libraries in the database. The identified
EST leads are then used to identify the operably linked regulatory sequences from genomic DNA
sequences accordingly.
121/503
[0075] By abundance as used herein is meant the number of times a clone or cluster of clones appears
in a library. The sequences that are enhanced or in high abundance in a specific tissue or organ that
represent a target expression profile are identified in this manner and primers can be designed from the
identified EST sequences. A PCR-based approach can be used to amplify flanking regions from a
genomic library of the target plant of interest. A number of methods are known to those of skill in the
art to amplify unknown DNA sequences adjacent to a core region of known sequence. Methods include
but are not limited to inverse PCR (IPCR), vectorette PCR, Y-shaped PCR, and genome walking
approaches.
[0076] In a preferred embodiment, genomic DNA ligated to an adaptor is subjected to a primary
round of PCR amplification with a gene-specific primer and a primer that anneals to the adaptor
sequence. The PCR product is next used as the template for a nested round of PCR amplification with a
second gene-specific primer and second adaptor. The resulting fragments from the nested PCR reaction
are then isolated, purified and subcloned into an appropriate vector. The fragments are sequenced, and
the translational start sites can be identified when the EST is derived from a truncated cDNA. The
fragments can be cloned into plant expression vectors as transcriptional or translational fusions with a
reporter gene such as beta -glucuronidase (GUS). The constructs can be tested in transient analyses,
and subsequently the 5' regulatory regions are operably linked to other genes and regulatory sequences
of interest in a suitable plant transformation vector and the transformed plants are analyzed for the
expression of the gene(s) of interest, by any number of methods known to those of skill in the art.
[0077] Any plant can be selected for the identification of genes and regulatory sequences. Examples
of suitable plant targets for the isolation of genes and regulatory sequences would include but are not
limited to Acadia, alfalfa, apple, apricot, Arabidopsis, artichoke, arugula, asparagus, avocado, banana,
barley, beans, beet, blackberry, blueberry, broccoli, brussels sprouts, cabbage, canola, cantaloupe,
carrot, cassava, castorbean, cauliflower, celery, cherry, chicory, cilantro, citrus, clementines, clover,
coconut, coffee, corn, cotton, cucumber, Douglas fir, eggplant, endive, escarole, eucalyptus, fennel,
figs, garlic, gourd, grape, grapefruit, honey dew, jicama, kiwifruit, lettuce, leeks, lemon, lily, lime,
Loblolly pine, linseed, mango, melon, mushroom, nectarine, nut, oat, oil palm, oil seed rape, okra,
olive, onion, orange, an ornamental plant, palm, papaya, parsley, parsnip, pea, peach, peanut, pear,
pepper, persimmon, pine, pineapple, plantain, plum, pomegranate, poplar, potato, pumpkin, quince,
radiata pine, radiscchio, radish, rapeseed, raspberry, rice, rye, sorghum, Southern pine, soybean,
spinach, squash, strawberry, sugarbeet, sugarcane, sunflower, sweet potato, sweetgum, tangerine, tea,
tobacco, tomato, triticale, turf grasses, turnip, a vine, watermelon, wheat, yams, and zucchini.
Particularly preferred plant targets would include corn, cotton, rice, rye, barley, sorghum, oats,
soybean, and wheat, most preferably wheat.
[0078] Any method that allows a differential comparison between different types or classes of
sequences can be used to isolate genes or regulatory sequences of interest. For example, in one
differential screening approach, a cDNA library from mRNA isolated from a particular tissue can be
prepared in a bacteriophage host using a commercially available cloning kit. The plaques are spread
onto plates containing lawns of a bacterial host such as E. coli to generate bacteriophage plaques.
About 10>;5; - 10>;6; plaques can be lifted onto DNA-binding membranes. Duplicate membranes are
probed using probes generated from mRNA from the target and non-target or background tissue. The
probes are labeled to facilitate detection after hybridization and development. Plaques that hybridize to
target tissue-derived probes but not to non-target tissue derived probes that display a desired
differential pattern of expression can be selected for further analysis. Genomic DNA libraries can also
be prepared from a chosen species by partial digestion with a restriction enzyme and size selecting the
DNA fragments within a particular size range. The genomic DNA can be cloned into a suitable vector
including but not limited to a bacteriophage and prepared using a suitable vector such as a
bacteriophage using a suitable cloning kit from any number of vendors (see for example Stratagene, La
Jolla CA or Gibco BRL, Gaithersburg, MD).
[0079] Differential hybridization techniques as described are well known to those of skill in the art
and can be used to isolate a desired class of sequences. By classes of sequences as used herein is meant
sequences that can be grouped based on a common identifier including but not limited to sequences
isolated from a common target plant, a common library, or a common plant tissue type. In a preferred
embodiment, sequences of interest are identified based on sequence analyses and querying of a
collection of diverse cDNA sequences from libraries of different tissue types. The disclosed method
122/503
provides an example of a differential screening approach based on electronic sequence analyses of
plant ESTs derived from diverse cDNA libraries.
[0080] A number of methods used to assess gene expression are based on measuring the mRNA level
in an organ, tissue, or cell sample. Typical methods include but are not limited to RNA blots,
ribonuclease protection assays and RT-PCR. In another preferred embodiment, a high-throughput
method is used whereby regulatory sequences are identified from a transcript profiling approach. The
development of cDNA microarray technology enables the systematic monitoring of gene expression
profiles for thousands of genes (Schena et al, Science, 270: 467, 1995). This DNA chip-based
technology arrays thousands of cDNA sequences on a support surface. These arrays are simultaneously
hybridized to multiple labeled cDNA probes prepared from RNA samples of different cell or tissue
types, allowing direct comparative analysis of expression. This technology was first demonstrated by
analyzing 48 Arabidopsis genes for differential expression in roots and shoots (Schena et al, Science,
270:467, 1995). More recently, the expression profiles of over 1400 genes were monitored using cDNA
microarrays (Ruan et al, The Plant Journal 15:821, 1998). Microarrays provide a high-throughput,
quantitative and reproducible method to analyze gene expression and characterize gene function. The
transcript profiling approach using microarrays thus provides another valuable tool for the isolation of
regulatory sequences such as promoters associated with those genes.
[0081] The present invention uses high throughput sequence analyses to form the foundation of rapid
computer-based identification of sequences of interest. Those of skill in the art are aware of the
resources available for sequence analyses. Sequence comparisons can be done by determining the
similarity of the test or query sequence with sequences in publicly available or proprietary databases
("similarity analysis") or by searching for certain motifs ("intrinsic sequence analysis") (e.g., cis
elements) (Coulson, Trends in Biotechnology, 12:76, 1994; Birren et al., Genome Analysis, 1:543,
1997).
[0082] The nucleotide sequences provided in SEQ ID NOS: 1-3 or fragments thereof, or
complements thereof, or a nucleotide sequence at least 90% identical, preferably 95% identical even
more preferably 99% or 100% identical to the sequence provided in SEQ ID NOS: 1-3 or fragment
thereof, or complement thereof, can be "provided" in a variety of mediums to facilitate use. Such a
medium can also provide a subset thereof in a form that allows one of skill in the art to examine the
sequences.
[0083] In one application of this embodiment, a nucleotide sequence of the present invention can be
recorded on computer readable media. As used herein, "computer readable media" refers to any
medium that can be read and accessed directly by a computer. Such media include, but are not limited
to: magnetic storage media, such as floppy discs, hard disc, storage medium, and magnetic tape; optical
strorage media such as CD-ROM; electrical storage media such as RAM and ROM; and hybrids of
these categories such as magnetic/optical storage media. One of skill in the art can readily appreciate
how any of the presently known computer readable media can be used to create a manufacture
comprising computer readable medium having recorded thereon a nucleotide sequence of the present
invention.
[0084] By providing one or more of nucleotide sequences of the present invention, those of skill in
the art can routinely access the sequence information for a variety of purposes. Computer software is
publicly available that allows one of skill in the art to access sequence information provided in a
computer readable medium. Examples of public databases would include but are not limited to the
DNA Database of Japan (DDBJ) (http://www.ddbj.nig.ac.jp/);Genbank
(http://www.ncbi.nlm.nih.gov/web/Genbank/Index.html); and the European Molecular Biology
Laboratory Nucleic Acid Sequence Database (EMBL) (http://www.ebi.ac.uk/ebi_docs/embl_db.html)
or versions thereof. A number of different search algorithms have been developed, including but not
limited to the suite of programs referred to as BLAST programs. There are five implementations of
BLAST, three designed for nucleotide sequence queries (BLASTN, BLASTX, and TBLASTX) and
two designed for protein sequence queries (BLASTP and TBLASTN) (Coulson, Trends in
Biotechnology, 12:76-80, 1994; Birren et al., Genome Analysis, 1:543, 1997).
[0085] BLASTN takes a nucleotide sequence (the query sequence) and its reverse complement and
searches them against a nucleotide sequence database. BLASTN was designed for speed, not maximum
123/503
sensitivity, and may not find distantly related coding sequences. BLASTX takes a nucleotide sequence,
translates it in three forward reading frames and three reverse complement reading frames, and then
compares the six translations against a protein sequence database. BLASTX is useful for sensitive
analysis of preliminary (single-pass) sequence data and is tolerant of sequencing errors (Gish and
States, Nature Genetics, 3: 266-272 (1993), herein incorporated by reference). BLASTN and BLASTX
may be used in concert for analyzing EST data (Coulson, Trends in Biotechnology, 12: 76-80 (1994);
Birren, et al., Genome Analysis, 1: 543-559 (1997)).
[0086] Given a coding nucleotide sequence and the protein it encodes, it is often preferable to use the
protein as the query sequence to search a database because of the greatly increased sensitivity to detect
more subtle relationships. This is due to the larger alphabet of proteins (20 amino acids) compared with
the alphabet of nucleic acid sequences (4 bases), where it is far easier to obtain a match by chance. In
addition, with nucleotide alignments, only a match (positive score) or a mismatch (negative score) is
obtained, but with proteins, the presence of conservative amino acid substitutions can be taken into
account. Here, a mismatch may yield a positive score if the non-identical residue has physical/chemical
properties similar to the one it replaced. Various scoring matrices are used to supply the substitution
scores of all possible amino acid pairs. A general purpose scoring system is the BLOSUM62 matrix
(Henikoff and Henikoff, Proteins, 17: 49-61 (1993), herein incorporated by reference in its entirety),
which is currently the default choice for BLAST programs. BLOSUM62 is tailored for alignments of
moderately diverged sequences and thus may not yield the best results under all conditions. Altschul, J.
Mol. Biol. 36: 290-300 (1993), herein incorporated by reference in its entirety, uses a combination of
three matrices to cover all contingencies. This may improve sensitivity, but at the expense of slower
searches. In practice, a single BLOSUM62 matrix is often used but others (PAM40 and PAM250) may
be attempted when additional analysis is necessary. Low PAM matrices are directed at detecting very
strong but localized sequence similarities, whereas high PAM matrices are directed at detecting long
but weak alignments between very distantly related sequences.
[0087] Homologues in other organisms are available that can be used for comparative sequence
analysis. Multiple alignments are performed to study similarities and differences in a group of related
sequences. CLUSTAL W is a multiple sequence alignment package available that performs progressive
multiple sequence alignments based on the method of Feng and Doolittle, J. Mol. Evol. 25: 351-360
(1987), the entirety of which is herein incorporated by reference. Each pair of sequences is aligned and
the distance between each pair is calculated; from this distance matrix, a guide tree is calculated, and
all of the sequences are progressively aligned based on this tree. A feature of the program is its
sensitivity to the effect of gaps on the alignment; gap penalties are varied to encourage the insertion of
gaps in probable loop regions instead of in the middle of structured regions. Users can specify gap
penalties, choose between a number of scoring matrices, or supply their own scoring matrix for both
the pairwise alignments and the multiple alignments. CLUSTAL W for UNIX and VMS systems is
available at: ftp.ebi.ac.uk. Another program is MACAW (Schuler et al., Proteins, Struct. Func. Genet,
9:180-190 (1991), the entirety of which is herein incorporated by reference, for which both Macintosh
and Microsoft Windows versions are available. MACAW uses a graphical interface, provides a choice
of several alignment algorithms, and is available by anonymous ftp at: ncbi.nlm.nih.gov
(directory/pub/macaw).
[0088] Any program designed for motif searching also has utility in the present invention. Sequence
analysis programs designed for motif searching can be used for identification of cis elements. Preferred
computer programs would include but are not limited to MEME, SIGNAL SCAN, and GENESCAN.
MEME is a program that identifies conserved motifs (either nucleic acid or peptide) in a group of
unaligned sequences. MEME saves these motifs as a set of profiles. These profiles can be used to
search a database of sequences. A MEME algorithm (version 2.2) can be found in version 10.0 of the
GCG package; MEME (Bailey and Elkan, Machine Learning, 21(1-2):51-80,1995 and the location of
the website is http://www.sdsc.edu/MEME/meme/website/COPYRIGHT.html. SIGNALSCAN is a
program that identifies known motifs in the test sequences using information from other motif
databases (Prestridge, CABIOS 7, 203-206, 1991). SIGNALSCAN version 4.0 information is available
at the following website: http://biosci.cbs.umn.edu/software/sigscan.html. The ftp site for
SIGNALSCAN is ftp://biosci.cbs.umn.edu/software/sigscan.html. Databases used with SIGNALSCAN
include PLACE (http://www.dna.affrc.go.ip/htdocs/PLACE; Higo et al., Nucleic Acids Research
27(1):297-300, 1999) and TRANSFAC (Heinemeye, X. et al., Nucleic Acid Research 27(1):318-322)
that can be found at the following website: http://transfac.gbf.de/. GENESCAN is another suitable
124/503
program for motif searching (Burge and Karlin, J. Mol. Biol. 268, 78-94, 1997), and version 1.0
information is available at the following website: http://gnomic.stanford.edu/GENESCANW.html. As
used herein, "a target structural motif' or "target motif" refers any rationally selected sequence or
combination of sequences in which the sequence(s) are chosen based on a three-dimensional
configuration that is formed upon the folding of the target motif. There are a variety of target motifs
known to those of skill in the art. Protein target motifs include, but are not limited to, enzymatic active
sites and signal sequences. Preferred target motifs of the present invention would include but are not
limited to promoter sequences, cis elements, hairpin structures and other expression elements such as
protein binding sequences.
[0089] As used herein, "search means" refers to one or more programs that are implemented on the
computer-based system to compare a target sequence or target structural motif with the sequence
information stored within the data storage means. Search means are used to identify fragments or
regions of the sequences of the present invention that match a particular target sequence or target motif.
Multiple sequences can also be compared in order to identify common regions or motifs that may be
responsible for specific functions. For example, cis elements or sequence domains that confer a specific
expression profile can be identified when multiple promoter regions of similar classes of promoters are
aligned and analyzed by certain software packages.
[0090] The present invention further provides systems, particularly computer-based systems, that
contain the sequence information described herein. As used herein, a "computer-based system" refers
to the hardware means, software means, and data storage means used to analyze the nucleotide
sequence information of the present invention. The minimum hardware means of the computer-based
systems of the present invention comprises a central processing unit (CPU), input means, output means,
and data storage means. Those of skill in the art can appreciate that any one of the available computerbased systems are suitable for use in the present invention.
[0091] In a preferred embodiment, the flanking sequences containing the 5' regulatory elements of
the present invention are isolated using a genome-walking approach (Universal GenomeWalker TM
Kit, CLONTECH Laboratories, Inc., Palo Alto, CA). In brief, the purified genomic DNA is subjected
to a restriction enzyme digest that produces genomic DNA fragments with ends that are ligated with
GenomeWalker TM adaptors. GenomeWalker TM primers are used along with gene specific primers
in two consecutive PCR reactions (primary and nested PCR reactions) to produce PCR products
containing the 5' regulatory sequences that are subsequently cloned and sequenced.
[0092] In addition to their use in modulating gene expression, the promoter sequences of the present
invention also have utility as probes or primers in nucleic acid hybridization experiments. The nucleic
acid probes and primers of the present invention can hybridize under stringent conditions to a target
DNA sequence. The term "stringent hybridization conditions" is defined as conditions under which a
probe or primer hybridizes specifically with a target sequence(s) and not with non-target sequences, as
can be determined empirically. The term "stringent conditions" is functionally defined with regard to
the hybridization of a nucleic-acid probe to a target nucleic acid (i.e., to a particular nucleic-acid
sequence of interest) by the specific hybridization procedure (see for example Sambrook et al., 1989, at
9.52-9.55 and 9.47-9.52, 9.56-9.58; Kanehisa, Nucl. Acids Res. 12:203-213, 1984; Wetmur and
Davidson, J. Mol. Biol. 31:349-370, 1968). Appropriate stringency conditions that promote DNA
hybridization are, for example, 6.0 x sodium chloride/sodium citrate (SSC) at about 45 DEG C,
followed by a wash of 2.0 x SSC at 50 DEG C, and they are known to those skilled in the art or can be
found in laboratory manuals including but not limited to Current Protocols in Molecular Biology, John
Wiley & Sons, N.Y., 1989, 6.3.1-6.3.6. For example, the salt concentration in the wash step can be
selected from a low stringency of about 2.0 x SSC at 50 DEG C to a high stringency of about 0.2 x
SSC at 50 DEG C. In addition, the temperature in the wash step can be increased from low stringency
conditions at room temperature, about 22 DEG C, to high stringency conditions at about 65 DEG C.
Both temperature and salt may be varied, or either the temperature or the salt concentration may be
held constant while the other variable is changed. For example, hybridization using DNA or RNA
probes or primers can be performed at 65 DEG C in 6x SSC, 0.5% SDS, 5x Denhardt's, 100 mu g/mL
nonspecific DNA (e.g., sonicated salmon sperm DNA) with washing at 0.5x SSC, 0.5% SDS at 65
DEG C, for high stringency.
125/503
[0093] It is contemplated that lower stringency hybridization conditions such as lower hybridization
and/or washing temperatures can be used to identify related sequences having a lower degree of
sequence similarity if specificity of binding of the probe or primer to target sequence(s) is preserved.
Accordingly, the nucleotide sequences of the present invention can be used for their ability to
selectively form duplex molecules with complementary stretches of DNA fragments. Detection of
DNA segments via hybridization is well-known to those of skill in the art. Thus depending on the
application envisioned, one will desire to employ varying hybridization conditions to achieve varying
degrees of selectivity of probe towards target sequence and the method of choice will depend on the
desired results.
[0094] The nucleic acid sequences in SEQ ID NOS: 1-3 and any variants thereof, are capable of
hybridizing to other nucleic acid sequences under appropriately selected conditions of stringency. As
used herein, two nucleic acid molecules are said to be capable of specifically hybridizing to one
another if the two molecules are capable of forming an anti-parallel, double-stranded nucleic acid
structure. A nucleic acid molecule is said to be the "complement" of another nucleic acid molecule if
they exhibit complementarity. As used herein, molecules are said to exhibit "complete
complementarity" when every nucleotide of one of the molecules is complementary to a nucleotide of
the other. Two molecules are said to be "minimally complementary" if they can hybridize to one
another with sufficient stability to permit them to remain annealed to one another under at least
conventional "low stringency" conditions. Similarly, the molecules are said to be "complementary" if
they can hybridize to one another with sufficient stability to permit them to remain annealed to one
another under conventional "high stringency" conditions. Conventional stringency conditions are
described by Sambrook et al. (Molecular Cloning, A Laboratory Manual, 2>;nd; Ed., Cold Spring
Harbor Press, Cold Spring Harbor, New York, 1989), and by Haymes et al. (Nucleic Acid
Hybridization, A Practical Approach, IRL Press, Washington, DC, 1985).
[0095] In a preferred embodiment, the nucleic acid sequences SEQ ID NOS: 1-3 or a fragment,
region, cis element, or oligomer of these sequences may be used in hybridization assays of other plant
tissues to identify closely related or homologous genes and associated regulatory sequences. These
include but are not limited to Southern or northern hybridization assays on any substrate including but
not limited to an appropriately prepared plant tissue, cellulose, nylon, or combination filter, chip, or
glass slide. Such methodologies are well known in the art and are available in a kit or preparation that
can be supplied by commercial vendors.
[0096] Of course, nucleic acid fragments can also be obtained by other techniques such as by directly
synthesizing the fragment by chemical means, as is commonly practiced by using an automated
oligonucleotide synthesizer. Fragments can also be obtained by application of nucleic acid reproduction
technology, such as the PCR TM (polymerase chain reaction) technology or by recombinant DNA
techniques generally known to those of skill in the art of molecular biology. Regarding the
amplification of a target nucleic- acid sequence (e.g., by PCR) using a particular amplification primer
pair, "stringent PCR conditions" refer to conditions that permit the primer pair to hybridize only to the
target nucleic-acid sequence to which a primer having the corresponding wild-type sequence (or its
complement) would bind and preferably to produce a unique amplification product.
[0097] A fragment of a nucleic acid as used herein is a portion of the nucleic acid that is less than
full-length. For example, for the present invention any length of nucleotide sequence that is less than
the disclosed nucleotide sequences of SEQ ID NOS: 1-3 is considered to be a fragment. A fragment
can also comprise at least a minimum length capable of hybridizing specifically with a native nucleic
acid under stringent hybridization conditions as defined above. The length of such a minimal fragment
is preferably at least 8 nucleotides, more preferably 15 nucleotides, even more preferably at least 20
nucleotides, and most preferably at least 30 nucleotides of a native nucleic acid sequence.
[0098] The nucleic acid sequences of the present invention can also be used as probes and primers.
Nucleic acid probes and primers can be prepared based on a native gene sequence. A "probe" is an
isolated nucleic acid to which is attached a conventional detectable label or reporter molecule, e.g., a
radioactive isotope, ligand, chemiluminescent agent, or enzyme. "Primers" are isolated nucleic acids
that are annealed to a complementary target DNA strand by nucleic acid hybridization to form a hybrid
between the primer and the target DNA strand, then extended along the target DNA strand by a
polymerase, e.g., a DNA polymerase. Primer pairs can be used for amplification of a nucleic acid
126/503
sequence, e.g., by the polymerase chain reaction (PCR) or other conventional nucleic-acid
amplification methods.
[0099] Probes and primers are generally 15 nucleotides or more in length, preferably 20 nucleotides
or more, more preferably 25 nucleotides, and most preferably 30 nucleotides or more. Such probes and
primers hybridize specifically to a target DNA or RNA sequence under high stringency hybridization
conditions and hybridize specifically to a target native sequence of another species under lower
stringency conditions. Preferably, probes and primers according to the present invention have complete
sequence similarity with the native sequence, although probes differing from the native sequence and
that retain the ability to hybridize to target native sequences may be designed by conventional methods.
Methods for preparing and using probes and primers are described (see Sambrook et al., 1989; Ausubel
et al., 1992, and Innis et al., 1990). PCR-primer pairs can be derived from a known sequence, for
example, by using computer programs intended for that purpose such as Primer (Version 0.5, copy&
1991, Whitehead Institute for Biomedical Research, Cambridge, MA). Primers and probes based on the
native promoter sequences disclosed herein can be used to confirm and, if necessary, to modify the
disclosed sequences by conventional methods, e.g., by re-cloning and re-sequencing.
[0100] In another embodiment, the nucleotide sequences of the promoters disclosed herein can be
modified. Those skilled in the art can create DNA molecules that have variations in the nucleotide
sequence. The nucleotide sequences of the present invention as shown in SEQ ID NOS: 1-3 may be
modified or altered to enhance their control characteristics. One preferred method of alteration of a
nucleic acid sequence is to use PCR to modify selected nucleotides or regions of sequences. These
methods are known to those of skill in the art. Sequences can be modified, for example by insertion,
deletion or replacement of template sequences in a PCR-based DNA modification approach. "Variant"
DNA molecules are DNA molecules containing changes in which one or more nucleotides of a native
sequence is deleted, added, and/or substituted, preferably while substantially maintaining promoter
function. In the case of a promoter fragment, "variant" DNA can include changes affecting the
transcription of a minimal promoter to which it is operably linked. Variant DNA molecules can be
produced, for example, by standard DNA mutagenesis techniques or by chemically synthesizing the
variant DNA molecule or a portion thereof.
[0101] In another embodiment, the nucleotide sequences as shown in SEQ ID NOS: 1-3 include any
length of said nucleotide sequences that are capable of regulating an operably linked DNA sequence.
For example, the sequences as disclosed in SEQ ID NOS: 1-3 may be truncated or portions deleted and
still be capable of regulating transcription of an operably linked DNA sequence. In a related
embodiment, a cis element of the disclosed sequences may confer a particular specificity such as
conferring enhanced expression of operably linked DNA sequences in certain tissues. Consequently,
any sequence fragments, portions, or regions of the disclosed sequences of SEQ ID NOS: 1-3 can be
used as regulatory sequences including but not limited to cis elements or motifs of the disclosed
sequences. For example, one or more base pairs may be deleted from the 5' or 3' end of a promoter
sequence to produce a "truncated" promoter. One or more base pairs can also be inserted, deleted, or
substituted internally to a promoter sequence. Promoters can be constructed such that promoter
fragments or elements are operably linked for example, by placing such a fragment upstream of a
minimal promoter. A minimal or basal promoter is a piece of DNA that is capable of recruiting and
binding the basal transcription machinery. One example of basal transcription machinery in eukaryotic
cells is the RNA polymerase II complex and its accessory proteins. The enzymatic components of the
basal transcription machinery are capable of initiating and elongating transcription of a given gene,
utilizing a minimal or basal promoter. That is, there are not added cis-acting sequences in the promoter
region that are capable of recruiting and binding transcription factors that modulate transcription, e.g.,
enhance, repress, render transcription hormone-dependent, etc. Substitutions, deletions, insertions or
any combination thereof can be combined to produce a final construct.
[0102] Native or synthetic nucleic acids according to the present invention can be incorporated into
recombinant nucleic acid constructs, typically DNA constructs, capable of introduction into and
replication in a host cell. In one preferred embodiment, the nucleotide sequences of the present
invention as shown in SEQ ID NOS: 1-3 or fragments, variants or derivatives thereof are incorporated
into an expression vector cassette that includes the promoter regions of the present invention operably
linked to a genetic component such as a selectable, screenable, or scorable marker gene. The disclosed
nucleic acid sequences of the present invention are preferably operably linked to a genetic component
127/503
such as a nucleic acid that confers a desirable characteristic associated with plant morphology,
physiology, growth and development, yield, nutritional enhancement, disease such as Fusarium head
blight disease, or pest resistance, environmental or chemical tolerance. These genetic components such
as marker genes or agronomic genes of interest can function in the identification of a transformed plant
cell or plant, or a produce a product of agronomic utility.
[0103] In a preferred embodiment, one genetic component produces a product that serves as a
selection device and functions in a regenerable plant tissue to produce a compound that would confer
upon the plant tissue resistance to an otherwise toxic compound. Genes of interest for use as a
selectable, screenable, or scorable marker would include but are not limited to GUS (coding sequence
for beta-glucuronidase), GFP (coding sequence for green fluorescent protein), LUX (coding gene for
luciferase), antibiotic resistance marker genes, or herbicide tolerance genes. Examples of transposons
and associated antibiotic resistance genes include the transposons Tns (bla), Tn5 (nptII), Tn7 (dhfr),
penicillins, kanamycin (and neomycin, G418, bleomycin); methotrexate (and trimethoprim);
chloramphenicol; and tetracycline.
[0104] Characteristics useful for selectable markers in plants have been outlined in a report on the use
of microorganisms (Advisory Committee on Novel Foods and Processes, July 1994). These include
stringent selection with minimum number of nontransformed tissues, large numbers of independent
transformation events with no significant interference with the regeneration, application to a large
number of species, and availability of an assay to score the tissues for presence of the marker.
[0105] A number of selectable marker genes are known in the art and several antibiotic resistance
markers satisfy these criteria, including those resistant to kanamycin (nptII), hygromycin B (aph IV)
and gentamycin (aac3 and aacC4). Useful dominant selectable marker genes include genes encoding
antibiotic resistance genes (e.g., resistance to hygromycin, kanamycin, bleomycin, G418, streptomycin
or spectinomycin); and herbicide resistance genes (e.g., phosphinothricin acetyltransferase). A useful
strategy for selection of transformants for herbicide resistance is described, e.g., in Vasil (Cell Culture
and Somatic Cell Genetics of Plants, Vols. I-III, Laboratory Procedures and Their Applications
Academic Press, New York, 1984). Particularly preferred selectable marker genes for use in the present
invention would include genes that confer resistance to compounds such as antibiotics like kanamycin
and herbicides like glyphosate (Della-Cioppa et al., Bio/Technology 5(6), 1987; U. S. Patent
5,463,175; U. S. Patent 5,633,435). Other selection devices can also be implemented and would still
fall within the scope of the present invention.
[0106] For the practice of the present invention, conventional compositions and methods for
preparing and using vectors and host cells are employed, as discussed, inter alia, in Sambrook et al.,
1989. In a preferred embodiment, the host cell is a plant cell. A number of vectors suitable for stable
transfection of plant cells or for the establishment of transgenic plants have been described in, e.g.,
Pouwels et al. (Cloning Vectors: A Laboratory Manual, 1985, supp. 1987); Weissbach and Weissbach
(Methods for Plant Molecular Biology, Academic Press, 1989); Gelvin et al. (Plant Molecular Biology
Manual, Kluwer Academic Publishers, 1990); and Croy (Plant Molecular Biology LabFax, BIOS
Scientific Publishers, 1993). Plant expression vectors can include, for example, one or more cloned
plant genes under the transcriptional control of 5' and 3' regulatory sequences. They can also include a
selectable marker as described to select for host cells containing the expression vector. Such plant
expression vectors also contain a promoter regulatory region (e.g., a regulatory region controlling
inducible or constitutive, environmentally or developmentally regulated, or cell- or tissue-specific
expression), a transcription initiation start site, a ribosome binding site, an RNA processing signal, a
transcription termination site, and a polyadenylation signal. Other sequences of bacterial origin are also
included to allow the vector to be cloned in a bacterial host. The vector will also typically contain a
broad host range prokaryotic origin of replication. In a particularly preferred embodiment, the host cell
is a plant cell and the plant expression vector comprises a promoter region as disclosed in SEQ ID
NOS: 1-3, an operably linked transcribable sequence, and a transcription termination sequence. Other
regulatory sequences envisioned as genetic components in an expression vector include, but is not
limited to, non-translated leader sequence that can be coupled with the promoter. Plant expression
vectors also can comprise additional sequences including but not limited to restriction enzyme sites that
are useful for cloning purposes.
128/503
[0107] A number of promoters have utility for plant gene expression for any gene of interest
including but not limited to selectable markers, scorable markers, genes for pest tolerance, disease
tolerance, nutritional enhancements and any other gene that confers a desirable trait or characteristic.
Examples of constitutive promoters useful for plant gene expression include, but are not limited to, the
cauliflower mosaic virus (CaMV) 35S promoter, which confers constitutive, high-level expression in
most plant tissues (see, e.g., Odel et al., Nature 313:810, 1985), including monocots (see, e.g.,
Dekeyser et al., Plant Cell 2:591, 1990; Terada and Shimamoto, Mol. Gen. Genet. 220:389, 1990); the
nopaline synthase promoter (An et al., Plant Physiol. 88:547, 1988); the octopine synthase promoter
(Fromm et al., Plant Cell 1:977, 1989); and the figwort mosaic virus (FMV) promoter as described in
U. S. Patent No. 5,378,619.
[0108] A variety of plant gene promoters that are regulated in response to environmental, hormonal,
chemical, and/or developmental signals can be used for expression of an operably linked gene in plant
cells, including promoters regulated by (1) heat (Callis et al., Plant Physiol. 88:965, 1988), (2) light
(e.g., pea rbcS-3A promoter, Kuhlemeier et al., Plant Cell 1:471, 1989; maize rbcS promoter, Schaffner
and Sheen, Plant Cell 3:997, 1991; or chlorophyll a/b-binding protein promoter, Simpson et al., EMBO
J. 4:2723, 1985), (3) hormones, such as abscisic acid (Marcotte et al., Plant Cell 1:969, 1989), (4)
wounding (e.g., wunI, Siebertz et al., Plant Cell 1:961, 1989); or (5) chemicals such as methyl
jasmonate, salicylic acid, or safener. It may also be advantageous to employ (6) organ-specific
promoters (e.g., Roshal et al., EMBO J. 6:1155, 1987; Schemthaner et al., EMBO J. 7:1249, 1988;
Bustos et al., Plant Cell 1:839, 1989).
[0109] Plant expression vectors can include RNA processing signals, e.g., introns, which may be
positioned upstream or downstream of a polypeptide-encoding sequence in the transgene. In addition,
the expression vectors may include additional regulatory sequences from the 3'-untranslated region of
plant genes (Thornburg et al., Proc. Natl. Acad. Sci. USA 84:744, 1987; An et al., Plant Cell 1:115,
1989), e.g., a 3' terminator region to increase mRNA stability of the mRNA, such as the PI-II
terminator region of potato or the octopine or nopaline synthase 3' terminator regions. Five-end nontranslated regions of a mRNA can play an important role in translation initiation and can also be a
genetic component in a plant expression vector. For example, non-translated 5' leader sequences
derived from heat shock protein genes have been demonstrated to enhance gene expression in plants
(see, for example U. S. Patent 5,362,865). These additional upstream and downstream regulatory
sequences may be derived from a source that is native or heterologous with respect to the other
elements present on the expression vector.
[0110] The promoter sequences of the present invention are used to control gene expression in
monocotyledonous plant cells, more specifically in cereals and even more specifically in defined wheat
cells. The disclosed promoter sequences are genetic components that are part of vectors used in plant
transformation. The promoter sequences of the present invention can be used with any suitable plant
transformation plasmid or vector containing a selectable or screenable marker and associated
regulatory elements, as described, along with one or more nucleic acids expressed in a manner
sufficient to confer a particular desirable trait. Examples of suitable structural genes of agronomic
interest envisioned by the present invention would include but are not limited to one or more genes for
insect tolerance such as a gene encoding a B.t endotoxin., pest tolerance such as genes for fungal
disease control, more specifically for Fusarium head blight disease control, herbicide tolerance such as
genes conferring glyphosate tolerance, and genes for quality improvements such as yield, physiology,
fertilizer, growth, development, morphology or plant product(s).
[0111] The promoter sequences of the present invention can be used in wheat tissue to control gene
expression involved in yield enhancement , anti-fungal and anti-microbial attack e.g. Fusarium,
Microdochium, Stagnospora and Blumeria. The promoter sequences according to the invention may be
used in controlling expression of those genes active against insecticidal damage to grain, normally
leading to pre-harvest sprouting because moisture gets into the insect damaged grain. In addition the
promoter sequences of the invention can be used in controlling expression of those genes having an
impact on plant stress e.g. heat or water stress.
[0112] Alternatively, the DNA coding sequences can effect these phenotypes by encoding a nontranslatable RNA molecule that causes the targeted inhibition of expression of an endogenous gene, for
example via antisense- or cosuppression-mediated mechanisms (see, for example, Bird et al., Biotech.
129/503
Gen. Engin. Rev. 9:207,1991). The RNA could also be a catalytic RNA molecule (i.e., a ribozyme)
engineered to cleave a desired endogenous mRNA product (see for example, Gibson and Shillitoe,
Mol. Biotech. 7:125,1997). Thus, any gene that produces a protein or mRNA that expresses a
phenotype or morphology change of interest is useful for the practice of the present invention.
[0113] In addition to regulatory elements or sequences located upstream (5') or within a DNA
sequence, there are downstream (3') sequences that affect gene expression and thus the term regulatory
sequence as used herein refers to any nucleotide sequence located upstream, within, or downstream to a
DNA sequence that controls, mediates, or affects expression of a gene product in conjunction with the
protein synthetic apparatus of the cell.
[0114] The promoter sequences of the present invention may be modified, for example for expression
in other plant systems. In another approach, novel hybrid promoters can be designed or engineered by a
number of methods. Many promoters contain upstream sequences that activate, enhance or define the
strength and/or specificity of the promoter (Atchison, Ann. Rev. Cell Biol. 4:127, 1988). T-DNA
genes, for example, contain "TATA" boxes defining the site of transcription initiation and other
upstream elements located upstream of the transcription initiation site modulate transcription levels
(Gelvin, In: Transgenic Plants, Kung and Us, eds, San Diego: Academic Press, pp.49-87, 1988).
Chimeric promoter combined a trimer of the octopine synthase (ocs) activator to the mannopine
synthase (mas) activator plus promoter and reported an increase in expression of a reporter gene (Min
Ni et al., The Plant Journal 7:661, 1995). The upstream regulatory sequences of the present invention
can be used for the construction of such chimeric or hybrid promoters. Methods for construction of
variant promoters of the present invention include but are not limited to combining control elements of
different promoters or duplicating portions or regions of a promoter (see for example U. S. Patent
5,110,732 and U. S. Patent 5,097,025). Those of skill in the art are familiar with the standard resource
materials that describe specific conditions and procedures for the construction, manipulation and
isolation of macromolecules (e.g., DNA molecules, plasmids, etc.), generation of recombinant
organisms and the screening and isolation of genes, (see for example Sambrook et al., Molecular
Cloning: A Laboratory Manual, Cold Spring Harbor Press, 1989; Maliga et al., Methods in Plant
Molecular Biology, Cold Spring Harbor Press, 1995; Birren et al., Genome Analysis: volume 1,
Analyzing DNA, (1997), volume 2, Detecting Genes, (1998), volume 3, Cloning Systems, (1999)
volume 4, Mapping Genomes, (1999), Cold Spring Harbor, New York).
[0115] The promoter sequences of the present invention may be incorporated into an expression
vector using screenable or scorable markers as described and tested in transient analyses that provide
an indication of gene expression in stable plant systems. Methods of testing gene expression in
transient assays are known to those of skill in the art. Transient expression of marker genes has been
reported using a variety of plants, tissues and DNA delivery systems. For example, types of transient
analyses can include but are not limited to direct gene delivery via electroporation or particle
bombardment of tissues in any transient plant assay using any plant species of interest. Such transient
systems would include but are not limited to protoplasts from suspension cultures in wheat (Zhou et al.,
Plant Cell Reports 12:612. 1993, electroporation of leaf protoplasts of wheat (Sethi et al., J. Crop Sci.
52: 152, 1983; electroporation of protoplast prepared from corn tissue (Sheen, The Plant Cell 3: 225,
1991), or particle bombardment of specific tissues of interest. The present invention encompasses the
use of any transient expression system to evaluate regulatory sequences operatively linked to selected
reporter genes, marker genes or agronomic genes of interest. Examples of plant tissues envisioned to
test in transients via an appropriate delivery system would include, but are not limited to, leaf base
tissues, callus, cotyledons, roots, endosperm, embryos, floral tissue, pollen, and epidermal tissue.
[0116] Any scorable or screenable marker can be used in a transient assay. Preferred marker genes
for transient analyses of the promoters or 5' regulatory sequences of the present invention include a
GUS gene or a GFP gene. The expression vectors containing the 5' regulatory sequences operably
linked to a marker gene are delivered to the tissues and the tissues are analyzed by the appropriate
mechanism, depending on the marker. The quantitative or qualitative analyses are used as a tool to
evaluate the potential expression profile of the 5' regulatory sequences when operatively linked to
genes of agronomic interest in stable plants. Ultimately, the 5' regulatory sequences of the present
invention are directly incorporated into suitable plant transformation expression vectors comprising the
5' regulatory sequences operatively linked to a transcribable DNA sequence interest, transformed into
130/503
plants and the stably transformed plants and progeny thereof analyzed for the desired expression profile
conferred by the 5' regulatory sequences.
[0117] Those of skill in the art are aware of the vectors suitable for plant transformation. Suitable
vectors would include but are not limited to disarmed Ti-plasmids for Agrobacterium-mediated
methods. These vectors can contain a resistance marker, 1-2 T-DNA borders, and origins of replication
for E. coli and Agrobacterium along with one or more genes of interest and associated regulatory
regions. Those of skill in the art are aware that for Agrobacterium-mediated approaches a number of
strains and methods are available. Such strains would include but are not limited to Agrobacterium
strains C58, LBA4404, EHA101 and EHA105. Particularly preferred strains are Agrobacterium
tumefaciens strains. Other DNA delivery systems for plant transformation are also known to those of
skill in the art and include, but are not limited to, particle bombardment of selected plant tissues.
[0118] Exemplary nucleic acids that may be introduced by the methods encompassed by the present
invention include, for example, DNA sequences or genes from another species, or even genes or
sequences that originate with or are present in the same species but are incorporated into recipient cells
by genetic engineering methods rather than classical reproduction or breeding techniques. However,
the term exogenous is also intended to refer to genes that are not normally present in the cell being
transformed, or perhaps simply not present in the form, structure, etc., as found in the transforming
DNA segment or gene, or genes that are normally present yet which one desires, e.g., to have overexpressed. Thus, the term "exogenous" or alternatively "heterologous" gene or DNA is intended to
refer to any gene or DNA segment that is introduced into a recipient cell, regardless of whether a
similar gene may already be present in such a cell. The type of DNA included in the exogenous DNA
can include DNA that is already present in the plant cell, DNA from another plant, DNA from a
different organism, or a DNA generated externally, such as a DNA sequence containing an antisense
message of a gene, or a DNA sequence encoding a synthetic or modified version of a gene.
[0119] The plant transformation vectors containing the promoter sequences of the present invention
may be introduced into plants by any plant transformation method. Several methods are available for
introducing DNA sequences into plant cells and are well known in the art. Suitable methods include but
are not limited to bacterial infection, binary bacterial artificial chromosome vectors, direct delivery of
DNA (e.g. via PEG-mediated transformation, desiccation/inhibition-mediated DNA uptake,
electroporation, agitation with silicon carbide fibers), and acceleration of DNA coated particles
(reviewed in Potrykus, Ann. Rev. Plant Physiol. Plant Mol. Biol., 42: 205, 1991).
[0120] Methods for specifically transforming dicots primarily use Agrobacterium tumefaciens. For
example, transgenic plants reported include but are not limited to cotton (U. S. Patent No. 5,004,863;
U. S. Patent No. 5,159,135; U. S. Patent No. 5,518,908, WO 97/43430), soybean (U. S. Patent No.
5,569,834; U. S. Patent No. 5,416,011; McCabe et al., Bio/Technology, 6:923, 1988; Christou et al.,
Plant Physiol., 87:671, 1988); Brassica (U. S. Patent No. 5,463,174), and peanut (Cheng et al., Plant
Cell Rep., 15: 653, 1996).
[0121] Similar methods have been reported in the transformation of monocots. Transformation and
plant regeneration using these methods have been described for a number of crops including but not
limited to asparagus (Asparagus officinalis; Bytebier et al., Proc. Natl. Acad. Sci. U.S.A., 84: 5345,
1987); barley (Hordeum vulgarae; Wan and Lemaux, Plant Physiol., 104: 37, 1994); maize (Zea mays;
Rhodes et al., Science, 240: 204, 1988; Gordon-Kamm et al., Plant Cell, 2: 603, 1990; Fromm et al.,
Bio/Technology, 8: 833, 1990; Koziel et al., Bio/Technology, 11: 194, 1993); oats (Avena sativa;
Somers et al., Bio/Technology, 10: 1589, 1992); orchardgrass (Dactylis glomerata; Horn et al., Plant
Cell Rep., 7: 469, 1988); rice (Oryza sativa, including indica and japonica varieties, Toriyama et al.,
Bio/Technology, 6: 10, 1988; Zhang et al., Plant Cell Rep., 7: 379, 1988; Luo and Wu, Plant Mol. Biol.
Rep., 6: 165, 1988; Zhang and Wu, Theor. Appl. Genet., 76: 835, 1988; Christou et al.,
Bio/Technology, 9: 957, 1991); sorghum (Sorghum bicolor; Casas et al., Proc. Natl. Acad. Sci. U.S.A.,
90: 11212, 1993); sugar cane (Saccharum spp.; Bower and Birch, Plant J., 2: 409, 1992); tall fescue
(Festuca arundinacea; Wang et al., Bio/Technology, 10: 691, 1992); turfgrass (Agrostis palustris;
Zhong et al., Plant Cell Rep., 13: 1, 1993); wheat (Triticum aestivum; Vasil et al., Bio/Technology, 10:
667, 1992; Weeks et al., Plant Physiol., 102: 1077, 1993; Becker et al., Plant, J. 5: 299, 1994), and
alfalfa (Masoud et al., Transgen. Res., 5: 313, 1996). It is apparent to those of skill in the art that a
131/503
number of transformation methodologies can be used and modified for production of stable transgenic
plants from any number of target crops of interest.
[0122] The transformed plants are analyzed for the presence of the genes of interest and the
expression level and/or profile conferred by the promoter sequences of the present invention. Those of
skill in the art are aware of the numerous methods available for the analysis of transformed plants. A
variety of methods are used to assess gene expression and determine if the introduced gene(s) is
integrated, functioning properly, and inherited as expected. For the present invention the promoters can
be evaluated by determining the expression levels of genes to which the promoters are operatively
linked. A preliminary assessment of promoter function can be determined by a transient assay method
using reporter genes, but a more definitive promoter assessment can be determined from the analysis of
stable plants. Methods for plant analysis include but are not limited to Southern blots or northern blots,
PCR-based approaches, biochemical analyses, phenotypic screening methods, field evaluations, and
immunodiagnostic assays.
[0123] The methods of the present invention including but not limited to cDNA library preparation,
genomic library preparation, sequencing, sequence analyses, PCR technologies, vector construction,
transient assays, and plant transformation methods are well known to those of skill in the art and are
carried out using standard techniques or modifications thereof.
[0124] The following examples are included to demonstrate preferred embodiments of the invention.
It should be appreciated by those of skill in the art that the techniques disclosed in the examples that
follow represent techniques discovered by the inventors to function well in the practice of the
invention. However, those of skill in the art should, in light of the present disclosure, appreciate that
many changes can be made in the specific embodiments that are disclosed and still obtain a like or
similar result without departing from the spirit and scope of the invention, therefore all matter set forth
or shown in the accompanying drawings is to be interpreted as illustrative and not in a limiting sense.
EXAMPLES
Example 1 - Plant material, RNA isolation and cDNA library construction
[0125] Tissue for the construction of the lemma/palea target library (LIB3399) is collected as
follows. Triticum aestivum (var. Bobwhite) seed are germinated and grown in a growth chamber
(humidity - 65%, temperature/light cycle - 16h light [18 DEG C]/8h dark [16 DEG C], light intensity 43kLux). Tissue harvest is carried out after approx. 8 weeks growth as plants reach stage 65 of the
BBCH growth scale (jointly developed by German agricultural institutes) when 50% of anthers are
extruded. Lemma and palea tissue is removed and placed immediately in liquid nitrogen with
subsequent storage at -80 DEG C.
[0126] Total RNA is purified from lemma and palea tissue using Trizol (Gibco BRL, Life
Technologies, Gaithersburg, Maryland U.S.A.), essentially as recommended by the manufacturer. Poly
A+ RNA (mRNA) is purified using magnetic oligo dT beads as recommended by the manufacturer
(Dynabeads, Dynal Corporation, Lake Success, New York U.S.A.).
[0127] Construction of plant cDNA libraries is well known in the art and a number of cloning
strategies exist. A number of cDNA library construction kits are commercially available. The
Superscript TM Plasmid System for cDNA synthesis and Plasmid Cloning (Gibco BRL, Life
Technologies, Gaithersburg, Maryland U.S.A.) was used, following the conditions suggested by the
manufacturer. cDNA is synthesised, size selected using a sephacryl column (500-2000 bp inclusive)
and directionally cloned into pSPORT1 (GibcoBRL, Life Technologies, Gaithersburg, Maryland
U.S.A.).
[0128] The cDNA libraries are plated on LB agar containing the appropriate antibiotics for selection
and incubated at 37 DEG C for a sufficient time to allow the growth of individual colonies. Single
132/503
colonies are placed in individual wells of 96-well microtiter plates containing LB liquid including the
selective antibiotics. The plates are incubated overnight at approximately 37 DEG C with gentle
shaking to promote growth of the cultures. Plasmid DNA is isolated from each clone using Qiaprep
plasmid isolation kits, using the conditions recommended by the manufacturer (Qiagen Inc., Santa
Clara, California U.S.A.).
[0129] The template plasmid DNA clones is sequenced by initiation from the 5' end of each cDNA
clone, the resultant sequences are referred to as expressed sequence tags (ESTs). The template plasmid
DNA clones is then sequenced. The cDNAs are sequenced using a commercially available sequencing
kit, such as the ABI PRISM dRhodamine Terminator Cycle Sequencing Ready Reaction Kit with
AmpliTaq TM DNA Polymerase, under the conditions recommended by the manufacturer (PE
Applied Biosystems, Foster City, CA).
[0130] A number of sequencing techniques are known in the art, including fluorescence-based
sequencing methodologies. These methods have the detection, automation and instrumentation
capability necessary for the analysis of large volumes of sequence data. Currently, the 377 DNA
Sequencer (Perkin-Elmer Corp., Applied Biosystems Div., Foster City, CA) allows the most rapid
electrophoresis and data collection. With these types of automated systems, fluorescent dye-labeled
sequence reaction products are detected and data entered directly into the computer, producing a
chromatogram that is subsequently viewed, stored, and analyzed using the corresponding software
programs. These methods are known to those of skill in the art and have been described and reviewed
(Birren et al., Genome Analysis: Analyzing DNA, 1, Cold Spring Harbor, New York, the entirety of
which is herein incorporated by reference).
Example 2 - EST Clustering
[0131] The ESTs generated from sequencing a range of T. asetivum cDNA libraries are stored in a
computer database. The 'raw' ESTs are sorted into groups of contiguous ESTs, i.e. ESTs originating
from homologous mRNA transcripts, in a process known as clustering.
[0132] The clustering process consists of three main steps:
1. The libraries are screened for vector contamination and poor quality sequence.
2. The sequences are compared to each other. Those sequences that have 90% identity over a 100
base pair range are considered to be in the same "bin".
3. All of the sequences in each "bin" are aligned generating a consensus sequence known as an EST
cluster sequence. The sequences in a "bin" that do not align are moved to a new bin.
[0133] The lemma and palea cDNA library (LIB3399) comprises 5856 clones each of which are
sequenced to produce an EST. These ESTs are then clustered with other available ESTs from further T.
aestivum cDNA libraries to produce a set of T. aestivum EST cluster sequences. Table 1 (in Appendix)
shows the 40 most abundant EST cluster sequences in LIB3399. Abundance is expressed as target
count (number of ESTs from LIB3399 comprising the cluster) and percentage abundance (target count
as a percentage of total number of ESTs in LIB3399).
Example 3 - Measuring abundance of EST clusters using BLAST
[0134] BLAST (Basic Local Alignment Search Tool) is a set of similarity search programs designed
to query DNA and protein sequence databases. The BLAST programs have been designed for speed,
with a minimal sacrifice of sensitivity to distant sequence relationships. The scores assigned in a
BLAST search have a well-defined statistical interpretation, making real matches easier to distinguish
from random background hits. BLAST uses a heuristic algorithm which seeks local as opposed to
global alignments and is therefore able to detect relationships among sequences which share only
isolated regions of similarity (Altschul et. al. J. Mol. Biol. 215(3): 403-410).
133/503
[0135] The number of ESTs originating from a particular library, that comprise a particular EST
cluster, provides a measure of the abundance of the corresponding mRNA transcript in the tissue used
to make the library.
[0136] The 96 most abundant EST clusters from LIB3399 were used as query sequences to search a
range of cDNA libraries (see table 2 in Appendix) using the BLAST algorithim. The number of 'hits'
with an E value >;= 1 x 10>;-7; and a bit score ;=100 (using default parameters except threshold
extension ;= 100) were collated for each cDNA library from which the number of 'hits' in each tissue
type was calculated (see table 3 in Appendix).
[0137] EST clusters selected were those in which the total number of hits in stem, leaf, embryo,
endosperm and root were >;5. Thirty seven of the 96 EST clusters analysed met this criteria. These
were further reduced to 30 EST clusters by selecting on the criteria of very low expression (>;=1 hit) in
stem, leaf, embryo, endosperm and root. However if some anther expression was evident a higher level
of expression in stem, leaf, embryo, endosperm and root was tolerated (>;=5 hits). See chart (Figure 1
in Appendix) for comparison of expression pattern of 3 EST clusters (3849_1, 17859_1 and 88_3
respectively) with desired expression pattern and another 4 with undesirable expression pattern.
Example 4 - Identification of homologous rice cDNAs and expression analysis
[0138] The 30 wheat EST clusters were then used as query sequences against an O. sativa unigene
database (Clustered and assembled whole rice species EST data set as of Sept. 21, 2000
(seqVersionCollection - Oryza_sativa_Unigene20000921) Last updated: October 19, 2000 11:55 AM)
to search for homologous rice cDNAs. Rice cDNA homologs were found for 25 of the 30 wheat EST
clusters (see table 5).
[0139] The 25 homologous rice cDNA sequences were then used as query sequences against a range
of O. sativa panicle and leaf/vegetative tissue EST databases (see table 4 in Appendix). The number of
hits (E value >;= 1 x 10>;-7;, bit score ;=100 and threshold extension ;= 100) were collated for tissue
type allowing comparison of the tissue type expression pattern.
[0140] See table 5 (in Appendix) for summary of the 30 wheat EST clusters associated rice cDNA
homolog and rice genomic DNA sequence.
[0141] Three rice cDNAs; 109_1.R2011, 618_3.R2011 and 5842_1.R2011 (named LP1, LP3 and
LP4 respectively) showed preferential expression in rice panicle over leaf tissue. A more stringent
analysis of the query/subject sequence alignment suggested these three cDNAs were even more
preferentially abundant in the panicle libraries than suggested by the original search conditions (see
Table 6 in Appendix).
Example 5 - Identification and cloning of putative promoter regions
[0142] The 25 identified rice cDNA homolog sequences were used as query sequences against an O.
sativa genomic DNA library to identify corresponding genomic DNA sequences (see summary table 5).
[0143] A BLASTX (all six nucleotide reading frames) search of GenPeptPRT database (publicly
available protein sequence) was conducted with the the three rice unigene cDNAs LP1, LP3 and LP4.
'Best hits' are shown below, cDNA / gDNA alignments follow table 6 in Appendix.
>;tb;>;TABLE; Columns=6
>;tb;
>;tb;Head Col 1: ID
>;tb;Head Col 2: Wheat EST Cluster
>;tb;Head Col 3: Rice cDNA homolog
>;tb;Head Col 4: Rice BAC homologue
134/503
>;tb;Head Col 5 to 6: 'Best hit' annotation
>;tb;
>;tb;SubHead Col 1:
>;tb;SubHead Col 2:
>;tb;SubHead Col 3:
>;tb;SubHead Col 4:
>;tb;SubHead Col 5: Accession
>;tb;SubHead Col 6: Description
>;tb;>;SEP;LP1>;SEP;TRIAE-CLUSTER3849
1>;SEP;109_1.R2011>;SEP;OSM13175>;SEP;AAC05507>;SEP;O. sativa 1-aminocyclopropane-1carboxylate oxidase (ACO2)
>;tb;>;SEP;LP3>;SEP;TRIAECLUSTER17859_1>;SEP;618_3.R2011>;SEP;OSM118362>;SEP;CAA81481>;SEP;O.sativa Sadenosyl methionine synthetase (pRSAM-1)
>;tb;>;SEP;LP4>;SEP;TRIAECLUSTER88_3>;SEP;5842_1.R2011>;SEP;OSM12402>;SEP;CAA59800>;SEP;Z.mays mRNA for
plasma membrane H+ ATPase.
>;tb;>;/TABLE;
[0144] The rice cDNA sequences were aligned with their corresponding rice genomic sequence, the
rice genomic sequence was translated in the same frame as the cDNA frame that gave rise to the hits
above. This enabled deduction of the position of the putative 'TATA' box and ATG translation start
codon for each genomic sequence (see figures 2, 3 and 4). Further evidence for the position of the
translation start codon was gathered by comparing the amino-terminal amino acid sequence of other
closely related protein sequences.
[0145] Nested pairs of oligonucleotide PCR primers were designed for each rice genomic DNA
sequence. An 'outer' primary pair were designed using primer design computer software (PrimerSelect DNAStar) to amplify a region from approximately 1700 bp upstream of the putative translation start
codon to 200 bp downstream of the putative translation start codon. This pair of primers were used
with a rice (Nipponbare) genomic DNA template to produce primary PCR products.
[0146] The 'inner' secondary pair of primers were designed manually. The forward primer either
incorporated a SalI site or annealed to a region immediately upstream of a SalI site within the putative
promoter, approximately 1500 bp upstream of the putative translation start codon. The reverse primer
was designed to anneal to the region of the putative ATG translation start codon but in so doing destroy
the ATG in the amplified product by a single base pair substitution. A NotI restriction site was also
included immediately downstream of the destroyed ATG codon. The secondary pair of primers were
used to PCR amplify the putative promoter using the primary PCR product as a template.
[0147] With this method approx. 1500 bp of each putative promoter, including nucleotides
immediately upstream of the putative ATG translation start codon, were amplified and cloned into a
suitable cloning vector using SalI and NotI restriction sites.
Example 6 - Promoter Analysis in Plants
[0148] For stable plant transformation the 5' regulatory sequences are cloned into a plant
transformation vector such as pMON-CAM1 shown (Figure 5). This is a double border (right and left
T-DNA borders) plant binary transformation vector and contains the following genetic components:
RACT is the first intron from the rice actin gene; GUS is the coding region for the reporter gene beta glucoronidase; NOS is the 3' termination signal from the nopaline synthase gene; Spec/Strep is the
coding region for spectinomycin and streptomycin resistance; ori-pUC and ori-V are origins of
replication; NPTII is the coding region for kanamycin resistance; HSP70 is an intron from the maize
heat shock protein 70 gene as described in U. S. Patent Nos. 5,593,874 (herein incorporated by
reference in its entirety) and 5,859,347 (herein incorporated by reference in its entirety); and CaMV35S
is the promoter for the 35S RNA from Cauliflower Mosaic Virus containing a duplication of the -90 to
-300 region.
135/503
[0149] The promoter is operably linked to the GUS reporter gene along with other regulatory
sequences including, but not limited to, non-translated leaders and terminators as described above, and
transformed into a target crop of interest via an appropriate delivery system such as Agrobacteriummediated transformation (see, for example, U. S. Patent No. 5,569,834, herein incorporated by
reference in its entirety, U. S. Patent No. 5,416,011, herein incorporated by reference in its entirety, U.
S. Patent No. 5,631,152, herein incorporated by reference in its entirety, U. S. Patent No. 5,159,135,
herein incorporated by reference in its entirety and U. S. Patent No. 5,004,863, herein incorporated by
reference in its entirety) or particle bombardment methods (see, for example, Patent Applns. WO
92/15675. WO 97/48814 and European Patent Appln. 586,355, and U. S. Patent Nos. 5,120,657,
5,503,998, 5,830,728 and 5,015,580, all of which are herein incorporated by reference in their entirety).
[0150] A large number of transformation and regeneration systems and methods are available and
well known to those skilled in the art. The stably transformed plants and progeny are subsequently
analyzed for expression of the gene in tissues of interest by any number of molecular,
immunodiagnostic, biochemical, and/or field evaluation methods known to those skilled in the art.
[0151] Wheat plants transformed with various promoter reporter constructs were analyzed for GUS
activity in the glume, lemma, palea and flag leaf respectively. The results obtained are shown in Table
7.
>;tb;>;TABLE; Id=Table 7. Columns=5
>;tb;Title: Comparison of GUS activity in wheat plants transformed with various promoter reporter
constructs.
>;tb;
>;tb;Head Col 1: Promoter
>;tb;Head Col 2: Glume
>;tb;Head Col 3: Lemma
>;tb;Head Col 4: Palea
>;tb;Head Col 5: Flag Leaf
>;tb;>;SEP;ScBV>;SEP;++++>;SEP;++++>;SEP;++++>;SEP;++++
>;tb;>;SEP;LP1>;SEP;++>;SEP;+++>;SEP;+++>;SEP;+
>;tb;>;SEP;LP3>;SEP;++>;SEP;++>;SEP;+++>;SEP;+
>;tb;>;SEP;LP4>;SEP;+++>;SEP;+++>;SEP;+++>;SEP;>;tb;>;SEP;PER1>;SEP;->;SEP;->;SEP;->;SEP;>;tb;>;/TABLE;
[0152] ScBV - promoter from Sugarcane badnavirus which drives constitutive expression (Tzafrir et.
al. 1998 Plant. Mol. Biol. 38, 347). PER1 - promoter of the Hordeum vulgare peroxiredoxin gene
which is expressed in embryo and aleurone tissue (Stacy et. al. 1996 Plant. Mol. Biol. 31, 1205). For
LP1, LP3 and LP4 : see SEQ.ID.NO.1, SEQ.ID.NO.2 and SEQ.ID.NO.3 respectively.
[0153] Tissues were dissected from numerous plants for each construct and individually stained
histochemically for GUS activity according to the protocol of Jefferson (1987, Plant. Mol. Biol. Rep. 5,
387). GUS activity was assessed by scoring the intensity of blue coloration by eye and assigning the
following values:
- for undetectable, + for detectable, and ++ for low, +++ for medium and ++++ for high.
[0154] LP4 was chosen for further analysis due to its superior expression pattern compared to LP1
and LP3. A LP4 GUS fusion reporter construct, without the RACT intron (= rice-actin intron) was
constructed by subcloning the LP4 promoter into the SalI and SmaI sites of pMON-CAM2 (fig.6).
[0155] Wheat plants were transformed with the pMON-CAM2 LP4 construct and the plants grown
alongside control plants transformed with LTP1:GUS (also constructed in pMON-CAM2) and
ScBV:GUS promoter reporter constructs. Tissues were dissected from a number of plants for each
construct (ScBV n=9, LP4 n=22 and LTP1 n=31) and individually stained and scored for GUS activity
as described above.
136/503
[0156] An individual plant transformed with LP4 gave rise to the expression pattern shown below
(table 8). The remaining LP4 plants had no detectable GUS expression in all tissues, as was the case for
all plants transformed with the LTP1 promoter. The LP4 promoter gave expression specifically in
glume tissue in wheat. Similar expression would be seen in the glume tissue of the male flower in corn;
the female flower may have a vestigial glume but apparently this is less anatomically similar to the
wheat glume than the male flower structure.
>;tb;>;TABLE; Id=Table 8. Columns=9
>;tb;Title: Comparison of GUS activity in wheat plants transformed with various promoter reporter
constructs. ScBV - promoter from Sugarcane Badnavirus which drives constitutive expression (Tzafrir
et. al. 1998 Plant. Mol. Biol. 38, 347). LTP1 - lipid transfer protein 1 promoter of Hordeum vulgare
which is expressed in the aleurone layer of developing and germinating seeds (Shiver et. al. 1992 Plant
Mol. Biol. 18, 585). For LP4 see SEQ.ID.NO.3.
>;tb;
>;tb;Head Col 1: Promoter
>;tb;Head Col 2: Glume
>;tb;Head Col 3: Lemma
>;tb;Head Col 4: Palea
>;tb;Head Col 5: Anther
>;tb;Head Col 6: Stigma
>;tb;Head Col 7: Ovary
>;tb;Head Col 8: Rachis
>;tb;Head Col 9: Flag Leaf
>;tb;ScBV>;SEP;+++>;SEP;++++>;SEP;++++>;SEP;++++>;SEP;++++>;SEP;++++>;SEP;++++>;SE
P;++++
>;tb;LP4>;SEP;+>;SEP;+>;SEP;->;SEP;->;SEP;->;SEP;->;SEP;->;SEP;>;tb;LTP1>;SEP;->;SEP;->;SEP;->;SEP;->;SEP;->;SEP;->;SEP;->;SEP;>;tb;>;/TABLE;
EMI68.1Data supplied from the esp@cenet database - Worldwide
Claims of EP1548117
Claims:
1. Monocotyledonous regulatory sequence capable of regulating transcription of an operably linked
nucleic acid sequence in lemma, palea and/or glume monocotyledonous tissue wherein said regulatory
sequence is of rice origin and wherein said tissue is of cereal preferebaly of wheat origin, and wherein
said regulatory sequence is an isolated nucleic acid sequence comprising a sequence selected from the
group consisting of SEQ ID NO: 3 or a fragment, region, or cis element thereof.
2. Monocotyledonous regulatory sequence according to claim 1 wherein the isolated nucleic acid
sequence is a promoter sequence.
3. Monocotyledonous regulatory sequence according to claim 2 wherein the promoter sequence is part
of a chimeric or hybrid promoter.
4. Monocotyledonous regulatory sequence according to claim 2 or 3 wherein the promoter sequence
further comprises a minimal promoter such as a minimal CaMV or a rice actin promoter.
5. Monocotyledonous regulatory sequence according to claim 4 wherein the minimal promoter is a
minimal CaMV 35S promoter.
6. A DNA construct comprising an isolated nucleic acid sequence selected from the group consisting of
SEQ ID NO: 3 or a fragment, region, or cis element thereof, and operably linked to said nucleic acid
sequence, a transcribable DNA sequence and a 3' non-translated region.
7. A plant cell comprising a DNA construct according to claim 6.
8. A plant tissue comprising a plant cell according to claim 7.
137/503
9. A transgenic plant or progeny thereof comprising a DNA construct comprising an isolated nucleic
acid sequence selected from the group consisting of SEQ ID NO: 3 or a fragment, region, or cis
element thereof, and operably linked to said nucleic acid sequence, a transcribable DNA sequence and
a 3' non-translated region.
10. Use of a monocotyledonous regulatory sequence according to any of claims 1-5 operably linked to
a nucleic acid sequence capable to regulate transcription of said nucleic acid sequence in lemma, palea
and/or glume monocotyledonous tissue.
11. A method of regulating transcription of a DNA sequence in a monocotyledonous plant tissue or
derivative thereof comprising operably linking a transcribable DNA sequence to a promoter comprising
a nucleic acid sequence selected from the group consisting of SEQ ID NO: 3 or fragment, region, or cis
element thereof wherein said promoter confers enhanced or decreased expression of the linked DNA
sequence.
12. The method of claim 11 comprising operably linking the DNA sequence to a hybrid or chimeric
promoter comprising the nucleic acid sequence selected from the group consisting of SEQ ID NO: 3 or
fragment, region or cis element thereof.
13. The method of claim 11 wherein operably linking the nucleic acid sequence selected from the
group consisting of SEQ ID NO: 3 or fragment, region or cis element thereof to said promoter confers
enhanced or decreased expression of the operably linked nucleic acid sequence in wheat tissue
preferably lemma, palea and/or glume.
14. The method of claim 11 comprising operably linking a minimal promoter to a nucleic acid
sequence selected form the group consisting of SEQ ID NO: 3 or fragment, region or cis element
thereof.
15. A method of producing a transgenic plant comprising introducing into a plant cell a DNA construct
comprising: (i) a promoter comprising a nucleic acid sequence selected from the group consisting of
SEQ ID NO: 3 or a fragment, region or cis element thereof, and, operably linked to said promoter, (ii) a
transcribable DNA sequence and (iii) a 3' non-translated region.Data supplied from the esp@cenet
database - Worldwide
138/503
21. FR2791347 - 9/29/2000
POLYPEPTIDE USEFUL FOR PROMOTING GROWTH OF PLANT CELL
COMPRISES PHYTOSULFOKIN PRECURSOR POLYPEPTIDE OF SPECIFIC
AMINO ACID SEQUENCE ORIGINATING FROM RICE PLANT
URL EPO =
http://v3.espacenet.com/textdoc?F=3&CY=ep&LG=en&IDX=FR2791347
Inventor(s):
SAKAGAMI YOJI (--); YANG HEPING (--); MATSUBAYASHI YOSHIKATSU
(--); NAKAMURA KENZO (--)
Applicant(s):
UNIV NAGOYA (JP)
IP Class 4 Digits: C07K; C12N
IP Class:C07K14/415; C12N15/29; C12N5/10; C12N5/04
E Class: C07K14/415; C12N15/82C8
Application Number:
FR20000000979 (20000126)
Priority Number: JP19990079612 (19990324)
Family: FR2791347
Equivalent:
US6403864; JP2000270869
Abstract:
Abstract of FR2791347
Precursor polypeptide (I) of phytosulfokin of rice plant origin consists of a sequence of 89 amino acids
(or a sequence where 1 or more amino acids are replaced or deleted) given in the specification.
139/503
Sulfuration of tyrosine residual group of phytosulfokin is capable of stimulating growth by secreting
sulfated tyrosine phytosulfokin. Independent claims are also included for the following: (1) a gene
encoding (I); and (2) plant transformed with gene encoding (I)Description:
Description of FR2791347
>;Desc/Clms Page number 1;
Cette invention est en rapport avec une séquence d'acides aminés d'un polypeptide précurseur de
phytosulfokine. La phytosulfokine est un peptide dont on sait qu'elle stimule la prolifération des
cellules végétales. Cette invention est en rapport aussi avec un gène qui code ce polypeptide
précurseur. De plus, cette invention est en rapport avec un procédé pour stimuler la prolifération des
cellules végétales par incorporation de ce gène dans une plante.
Ces dernières années, du fait du développement de l'étude des gènes végétaux, on a introduit différents
gènes étrangers dans des végétaux. Une telle technique est disponible pour plusieurs espèces végétales
et joue un rôle important dans le développement industriel. Par exemple, une telle technique permet la
production de nouvelles espèces végétales avec une productivité améliorée de leurs métabolites
secondaires.
Pour la production d'une plante transgénique, il est nécessaire de cultiver un petit nombre de cellules
transformées, où un certain gène exogène est incorporé, pour régénérer un végétal entier. Cependant,
dans le cas d'une cellule végétale où un certain gène exogène est incorporé, la prolifération d'une telle
cellule est très lente. Par conséquent, la régénération d'une plantule pour produire une plante
transgénique peut être difficile. Une cellule végétale sécrète dans le milieu extracellulaire des agents de
stimulation inconnus pour stimuler la division cellulaire. Cependant, quand les cellules végétales
existent en concentration insuffisante, la prolifération des cellules végétales devient difficile parce que
la durée nécessaire pour que le facteur de stimulation parvienne à une concentration suffisante est trop
longue, ou parce que la vitesse de dégradation du facteur de stimulation est plus grande que sa vitesse
de sécrétion. De plus, la culture cellulaire elle-même est difficile dans beaucoup d'espèces végétales, ou
la vitesse de prolifération cellulaire est très lente. Par conséquent, le développement d'une technique
permettant de stimuler la prolifération des cellules végétales a été désiré.
Les demandeurs ont isolé et purifié la phytosulfokine (PSK), à titre de facteur peptidique de
stimulation des végétaux évoqué ci-dessus (Y. Matsubayashi et Y. Sakagami, Proc. Natl. Acad. Sci.
USA 93, p. 7623,1996). La PSK est l'un des facteurs de stimulation des végétaux contenu dans ce que
l'on appelle "le milieu conditionné : MC", un milieu utilisé pour la culture cellulaire. On sait que la
PSK est sécrétée dans le milieu extra-cellulaire et a une fonction de type autocrine.
On sait aussi que les résidus tyrosine de PSK sont sulfatés par une modification post-traductionnelle.
L'existence de deux types de PSK, à savoir PSK-a etPSK-p,
>;Desc/Clms Page number 2;
est reconnue et les séquences correspondantes sont décrites au-dessous.PSK-p est un produit de
dégradation enzymatique de PSK-a et l'activité de prolifération cellulaire observée dansPSK-p est
inférieure au dixième de celle de PSK-a.
PSK-a: Tyr(S03H)-Ile-Tyr(S03H)-Thr-GlnPSK-p: Tyr(S03H)-Ile-Tyr(S03H)-Thr
L'existence d'un peptide végétal physiologiquement actif dans lequel les résidus tyrosine sont sulfatés
était inconnue jusqu'à la découverte de PSK. Mais chez les animaux on en connaît approximativement
30 types, y compris la cholécystokinine et la gastrine, qui présentent une telle propriété. Ce sont tous
des peptides sécrétés dans le milieu extra-cellulaire qui sont biosynthétisés sous forme de leurs
précurseurs, sulfatés et soumis à une maturation pendant leur passage dans l'appareil de Golgi. On
suppose que l'excision de la séquence de PSK se produit dans la même manière. La présence d'une
certaine séquence signal est prédite sur les peptides précurseurs dont les résidus tyrosine sont sulfatés
spécifiquement, car les peptides précurseurs sont sécrétés dans la région extracellulaire. À propos du
peptide PSK, l'existence d'un peptide précurseur est prédite sur la base d'une telle connaissance. Par
140/503
conséquent, le gène qui code le polypeptide précurseur de PSK du riz a été isolé et la séquence de bases
du gène du précurseur a été déterminée. Le gène ainsi obtenu a été incorporé dans des cellules Oc de
riz en culture, et l'effet du gène a été examiné. La surexpression du gène qui code le polypeptide
précurseur de PSK augmentait la sécrétion de PSK dans le milieu cultivé et favorisait la prolifération
des cellules Oc du riz. La lignée cellulaire Oc du riz provient de la variété C5924 du riz (Oryza sativa
L. ). C'est une lignée cellulaire prépondérante du riz à prolifération rapide obtenue de la manière
suivante : des grains de riz (Oriza sativa L. C5924) sont stérilisés avec une solution d'hypochlorite de
sodium à 5% pendant 10 min et lavés trois fois avec de l'eau distillée stérilisée. Puis ils sont amenés à
germer dans des conditions aseptiques dans du milieu basal de Murashige et Skoog (MS). Au bout
d'une semaine de germination, des explants radiculaires sont excisés des plantules et cultivés sur du
milieu MS gélosé(1 %) contenant 1 mg/1 de 2,4-D et 0,1mg/l de kinétine. Les cultures de cals obtenues
à partir des explants radiculaires sont souscultivées tous les mois sur le milieu utilisé pour l'induction
des cals. Les cellules ainsi obtenues sont appelées cellules Oc. Ces cellules sont ensuite sous-cultivées
à 25 C à l'obscurité à 120 tr/min dans du milieu MS additionné de 1 mg/1 de 2,4-D
>;Desc/Clms Page number 3;
à intervalles réguliers de 2 semaines. Les cellules Oc prolifèrent rapidement dans les cultures en
suspension.
Le polypeptide précurseur de PSK (préprophytosulfokine) de cette invention est identifié par une
séquence d'acides aminés appelée séquence n . 1 dans la liste de séquences annexée et le gène qui code
la préprophytosulfokine est identifié par une séquence de bases appelée séquence n . 2 dans la liste de
séquences annexée.
En général, un acide aminé est codé par plusieurs codons d'ADN. Par conséquent, plusieurs gènes,
différents du gène natif de cette invention, peuvent coder des séquences d'acides aminés identiques à
celle de la préprophytosulfokine.
Le gène de cette invention n'est pas limité au gène natif seulement et inclut beaucoup d'autres
séquences de bases qui codent la préprophytosulfokine.
Le polypeptide précurseur de PSK de cette invention inclut un polypeptide qui a une séquence d'acides
aminés qui a au moins 40% d'homologie avec la séquence d'acides aminés appelée séquence n . 1 dans
la liste de séquences annexée, dans la mesure où il conserve les caractéristiques biochimiques de la
préprophytosulfokine. De préférence, le polypeptide précurseur de cette invention a plus de 50%
d'homologie avec la séquence d'acides aminés appelée séquence n .
1 dans la liste de séquences annexée. De préférence encore, le polypeptide précurseur de cette
invention a plus que 80% d'homologie avec la séquence d'acides aminés appelée séquence n . 1 dans la
liste de séquences annexée.
De plus, le gène de cette invention inclut un gène qui code le polypeptide précurseur de PSK décrit cidessus et qui consiste en une séquence de bases qui s'hybride dans des conditions strictes ou stringentes
avec la séquence de bases appelée séquence n . 2 dans la liste de séquences annexée.
La prolifération d'une cellule végétale peut être stimulée par incorporation d'un gène qui code la
préprophytosulfokine bien qu'une cellule végétale où un certain gène exogène est incorporé ait
tendance à voir sa vitesse de prolifération diminuer. Par conséquent, la différenciation cellulaire et la
régénération d'une plantule peuvent être accomplies par incorporation du gène qui code la
préprophytosulfokine. De plus, une amélioration de la croissance d'une plante peut être obtenue par
incorporation du gène. Le gène selon cette invention peut être incorporé dans plusieurs plantes. Les
plantes décrites dessous sont des plantes préférables pour l'incorporation du gène. Ce sont des plantes
monocotylédones comme le riz, le maïs, l'asperge et le blé ou des plantes dicotylédones comme
l'arabidopsis, le tabac, la carotte, le soja, la tomate et la
>;Desc/Clms Page number 4;
141/503
pomme de terre. Les techniques communes connues peuvent être adoptées pour produire un
transformant. A titre d'exemple de vecteur disponible, on peut citer pAct-nos/Hmz. Un tel vecteur peut
être introduit dans Agrobacterium, par exemple, et un transformant peut être produit par infection d'un
cal ou d'une jeune plante.
D'autres objets et avantages de l'invention deviendront plus apparents à la lecture de la description
détaillée qui suit et se réfère aux dessins annexés dans lesquels :
La figure 1 montre la séquence de bases du gène OsPSK et la séquence d'acides aminés
correspondante.
La figure 2 montre la détection d'analogues de PSK qui existent dans un milieu conditionné de cellules
Oc de riz transformées, par chromatographie liquide-spectrométrie de masse (CL-SM).
La figure 3 montre des cellules Oc du riz non transformées après deux semaines de culture.
La figure 4 montre des cellules Oc de riz où le gène OsPSK est incorporé dans l'orientation sens, après
deux semaines de culture.
La figure 5 montre des cellules Oc de riz où le gène OsPSK est incorporé dans l'orientation antisens,
après deux semaines de culture.
La figure 6 représente un transfert de Western montrant la détection du gène OsPSK dans des cellules
Oc du riz où le gène est incorporé dans l'orientation sens et dans l'orientation antisens.
La figure 7 représente un transfert de Western montrant l'expression du gène OsPSK dans des cellules
Oc du riz au bout de 3,7, 10 et 14 jours.
La figure 8 représente un transfert de Western montrant l'expression du gène OsPSK dans des cellules
Oc du riz où le gène est incorporé dans l'orientation sens et dans l'orientation antisens.
La figure 9 représente un transfert de Western montrant l'expression du gène OsPSK dans des plants
de riz, examinée sur plusieurs parties d'un corps végétal.
La figure 10 représente un transfert de Western montrant le nombre de copies du gène OsPSK,
examiné après traitement avec diverses enzymes de restriction.
La figure 11 représente un transfert de Western montrant la conservation du gène OsPSK examinée sur
Arabidopsisthaliana, Asparagusofficinalis, Daucus carota et Zinnia elegans.
>;Desc/Clms Page number 5;
Un criblage a été exécuté comme décrit au-dessous, sur une banque d'ADNc construite à partir de
cellules Oc du riz avec des sondes constituées par un mélange d'oligonucléotides, pour tenir compte de
la dégénérescence du code génétique, qui correspondent à la séquence d'acides aminés de PSK. L'ARN
poly (A) + a été purifié avec une colonne d'oligo (dT) à partir de cellules Oc cultivées pendant 10 jours.
Une banque d'ADNc a été construite avec le kit de synthèse d'ADNc ZAP (Stratagene, La Jolla, CA).
Quatre-vingt-seize types d'oligonucléotides 15-mères qui correspondent à la séquence d'acides aminés
de PSK-a ont été synthétisés, marqués avec [y - 32P]ATP avec un kit de kination (Toyobo, Osaka), et
utilisés pour cribler la banque d'ADNc par hybridation sur plages à 25 C dans une solution qui contient
6X de citrate de sodium salin (SSC), 20 mM deNaH2P04, 0,4% de SDS, 5X de solution de Denhardt et
500 mg/1 d'ADN de sperme de saumon. Les filtres ont été lavés plusieurs fois avec 6X SSC et 0,1%
SDS à 25 C pendant une heure. A titre de résultat, trois clones d' ADNc s'hybridaient avec les sondes.
Les plasmides pBluescript qui contiennent les inserts positifs ont été excisés et introduits dans la
souche SOLR de Escherichia coli. Les inserts sousclonés ont été séquences avec le kit de séquençage
Big Dye Terminator Cycle et l'analyseur génétique PRISME ABI 310 (Applied Biosystems, Foster,
142/503
CA) conformément aux protocoles du fabricant. Le résultat a montré qu'un clone d'ADNc code le
précurseur de phytosulfokine. L'ADNc ainsi obtenu est appelé OsPSK.
Le résultat de l'analyse de la séquence a révélé quel'ADNc OsPSK avait une longueur de 725 paires de
bases (pb). La séquence de bases de l'ADNc OsPSK est montrée dans la séquence supérieure de Fig. 1
et dans la séquence n . 2 de la liste de séquences annexée. La séquence contient seize GA répétés dans
la région non traduite en 5' (Fig. 1 ligne pointillée). Le cadre de lecture ouvert était long de 267 pb et
code la préprophytosulfokine (précurseur du polypeptide PSK) consistant en 89 acides aminés. La
séquence d'acides aminés de la préprophytosulfokine est montrée dans la séquence inférieure de la Fig.
1 et dans la séquence n . 1 de la liste de séquences annexée. La séquence de la Fig. 1 suggère une masse
moléculaire prédite de 9,8 kDa et un point isoélectrique de 6,48. Une région hydrophobe de 22 acides
aminés qui ressemblait à un peptide signal clivable a été trouvée à l'extrémitéNH2-terminale de la
préprophytosulfokine. Une telle structure de région hydrophobe est trouvée dans des précurseurs de
peptides bioactif des animaux. La forme mature prédite de la
>;Desc/Clms Page number 6;
préprophytosulfokine contient un haut pourcentage d'acides aminés chargés (6% d'acide aspartique,
7,5% d'acide glutamique, et 6% de lysine) et est par conséquent hydrophile. Parmi les 89 acides aminés
de la préprophytosulfokine, les acides aminés 80 à 84 codent PSK-a (Fig. 1 ligne double).
Les tyrosines sulfatées sont habituellement localisées dans les régions acides de protéines sécrétoires.
Tous les sites qui ont été caractérisés dans les animaux contiennent des résidus acide aspartique et
acide glutamique près de la tyrosine sulfatée. Les acides aminés acides sont montrés par des cercles
dans la Fig. 1. Il y a un résidu acide aspartique en position immédiatementNH2-terminale -1 par
rapport à la première tyrosine de PSK, et deux ou trois résidus acides sont trouvés entre-5 et +5 par
rapport au premier ou deuxième résidu tyrosine dans PSK-a, respectivement. Une telle caractéristique
de la structure suggère que les résidus tyrosine pourraient être sulfatés par la sulfotransférase. Les sites
de maturation supposés qui sont contigus à PSK sont conformes à la séquence consensus pour la
peptidase V8, ce qui suggère que PSK pourrait être obtenue par maturation protéolytique à partir de la
préprophytosulfokine. Les sites de reconnaissance par la peptidase V8 sont indiqués par les flèches.
Aucune homologie significative n'a été trouvée entre l'ADNc et d'autres séquences dans les banques de
données d'ADN, à l'exception de plusieurs marqueurs de séquence du riz exprimés sans fonction
connue.
Pour confirmer que le gène OsPSK code effectivement PSK, des cellules Oc du riz ont été
transformées avec un ADNc d'OsPSK muté. Les ADNc mutés utilisés pour la transformation sont
conçus pour produire de la PSK-a ou de laPSK-p mutée où la thréonine, localisée à la quatrième place
du peptide, est remplacée par la sérine. La PSK-a obtenue est appelée [Ser4]PSK-a et laPSK-P est
appelée [Ser4]PSK-ss. Les séquences de[Ser4]PSK-a et [Ser4]PSK-ss sont présentées ci-dessous.
EMI6.1
[Ser4]PSK-a: Y(S03H)IY(S03H)SQ [Ser4]PSK-(3: Y(S03H)IY(S03H)S
Une amorce 22-mère (5'-CATCTTGGGAGTAGATATAATC-3') a été synthétisée et utilisée pour
obtenir l'ADNc de préprophytosulfokine muté décrit ci-dessus avec un kit de mutagenèse in vitro
(Takara, Tokyo). Le plasmide pActnos/Hmz qui contient des gènes de résistance à la kanamycine et à
l'hygromycine pour la sélection de transformants a été employé comme vecteur binaire pour la
>;Desc/Clms Page number 7;
transformation de cellules Oc.L' ADNc de type sauvage ou muté concernant la sérine a été excisé avec
Sma 1 et Eco RV et inséré dans le site Sma I du vecteur.
L'expression des gènes chimères était sous le contrôle du promoteur de l'actine du riz incorporé dans le
vecteur binaire. Les constructions ont été utilisées pour transformer la souched'Agrobacterium
LBA4404 par appariement triparental (procédé de transfert d'un plasmide binaire de E. coli à
Agrobacterium par coculture de E. coli contenant le plasmide binaire, de E. coli auxiliaire contenant un
143/503
plasmide auxiliaire (pRK2013) et de l'organisme receveur Agrobacterium), et la transformation de
cellules Oc à médiation par Agrobacterium a été exécutée.
Les quantités de PSK-a et de ses analogues, libérées dans le milieu par la souche de type sauvage ou le
transformant, ont été mesurées par analyse par chromatographie liquide/ spectrométrie de masse
(CL/SM). Un milieu conditionné (MC) obtenu à partir de cellules Oc de type sauvage ou transformées
cultivées pendant 14 jours a été chromatographié sur une colonne de DEAE Sephadex A- 25. Les PSKa etPSK-p contenues dans les fractions de 800 et 1200 mM de KCl ont été adsorbées sur des cartouches
Sep-PakVac, éluées avec de l'acétonitrile à 30% qui contient 0,1% d'acide trifluoroacétique, et
lyophilisées. Les spectres de masse ont été obtenus avec un spectromètre de masse VG Platform
Quadruple Fisons avec ionisation à électropulvérisation (ou électrospray) connecté à un système de
CLHP Jasco PU980. Les fractions qui contiennent les PSK ont été dissoutes dans 200 l d'eau et
séparées sur une colonne de CLHP en phase inverse (4,6 x 250 mm) avec de l'acétonitrile à 10% qui
contient 0,1% d'acide trifluoroacétique à 1,0 ml/min. Les ions pseudomoléculaires de PSK ont été
surveillés par balayage toutes les 1,9 s en mode de surveillance sélectif à l'égard des ions. Les
séquences d'acides aminés des peptides ont été déterminées par un sequenceur Applied Biosystems
modèle 490.
Le résultat de l'analyse quantitative d'analogues de PSK exécutée par CL-SM comme décrit ci-dessus
est montré dans la Fig. 2. Dans la Fig. 2 les pics qui correspondent à [Ser4] PSK-a (temps de rétention
6,9 min), PSK-a (temps de rétention 8,0 min), [Ser4]PSK-(3 (temps de rétention 9,0 min) etPSK-P
(temps de rétention 12,7 min) ont été détectés dans le liquide d'élution provenant du milieu conditionné
des cellules Oc transgéniques contenant l'ADNc muté. En outre, les peptides contenus dans les
fractions correspondantes ont été séquences et il a été confirmé qu'il s'agissait bien de [Ser4] PSK-a et
de [Ser4]PSK-P, ce qui est en faveur de l'hypothèse selon laquelle l'ADNc OsPSK code la
préprophytosulfokine etPSK-P est un produit de dégradation enzymatique de PSK-a.
>;Desc/Clms Page number 8;
En outre, l'ADNc OsPSK a été introduit dans l'orientation sens et dans l'orientation antisens dans des
cellules Oc avec le même vecteur binaire. Puis les quantités de PSK-a et dePSK-P ont été analysées par
CL-SM. Les cellules Oc témoins ou transformées (0,8 g) ont été placées dans 100 ml de milieu frais et
les quantités de PSK-a et de ses analogues ont été déterminées par analyse au bout d'une semaine de
culture.
Les résultats indiqués par la valeur moyenne de trois expériences indépendantes sont montrés dans
Tableau 1 avec les écarts-types (unité de concentration nM). La PSK-a et laPSK-p accumulées dans le
milieu conditionné du transformant sens étaient 1,6 fois plus concentrées que dans le témoin.
L'augmentation de la sécrétion de PSK s'est révélée être due à l'introduction du gène. Les quantités de
PSK-a et dePSK-p accumulées dans le milieu conditionné du transformant antisens était inférieures à
60% du niveau témoin moyen, ce qui indique une baisse de la sécrétion de PSK. D'autre part, la
quantité totale de [Ser4]PSK-a et de[Ser4]PSK-P était égale à 34% de PSK-a et dePSK-P de type
sauvage seulement, ce qui suggère que le remplacement d'acides aminés peut diminuer l'efficacité de la
maturation et/ou de la modification.
Tableau 1.
Accumulation de PSK dans du milieu conditionné par des cellules Oc témoins ou transgéniques
EMI8.1
>;tb;
>;tb; type >;SEP; cellulaire >;SEP; PSK-a >;SEP; PSK-P >;SEP; [SER4]PSK-a >;SEP; [SER4]PSK-ss
>;tb; témoin >;SEP; 12,6+1,1 >;SEP; 332,7+20,1 >;SEP; 0 >;SEP; 0
>;tb; antisens >;SEP; 7,3+0,4 >;SEP; 175,8+15,4 >;SEP; 0 >;SEP; 0
>;tb; sens >;SEP; 21,0+1,9 >;SEP; 555,7+31,1 >;SEP; 0 >;SEP; 0
>;tb; mutant >;SEP; [Ser4] >;SEP; 11,5+0,9 >;SEP; 302,5+15,8 >;SEP; 3,1+0,3 >;SEP; 105,2+8,9
144/503
>;tb;
L'effet du gène OsPSK sur la prolifération cellulaire a été étudié. Le résultat a montré que les cellules
transgéniques sens S2 se divisaient approximativement deux fois plus vite (Fig. 4) que le témoin (Fig.
3), tandis que les transformants antisens A2 ralentissaient leurs activités mitogènes cellulaires (Fig. 5).
De plus, le fait de munir les transformants antisens de PSK-a permettait de rétablir en partie leurs
activités mitogènes (38-64%), ce qui indique que le gène OsPSK favorise la division des cellules
végétales.
>;Desc/Clms Page number 9;
Puis la présence du gène incorporé dans les cellules transformées a été confirmée par transfert de
Southern (Fig. 6). Dans la Fig. 6, chaque piste indique les échantillons suivants :
W : eau seulement
N : cellules Oc du riz non transformées
AI-A4: cellules transformées antisensS1-S4: cellules transformées sens
P : vecteur d'expression seulement
Dans la Fig. 6, une bande de 0,5 kb qui correspond au gène OsPSK incorporé a été identifiée dans les
cellules transformées sensS1-S4 et dans les cellules transformées antisens A2. La bande de l,6kb qui
correspond au gèneOsRacl endogène (gène de l'actine du riz qui existe de manière endogène dans les
cellules Oc et qui est utilisé comme gène témoin du fait de son expression constitutive) a été observée
dans les cellules transformées sens et dans les cellules transformées antisens.
La modification de l'expression du gène OsPSK qui se produit pendant la période de culture a été
analysée par analyse par transfert de Northern exécutée par hybridation avec un ADNc de longueur
intégrale marqué à 60 C. Dans la Fig. 7, la piste 1, la piste 2, la piste 3 et la piste 4 indiquent les
résultats au bout de 3 jours, 7 jours, 10 jours et 14 jours, respectivement. Les résultats dans la Fig. 7
montrent que le gène OsPSK a été exprimé de façon continue dans les cellules Oc cultivées en
fournissant PSK de manière continue et a permis aux cellules de proliférer rapidement. Surtout, le gène
OsPSK a été exprimé le plus abondamment au bout de 10 à 14 jours. L'expression du gène OsPSK dans
les cellules transformées a été confirmée dans la Fig. 8. L'expression du gène OsPSK dans les cellules
transformées sens de la piste 1 a augmenté par rapport à celle des cellules non transformées (piste 3).
D'autre part, l'expression dans les cellules transformées antisens diminuait (voie 2). De plus, la
configuration de l'expression a été examinée sur un plant de riz (Fig. 9). La configuration montrée dans
les pistes 1,2, 3,4, 5 indique les résultats pour la première feuille, la deuxième feuille, l'extrémité de la
pousse, la racine latérale et la racine de la graine, respectivement. Une expression significative du gène
dans l'extrémité de la pousse et la racine de la graine et une expression moindre dans les feuilles sont
montrées dans la Fig. 9. Ces résultats indiquent que les régions à croissance active présentent une
expression abondante du gène OsPSK.
>;Desc/Clms Page number 10;
Finalement, une analyse par transfert de Southern a été exécutée après traitement avec différentes
enzymes de restriction. Les enzymes de restriction utilisées pour le traitement enzymatique de la Fig.
10 étaient Bam HI (Ba), Eco RI (Ec), Xba 1 (Xb) et Xho I (Xh). De multiples petites bandes ont été
observées dans l'échantillon traité avec EcoR I, ce qui indique que le gèneOsPSK peut appartenir à une
famille de gènes multiples. Cependant, les multiples bandes qui s'hybrident issues de la digestion avec
Eco RI ont pu être attribuées aux sites de restriction trouvés dans l'ADNc OsPSK. Pour le vérifier, le
transfert a été testé de nouveau avec un fragment de 300 paires de bases provenant de l'extrémité 5 ' de
l'ADNc OsPSK. Comme prévu, seule une bande (3,7 kilopaires de bases) s'est hybridée.
Par conséquent, il apparaît que la préprophytosulfokine est codée par un seul gène et non pas par des
gènes multiples.
145/503
Pour déterminer si des homologuesd'OsPSK sont trouvés dans d'autres espèces végétales, une analyse
par transfert de Southern a été exécutée après un traitement avec des enzymes de la restriction comme
décrit dans la Fig.
10. Les enzymes utilisées pour le traitement de la Fig. 11étaient Bam HI (Ba) et Eco RI (Ec),
respectivement. Une analyse par transfert de Southern a été exécutée sur l'ADN génomique de quatre
espèces dont on sait qu'elles produisent PSK, à savoir Arabidopsis thaliana (colonne 1),
Asparagusofficinalis (colonne 2), Daucus carota (colonne 3), et Zinnia elegans (colonne 4). Des
homologuesd'OsPSK ont été détectés dans les quatre espèces comme montré dans la Fig. 11, ce qui
indique que le gène OsPSK est conservé dans les monocotylédones et les dicotylédones. Par
conséquent, on suppose que l'incorporation du gène OsPSK est efficace dans différentes espèces de
plantes.
Liste de séquences>;110; nom du demandeur : de l'université de Nagoya >;120; titre de l'invention :
précurseur de phytosulfokine, gène le codant, cellule végétale contenant ce gène et procédé pour
stimuler la prolifération des cellules végétales >; 160; nombre total de séquences :2>; 210; séquence n .
1 >;21 1; longueur de la séquence : acides aminés >;212; type de séquence : aminés >; 213; organisme :
cellule Oc de Oryza sativa L.
>; 400; séquence:
>;Desc/Clms Page number 11;
MVNPGRTARA LCLLCLALLL LGQDTHSRKL LLQEKHSHGV GNGTTTTQEP SRENGGSTGS
60 NNNGQLQFDS AKWEEFHTDY IYTQDVKNP 89 >; 210; séquence n . 2 >;21 1; longueur de la
séquence : 725 bases >; 212; type de séquence :>;213; organisme : cellule Oc de Oryza sativa L.
>; 400; séquence: GAAGAAGCAG CAGCAAAAAA GTTGATCAGT TAATTAGCAA
GTGTGTTCTT CTTTCTTTTG 60 GTGAGAGAGA GAGAGAGAGA GAGAGAGAGA
GAGATCTCAG AATGGTGAAT CCAGGAAGAA 120 CAGCTAGGGC ACTCTGCCTC
CTATGCCTTG CTCTCCTCCT GCTAGGTCAA GATACCCATT 180 CCAGGAAGCT
CCTGTTGCAG GAGAAGCACA GCCATGGCGT CGGCAACGGC ACAACCACCA 240
CCCAGGAACC AAGCAGAGAG AATGGAGGAA GTACAGGTTC CAATAACAAT
GGGCAGCTGC 300 AGTTTGATTC AGCCAAATGG GAAGAATTCC ACACGGATTA
TATCTACACC CAAGATGTCA 360 AAAACCCATA ATGGCTGTTCATTTATGATT
TGAACTAGTA CTAGTAGCTT ATACCTTCTG 420CGCGTCTTTT GTTCGTTTGG
AGAGGGGATT TTCTTGGGAT TTAGCATATG AACTAATTAA 480
ATTAAATCCCAGGCAAATCC CACTCAGCCC ATTTTGTGCA GAAGTTGTCA
GTGTGCACTG 540 TATAATTATT TAGTCATACA CAACTACTCC TGGTAACTAC
TCCTATCTTC GATGAATTTT 600CTGGTTTTGC CAGACGTGAC AATAGTCCAG
TAGCATGCAG TACCCTCTCA GAATCCCTGT 660 AATTTTTAGC AAAAAAAAAA
GGAAGAAAAG AAAAGAAGCT TCCCTACTAA AAAAAAAAAA 720 AAAAA 725Data
supplied from the esp@cenet database - Worldwide
Claims:
Claims of FR2791347
REVENDICATIONS
1. Polypeptide précurseur de phytosulfokine caractérisé en ce qu'il consiste (a) en un polypeptide ayant
la séquence des acides aminés 1 à 89 dans la séquence n . 1 de la liste de séquences, ou (b) en un
polypeptide ayant une séquence d'acides aminés qui a plus de 40% d'homologie avec la séquence dudit
polypeptide (a), ledit polypeptide étant soumis à une maturation et sulfaté sur les résidus tyrosine de
ladite phytosulfokine dans une cellule végétale pour que la phytosulfokine dont les résidus tyrosine
sont sulfatés soit sécrétée et puisse stimuler la prolifération de ladite cellule végétale.
2. Gène caractérisé en ce qu'il code le polypeptide précurseur selon la revendication 1.
3. Gène selon la revendication 2 caractérisé en ce qu'il consiste en une séquence de bases parmi la
séquence des bases 1 à 725 dans la séquence n . 2 de la liste de séquences et une séquence de bases qui
s'hybride avec la séquence de bases précédente dans des conditions stringentes.
146/503
4. Cellule végétale transgénique caractérisée en ce qu'elle comprend le gène selon l'une quelconque
des revendications 2 et 3 incorporé dans la cellule pour stimuler la prolifération de ladite cellule.
5. Procédé pour stimuler la prolifération d'une cellule végétale caractérisé en ce qu'il comprend
l'incorporation du gène selon l'une quelconque des revendications 2 et 3 dans ladite cellule végétale.
6. Procédé pour produire une cellule végétale transgénique caractérisé en ce qu'il comprend
l'incorporation du gène selon l'une quelconque des revendications 2 et 3 dans une cellule végétale pour
stimuler la prolifération de ladite cellule végétale.Data supplied from the esp@cenet database Worldwide
147/503
22. GB2355265
- 4/18/2001
PROLINE TRANSPORTER FROM RICE (ORYZA SATIVA)
URL EPO =
http://v3.espacenet.com/textdoc?F=3&CY=ep&LG=en&IDX=GB2355265
Inventor(s):
IGARASHI YUMIKO (JP); YOSHIBA YOSHU (JP)
Applicant(s):
HITACHI LTD (JP)
IP Class 4 Digits: C07K; C12N; A01H
IP Class:C07K14/415; C12N15/82; A01H5/00; C12N15/29
E Class: C07K14/415; C12N15/82C4B10; C12N15/82C8B2; C12N9/02B
Application Number:
GB20000020232 (20000816)
Priority Number: JP19990230291 (19990817)
Family: GB2355265
Equivalent:
US6423838; JP2001054385
Abstract:
Abstract of GB2355265
A nucleic acid molecule encoding a proline transporter from rice (Oryza sativa) is claimed. The nucleic
acid encodes a protein with at least 80 % amino acid identity with the amino acid sequence of SEQ ID
NO: 1. The nucleic acid sequence has the coding sequence of SEQ ID NO: 1 or a sequence
complementary thereto. Vectors, including plasmids and phages, probes and transgenic plants,
preferably rice are also claimed. Expression of the gene may be controlled by a promoter responsive to
water stress and/or high environmental salt concentration, preferably the W >;SP;1>;/SP;-pyrroline-5carboxylate synthetase gene promoter.Description:
Description of GB2355265
2355265 A Gene for Proline Transporter in Rice 5 The present invention
relates to a gene for proline transporter in rice.
It is known that some plants, including halophytes, when they are under salt stress, accumulate proline
in their bodies. It is considered that the proline accumulated serves as a compatible osmolyte,
regulating the intracellular osmotic pressure and keeping water in the plant body. In plants, proline is
synthesized from glutamic acid by two reactions catalyzed by two enzymes, namely A'-pyrroline5carboxylate (P5C) synthetase (P5CS) and Al- pyrroline5-carboxylate reductase (P5CR), respectively.
When such plants undergo water stress (state in which water absorpzion is difficult), such as salt
stress or water deficit, the levels of P5CS activity and P5CS gene expression increase. In that case, the
levels of P5CR activity and P5CR gene expression remain almost constant and are low. This indicates
that P5CS is a rate-limiting factor in the proline synthesis under water stress (Yoshiba et al., Plant J.
7:751-760 (1995)).
Kishor et al. succeeded in increasing the salt 1 tolerance of tobacco by introducing the P5CS gene of
mothbean thereinto to thereby cause overexpression of that gene, indicating that gene manipulation
involving the P5CS gene is effective in producing salt tolerant crop plants (Kishor et al., Plant Physiol.
108:1387 1394 (1995)).
148/503
Not only the proline synthesis but also proline transport is involved in the accumulation of proline
under water stress. As regards the proline transport, two proline transporter genes have been cloned
from Arabidopsis thaliana and three from tomato. The transporters, unlike other amino acid permeases,
transport prollne alone selectively.
Upon amino acid sequence comparison, the two Arabidopsis proline transporter genes are shown to be
very close to each other. They differ, however, in the mode of gene expression from each other. One is
the Arabidopsis proline transporter 1 (AtProTI) gene, which is expressed constantly at a low level
throughout tissues, and the other is the Arabidopsis proline transporter 2 (AtProT2) gene, which is
scarcely expressed under normal growth conditions but whose expression is swiftly and intensely
induced under salt stress conditions. Therefore, the latter gene is considered to be a transporter gene
prepared exclusively for water stress and serving to transport proline as a compatible osmolyte
(Rentsch et al., The Plant Cell 8:1437-1446 (1996)).
2 Among the three proline transporter genes cloned from tomato, the proline transporter 1 (LeProTl)
gene has been analyzed to a good extent with respect to its function and it is known that it is intensely
expressed in the process of pollen maturation and LeProTl transports proline to and cause accumulation
thereof in pollen. It is a characteristic feature of LeProTl -that it transports not only proline but also
glycine betaine and like compatible osmolytes induced by water stress. At present, no report is
available of the functions of the proline transporter 2 (LeProT2) and proline transporter 3 (LeProT3).
However, since the genes encoding them belong to the same gene family as that to which the LeProT1
belongs, they are considered to be involved in amino acid transport to pollen and/or in stressresponding transport, like AtProT2 (Schwacke et al., The Plant Cell 11: 377-391 (1999)).
For proline accumulation under water stress, proline synthesis and transport of the proline synthesized
are both important. For plants to cope with rapid environmental changes such as drought and/or salt
stress, it is effective to prompt proline synthesis as far as possible and transport proline to tissues
requiring it. If, for such purposes, the P5CS gene can be manipulated to realize overexpression 3
thereof and proline synthesis activation and, further the proline transporter gene or genes can be
manipulated to realize overexpression thereof for transportation of the proline synthesized to tissues
requiring the same, it will become possible to breed rice and other useful crop plants showing
synergistic action and further having high salt tolerance and drought resistance. It is estimated that the
proportion of saline soils resulting from drought and semidrought will increase more and more in the
future as a result of destruction of the natural environment. Thus, breeding such tolerant or resistant
crop plants as mentioned above plays an important role in solving the global food problem.
As far as the proline transporter genes in plants are concerned, only the corresponding cDNAs have so
far been isolated from Arabidopsis thaliana and tomato. None has been isolated from monocots. Under
such circumstances, the present invention provides a proline transporter gene in rice, which is a
monocot.
The present invention, by which a monocot proline transporter gene, which is quite unknown in the
art, has been isolated, can be said to have achieved a novel technological advancement.
The present invention, which has been made with attention paid to the importance of such a rice
proline transporter, provides materials which may prove useful in enhancing and/or controlling proline
transport by gene manipulation, or in which proline transport may be enhanced arid/or controlled as a
result of gene 4 manipulation. Namely, the present inventors newly raised the above technical problem
so far not recognized in the art and approached the problem from various angles. Thus, they made
intensive investigations in an.attempt to isolate a relevant gene from rice seedling tissues and, as a
result, successfully isolated a cDNA coding for the full length of a rice proline transporter gene from a
cDNA library prepared by reverse transcription of mRNA.
BRIEF DESCRIPTION OF THE DRAWINGS
Fig. I comparatively shows the hydropathy plots deduced from the amino acid sequences of the rice
proline transporter and the two Arabidopsis proline transporters. Thus, Fig. 1A shows the plot pattern
149/503
of the transporter of the present invention and Fig. 1B and Fig. 1C show the plot patterns of the two
Arabidopsis proline transporters AtProT1 and AtProT2.
Fig. 2 shows the results of expression analysis of the rice proline transporter gene. Thus, Fig. 2A
shows the levels of expression of the gene in several organs of rice throughout plant growth and Fig.
2B and Fig. 2C show the levels of expression under different salt stress conditions.
The present invention relates to a rice proline transporter gene (cDNA), and the DNA sequence
thereof is as shown in the sequence listing under SEQ ID NO. 1.
This gene was found to be comprised of 1,863 base pairs and have one open reading frame and the
sequence AATAAA for polyadenylation at the 31 terminus. The present invention also includes a
phage containing the rice proline transporter gene (cDNA) as well as a plasmid derived therefrom.
In practicing the present invention, mRNA may be first extracted from rice seedlings and cDNA may
be prepared using the mRNA extracted. This cDNA may be ligated into a vector, e. g. a plasmid or
phage, and then introduced into a host microorganism for recombinant DNA preparation. From among
the transformed microorganisms harboring this recombinant DNA introduced therein, a desired
transformant may be selected by conventional screening, for example using the Arabidopsis-derived
AtProT1 and/or AtProT2 gene as a probe. The desired plasmid can be isolated from the transformant
obtained and, if necessary, cloned by cleavage with an appropriate restriction enzyme or enzymes and
subcloning in a plasmid vector. This cloned DNA may be used for preparing a transfo'rmant, which
may then be cultivated, whereby the rice proline transporter can be recovered in large quantities from
the culture.
6 The present invention relates not only to the DNA comprising the specific sequence as set out in the
sequence listing, but it also provides nucleic acids (including DNA and RNA molecules) which
comprise (or consist of) sequences which differ from that sequence but encode the same amino acid
sequence. The present invention also provides nucleic acids which encode polypeptides homologous to
the amino acid sequence shown in the sequence listing.
Preferably such homologous polypeptides also have the ability to transport proline, preferably
selectively.
The polypeptides may have amino acid sequences identical to those of other naturally proline
transporter proteins (for example other rice proline transporter proteins or corresponding proteins from
other monocots) Nucleic acid encoding such polypeptides may be obtained from rice or other
monocots, in a similar way to that used to clone the nucleic acid of the present invention, e.g. using the
sequence as set out in the sequence listing to design a probe and/or amplification primers.
Alternatively, the polypeptides may differ from naturally occurring proteins by one or more of amino
acid deletion, substitution or addition and nucleic acid encoding such polypeptides may be obtained
e.g. by manipulating naturally occurring nucleic acid sequences.
The present invention also provides nucleic acid molecules having a sequence complementary to any
of the above nucleic acid molecules.
References herein to "rice proline transporter gene" should be interpreted accordingly, although the
specific nucleic acid sequence set out in the sequence listing is a preferred embodiment.
Preferably the nucleic acid molecules of the invention encode, or have a sequence complementary to
that of a nucleic acid which encodes, an homologous 7 polypeptide having at least 80% amino acid
identity with the amino acid sequence as set out in the sequence listing. More preferably the level of
identity is at least 8S%, 90%, 9S%, 97%, 98% or 99%.
Percentage (%) amino acid sequence identity may be determined for these purposes using the
sequence comparison program NCBI-BLAST2 (Altschul et al., Nucleic Acids Res. 2S:33893402
(1997), http://www.ncbi.nlm.nih.
150/503
gov) with all the search parameters set to default values. The percentage identity of a given amino
acid sequence A to, with, or against a given amino acid sequence B (which can alternatively be phrased
as a given amino acid sequence A that has or comprises a certain perentage amino acid sequence
identity to, with, or against a given amino acid sequence B) is calculated as follows:
times the fraction X/Y, where X is the number of amino acid residues scored as identical matches by
the sequence alignment program NCBI BLAST2 in that program's alignment of A and B, and where Y
is the total number of amino acid residues in B. 8 The rice proline transporter gene prepared according
to the present invention can be ligated to the downstream end of a potent (or constitutive) promoter or a
promoter enabling specific expression in leaf or roots and joined to a plasmid. The resulting
recombinant plasmid can be introduced into cells of rice or some other useful plant in the conventional
manner, for example by the technique of electroporation or Agrobacterium transfection, for
regenerating plant bodies from the thus-transformed cells. In this manner, the rice or useful plant,
which produces the rice proline transporter in excess, transports proline to and causes accumulation
thereof in the plant body or a specific tissue or tissues, such as leaf, roots, etc. When the gene is ligated
to the downstream end of a promoter enabling specific expression under stress conditions for joining to
a plasmid and the resulting recombinant plasmid is introduced into cells of rice or some other useful
plant in the conventional manner, for example by the electroporation or Agrobacterium transfection
technique,. the rice or useful plant regenerated from these cells produces the rice proline transporter in
excess specifically under stress conditions, which transfers and accumulates proline.
A promoter from Arabidopsis thaliana, which enables specific expression under stress conditions, is
disclosed in a UK application of Hitachi Ltd, which has the same date as this application, which claims
priority from Japanese patent application number 11-230287, and which is entitled "A promoter for A'pyrroline-5carboxylate synthase gene in Arabidopsis".
I The following example illustrates the present invention in further detail. The example is, however,
by no means limitative of the scope of the invention. In the following example, unless otherwise
specified, the respective procedures were carried out essentially as described in Sambrook et al.:
Molecular Cloning, Cold Spring Harbor Lab. (1989).
to EMBODIMENT First, a cDNA library was constructed f rom seedlings of the rice cultivar
"Akibare". Thus, total RNA was extracted f rom. 10 g of seedlings two weeks after germination by the
guanidine thiocyanate/CsCl method. mRNA was separated from the total RNA extracted, using
Oligo(dT) Latex (Takara, Kusatsu, Japan). The yield of mRNA was about 1.2% based on the total
RNA. cDNA synthesis from the mRNA was carried out using a commercial cDNA synthesis kit
(Stratagene, La Jolla, CA, USA). The cDNA synthesized was inserted into X ZAP II (Stratagene, La
Jolla, CA, USA), a X phage vector, followed by infection of Escherichia coli with the resulting
recombinant, to give a cDNA library.
Then, about six positive clones were obtained by the plaque hybridization method using the
previously isolated AtProT1 and AtProT2 gene cDNAs as probes. These clones were subcloned in
Bluescript and all of them were examined for their length by restriction enzyme treatment and the 5'
and 3' termini were partly sequenced by the cycle sequencing method. In this way, a clone probably
containing the full length of a proline transporter gene cDNA was obtained. From this clone, clones
differing by about 300 bp were obtained using a DNA deletion kit. Plasmid DNAs were extracted from
these clones and submitted to full-length cDNA sequencing by the cycle sequencing method.
Upon homology analysis, the thus-sequenced cDNA showed high homology, namely 68.8%
homology, on the amino acid level, with the AtProT1 gene previously isolated and expressed in all
tissues of Arabidopsis thaliana and 67.8% homology, on the amino acid level, with the AtProT2 gene
expressed specifically under salt stress. In addition, the proline transporter protein was compared with
the two Arabidopsis proline transporter AtProT1 and AtProT2 proteins by hydropathy plotting by
which the transmembrane domain, in the cell membrane, of the proline transporter protein can be
predicted. The results of such comparison are shown in Fig. 1. Fig. 1 shows the hydropathy plots
predicting the transmembrane domain, of each proline transporter protein, the abscissa denoting the
amino acid residue number and the ordinate denoting the hydrophobicity.
151/503
Fig. 1A shows the pattern of the plots of the transporter of the present invention and Fig. 1B and Fig.
1C show the plot patterns for the two Arabidopsis proline transporters AtProT1 and AtProT2,
respectively.
As shown in Fig. 1, the plot patterns are very similar to one another, hence the cDNA sequenced in
the above manner was identified as a proline transporter gene in rice.
Further, using this cDNA as a probe, the levels of gene expression were checked by the Northern
analysis method. Fig. 2A shows the results of such examination of the rice proline transporter gene
expression in several organs of rice at several growth stages, namely at one week of age, at one month
of age, and before heading. In one-week-old rice, the leaf blade, and stem were examined. In onemonth-old rice, the leaf blade, leaf sheath and stem were examined.
Before heading, the leaf, sheath, root and young panicle were examined. As is evident from the results
shown, the gene of the present invention was expressed in all the tissues examined, in particular
abundantly in the leaf sheath, stem and mature leaf blade having a well-developed vascular system.
Fig. 2B and Fig. 2C show the results of rice proline transporter gene expression analysis under salt
stress conditions. Fig. 2B shows, as a function of time, the levels of gene expression in a state in which
the root was immersed in distilled water. Fig. 2C shows, as a function of time, the levels of gene
expression in a state in which the root was immersed in a 250 mM NaCl solution, with no increases in
expression level as compared with hour 0, like under distilled water treatment. It was thus revealed that
the expression of the gene of the present invention is not induced by high salt treatment. Based on these
results, the gene of the present invention was estimated to be equivalent in function to the AtProT1
gene which is expressed in all tissues of Arabidopsis thaliana.
As described hereinabove, it was revealed that the gene of the present invention encodes a proline 13
transporter. The nucleotide sequence revealed and the corresponding amino acid sequence are shown in
the sequence listing under SEQ ID NO. 1. The structure of such rice proline transporter gene has been
determined for the first time by the present invention.
Therefore, by enhancing the gene of the present invention in plant, it is possible to cause rapid
transport and accumulation of proline to thereby provide the plant with salt tolerance or drought
resistance. Furthermore, by breeding rice or other useful crop plants with the gene of the invention and
the rice A'-pyrroline-5-carboxylate synthetase gene previously proposed by the present inventors in
Japanese Unexamined Patent Publication H10-57069 introduced therein together with a promoter
capable of promoting gene expression in a severe environment such as a high salt condition, it can be
expected that the transformed rice or other plants might be cultivated even in saline soils containing
accumulated salts or in desert soils and the food production might be increased accordingly. It is also
expected that the increases in population in deveioping countries might be coped with thereby.
Paying at-tention to the importance of the proline transporter in rice, the present inventors address a
novel technical problem of controlling this transporter by gene manipulation.
If the gene coding for P5CS, which is a rate-limiting factor in proline synthesis can be manipulated to
realize overexpression thereof and proline synthesis activation and, further the proline transporter gene
or genes can be manipulated to realize overexpression thereof for rapid transportation of the proline
synthesized to tissues requiring the same, it will be possible to breed rice and other useful crop plants
showing synergistic action and further having high salt tolerance and drought resistance. It is estimated
that the proportion of saline soils resulting from drought and semidrought will increase more and more
in the future as a result of destruction of the natural environment. Thus, breeding such tolerant crop
plants as mentioned above plays an important role in solving the global food problem.
The present invention therefore provides plant cells comprising nucleic acid constructs which contain
the nucleic acid sequences of the invention, usually in operative association with a constitutive, tissue
specific or stress-responsive promoter. Furthermore the invention provides plants and plant propagating
material or tissue (e.g. seeds) comprising such cells.
6 SEQUENCE LISTING (110) Hitachi LTD. >;120 Rice gene for proline transporter 160) 1 tio) i
(211) 1863 (212) DNk >;213) Oryza sativa L.
152/503
>;220) (221) cds (222) 144-1-562 >;300) (308) AB022783 309) January 28, 1999 >;400) 1 gccgccrgct tgccggagct ctctatctat ctctctatct ctatctc-tat ccctccagat 60 tccctcctcr- atcgaatctc tgatatttgg agggagcgac
tcgacgcagc atcgr-atogt 120 aaggaagg-tc ccctccactg tcg 143 atg gat cag Cac cag Ctc gac gag gag aac cag
aga 9cC gog ctc ttc cac 1,94 Met Asp Gln His Gln Leu Asp Glu Glu Asn Gln Arg Ala Ala Leu Phe His
1 5 10 15 tcc tct gcc cca tct tcc tct - ttg gga gct gac ggg gag gag gag agg gag 245 Ser Ser Ala Pro Ser
Ser Ser Leu Gly Ala Asp Gly Glu Glu Glu Arg Glu 25 30 /C act gtg ccg ctg ctg tcc tgc aag atg gcc gac
gat aaa tct gac act gtc 296 Thr Val Pro Loeu Leu Ser Cys Lys Met Ala Asp Asp Lys Ser Asp Thr Val
40 45 50 cag gtc tcc gag gat acg gcg cac cag att. agc att gat ccc tgg tat caa 347 Gln Val Ser Glu Asp
Thr Ala His Gln Ile Ser Ile Asp Pro Trp Tyr Gln 60 65 gtt gga ttc att ctg aca acc ggg gtg aat agt gca tat
gtt ctg gga tat 398 Val Gly Phe Ile Leu Thr Thr Gly Val Asn Ser Ala Tyr Val Leu Gly Tyr 75 80 85 tct
gca tca atc atg gtc cct tta ggc tgg att ggt ggg aca tgt ggc ttg 449 Ser Ala Ser Ile Met Val Pro Ioeu Gly
Trp Ile Gly Gly Thr Cys Gly Leu 95 100 att cta gct gct gca ata. tcc atg tat gca aat gct ctt ctt gct cac ctt
500 Ile Leu Ala Ala Ala Ile Ser Met Tyr Ala Asn Ala Leu Lem Ala His Leu 110 115 cat gaa gtt ggt ggc
aaa cgr- cat atc aga tac aga. gat ctt gat ggg cac 551 His Glu Val Gly Gly Lys Arg His Ile Arg Tyr Arg
Asp Leu Ala Gly His 125 130 135 ata tat ggt aga aaa atg tat tog ctt aca tgg gct ctg r-:q;; tat gtt aat 602
Ile Tyr Gly Arg Lys Met Tyr Ser Leu Thr Trp Ala Leu Gln Tyr Val Asn 145 150 1-7 cta. ttc atg atc aac
act ggc ctt atc att tta. gct ggt caa gcc ctg aag 653 Leu Phe Met Ile Asn Thr Gly Leu Ile Ile Leu Ala Gly
Gln Ala Leu Lys 160 165 170 gca. ata. tat gta tta ttt agg gac gat gga gtt cta aag cta. ccc tac tgc 704 Ala
Ile Tyr Val loeu Phe Arg Asp Asp Gly Val Leu Lys Leu Pro Tyr Cys 180 185 ata gca tta tct. ggg ttt gtc
tgt gct ctt. ttt gcc ttt gga. atc cat tat 755 Ile Ala Leu Ser Gly Phe Val Cys Ala Leu Phe Ala Phe Gly Ile
Pro Tyr 195 200 ctg tct gct ctc agg att, tcjg ttg gga. tta. tca aca gtt ttc agt ctc atc 806 Leu Ser Ala Leu
Arg Ile Trp Leu Gly Leu Ser Thr Val Phe Ser Leu Ile 205 210 215 220 tat ata. atg ata gca. ttt gtc atg tcg
ctt. aga gat ggg att. acc aca. cct 857 Tyr Ile Met Ile Ala Phe Val Met Ser Leu Arg Asp Gly Ile Thr Thr
Pro 225 230 235 gca. aag gat tat act att cct gga tca. cat tca. gat aga atc ttc act acg 908 Ala Lys Asp Tyr
Thr Ile Pro Gly Ser His Ser Asp Arg Ile Phe Thr Thr 240 245 250 255 ata qgt gct gta. gca aac ctt gtg ttc
gct tac aac act gga. atg ctc cca 959 Ile Gly Ala Val Ala Asn Leu Val Phe Ala Tyr Asn Thr Gly Met Leu
Pro 260 265 270 19 gaa att caa gca acc ata agg cct cct gtg gtc aag aat atg gag aag gct 1010 Glu Ile Gln
Ala Thr Ile Arg Pro Pro Val Val Lys Asn Met Glu Lys Ala 275 280 285 cta tgg ttc cag ttc act gtt ggt
tcg tt9 cct ctt tat gct gtc acc ttt 1061 Leu Trp Phe Gln Phe Thr Val Gly Ser Leu Pro Leu Tyr Ala Val
Thr Phe 290 295 300 305 atg ggg tat tgg gcg tac ggg tcc tca aca tca agc tat cta ctg aat agt 1112 Met Gly
Tyr Trp Ala Tyr Gly Ser Ser Thr Ser Ser Tyr Leu Leu Asn Ser 310 315 320 gtg aag gga cca att tcjg ata
aaa act gtg gca aat tta tog gog ttt ctt 1163 Val Lys Gly Pro Ile Trp Ile Lys Thr Val Ala Asn Leu Ser Ala
Phe Leu 325 330 335 340 cag act gtc ata gca tta cat ata ttt gca agc cca. atg tac gaa ttc ttg 1214 Gln Thr
Val Ile Ala Leu His Ile Phe Ala Ser Pro Met Tyr Glu Phe Leu 345 350 355 gac aca aga ttc ggc agt gga
cat ggt ggt cct ttt gca atc cac aac ata 1265 Asp Thr Arg Phe Gly Ser Gly His Gly Gly Pro Phe Ala Ile
His Asn Ile 360 365 370 atg ttc aga gtg ggt gtc aga gga ggc tac ctg acc gtc aac acc ttg gtg 1316 Met Phe
Arg Val Gly Val Arg Gly Gly Tyr Leu Thr Val Asn Thr Deu Val 375 380 385 390 N gcc gcg atg ctc.
ccc ttc ctt ggc gac ttc atg agc ctg ar-g ggt gca ctc 1367 Ala Ala Met Leu Pro Phe Leu Gly Asp Phe Met
Ser Leu Thr Gly Ala Leu 395 400 405 agc acc ttt ccc ctg aca ttc gtt ctt gca aat. cac atg tac ctc acg gtg
1418 Ser Thr Phe Pro Leu Thr Phe Val Leu Ala Asn His Met Tyr Leu Thr Val 410 415 420 425 aag
cag aac aag atg tcc atc ttc agg aaa tgc tgg cac tgg ctg aac gtt 1469 Lys Gln Asn Lys Met Ser Ile Phe
Arg Lys Cys Trp His Trp Leu Asn Val 430 435 440 gtt ggc ttc agc tgc ttg tcc gtc gca gct gcg gtt gct
gcg gtg agg cta 1520 Val Gly Phe Ser Cys Leu Ser Val Ala Ala Ala Val Ala Ala Val Arg Leu 445 450
455 atc acg gtc gac tac agt aca tac cat ttg ttt gct gat atg 1562 Ile Thr Val Asp Tyr Ser Thr Tyr His Leu
Phe Ala Asp Met 460 465 470 tgaggctgga aagtgcaagr- atgcagccct ggatcagctg taaattcgtc ctcttctttt 1622
ttattttttt ggttagggga tgcatgtagg tcgatagaat gatggagatt gcaataaata 1682 atttggctaa aatgttgtcc agatttggtt
gtttgaggtg caagatgttt gcctcaaaac 1742 gtaccgctat. ggttcacttt ttaagaactg tactgctacc tctgtttgcg gagatttttg
1802 tctgcaggca tgcaggatga atattattca agtgctctaa acgaggatcc gggtaccatg 1862 9 1863 zoData supplied
from the esp@cenet database - Worldwide
153/503
23. JP10257894
- 9/29/1998
GENE XA-1 AND XA-1 PROTEIN RESISTANT TO RICE XANTHOMONAS
ORYZAE PV. ORYZAE
URL EPO =
http://v3.espacenet.com/textdoc?F=3&CY=ep&LG=en&IDX=JP10257894
Inventor(s):
YOSHIMURA TOMOMI (--); KURATA NORI (--); KATAYOSE YUICHI (--);
TOKI SEIICHI (--); OU SHIKEN (--); YAMAUCHI UTAKO (--); KONO IZUMI (--)
Applicant(s):
NORINSUISANSHO NOGYO SEIBUTSU (--); NORIN SUISAN SENTAN
GIJUTSU SA (--)
IP Class 4 Digits: C07K; C12N; A01H
IP Class:C07K14/415; A01H5/00; C12N5/10; C12N15/09
Application Number:
JP19970067063 (19970319)
Priority Number: JP19970067063 (19970319)
Family: JP10257894
Abstract:
Abstract of JP10257894
154/503
PROBLEM TO BE SOLVED: To obtain the subject new protein having a specific amino acid
sequence, resistant to Xanthomonas oryzae pv. oryzae, and useful for breeding gene-recombined rice
resistant to the Xanthomonas oryzae pv. oryzae by the transduction of the gene. SOLUTION: This new
Xa-1 protein comprises an amino acid sequence of the formula and resists to Xanthomonas oryzae pv.
oryzae. The transduction of the gene resistant to rice Xanthomonas oryzae pv. oryzae is useful for
breeding the gene-recombined rice exhibiting the resistance to the rice Xanthomonas oryzae pv. oryzae.
The gene is obtained by inoculating Xanthomonas oryzae pv. oryzae I group in the mature leaves of a
strain resistant to the rice Xanthomonas oryzae pv. oryzae, extracting mRNA from the inoculated
leaves within 5 days, preparing a cDNA library from the mRNA, isolating and identifying resistant
gene candidates from the cDNA library by the use of a probe, narrowing the obtained candidates,
inserting the obtained Xa-1 into an expressing vector, and subsequently expressing the gene Xa-1 in a
host cell.
155/503
24. JP11290082
- 10/26/1999
OSDIM GENE OF RICE
URL EPO =
http://v3.espacenet.com/textdoc?F=3&CY=ep&LG=en&IDX=JP11290082
Inventor(s):
NAKAMURA IKUO (--)
Applicant(s):
IWATE PREFECTURE (--)
IP Class 4 Digits: C07K; C12N; A01H; C12R
IP Class:C07K14/415; C12N5/10; A01H1/00; C12N15/09; C12R1/01; C12R1/91
Application Number:
JP19980108037 (19980417)
Priority Number: JP19980108037 (19980417)
Family: JP11290082
Abstract:
Abstract of JP11290082
PROBLEM TO BE SOLVED: To obtain the subject new gene comprising DNA encoding a protein
which participates in formation of a form of a plant having a specific amino acid sequence and useful
for preparation of dwarf plants by antisense chain of the DNA and expression of foreign gene of rice.
156/503
SOLUTION: This new OSDIM gene of rice comprises an amino acid sequence in which one or a
plurality of amino acids are deleted or substituted or added in a protein comprising an amino acid
sequence represented by the formula or an amino acid sequence represented by the formula and
encodes a protein which participates in formation of a form of a plant and is useful as a promoter, etc.,
for constitutively expressing foreign gene in rice. The gene is obtained by screening cDNA library
prepared from a leaf of rice by using cDNA exhibiting high homology with a DIM gene obtained from
salt stress cDNA of rice as a probe.
157/503
25. JP2000125885
- 5/9/2000
GENE RESISTANT TO RICE BLAST AND ASSOCIATED GENE
URL EPO =
http://v3.espacenet.com/textdoc?F=3&CY=ep&LG=en&IDX=JP2000125885
Inventor(s):
KAWASAKI SHINJI (--); HIDARI NANSHU (--); NAKAMURA SHINGO (--)
Applicant(s):
CORP (--)
NATL INST OF AGROBIOLOGICAL RE (--); JAPAN SCIENCE and TECH
IP Class 4 Digits: C07K; C12N; A01H; C12P; C12R
IP Class:C07K14/415; A01H5/00; C12N5/10; C12N15/09; C12R1/91; C12P21/02
Application Number:
JP19990087305 (19990329)
Priority Number: JP19990087305 (19990329); JP19980235884 (19980821)
Family: JP2000125885
Abstract:
Abstract of JP2000125885
PROBLEM TO BE SOLVED: To obtain a gene resistant to rice blast, composed of a blast-resistant
gene having a specific base sequence, capable of providing a blast-resistant rice capable of extremely
158/503
reducing the amount of agrochemicals to be scattered by transducing the gene into a blast-sensitive
rice, and usable for plant bleeding or the like. SOLUTION: This gene is the new blast-resistant gene
having a base sequence of the formula. The gene enables a blast-resistant rice to be created by
transducing a recombinant vector having the gene, into a blast-sensitive rice, and allows the amount of
agrochemicals to be scattered to be reduced extremely. The gene is obtained by forming a genome
library of blast-resistant rice species BL-1, and screening the library by using a neighborhood marker
having a determined and specified position on a chromosome of a blast-resistant gene by the F2
analysis by using an F2 group obtained by hybridizing a blast-sensitive Indica species with a blastsensitive Japonica species, and a nucleic acid marker.
159/503
26. JP2001245667
- 9/11/2001
RICE PLANT DERIVED INFORMATION TRANSMISSION RELATED FACTOR
URL EPO =
http://v3.espacenet.com/textdoc?F=3&CY=ep&LG=en&IDX=JP2001245667
Inventor(s):
YAMAGUCHI ISAMU (--); MOTOYAMA TAKAYUKI (--); YOKOYAMA
TOMOKO (--); YONEYAMA KATSUMI (--)
Applicant(s):
RIKAGAKU KENKYUSHO (--)
IP Class 4 Digits: C07K; C12N; C12Q; A01H; C12P; C12R; G01N
IP Class:C07K14/415; C12Q1/68; A01H5/00; C12N5/10; C12N1/21; C12N15/09; C12R1/91;
C12P21/02; C12N1/15; C12N1/19; G01N33/15; G01N33/50
Application Number:
JP20000062316 (20000307)
Priority Number: JP20000062316 (20000307)
Family: JP2001245667
Abstract:
Abstract of JP2001245667
PROBLEM TO BE SOLVED: To obtain a new NIF1 homolog protein obtained from a rice plant being
a monocotyledonous plant, a gene encoding the protein, a transformant containing the gene and a
transgenic plant containing the gene to provide a method for screening an agrochemical candidate
substance using the gene and the protein. SOLUTION: This protein is (a) a protein composed of am
amino acid sequence represented by a sequence number 2, a sequence number 4, a sequence number 6
or a sequence number 8 (reference to the specification) or (b) a protein which is composed of an amino
acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid
sequence represented by the sequence number 2, the sequence number 4, the sequence number 6 or the
sequence number 8 and has pathological activity of the NHF1 homolog protein.
160/503
27. JP7184659
- 7/25/1995
GENE RELATED TO RESISTANCE AGAINST DISEASE DAMAGE TO RICE
PLANT
URL EPO =
http://v3.espacenet.com/textdoc?F=3&CY=ep&LG=en&IDX=JP7184659
Inventor(s):
MIDO NAOKI (--); IWATA MICHIAKI (--); ANZAI HIROYUKI (--)
Applicant(s):
MEIJI SEIKA KAISHA (--)
IP Class 4 Digits: C07K; C12N; C12Q; C12P
IP Class:C07K14/415; C12Q1/68; C12N15/09; C12P21/02
Application Number:
JP19930349043 (19931228)
Priority Number: JP19930349043 (19931228)
Family: JP7184659
Abstract:
Abstract of JP7184659
PURPOSE:To obtain a new DNA useful for screening a new substance capable of inducing resistance
against disease damage n for preparing a transformed plant having resistance against disease damage.
CONSTITUTION:This gene has a DNA having a base sequence of 834bp of the formula as a cDNA
from an mRNA derived from a rice plant (Oryza-Sativa-L.- cv-Jikkoku) or a part thereof, is transduced
into a rice plant by treatment of the rice plant with probenazole and encodes pathogenesis-relatedprotein contributing to manifestation of pathogenic resistance or its precursor polypeptide. By
differential screening of a cDNA library prepared by taking out an mRNA from the whole RNA
derived from a rice plant treated with probenazole, purifying and synthesizing a cDNA and cloning, a
plasmid vector containing the objective gene is obtained and a base sequence of the cDNA in the
plasmid vector is determined to give a sequence of the formula.
161/503
28. JP8066193
- 3/12/1996
RICE NADH-DEPENDENT REDUCTASE GENE
URL EPO =
http://v3.espacenet.com/textdoc?F=3&CY=ep&LG=en&IDX=JP8066193
Inventor(s):
UCHIMIYA HIROBUMI (--); FUSHIMI TAKAOMI (--); KUDOU UME (--);
TAGAWA MICHITO (--)
Applicant(s):
NISSAN CHEMICAL IND LTD (--)
IP Class 4 Digits: C07K; C12N
IP Class:C07K14/415; C12N15/09; C12N9/02
Application Number:
JP19940256571 (19941021)
Priority Number: JP19940256571 (19941021); JP19940141686 (19940623)
Family: JP8066193
Abstract:
Abstract of JP8066193
PURPOSE: To obtain a new gene having a specific base sequence, coding for a rice NADH-dependent
reductase, capable of giving resistance to pathogenic bacteria to a plant such as rice through linkage to
a manifestation promoter system for plant cells and transfection into said plant. CONSTITUTION:
This new gene has a base sequence containing a base sequence expressed by the formula, coding for a
rice NADH-dependent reductase, capable of controlling toxins produced by phytopathogenic bacteria
and the peripheral metabolites by its linking to a promoter manifestative in plant and its transfecting
into a plant to effect manifestation, thus enabling plants such as rice to be furnished with resistance to
pathogenic bacteria. This new gene is obtained by extracting a mRNA from rice anther by a
conventional method, synthesizing a cDNA using this mRNA to make a cDNA library which is then
screened with a probe followed by recovering the aimed gene from a positive clone.
162/503
29. JP8259598
- 10/8/1996
PREPARED MATERIAL OF RICE, ITS PRODUCTION AND DETECTION OF
RICE ALLERGEN ANTIBODY
URL EPO =
http://v3.espacenet.com/textdoc?F=3&CY=ep&LG=en&IDX=JP8259598
Inventor(s):
IKEZAWA YOSHIRO (--); TSUBAKI KAZUFUMI (--); SHIMADA SADASUKE
(--); MOGI KAZUYUKI (--); SUGIYAMA HIROSHI (--)
Applicant(s):
ALLERGEN FURII TECHNOL KENKYUS (--)
IP Class 4 Digits: C07K; A23J; G01N; A23L
IP Class:C07K14/415; A23L1/10; G01N30/88; G01N33/53; A23J3/14
Application Number:
JP19950091365 (19950324)
Priority Number: JP19950091365 (19950324)
Family: JP8259598
Abstract:
Abstract of JP8259598
PURPOSE: To obtain a prepared material of rice by fractionating an extract produced by extracting
rice with an aqueous medium, fractionating the extract based on the molecular weight of a protein
contained in it and combining the fractions based on their molecular weights, capable of detecting a
rice allergen antibody in high sensitivity. CONSTITUTION: Polished rice such as KOSIHIKARI as a
variety of rice is ground by using a grinder, passed through a sieve of 200mu m to give rice flour,
which is put in a triangular flask and extracted with diethyl ether. The extracted solution is centrifuged,
the supernatant liquid is removed, the rice flour as the precipitate is air-dried to give de-fatted rice
flour. Then, the de-fatted rice flour is stirred with a solution of a salt such as 500mM aqueous solution
of sodium chloride or water for 1 hour, centrifuged, the supernatant liquid is collected to give an
extracted solution of rice allergen. Then, the extracted solution is treated by gel filtration
chromatography or ion exchange chromatography, fractionated based on molecular weight of protein
and the fractions are combined to give the objective prepared material of rice having the ratio of protein
amount with >;25KD molecular weight/protein amount with ;=25KD molecular weight of >;=4.0.
163/503
30. JP9249695
- 9/22/1997
EXTRACTION OF RICE RESERVE PROTEIN
URL EPO =
http://v3.espacenet.com/textdoc?F=3&CY=ep&LG=en&IDX=JP9249695
Inventor(s):
KIZAKI KOZO (--); OKAZAKI NAOTO (--); ARAMAKI ISAO (--); YAO
HIROYUKI (--); TAKAHASHI KOJIRO (--); KOBAYASHI SHINYA (--)
Applicant(s):
NAT TAX ADMINISTRATION AGENCY (--)
IP Class 4 Digits: C07K; A23L
IP Class:C07K14/415; C07K1/14; A23L1/10
Application Number:
JP19960081956 (19960312)
Priority Number: JP19960081956 (19960312)
Family: JP9249695
Abstract:
Abstract of JP9249695
PROBLEM TO BE SOLVED: To selectively extract a high-purity glutelin protein, having high safety
and useful for a reagent, a substrate, a food, a medicine, etc., in a rice reserve protein by absorbing
water in rice, a rice flour or a white rice bran, directly treating the resultant rice, etc., with a dilute acid
or drying the rice, etc., and then treating the dried rice, etc., with the dilute acid. SOLUTION: Rice, a
rice flour or a white rice bran, etc., is immersed in water (at 15 deg.C) in an amount of 10 times based
on the rice, etc., for 2 hr to absorb water therein. The resultant rice, etc., is then drained, steamed with a
steaming basket for 50min, subsequently allowed to cool or directly used or dried, then immersed in a
0.05-5% solution of lactic acid, malic acid, succinic acid, citric acid, fumaric acid, acetic acid,
phosphoric acid and/or hydrochloric acid, etc., and treated with the dilute acid to extract only a protein
body II fraction in a rice reserve protein. The resultant extract solution is separated and a 2%
sulfosalicylic acid is added thereto to precipitate the protein, which is subsequently collected by
centribugation. Thereby, the objective high-purity rice reserve glutelin protein, has high safety and is
usable as a reagent, a substrate and further a food or a medicine.
164/503
31. US2004016027
- 1/22/2004
NOVEL RICE GENE CONTROLLING TOLERANCE TO SALT STRESS
URL EPO =
http://v3.espacenet.com/textdoc?F=3&CY=ep&LG=en&IDX=US2004016027
Inventor(s):
HIROCHIKA HIROHIKO (JP); MIYAO AKIO (JP); TAKEDA MAKOTO (JP);
ABE KIYOMI (JP)
IP Class 4 Digits: C07K; C12N; C12Q; A01H; C07H; C12P
IP Class:C12Q1/68; C12N15/82; A01H5/00; A01H1/00; C12N5/04; C12P21/02; C07H21/04;
C07K14/435
E Class: C07K14/415; C12N15/82C8B2
Application Number:
US20030344980 (20030516)
Priority Number: JP20010239980 (20010807); WO2002JP08041 (20020806)
Family: US2004016027
Equivalent:
WO03014350; JP2003047466; CA2425040
Abstract:
Abstract of US2004016027
A gene encoding a protein capable of controlling salt stress tolerance is provided. A polynucleotide
encoding a plant gene capable of controlling salt stress tolerance is provided. The polynucleotide
includes a polynucleotide which has a nucleotide sequence encoding an amino acid sequence from
methionine at position 1 to asparagine at position 243 of SEQ ID NO: 2 in the sequence listing, or
which has a nucleotide sequence encoding the amino acid sequence having one or several amino acid
deletions, substitutions and/or additions and is capable of controlling salt stress tolerance.Description:
Description of US2004016027
TECHNICAL FIELD
[0001] The present invention relates to a novel gene. More particularly, the present invention relates to
a novel gene encoding a protein having a function of controlling salt stress tolerance in plants.
BACKGROUND ART
[0002] Plants constantly suffer from stresses even in a normal growth environment. Such stresses
variously include salt, drying, high temperature, low temperature, intense light, air pollution, and the
like. Salt stress has received attention in terms of agricultural production. When soils and stones are
decomposed, salts are generated, and the generation of salts is constantly continued. When it rains, the
salts may flow into the river or the sea. In desert areas of low rainfall, a lesser amount of salts flow out,
so that the salt concentration is considerably higher in soil water. Plants draw salts (nutrients) along
with water osmotically through roots. When the salt concentration is high, plants cannot draw water.
Moreover, the growth of the plants is inhibited due to physiological actions specific to ions. It is known
that responses of plants to a salt stress overlap responses to environmental stresses, such as drying, high
osmotic pressure, low temperature, and the like. These stresses lead to considerably severe damage to
agriculture.
[0003] Recently, due to use of fertilizers in bulk or long-term sequential cropping, it is often observed
that a high concentration of salt is accumulated in soil. Especially in greenhouse soil, detrimental salt
accumulation frequently occurs. In areas near seashores, sea water or sea breeze causes damage. In arid
or semiarid regions, salts are accumulated in the surface layer of soil due to excessive evaporation.
These problems limit use of agricultural lands. In order to solve such problems, generally, the affected
165/503
soil is exchanged or salts are removed by irrigation. However, these methods require huge expense or
effort. The removal of salts by irrigation causes a large volume of salt water to flow into surrounding
regions, leading to environmental pollution. Restriction of irrigation is now under consideration.
[0004] Therefore, it is very important to find a plant tolerant to such a salt stress.
[0005] According to studies for salt tolerant plants, which have been carried out at home and abroad, it
is known that when salt tolerant plants are transferred from under non-stress conditions to salt stress
conditions, expression of new genes is induced and the products of these genes play a role in salt stress
tolerance. It is known that among plants of the genus Nicotiana, there are some types of plant having
salt stress tolerance. Isolation of a relevant gene has been reported (Nelson et al., (1992) Plant
Molecular Biology, vol. 19, 577-588; Yun et al. (1996) Plant Physiology, vol. 111, 1219-1225).
Another exemplary gene of plants of the genus Nicotiana relating to response to a salt stress is a gene
derived from Nicotiana paniculata of a type having salt stress tolerance, which is described in Japanese
Laid-Open Publication No. 11-187877, Japanese Laid-Open Publication No. 11-187878, Japanese
Laid-Open Publication No. 11-187879, and Japanese Laid-Open Publication No. 11-187880. Japanese
Laid-Open Publication No. 11-187877 describes a novel gene induced by salt stress. A gene product
encoded by this gene is considered to have a function of conferring moisture stress tolerance to plants.
Japanese Laid-Open Publication No. 11-187878 describes a novel potassium channel gene induced by
salt stress. The potassium channel gene encoded by this gene is considered to have a function of
conferring moisture stress tolerance to plants. Japanese Laid-Open Publication No. 11-187879
describes a novel INPS gene induced by salt stress. The INPS gene encoded by this gene has a function
of conferring moisture stress tolerance to plants. Japanese Laid-Open Publication No. 11-187880
describes a novel chloroplast type fructose bisphosphate aldolase induced by salt stress. The aldolase
encoded by this gene is considered to have a function of conferring moisture stress tolerance to plants.
[0006] Two genes relating to response to salt stress in rice are chloroplast glutamine synthetic enzyme
(GS2) gene (Hoshida et al., Plant Mol. Biol. 43:103-11(2000)); and [Delta]1-pyrroline-5-carboxylate
(P5C) synthetic enzyme (OsP5CS) gene (Igarashi et al., Plant Mol. Biol. 33:857-65(1997)). In the
above-mentioned literature, it is described that the GS2 gene enhances photorespiration ability so that
salt stress tolerance is conferred to a plant. A gene for OsP5CS involved in biosynthesis of proline is
induced by a high concentration of salt, dehydration, abscisic acid treatment, and low temperature.
Expression of the OsP5CS gene under salt stress is stably increased in a salt tolerant cultivar Dee-geewoo-gen, while it is slightly increased in salt sensitive bred variety IR28.
[0007] A number of gene disruption strains of rice have been produced by the property of rice
retrotransposon Tos17 that it is activated by culture to undergo transposition. Transposons are
mutagenic genes which are ubiquitous in the genomes of animals, yeast, bacteria, and plants.
Transposons are classified into two categories according to their transposition mechanism. Transposons
of class II undergo transposition in the form of DNA without replication. Examples of class II
transposons include Ac/Ds, Spm/dSpm and Mu elements of maize (Zea mays) (Fedoroff, 1989, Cell
56, 181-191; Fedoroff et al., 1983, Cell 35, 235-242; Schiefelbein et al., 1985, Proc. Natl. Acad. Sci.
USA 82, 4783-4787), and Tam element of Antirrhinum (Antirrhinum majus) (Bonas et al., 1984,
EMBO J, 3, 1015-1019). Class II transposons are widely used for gene isolation by means of
transposon tagging. Such a technique utilizes a property of transposons, that is, a transposon transposes
within a genome and enters a certain gene and, as a result, such a gene is physiologically and
morphologically modified, whereby the phenotype controlled by the gene is changed. If such a
phenotype change can be detected, the affected gene may be isolated (Bancroft et al., 1993, The Plant
Cell, 5, 631-638; Colasanti et al., 1998, Cell, 93, 593-603; Gray et al., 1997, Cell, 89, 25-31; Keddie et
al., 1998, The Plant Cell, 10, 877-887; and Whitham et al., 1994, Cell, 78, 1101-1115).
[0008] Transposons of class I are also called retrotransposons. Retrotransposons undergo replicative
transposition through RNA as an intermediate. A class I transposon was originally identified and
characterized in Drosophila and yeast. A recent study has revealed that retrotransposons are ubiquitous
and dominant in plant genomes (Bennetzen, 1996, Trends Microbiolo., 4, 347-353; Voytas, 1996,
Science, 274, 737-738). It appears that most retrotransposons are an integratable but non-transposable
unit. Recently, it has been reported that some retrotransposons of such a type are activated under stress
conditions, such as injury, pathogen attack, and cell culture (Grandbastien, 1998, Trends in Plant
Science, 3, 181-187; Wessler, 1996, Curr. Biol., 6, 959-961; Wessler et al., 1995, Curr. Opin. Genet.
Devel., 5, 814-821). For example, such activation under stress conditions was found in
retrotransposons of tobacco, Tnt1A and Tto1 (Pouteau et al., 1994, Plant J., 5, 535-542; Takeda et al.,
1988, Plant Mol. Biol., 36, 365-376), and a retrotransposon of rice, Tos17 (Hirochika et al., 1996, Proc.
Natl. Acad. Sci. USA, 93, 7783-7788).
166/503
[0009] The rice retrotransposon Tos17 is a class I element in plants which has been extensively studied.
Tos17 was cloned by RT-PCR using degenerate primers which had been prepared based on a
conserved amino acid sequence of the reverse transcriptase domains of Ty1-copia group retro-elements
(Hirochika et al., 1992, Mol. Gen. Genet., 233, 209-216). Tos17 has a length of 4.3 kb and has two
identical LTRs (long terminal repeats) of 138 bp and a PBS (primer binding site) which is
complementary to the 3' end of the initiator methionine tRNA (Hirochika et al., 1996, supra).
Transcription of Tos17 is strongly activated by tissue culture, and the copy number of Tos17 increases
with time in culture. Its initial copy number in Nipponbare (a Japonica variety), which is used as a
genome research model, is two. In plants regenerated from tissue culture, its copy number is increased
to 5 to 30 (Hirochikaet al., 1996, supra). Unlike class I transposons found in yeast and Drosophila,
Tos17 undergoes random transposition in a chromosome and induces mutation in a stable manner.
Therefore, Tos17 provides a useful tool in reverse genetics for analyzing the function of a gene in rice
(Hirochika, 1997, Plant Mol. Biol. 35, 231-240; K. Shimamoto Ed., 1999, Molecular Biology of Rice,
Springer-Verlag, 43-58).
DISCLOSURE OF THE INVENTION
[0010] Therefore, an object of the present invention is to reveal a gene encoding a protein capable of
determining sensitivity to a salt stress and/or osmotic stress; manipulate sensitivity to a plurality of
environmental stresses including a salt stress and an osmotic stress; select plants having different
sensitivities; and provide a gene useful for production of plants having enhanced tolerance to these
environmental stresses.
[0011] The present inventors found mutants having a high level of sensitivity to a salt stress among a
number of rice gene destruction strains which were produced using the property of rice retrotransposon
Tos17 that it is activated by culture to undergo transposition. This mutant exhibits traits, such as
growth inhibition and morphological abnormality of an organ, under salt stress. The relationship
between trait change and salt stress has been rigorously studied. As a result, it was found that trait
change is attributed to mutation(s) of a gene capable of determining sensitivity to salt stress, and the
present invention was completed.
[0012] The present invention relates to a polynucleotide, encoding a plant gene capable of controlling
salt stress tolerance, wherein the polynucleotide includes a polynucleotide which has a nucleotide
sequence encoding an amino acid sequence from methionine at position 1 to asparagine at position 243
of SEQ ID NO: 2 in the sequence listing, or which has a nucleotide sequence encoding the amino acid
sequence having one or several amino acid deletions, substitutions and/or additions and is capable of
controlling salt stress tolerance.
[0013] In one embodiment of this invention, the plant gene is further capable of controlling osmotic
stress tolerance.
[0014] In one embodiment of this invention, the polynucleotide is derived from rice.
[0015] The present invention also relates to a polynucleotide, encoding a plant gene capable of
controlling salt stress tolerance, wherein the polynucleotide includes a polynucleotide having a
nucleotide sequence from A at position 233 to C at position 961 in SEQ ID NO: 1 in the sequence
listing, or a nucleotide sequence hybridizable to the nucleotide sequence under stringent conditions.
[0016] In one embodiment of this invention, the plant gene is further capable of controlling osmotic
stress tolerance.
[0017] In one embodiment of this invention, the polynucleotide is derived from rice.
BRIEF DESCRIPTION OF THE DRAWINGS
[0018] FIG. 1 shows photographs (A) indicating the morphology of shoots and roots of mutants highly
sensitive to salt stress obtained from a redifferentiated Nipponbare strain and wild type seedlings as
controls, and photographs (B) indicating the morphology of roots.
[0019] FIG. 2 shows photographs indicating the morphology of shoots and roots of mutants highly
sensitive to salt stress separately obtained from a redifferentiated Nipponbare strain (A) and a
redifferentiated Hitomebore strain and wild type seedlings as controls.
[0020] FIG. 3 shows a cDNA sequence of a rice gene determining salt stress sensitivity.
[0021] FIG. 4 shows a putative amino acid sequence of a protein encoded by a rice gene determining
salt stress sensitivity.
[0022] FIG. 5 shows photographs indicating the morphology of shoots and roots of wild types and
mutant types germinated and grown in medium without sodium chloride (A) and medium with sodium
chloride (B), and the morphology of growth of a mutant type grown in normal soil.
167/503
[0023] FIG. 6 shows a photograph indicating the morphology of growth of shoots and roots of wild
types and a mutant type grown in mannitol-containing medium.
BEST MODE FOR CARRYING OUT THE INVENTION
[0024] The present invention provides a novel plant gene which was isolated by using Tos17 and
whose function was revealed.
[0025] The term "gene" as used herein refers to a structural unit carrying hereditary information and an
element defining a trait. A gene may be defined as a hereditary functional unit specified by the base
sequence of a certain region in polymer DNA or RNA. Therefore, a gene may be understood as a DNA
or RNA which will be eventually translated into a protein, or a polynucleotide.
[0026] "Stress" as used herein refers to a factor which externally causes a change in the growth of
plants. "Environmental stress" refers to a stress provided by a change in an external environment,
including salts, high osmotic pressure, drying, high temperature, low temperature, intense light, air
pollution, and the like.
[0027] According to the present invention, a polynucleotide encoding a plant gene controlling salt
stress tolerance is provided. The term "salt stress" as used herein means that salt concentration is
increased in a cultivation medium (e.g., soil, media which permit cultivation of plants (solid or liquid),
etc.) to the extent that the growth of plants is adversely affected. Salts include any salt which leads to
inhibition of water absorption in plants, including, for example, magnesium salts, chloride salts,
aluminum salts, and the like. The term "salt stress tolerance" as used herein refers to tolerance to the
above-described salt stresses. "Salt stress sensitivity" refers to sensitivity to the above-described salt
stresses, for example, affected by an influence disadvantageous to growth. When a strain having "salt
stress sensitivity" is grown in a cultivation medium (e.g., soil, media which permit cultivation of plants
(solid or liquid), etc.) having an intermediate/low concentration (e.g., 50 to 300 mM, and preferably
100 to 150 mM) of salt, the strain may exhibit growth inhibition and morphological abnormality in
plant organs and tissue. "Control salt stress tolerance" refers to suppressing or promoting expression of
a gene involved in salt stress, or encoding a protein determining salt stress tolerance or controlling its
operation.
[0028] The plant gene of the present invention may further control osmotic stress tolerance. "Osmotic
stress" means that generation of osmotic pressure adversely affects the growth of plants. Osmotic
pressure is involved in the growth of plant cells (water absorption) in which water is taken into the cell
to increase the volume of the cell. In general, as osmotic pressure is increased, the water absorption
power of plants is lowered. The term "osmotic stress tolerance" as used herein refers to tolerance to an
osmotic stress. "Osmotic stress sensitivity" means a certain response to the above-described osmotic
stress. When a strain having "onosmotic stress sensitivity" is grown in a cultivation medium (e.g., soil,
media which permit cultivation of plants (solid or liquid), etc.) and which causes high osmotic pressure
(e.g., 50 to 600 mM, and preferably at least 150 mM in a mannitol equivalent), a plant body
(particularly, roots) may exhibit significant growth inhibition. "Control osmotic stress tolerance" refers
to suppressing or promoting expression of a gene involved in an osmotic stress, or encoding a protein
determining osmotic stress tolerance or controlling its operation.
[0029] The polynucleotide of the present invention as mentioned above is a polynucleotide, including a
polynucleotide having a nucleotide sequence encoding an amino acid sequence from methionine (Met)
at position 1 to asparagine (Asn) at position 243 in SEQ ID NO: 2 in the sequence listing, or a
nucleotide sequence encoding an amino acid sequence in which one or several amino acids are deleted
from, substituted in, and/or added to the above amino acid sequence. In one embodiment, the
polynucleotide of the present invention is a polynucleotide having a nucleotide sequence at position
233-961 of SEQ ID NO: 1 of the sequence listing. The polynucleotide of the present invention may
further contain a nucleotide sequence (e.g., a non-translational region) out of (5' or 3' to) the abovedescribed regions (the nucleotide sequence region encoding the amino acid sequence from methionine
(Met) at position 1 to asparagine (Asn) at position 243 of SEQ ID NO: 2 or the nucleotide sequence
region at position 233-961 of SEQ ID NO: 1). More preferably, the polynucleotide of the present
invention consists of the full-length sequence at position 1-1154 of SEQ ID NO: 1. The polynucleotide
of the present invention includes all degenerate isomers of SEQ ID NO: 1. The term "degenerate
isomer" refers to DNA encoding the same polypeptide and having a degenerate codon(s). For example,
for a DNA having the base sequence of SEQ ID NO: 1 in which a codon corresponding to a certain
amino acid (e.g., Asn) thereof is AAC, a DNA in which the AAC is changed to the degenerate codon
AAT is called a degenerate isomer.
168/503
[0030] The polynucleotide of the present invention has been obtained from a rice genomic DNA using
Tos17 as a marker based on the finding of a mutant highly sensitive to a salt stress of a rice gene
disruption strain produced using the property of rice retrotransposon Tos17 that it is activated by
culture and undergoes transposition. Therefore, in one embodiment, the polynucleotide of the present
invention is derived from rice.
[0031] Fragments and variants of the disclosed nucleotide sequences and proteins encoded thereby may
be included in the present invention. The term "fragment" is intended to refer to a portion of a
nucleotide sequence or a portion of an amino acid sequence, or a protein encoded thereby. A fragment
of a nucleotide sequence can encode a protein fragment holding at least one functional biological
activity of a native protein.
[0032] A variant of a protein encoded by the polynucleotide of the present invention is intended to refer
to a protein modified from the native protein by at least one amino acid deletion (truncation) or
addition at the N and/or C terminus of the protein; at least one amino acid deletion or addition at at
least one site in the protein; or at least one amino acid substitution at at least one site in the protein.
Such a variant may be generated by genetic polymorphism or artificial modification, for example.
[0033] The protein encoded by the polynucleotide of the present invention may be modified using
various methods (including amino acid substitution, deletion, truncation, and insertion). These methods
are generally known in the art. For example, a variant of the amino acid sequence of the protein
encoded by the plant gene capable of controlling stress tolerance of the present invention may be
prepared by mutagenesis. Methods for mutagenesis and modification of a nucleotide sequence are well
known in the art, e.g., Kunkel (1985) Proc. Natl. Acad. Sci. USA 82:488-492; Kunkel et al. (1987)
Methods in Enzymol. 154:367-382; U.S. Pat. No. 4,873,192; Walker and Gaastra ed. (1983)
Techniques in Molecular Biology (MacMillian Publishing Company, New York) and their cited
references. Guidance as to appropriate amino acid substitutions that do not affect biological activity of
the protein of interest can be found in the model of Dayhoff et al. (1987) Atlas of Protein Sequence and
Structure (Natl. Biomed. Res. Found. Washington, D.C.), which is herein incorporated by reference.
Conservative substitution (e.g., one amino acid is substituted with another one having a similar
property) may be preferable. Examples of such a substitution include a substitution between
hydrophobic amino acids (Ala, Ile, Leu, Met, Phe, Pro, Trp, Tyr, and Val); a substitution between
hydrophilic amino acids (Arg, Asp, Asn, Cys, Glu, Gln, Gly, His, Lys, Ser, and Thr); a substitution
between amino acids having an aliphatic side chain (Gly, Ala, Val, Leu, Ile, and Pro); a substitution
between amino acids having a side chain containing a hydroxyl group (Ser, Thr, and Tyr); a
substitution between amino acids having a side chain containing a sulfur atom (Cys and Met); a
substitution between amino acids having a side chain containing carboxylic acid and amide (Asp, Asn,
Glu, and Gln); a substitution between amino acids having a side chain containing a base (Arg, Lys, and
His); and a substitution between amino acids having a aromatic side chain (His, Phe, Tyr, and Trp).
[0034] Therefore, "one or several deletions, substitutions and/or additions" refers to as many amino
acid substitution(s), deletion(s) and/or addition(s) as those caused by genetic polymorphism or artificial
modification (including the above-described well-known methods). "One or several deletions,
substitutions and/or additions" are any number of amino acids may be deleted from, added to, and/or
substituted in the amino acid sequence of the protein as long as a protein having such modifications
still has the function of the protein encoded by the polynucleotide of the present invention. It will be
clearly understood by those skilled in the art that the influence of modifications, such as amino acid
substitutions, deletions and/or additions, on activity may be dependent on the positions, extent, types,
or the like of amino acids to be modified. Regarding the polynucleotide of the present invention, a
number of amino acids may be deleted, substituted and/or added in the full-length amino acid sequence
to satisfy the amino acid sequence identity defined below, as long as the function of the protein
encoded by the polynucleotide of the present invention can be expressed, for example.
[0035] The polynucleotide encoding the plant gene capable of controlling salt stress tolerance of the
present invention includes a polynucleotide having a nucleotide sequence encoding an amino acid
sequence having at least 60%, preferably at least 65%, more preferably at least 70%, more preferably at
least 75%, even more preferably at least 80%, still more preferably at least 90%, still even more
preferably at least 95%, and most preferably at least 99% sequence identity to the amino acid sequence
from Met at position 1 to Asn at position 243 in SEQ ID NO: 2 of the sequence listing as long as it can
similarly salt stress tolerance.
[0036] The polynucleotide encoding the plant gene capable of controlling salt stress tolerance of the
present invention includes a polynucleotide having a nucleotide sequence having at least 70%,
preferably at least 75%, more preferably at least 80%, even more preferably at least 85%, still more
preferably at least 90%, still even more preferably at least 95%, and most preferably at least 99%
169/503
sequence identity to the nucleotide sequence encoding the amino acid sequence from Met at position 1
to Asn at position 243 in SEQ ID NO: 2 of the sequence listing (preferably, a nucleotide sequence from
A at position 233 to C at position 961 in SEQ ID NO: 1) as long as it can similarly control salt stress
tolerance.
[0037] As used herein, a "reference sequence" refers to a defined sequence used as a basis for a
sequence comparison. A reference sequence may be a subset or the whole of the specified sequence;
for example, a segment of a full-length cDNA or gene sequence or a complete DNA or gene sequence.
[0038] As used herein, a "comparison window"s includes reference to a contiguous and specified
segment of a polynucleotide sequence, wherein the polynucleotide sequence in the comparison window
may contain additions or deletions (i.e., gaps) compared to the reference sequence (which does not
comprise additions or deletions) for optimal alignment of the two sequences. Generally, the comparison
window is at least 20 contiguous nucleotides in length, and optionally can be 30, 40, 50, 100, or longer.
Those skilled in the art understand that to avoid a high similarity to a reference sequence due to
inclusion of gaps in the polynucleotide sequence, typically a gap penalty is introduced and is subtracted
from the number of matches.
[0039] Methods of alignment of sequences for comparison are well-known in the art. Global optimal
alignment of a reference sequence (the sequence of the present invention) and a subject sequence is
preferably determined by homology analysis using BLAST (Altshul et al., 1997, Nucleic Acids Res.,
25, 3389-3402). In a sequence alignment, the reference and subject sequences are both DNA
sequences. An RNA sequence can be compared by converting U's to T's. The result of the global
sequence alignment is in percent identity. The sequence alignment may be conducted using default
parameters in the program.
[0040] As used herein, "sequence identity" or "identity" in the context of two nucleic acid or
polypeptide sequences includes reference to the residues in the two sequences which are the same when
aligned for maximum correspondence over a specified comparison window. When percentage of
sequence identity is used in reference to proteins it is recognized that residue positions which are not
identical often differ by conservative amino acid substitutions, where amino acid residues are
substituted with other amino acid residues with similar chemical properties (e.g. charge or
hydrophobicity) and therefore do not change the functional properties of the molecule. Where
sequences differ in conservative substitutions, the percent sequence identity maybe adjusted upwards to
correct for the conservative nature of the substitution. Sequences which differ by such conservative
substitutions are said to have "sequence similarity" or "similarity". Means for making this adjustment
are well-known to those skilled in the art. Typically this involves scoring a conservative substitution as
a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for
example, where an identical amino acid is given a score of 1 and a non-conservative substitution is
given a score of zero, a conservative substitution is given a score between zero and 1. The scoring of
conservative substitutions is calculated with, e.g., the program PC/GENE (Intelligenetics, Mountain
View, Calif., USA).
[0041] As used herein, "percentage of sequence identity" means the value determined by comparing
two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide
sequence in the comparison window may contain additions or deletions (i. e., gaps) as compared to the
reference sequence (which does not comprise additions or deletions) for optimal alignment of the two
sequences. The percentage is calculated by determining the number of positions at which the identical
nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched
positions, dividing the number of matched positions by the total number of positions in the window of
comparison and multiplying the result by 100 to yield the percentage of sequence identity.
[0042] The term "substantial identity" of polynucleotide sequences means that a polynucleotide
comprises a sequence that has at least 70% sequence identity, preferably at least 80%, more preferably
at least 90% and most preferably at least 95%, compared to a reference sequence using one of the
alignment programs described using standard parameters. Those skilled in the art will recognize that
these values can be appropriately adjusted to determine corresponding identity of proteins encoded by
two nucleotide sequences by taking into account codon degeneracy, amino acid similarity, reading
frame positioning and the like. Substantial identity of amino acid sequences for these purposes means
sequence identity of normally at least 60%, more preferably at least 70%, 80%, 90%, and most
preferably at least 95%.
[0043] The term "substantial identity" in the context of a peptide indicates that a peptide comprises a
sequence with at least 70% sequence identity to a reference sequence, preferably 80%, more preferably
85%, most preferably at least 90% or 95% sequence identity to the reference sequence over a specified
comparison window. Optionally, optimal alignment is conducted using the homology alignment
170/503
algorithm of Needleman et al., J. Mol. Biol. 48: 443 (1970). A peptide is substantially identical to a
second peptide, for example, where the two peptides differ only by a conservative substitution.
Peptides which are "substantially similar" share sequences as noted above except that residue positions
which are not identical may differ by conservative amino acid changes.
[0044] Fragments of the plant gene nucleotide sequence of the present invention capable of controlling
salt stress tolerance, which encode a biologically active portion of a protein capable of controlling salt
stress tolerance, encode at least 15, 25, 30, 50, 100, 125, 150, 175, 200, or 225 contiguous amino acids,
or the overall amino acids present in the full-length protein of the present invention (e.g., 243 amino
acids of SEQ ID NO: 2). In general, a fragment of the plant gene nucleotide sequence capable of
controlling salt stress tolerance, which is used as a hybridization probe for a PCR primer, may not
encode a biologically active portion of a protein capable of controlling salt stress tolerance in plants.
[0045] Polynucleotides encoding a plant gene capable of controlling salt stress tolerance derived from
plants other than rice maybe included in the scope of the present invention. Such a polynucleotide may
be isolated by, for example, conducting PCR using a primer designed based on the full-length or a
portion of a disclosed nucleotide sequence and the genomic DNA of a selected plant as a template,
followed by screening genomic DNA or cDNA libraries of the same plant using an obtained amplified
DNA fragment as a probe. In this manner, methods such as PCR, hybridization, and the like can be
used to identify such sequences based on their sequence identity to the sequence set forth herein.
Sequences isolated based on their sequence identity to the sequences set forth herein or to fragments
thereof are encompassed by the present invention.
[0046] In a hybridization technique, all or part of a known nucleotide sequence is used as a probe
which selectively hybridizes an other corresponding nucleotide sequence present in a group of cloned
genomic DNA fragments or cDNA fragments derived from a selected organism (i.e., genomic libraries
or cDNA libraries). The hybridization probe may be genomic DNA fragments, cDNA fragments, RNA
fragments, or other oligonucleotides, and may be labeled with a detectable group. (e.g., >;32;P) or any
other detectable marker. Therefore, probes for hybridization can be made by labeling synthetic
oligonucleotides based on the nucleotide sequence of the plant gene capable of controlling salt stress
tolerance in plants of the present invention. Methods for preparation of probes for hybridization and
construction of cDNA libraries and genomic libraries are generally known in the art and are disclosed
in Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2nd ed., Cold Spring Harbor
Laboratory Press, Plainview, N.Y., which is herein incorporated by reference).
[0047] For example, all or a part of a nucleotide sequence encoding the plant gene capable of
controlling salt stress tolerance disclosed herein can be used as a probe hybridizable to the
corresponding plant gene sequence capable of controlling salt stress tolerance and the messenger RNA
thereof. To achieve specific hybridization under various conditions, such a probe is unique to the plant
gene sequence capable of controlling salt stress tolerance, and includes sequence having preferably at
least about 10 nucleotides in length, and most preferably at least about 20 nucleotides in length. Such a
probe can be used in PCR to amplify the plant gene sequence capable of controlling salt stress
tolerance derived from a selected organism. Methods for PCR amplification are well known in the art
(PCR Technology: Principles and Applications for DNA Amplification, H A Erlich ed., Freeman Press,
New York, N.Y. (1992); PCR Protocols: A Guide to Methods and Applications, Innis, Gelfland,
Snisky, and White ed., Academic Press, San Diego, Calif. (1990); Mattila et al. (1991) Nucleic Acids
Res. 19: 4967; Eckert, K. A. and Kunkel, T. A. (1991) PCR Methods and Applications 1: 17; PCR,
McPherson, Quirkes, and Taylor, IRL Press, Oxford, these are herein incorporated by reference). This
technique can be used as a diagnostic assay to isolate additional encoding sequences from a desired
organism or to determine the presence of an encoding sequence in an organism. The hybridization
technique includes hybridization screening of plated DNA libraries (either plaques or colonys; e.g.,
Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2nd ed., Cold Spring Harbor
Laboratory Press, Plainview, N.Y.)).
[0048] The hybridization of the sequences may be conducted under stringent conditions. The terms
"stringent conditions" or "stringent hybridization conditions" includes reference to conditions under
which a probe will hybridize to its target sequence, to a detectably greater degree than other sequences
(e. g., at least 2-fold over background). Stringent conditions are sequence-dependent and will be
different in different circumstances. By controlling the stringency of the hybridization and/or washing
conditions, target sequences can be identified which are 100% complementary to the probe.
Alternatively, stringency conditions can be adjusted to allow some mismatching in sequences so that
lower degrees of similarity are detected. Generally, a probe is less than about 1000 nucleotides in
length, preferably less than 500 nucleotides in length.
171/503
[0049] Typically, stringent conditions will be those in which the salt concentration is less than about
1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) (pH 7.0 to 8.3) and the
temperature is at least about 30[deg.] C. for short probes (e. g., 10 to 50 nucleotides) and at least about
60[deg.] C. for long probes (e. g., greater than 50 nucleotides). Stringent conditions may also be
achieved with the addition of destabilizing agents (e.g., formamide). Exemplary stringency conditions
include hybridization with a buffer solution of 30 to 35% formamide, 1 M NaCl, 1% SDS (sodium
dodecyl sulphate) at 37[deg.] C., and a wash in 1* to 2* SSC (20* SSC=3.0 M NaCl/0.3 M trisodium
citrate) at 50 to 55[deg.] C. Exemplary more stringent conditions include hybridization in 40 to 45%
formamide, 1.0 M NaCl, 1% SDS at 37[deg.] C., and awash in 0.5* to 1* SSC at 55 to 60[deg.] C.
Exemplary even more stringent conditions include hybridization in 50% formamide, 1 M NaCl, 1%
SDS at 37[deg.] C., and a wash in 0.1* SSC at 60 to 65[deg.] C.
[0050] Specificity is typically the function of post-hybridization washes, the critical factors being the
ionic strength and temperature of the final wash solution. For DNA-DNA hybrids, the Tm can be
approximated from the equation of Meinkoth and Wahl (1984), Anal. Biochem., 138: 267-284:
Tm=81.5[deg.] C.+16.6(log M)+0.41 (% GC)-0.61 (% form)-500/L; where M is the molarity of
monovalent cations, % GC is the percentage of guanosine and cytosine nucleotides in the DNA, %
form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in
base pairs. The Tm is the temperature (under defined ionic strength and pH) at which 50% of a
complementary target sequence hybridizes to a perfectly matched probe. Tm is reduced by about
1[deg.] C. for each 1% of mismatching; thus, Tm, hybridization and/or wash conditions can be adjusted
to hybridize to sequences of the desired identity. For example, if sequences with at least 90% identity
are sought, the Tm can be decreased 10[deg.] C. Generally, stringent conditions are selected to be
about 5[deg.] C. lower than the thermal melting point (Tm) for the specific sequence and its
complement at a defined ionic strength and pH. However, severely stringent conditions can utilize a
hybridization and/or wash at 1, 2, 3, or 4[deg.] C. lower than the thermal melting point (Tm);
moderately stringent conditions can utilize a hybridization and/or wash at 6, 7, 8, 9, or 10[deg.] C.
lower than the thermal melting point (Tm); low stringency conditions can utilize a hybridization and/or
wash at 11, 12, 13, 14, 15, or 20[deg.] C. lower than the thermal melting point (Tm). Using the
equation, hybridization and wash compositions, and desired Tm, those skilled in the art will understand
that variations in the stringency of hybridization and/or wash solutions are inherently described. If the
desired degree of mismatching results in a Tm of less than 45[deg.] C. (aqueous solution) or 32[deg.]
C. (formamide solution) it is preferred to increase the SSC concentration so that a higher temperature
can be used. An extensive guide to the hybridization of nucleic acids is found in Tijssen (1993),
Laboratory Techniques in Biochemistry and Molecular Biology Hybridization with Nucleic Acid
Probes, Part I, Chapter 2 (Elsevier, N.Y.); and Ausubel, et al., Eds. (1995), Current Protocols in
Molecular Biology, Chapter 2 (Greene Publishing and Wiley-Interscience, New York). Also See,
Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2nd ed., Cold Spring Harbor
Laboratory Press, Plainview, N.Y., which is herein incorporated by reference).
[0051] The base sequence of the obtained gene can be determined by a nucleotide sequence analysis
method known in the art or a commercially available automated sequencer.
[0052] The polynucleotide of the present invention is typically obtained in accordance with a method
set forth herein, or may be obtained by chemical synthesis based on the sequences described in the
present invention. For example, the polynucleotide of the present invention may be synthesized using a
polynucleotide synthesizer commercially available from Applied BioSystems, Inc. (the present Perkin
Elmer) in accordance with the instructions provided by the manufacturer.
[0053] As demonstrated in examples below, it is clear that a polynucleotide encoding the plant gene of
the present invention determines sensitivity to a salt stress and an osmotic stress. It is known that
responses of plants to a salt stress overlap responses to environmental stresses, such as drying, high
osmotic pressure, low temperature, and the like (Tanpakushitsu Kakusan Koso [Protein/Nucleic
acid/Enzyme] (1999) Vol. 44, 2147-2148/2188-2198; Curr. Opinion. Plant. Biol. (2001) vol. 4 241246; Curr. Opinion. Plant. Biol. (2000) vol. 3 217-223; TRENDS in Plant Science (2001) Vol.6 66-71).
It is highly probable that the polynucleotide of the present invention relates to a stress due to drying or
low temperature. When the polynucleotide of the present invention exhibits its function, plants
normally grow under stress conditions or the growth of plants is not adversely affected. However, when
the polynucleotide of the present invention does not function for any reason, the growth of plants under
stress conditions may be inhibited.
[0054] A desired property of the polynucleotide produced by the above-described genetic engineering
method or chemical synthesis method, i.e., capability of controlling salt stress tolerance, can be
confirmed as follows. Specifically, the obtained polynucleotide is introduced into salt stress sensitive
172/503
plants (e.g., a strain ND1004(-/-) obtained in Example 1 below) with techniques well known in the art.
If salt stress tolerance is restored, the presence of the desired activity, i.e., an action of controlling salt
stress tolerance, can be confirmed. The presence of an action of controlling salt stress tolerance may be
confirmed by substantially the same procedure as described in Example 5. For example, it is assumed
that the polynucleotide is introduced into the strain ND1004(-/-). If the strain ND1004(-/-) exhibits
substantially the same salt stress tolerance as that of a wild type plant as described in Example 5, the
presence of salt stress tolerance is confirmed. "Exhibit substantially equivalent salt stress tolerance as
that of a wild type plant" may mean that no significant difference is observed in the growth of plants, to
which the polynucleotide of the present invention is introduced, under salt stress conditions and no-salt
stress conditions as shown in Example 5. Note that "salt stress conditions" as used herein means that
plants can be grown in the cultivation medium (e.g., soil, media which permit cultivation of plants
(solid or liquid), etc.) having an intermediate/low concentration (e.g., 50 to 300 mM, and preferably
100 to 150 mM) of salt as mentioned above.
[0055] Therefore, the polynucleotide of the present invention may be used to manipulate the sensitivity
of plants to the above-described stresses including salt stress and osmotic stress or to select plants
having different sensitivities to the stress (e.g., by screening various plant strains using a probe or a
primer based on the whole or a part of the polynucleotide having the sequence of the present
invention).
[0056] The polynucleotide of the present invention can be used to produce plants having enhanced
tolerance to the above-described stresses. These plants are preferable if they are useful for agriculture.
Development of such stress tolerant plants is expected to provide a reduction in agricultural damage
due to environmental stresses and beneficial effects, such as an increase in crop yield due to extension
of cultivation area and preservation of the environment.
[0057] The polynucleotide of the present invention may be ligated in a native or modified form with an
appropriate plant expression vector using a method well known to those skilled in the art, and the
vector may be introduced into a plant cell using a known gene recombination technique. The gene is
incorporated in the DNA of a plant cell. The DNA of a plant cell includes DNA contained in various
organelles (e.g., mitochondria and chloroplasts) as well as chromosomes.
[0058] As used herein, a "plant expression vector" refers to a nucleic acid sequence to which various
regulatory elements, such as a promoter which regulates expression of the gene of the present
invention, are operatively linked in a host plant cell. The term "control sequence" as used herein refers
to a DNA sequence having a functional promoter and any related transcription element (e.g., an
enhancer, a CCAAT box, a TATA box, and a SPI site). The term "operably linked" as used herein
indicates that a polynucleotide is linked to a regulatory element which regulates expression of a gene,
such as a promoter or an enhancer, so that the gene can be expressed. The plant expression vector may
preferably include plant gene promoters, terminators, drug-resistance genes, and enhancers. It is well
known to those skilled in the art that the type of an expression vector and the type of a regulatory
element used may be changed depending on the host cell. A plant expression vector used in the present
invention may have a T-DNA region. The T-DNA region can enhance the efficiency of gene
introduction, particularly when Agrobacterium is used to transform a plant.
[0059] The term "plant gene promoter" as used herein refers to a promoter which is expressed in plants.
A plant promoter fragment can be employed which will direct expression of a polynucleotide of the
present invention in all tissues of a regenerated plant. Examples of a promoter for structural expression
include a promoter for nopaline synthase gene (Langridge, 1985, Plant Cell Rep. 4, 355), a promoter
for producing cauliflower mosaic virus 19S-RNA (Guilley, 1982, Cell 30, 763), a promoter for
producing cauliflower mosaic virus 35S-RNA (Odell, 1985, Nature 313, 810), rice actin promoter
(Zhang, 1991, Plant Cell 3, 1155), a maize ubiquitin promoter (Cornejo 1993, Plant Mol. Biol. 23,
567), and a REX[phi] promoter (Mitsuhara, 1996, Plant Cell Physiol. 37, 49).
[0060] Alternatively, the plant promoter can direct expression of a polynucleotide of the present
invention in a specific tissue or may be otherwise under more precise environmental or developmental
control. Such promoters are herein referred to as "inducible" promoters. Examples of inducible
promoters include promoters which are inducible by environmental conditions, such as light, low
temperature, high temperature, dryness, ultraviolet irradiation, or spray of a specific compound.
Examples of such promoters include a promoter for a gene encoding ribulose-1,5-diphosphate
carboxylase small subunit which is induced by light irradiation (Fluhr, 1986, Proc. Natl. Acad. Sci.
USA 83, 2358), a promoter for rice lip19 gene inducible by low temperature (Aguan, 1993, Mol. Gen.
Genet. 240, 1), promoters for rice hsp72 and hsp80 genes inducible by high temperature (Van
Breusegem, 1994, Planta 193, 57), a promoter for the rab16 gene of Arabidopsis thaliana inducible by
dryness (Nundy, 1990, Proc. Natl. Acad. Sci. USA 87, 1406), and a promoter for maize alcohol
173/503
dehydrogenase gene inducible by ultraviolet irradiation (Schulze-Lefert, 1989, EMBO J. 8, 651). A
promoter for the rab16 gene is inducible by spraying abscisic acid which is a plant hormone.
[0061] A "terminator" is a sequence which is located downstream of a region encoding a protein of a
gene and which is involved in the termination of transcription when DNA is transcribed into mRNA,
and the addition of a polyA sequence. It is known that a terminator contributes to the stability of
mRNA, and has an influence on the amount of gene expression. Examples of such a terminator include,
but are not limited to, a CaMV35S terminator and a terminator for the nopaline synthetase gene (Tnos).
[0062] A "drug-resistant gene" is desirably one that facilitates the selection of transformed plants. The
neomycin phosphotransferase II (NPTII) gene for conferring kanamycin resistance, the hygromycin
phosphotransferase gene for conferring hygromycin resistance, and the like may be preferably used.
The present invention is not so limited.
[0063] An "enhancer" may be used so as to enhance the expression efficiency of a gene of interest. As
such an enhancer, an enhancer region containing an upstream sequence within the CaMV35S promoter
is preferable. A plurality of enhancers may be used.
[0064] Plant expression vectors as described above may be prepared using a gene recombination
technique well known to those skilled in the art. In addition to vectors used in the Examples below, in
construction of a plant expression vector, pBI vectors or pUC vectors are preferably used. The present
invention is not so limited.
[0065] A plant material for DNA introduction can be appropriately selected from leaves, stems, roots,
tubers, protoplasts, calluses, pollen, embryos, shoot primordium, according to the introduction method
or the like. A "plant cell" may be any plant cell. Examples of a "plant cell" include cells of tissues in
plant organs, such as leaves and roots; callus; and suspension culture cells. The plant cell may be in any
form of a culture cell, a culture tissue, a culture organ, or a plant. Preferably, the plant cell is a culture
cell, a culture tissue, or a culture organ. More preferably, the plant cell is a culture cell.
[0066] A plant culture cell, to which DNA is introduced, is generally a protoplast. DNA is introduced
to a plant culture cell by a physicochemical method, such as an electroporation method and a
polyethylene glycol method. A plant tissue, to which DNA is introduced, is a leaf, a stem, a root, a
tuber, a callus, pollen, an embryo, shoot primordium, preferably a leaf, a stem, and a callus. DNA is
introduced into a plant tissue by a physico chemical method, such as a biological method using a virus
or Agrobacterium, or a particle gun method. The method using Agrobacterium is disclosed, for
example, in Nagel et al. (Microbiol. Lett., 67, 325 (1990)). In this method, a plant expression vector is
first used to transform Agrobacterium (e.g., by electroporation), and then the transformed
Agrobacterium is introduced into a plant tissue by a well-known method, such as a leaf disc method.
These methods are well known in the art. A method suitable for a plant to be transformed can be
appropriately selected.
[0067] A cell, into which a plant expression vector has been introduced, is selected for drug resistance,
such as kanamycin resistance. The selected cell can be regenerated to a plant by a commonly used
method.
[0068] A plant cell, into which a polynucleotide of the present invention has been introduced, can be
regenerated to a plant by culturing the plant cell in redifferentiation medium, hormone-free MS
medium, or the like. A young rooted plant can be grown to a plant by transferring it to soil, followed by
cultivation. Redifferentiation methods vary depending on the type of a plant cell. Redifferentiation
methods for various plants are described: rice (Fujimura, 1995, Plant Tissue Culture Lett. 2, 74); maize
(Shillito, 1989, Bio/Technol. 7, 581; Gorden-Kamm, 1990, Plant Cell 2, 603); potato (Visser, 1989,
Theor. Appl. Genet. 78, 594); and tobacco (Nagata, 1971, Planta 99, 12).
[0069] Expression of an introduced gene of the present invention in a regenerated plant can be
confirmed by a method well known to those skilled in the art. This confirmation can be carried out
using, for example, Northern blotting. Specifically, total RNA is extracted from a plant leaf, is
subjected to electrophoresis on denaturing agarose, and is blotted to an appropriate membrane. This
blot is subjected to hybridization with a labeled RNA probe complementary to a portion of the
introduced gene, thereby detecting mRNA of a gene of the present invention.
[0070] Plants which can be transformed using a polynucleotide of the present invention include any
plant to which a gene can be introduced. As used herein, the term "plant" includes reference to whole
plants, plant organs (e.g., leaves, stems, roots, etc.), seeds, plant propagators (e.g., pollen), and plant
cells, and progeny of same. Plant cells as used herein include, without limitation, seeds, suspension
cultures, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes,
pollen, and microspores. The term "plant" includes monocotyledonous and dicotyledonous plants. Such
plants include any useful plants, particularly crop plants, vegetable plants, and flowering plants of
garden varieties. Preferable plants include, but are not limited to, rice, maize, sorghum, barley, wheat,
174/503
rye, Echinochloa crus-galli, foxtail millet, asparagus, potato, Japanese white radish, soybean, pea,
rapeseed, spinach, tomato, and petunia. The most preferable plant to which the present invention is
applied is rice, particularly Japonica rice.
[0071] Examples of types of plants that can be used in the manufacturing method of the present
invention include plants in the families of Solanaceae, Poaeae, Brassicaceae, Rosaceae, Leguminosae,
Curcurbitaceae, Lamiaceae, Liliaceae, Chenopodiaceae and Umbelliferae.
[0072] Examples of plants in the Solanaceae family include plants in the Nicotiana, Solanum, Datura,
Lycopersicon and Petunia genera. Specific examples include tobacco, eggplant, potato, tomato, chili
pepper, and petunia.
[0073] Examples of plants in the Poaeae family include plants in the Oryza, Hordenum, Secale,
Saccharum, Echinochloa and Zea genera. Specific examples include rice, barley, rye, Echinochloa
crus-galli, sorghum, and maize.
[0074] Examples of plants in the Brassicaceae family include plants in the Raphanus, Brassica,
Arabidopsis, Wasabia, and Capsella genera. Specific examples include Japanese white radish,
rapeseed, Arabidopsis thaliana, Japanese horseradish, and Capsella bursa-pastoris.
[0075] Examples of plants in the Rosaceae family include plants in the Orunus, Malus, Pynus, Fragaria,
and Rosa genera. Specific examples include plum, peach, apple, pear, Dutch strawberry, and rose.
[0076] Examples of plants in the Leguminosae family include plants in the Glycine, Vigna, Phaseolus,
Pisum, Vicia, Arachis, Trifolium, Alfalfa, and Medicago genera. Specific examples include soybean,
adzuki bean, kidney bean, pea, fava bean, peanut, clover, and bur clover.
[0077] Examples of plants in the Curcurbitaceae family include plants in the Luffa, Curcurbita, and
Cucumis genera. Specific examples include gourd, pumpkin, cucumber, and melon.
[0078] Examples of plants in the Lamiaceae family include plants in the Lavandula, Mentha, and
Perilla genera. Specific examples include lavender, peppermint, and beefsteak plant.
[0079] Examples of plants in the Liliaceae family include plants in the Allium, Lilium, and Tulipa
genera. Specific examples include onion, garlic, lily, and tulip.
[0080] Examples of plants in the Chenopodiaceae family include plants in the Spinacia genera. A
specific example is spinach.
[0081] Examples of plants in the Umbelliferae family include plants in the Angelica, Daucus,
Cryptotaenia, and Apitum genera. Specific examples include Japanese udo, carrot, honewort, and
celery.
[0082] The nomenclature used hereafter and the laboratory procedures described hereafter often
involve well known and commonly employed procedures in the art. Standard techniques are used for
recombinant methods, polynucleotide synthesis, and cell culture. The techniques and procedures are
generally performed according to conventional methods in the art and various general references (see,
generally, Sambrook et al. Molecular Cloning: A Laboratory Manual, 2nd ed. (1989) Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y., which is incorporated herein by reference).
[0083] Hereinafter, the present invention will be described by way of examples. The present invention
is not so limited. Materials, reagents, and the like used in the examples are available from commercial
sources, unless otherwise mentioned.
EXAMPLES
Example 1
[0084] Activation of Tos17 by Culture and Characterization of Resultant Mutants
[0085] Mature seeds of "Nipponbare", "Hitomebore", or the like (varieties of species Japonica) were
used as starting material to conduct callus initiation culture and cell suspension culture, as described in
Hirochika et al., 1996, Proc. Natl. Acad. Sci. USA, 93, 7783-7788) (supra). Culture conditions for
activating Tos17 used in gene disruption were determined in accordance with Otsuki's method (1990)
(Rice protoplast culture, Agriculture, Forestry and Fisheries Technical Information Society).
[0086] Briefly, mature seeds of rice were cultured in MS medium containing 2,4dichlorophenoxyacetic acid (2,4-D) (Otsuki (1990), supra) (25[deg.] C., 1 month) so as to induce
calluses. The resultant calluses were cultured in N6 liquid medium containing 2,4-D (Otsuki (1990),
supra) for 5 months, and were transferred to redifferentiation medium (Otsuki (1990), supra) to obtain
redifferentiated rice (first generation (R1) plant).
[0087] About 20 R1 seeds were recovered from each plant. The seeds were sterilized with 1.0%
sodium hypochlorite, followed by thoroughly washing. The seeds were immersed in water at 25[deg.]
C. for 24 hours. Thereafter, the seeds were plated on MS solid medium (described in Murashige and
Skoog, 1962, Physiol. Plant., 15, 473-497) containing 150 mM sodium chloride, which provided salt
175/503
stress conditions. Second generation (R2) plants were obtained and were subjected to morphological
analysis. The phenotype of each plant of the R2 group was carefully observed over 3 to 4 weeks after
germination. As a result, among the R2 group of the strain ND1004 (variety: Nipponbare), a mutant
was found, which had significant growth inhibition in its shoot and root (seedlings other than the leftmost one in FIG. 1A), and significant branching of its root (a seedling to the right of FIG. 1B) under
the salt stress conditions as compared to a wild type ND1004. On the other hand, the growth of the wild
type ND1004 was not significantly inhibited under the salt stress conditions (the left-most seedling in
FIG. 1A; and a seedling to the left of FIG. 1B).
[0088] Therefore, gene destruction due to transition of Tos17 was inferred to be responsible for such
expression of the phenotype under the salt stress conditions.
Example 2
[0089] Isolation of Flanking Sequence to Tos17
[0090] In order to find a gene which controls the phenotype observed in Example 1, a flanking
sequence to Tos17, which had been transferred into genomic DNA, was isolated.
[0091] DNA was prepared from the R2 rice (strain ND1004) obtained in Example 1 by a CTAB
method (Murray and Thompson, 1980, Nucleic Acids Res. 8, 4321-4325). A Tos17 target site sequence
was amplified by reverse PCR using total DNA as previously described (Hirochika et al., 1996, supra;
and Sugimoto et al., 1994, Plant J., 5, 863-871).
[0092] Briefly, about 0.5 [mu]g of total DNA from a mutant plant (strain ND1004-/-), in which Tos17
was inserted into a target site by transposition, was initially digested with XbaI. The digested DNA was
extracted with phenol/chloroform, followed by ethanol precipitation for purification. Thereafter, T4
DNA ligase was used to carry out ligation at 12[deg.] C. overnight with a total volume of 300 [mu]l.
Ligated DNA was purified, one third of which was used as a template for PCR. An amplification
reaction was carried out by PCR using the following primer: Tos17-3911F,
GAGAGCATCATCGGTTACATCTTCTC and Tos17-xbaI-R,
CATGAAATAGATCCATGTATATCT. A reverse PCR product was cloned in pCR2.1-TOPO vector
(Invitrogen), followed by sequencing using a sequencer (ABI, model 310). Based on the resultant
sequence, a primer OF, GCCATCACAAATCAGCAAGC, and a primer 3R,
ATGGATTGAAGGCCAAGCCAC, were designed. These primers were used to carry out reverse PCR
using total DNA of a normal plant (without tissue culture) so that the target site of Tos17 insertion was
amplified. The target site was sequenced as mentioned above.
Example 3
[0093] Structural Analysis of Causative Gene in Mutant
[0094] RNA was prepared from seedlings of wild type rice (Nipponbare) grown in soil for 11 days in
the manner below. Initially, ISOGEN solution was used to extract total RNA from the seedlings. The
total RNA was applied to an oligo(dt)cellulose column included in a mRNA purification kit
(Stratagene) to obtain poly(A) mRNA. cDNA was synthesized from the resultant poly(A) mRNA by a
commonly used method. A cDNA library was constructed in HybriZAP-2.1 vectors (Stratagene). The
cDNA library had an infection ability of 5*10>;5 ;plaques. In vivo cleavage of pBluescript plasmid
including cDNA inserted fragments was conducted using Escherichia coli strain XL1-Blue MRF2.
[0095] The cDNA library was subjected to screening in accordance with a method described in
Molecular Cloning, A Laboratory Manual (Sambrook et al., 1989), where the reverse PCR products of
the flanking sequence to Tos17, which were obtained in Example 2, were used as probes.
[0096] From the cDNA library, nine cDNA clones exhibiting a strong hybridization signal were
obtained.
[0097] The longest cDNA of the nine clones, having a size of about 1.2 kb, was sequenced using the
sequencer 3100 (Applied Biosystems (ABI)) in both directions, followed by homology analysis using
open reading frame (ORF) and BLAST (Altshul et al., 1997, Nucleic Acids Res., 25, 3389-3402) and
analysis using Mac Vector 6.0 program (Teijin System Technology).
[0098] According to the sequencing analysis, the longest cDNA clone was 1154 bp in length (SEQ ID
NO: 1). The mRNA analysis using the Mac Vector 6.0 package identified the longest open reading
frame of 729 bp encoding a protein consisting of 243 amino acids (SEQ ID NO: 2). The cDNA
sequence of 1154 bp indicated by SEQ ID NO: 1 is shown in FIG. 3. The open reading frame is located
at position 233-961 of the cDNA sequence. A putative amino acid sequence (SEQ ID NO: 2) of a
polypeptide encoded by the open reading frame is shown in FIG. 4.
Example 4
176/503
[0099] Search for Separate Mutant Strains
[0100] In Example 1, the mutant strain ND1004 was selected, which exhibited growth inhibition in its
shoot and root under the salt stress conditions. In Example 3, the candidate gene which controls the
phenotype was isolated. If the same phenotype is observed in other separate mutant strains having
Tos17 insertion mutation in the same gene, it is concluded that the gene isolated in Example 3 is a gene
controlling the phenotype. In order to confirm this, separate mutant strains were screened in the
following manner.
[0101] DNA was prepared from a redifferentiated rice group as in Example 2. The base sequence of
cDNA obtained in Example 3 was used to design the following four primers, and PCR was carried out
using the above-described DNA as a template: GTCTGGCCAGTCGTGCAATG;
CTGCTGGCAAGAGGGCTGAT; TGGGTTCTTGGTGGCCTCAT; and
GCCAAGCCACTGAAGCCATT). PCR screening for mutants was carried out in accordance with a
method described in Akio Miyao and Hirohiko Hirochika (2001), Ine-no-Tos17-niyoru-Idenshihakaiho
[Gene Destruction Method Using rice Tos17], Saibo-Kogaku-Bessatsu [Special Issue of Cellular
Engineering] "Shokubutsu-no-Genomu-saiensu-purotokoru [Protocol for Plant Genome Science",
Shujyunsha, 73-81. As a result, a mutant strain NC8328 (derived from the variety Nipponbare) was
obtained.
[0102] A Tos17 flanking sequence database (http://pc7080.abr.affrc.go.jp/-miyao/pub/Tos17/) was
searched using the cDNA sequence described in FIG. 3 as a query. As a result, another mutant strain
H0851 (derived from the variety Hitomebore) was identified.
[0103] When these strains were grown under the salt stress conditions as described in Example 1,
growth inhibition and morphological abnormality were observed in their shoots and roots (FIG. 2A
(NC8328; the left-most plant indicates a wild type, and the middle and right plants indicate mutant
types) and FIG. 2B (H0851; the left-most plant indicates a wild type, and four other seedlings were of a
mutant type)).
Example 5
[0104] Evaluation of Salt Stress Sensitivity
[0105] In this example, a relationship between the gene obtained in Examples 2 to 4 and salt stress
sensitivity was studied. The Nipponbare strain ND1004 was selected as a strain having this gene while
the strain ND1004-/- was used as a mutant in which the gene was destroyed.
[0106] Individuals having the normal gene and mutants having the destroyed gene were separated in
the R2 generation of the strain ND1004. The former was called strain ND1004+/+ while the latter was
called strain ND1004-/- in experiments below. Southern analysis was carried out to determine whether
the plant was a mutant. Specifically, DNA was extracted from the R2 generation strain ND1004 plant.
The DNA was cleaved with the restriction enzyme XbaI, followed by agarose electrophoresis. The
DNA was transcribed to a nylon membrane. Thereafter, hybridization was carried out using the gene
labeled with >;32;P as a probe so as to confirm the mutation of the gene. An individual exhibiting a
mutant type band pattern is called strain ND1004-/-. The above-described analysis was carried out
under conditions described in Molecular Cloning, A Laboratory Manual (Sambrook et al., 1989).
[0107] Seeds of the wild type ND1004 and the mutant type ND1004-/- (about 30 seeds for each plant)
were sterilized with 1.0% sodium hypochlorite, followed by thoroughly washing. The seeds were
immersed in water at 25[deg.] C. for 24 hours. Thereafter, the seeds were plated on MS solid medium
(described in Murashige and Skoog, supra) containing 0 mM and 150 mM sodium chloride. The seeds
were aseptically germinated and grown at 25[deg.] C. for 18 days in the light for 14 hours and in the
dark for 10 hours. The growth of these plants is shown in FIGS. 5A and B. FIG. 5A shows the shoots
and roots (left) and roots (right) of the wild type and the mutant type in media without sodium chloride
(in the left photograph, the left-most plant is of the wild type, and the others are of the mutant type; and
in the right photograph, the left plant is of the wild type and the right plant is of the mutant type). B
shows the shoots and roots of a wild type (left most) and mutant types (three other individuals) grown
in media containing sodium chloride. There was no significant difference observed in the morphology
of shoots and roots of the wild type strain ND1004 between the salt stress conditions and the non-salt
stress conditions, though the growth of the wild type strain ND1004 was slightly retarded (FIGS. 5A
and 5B). In the mutant type ND1004-/- under the salt stress conditions, significant growth inhibition
was observed in the shoot and the root, and morphological abnormality was observed in the root (FIG.
5B). Such growth inhibition and morphological abnormality were not observed under no-stress
conditions (FIG. 5A).
[0108] Further, when this mutant type was germinated and grown in soil without salt stress (in a
greenhouse for 3 months), it grew normally (FIG. 5C).
177/503
[0109] Therefore, sensitivity to salt stress was expressed by destruction of the gene. This indicates that
the gene determines the sensitivity to salt stress.
Example 6
[0110] Evaluation of Sensitivity to Osmotic Stress
[0111] In this example, the relationship between the gene obtained in Examples 2 to 4 and osmotic
stress sensitivity was studied. The Nipponbare strain ND1004 was selected as a strain having this gene
while the strain ND1004-/- was used as a mutant in which the gene was destroyed.
[0112] Seeds of the wild type ND1004 and the mutant type ND1004-/- (about 30 seeds for each plant)
were sterilized with 1.0% sodium hypochlorite, followed by thoroughly washing. The seeds were
immersed in water at 25[deg.] C. for 24 hours. Thereafter, the seeds were aseptically germinated and
grown in MS solid medium (described in Murashige and Skoog, supra) without mannitol for 11 days
under the same conditions as described in Example 5. An upper portion of the shoot and the root of a
seedling grown for 11 days were cut and removed (a cut portion is indicated by arrows in FIG. 6). The
remaining tissue section was transferred to MS solid medium containing 150 mM mannitol, and was
grown for further 7 days under the same conditions as above. Whereas roots were newly generated and
normally grown in the wild type, significant growth inhibition was observed in newly generated roots
of the mutant type (the right plant indicates the mutant type, and the remaining two plants indicate the
wild types).
[0113] Therefore, sensitivity to osmotic stress was also expressed by destruction of the gene. This
indicates that the gene determines the sensitivity to osmotic stress.
[0114] The above-described examples illustrate various aspects of the present invention, and how a
specific oligonucleotide of the present invention is produced and used. The present invention is not so
limited.
[0115] Industrial Applicability
[0116] A novel polynucleotide capable of controlling environmental stress tolerance, which is
applicable to breeding of plants, is provided. Further, a polynucleotide useful for manipulation of
sensitivity to environmental stress, selection of plants having different sensitivities, and enhancement
of tolerance to environmental stress, is provided.Data supplied from the esp@cenet database Worldwide
Claims:
Claims of US2004016027
1. A polynucleotide, encoding a plant gene capable of controlling salt stress tolerance, wherein the
polynucleotide includes a polynucleotide which has a nucleotide sequence encoding an amino acid
sequence from methionine at position 1 to asparagine at position 243 of SEQ ID NO: 2 in the sequence
listing, or which has a nucleotide sequence encoding the amino acid sequence having one or several
amino acid deletions, substitutions and/or additions and is capable of controlling salt stress tolerance.
2. A polynucleotide according to claim 1, wherein the plant gene is further capable of controlling
osmotic stress tolerance.
3. A polynucleotide according to claim 1, wherein the polynucleotide is derived from rice.
4. A polynucleotide, encoding a plant gene capable of controlling salt stress tolerance, wherein the
polynucleotide includes a polynucleotide having a nucleotide sequence from A at position 233 to C at
position 961 in SEQ ID NO: 1 in the sequence listing, or a nucleotide sequence hybridizable to the
nucleotide sequence under stringent conditions.
5. A polynucleotide according to claim 4, wherein the plant gene is further capable of controlling
osmotic stress tolerance.
6. A polynucleotide according to claim 4, wherein the polynucleotide is derived from rice.Data
supplied from the esp@cenet database - Worldwide
178/503
32. US2004219675
- 11/4/2004
NUCLEIC ACID MOLECULES FROM RICE ENCODING PROTEINS FOR
ABIOTIC STRESS TOLERANCE, ENHANCED YEILD, DISEASE RESISTANCE
AND ALTERED NUTRITIONAL QUALITY AND USES THEREOF
URL EPO =
http://v3.espacenet.com/textdoc?F=3&CY=ep&LG=en&IDX=US2004219675
Inventor(s):
SAINZ MANUEL B (US); SALMERON JOHN (US); WEISLO LAURA (US)
IP Class 4 Digits: C07K; C12N; A01H; C07H; A61K
IP Class:C12N15/63; C07K14/00; C12N15/82; A01H5/00; C12N15/29; C12N5/14; C12N5/10;
C12N15/87; C12N5/04; C12N15/09; C07H21/04; C07K1/00; C12N15/00; A61K39/395
E Class: C07K14/415; C12N15/82C8; C12N15/82C8B6; C12N15/82C4B; C12N15/82C8B
Application Number:
US20040491733 (20040405)
Priority Number: WO2002US38359 (20021127); US20010334501P (20011130); US20040491733
(20040405)
Family: US2004219675
Abstract:
Abstract of US2004219675
The present invention encompasses nucleic acid molecules isolated from Oryza sativa that encode
proteins for conferring abiotic stress tolerance, enhanced yield, disease resistance, or altered nutritional
composition in plants. The invention further relates to expression of these molecules in microorganisms
and transgenic plants for altering these characteristics of the organism.Description:
Description of US2004219675
[0001] This application claims the benefit of U.S. Provisional Application No. 60/334,501 filed Nov.
30, 2001, which is incorporated by reference herein in its entirety.
FIELD OF THE INVENTION
[0002] The present invention pertains to nucleic acid molecules isolated from Oryza sativa
comprising nucleotide sequences that encode proteins for abiotic stress tolerance, enhanced yield,
disease resistance or altered nutritional quality. The invention particularly relates to methods of using
nucleic acid molecules and/or proteins from Rice in transgenic plants to conferthe above-identified
agronomic traits.
BACKGROUND OF THE INVENTION
[0003] Improvement of the agronomic characteristics of crop plants has been ongoing since the
beginning of agriculture. Most of the land suitable for crop production is currently being used. As
human populations continue to increase, improved crop varieties will be required to adequately provide
our food and feed (Trewavas (2001) Plant Physiol. 125: 174-179). To avoid catastrophic famines and
malnutrition, future crop cultivars will need to have improved yields with equivalent farm inputs.
These cultivars will need to more effectively withstand adverse conditions such as drought, soil salinity
or disease, which will be especially important as marginal lands are brought into cultivation. Finally,
we will need cultivars with altered nutrient composition to enhance human and animal nutrition, and to
enable more efficient food and feed processing, by designing cultivars for specific end-uses.
[0004] Recent scientific advances have together identified many candidate genes associated with
traits of agronomic interest. Scientific approaches used to identify genes involved in a pathway or
179/503
response of interest associated with an agronomic trait include genetics, genomics, bioinformatics, and
functional genomics. Genetics is the scientific study of the mechanisms of inheritance. By identifying
mutations which alter the pathway or response of interest, classical (or forward) genetics can help to
identify the genes involved in these pathways or responses. For example, a mutant with enhanced
susceptibility to disease may identify an important component of the plant signal transduction pathway
leading from pathogen recognition to disease resistance. Genomics is the system-level study of an
organism's genome, including genes and corresponding gene products-RNA and proteins. Genomic
approaches have provided sequence information from diverse plant species, including full-length and
partial cDNA sequences; more recently the complete genomic sequence of Arabidopsis thaliana
became available. A unique proprietary resource used for purposes of this invention is the Syngenta
draft genomic sequence of rice (Oryza sativa). As part of genomics, bioinformatics approaches process
raw sequence information and can be used, for example, to help identify genes in a genomic sequence.
[0005] Functional genomics is the assignment of function to genes and their products. Functional
genomics makes use of a variety of approaches to identify genes in a particular pathway or response of
interest. The use of genetics to help assign function is described in the paragraph above. Using, for
example, similarity searches, alignments and phylogenetic analyses, bioinformatics can often identify
homologs of a gene product of interest. Very similar homologs (eg. ;90% amino acid identity over the
entire length of the protein) are very likely orthologs, i.e. share the same function in different
organisms. Thus bioinformatics is another approach to assigning function to genes identified through
genomics.
[0006] Functional genomics can make use of additional approaches. Expression analysis uses high
density DNA microarrays to monitor the mRNA expression of thousands of genes in a single
experiment. Experimental treatments can include those eliciting a response of interest, such as the
disease resistance response in plants infected with a pathogen. To give additional examples of the use
of microarrays, mRNA expression levels can be monitored in distinct tissues over a developmental
time course, or in mutants affected in a response of interest. Proteomics can also help to assign
function, by assaying the expression and post-translational modifications of hundreds of proteins in a
single experiment. Proteomics approaches are in many cases analogous to the approaches taken for
monitoring mRNA expression in microarray experiments. Protein-protein interactions can also help to
assign proteins to a given pathway or response, by identifying proteins which interact with known
components of the pathway or response. For functional genomics, protein-protein interactions are often
studied using large-scale yeast two-hybrid assays. Another approach to assigning gene function is to
express the corresponding protein in a heterologous host, for example the bacterium Escherichia coli,
followed by purification and enzymatic assays.
[0007] The generation and analysis of plants transgenic for a gene of interest can be used for plant
functional genomics, with several advantages. The gene can often be both overexpressed and
underexpressed ("knocked out"), thereby increasing the chances of observing a phenotype linking the
gene to a pathway or response of interest. Two aspects of transgenic functional genomics help lend a
high level of confidence to functional assignment by this approach. First, phenotypic observations are
carried out in the context of the living plant. Second, the range of phenotypes observed often correlates
well with observed expression levels.
[0008] Transgenic functional genomics is especially valuable in improved cultivar development.
Only genes that function in a pathway or response of interest, and that in addition are able to confer a
desired trait-based phenotype, are promoted to candidate genes for crop improvement efforts. Such
efforts can take various forms, for example the generation of transgenic crops or marker-assisted
breeding using desirable alleles of the gene.
SUMMARY OF THE INVENTION
[0009] This Summary of Invention lists several embodiments of the invention, and in many cases
lists variations and permutations of these embodiments. This Summary is merely exemplary of the
numerous and varied embodiments. Mention of one or more preferred features of a given embodiment
is likewise exemplary. Such embodiment can typically exist with or without the feature(s) mentioned;
likewise, those features can be applied to other embodiments of the invention, whether listed in this
Summary or not. To avoid excessive repetition, this Summary does not list or suggest all possible
combinations of such features.
[0010] Embodiments of the present invention provide nucleotide and amino acid sequences known
as cDNAs from rice.
[0011] Embodiments of the present invention relate to an isolated nucleic acid comprising or
consisting of a nucleotide sequence including:
180/503
(a) a nucleotide sequence listed in odd numbered sequences of SEQ ID NO:1-63, fragment, domain, or
feature thereof;
(b) a nucleotide sequence having substantial similarity to (a);
(c) a nucleotide sequence capable of hybridizing to (a);
(d) a nucleotide sequence complementary to (a), (b) or (c); and
(e) a nucleotide sequence which is the reverse complement of (a), (b) or (c).
[0017] In a preferred embodiment, the substantial similarity is at least about 65% identity, preferably
about 80% identity, preferably 90%, and more preferably at least about 95% identity to the nucleotide
sequence listed in odd numbered sequences of SEQ ID Nos:1-63, fragment, domain, or feature thereof.
[0018] In a preferred embodiment, the sequence having substantial similarity to the nucleotide
sequence listed in odd numbered sequences of SEQ ID Nos:1-63, fragment, domain, or feature thereof,
is from a plant. In a preferred embodiment, the plant is a dicot. In another preferred embodiment, the
plant is a gymnosperm. In a more preferred embodiment, the plant is a monocot. In another preferred
embodiment, the plant is rice, wheat, barley, rye, corn, potato, canola, soybean, sunflower, carrot,
sweet potato, sugarbeet, bean, pea, chicory, lettuce, cabbage, cauliflower, broccoli, turnip, radish,
spinach, asparagus, onion, garlic, eggplant, pepper, celery, squash, pumpkin, cucumber, apple, pear,
quince, melon, plum, cherry, peach, nectarine, apricot, strawberry, grape, raspberry, blackberry,
pineapple, avocado, papaya, mango, banana, soybean, tobacco, tomato, sorghum or sugarcane. In a
more preferred embodiment, the monocot is a cereal. In a more preferred embodiment, the cereal may
be, for example, maize, wheat, barley, oats, rye, millet, sorghum, triticale, secale, einkorn, spelt,
emmer, teff, milo, flax, gramma grass, Tripsacum sp., or teosinte. In a most preferred embodiment, the
cereal is rice.
[0019] In a preferred embodiment, the nucleic acid is expressed in a specific location or tissue of a
plant. In a more preferred embodiment, the location or tissue is for example, but not limited to,
epidermis, vascular tissue, meristem, cambium, cortex, pith, leaf, and flower. In a most preferred
embodiment, the location or tissue is a leaf, sheath, flower, root or seed. In another preferred
embodiment, the nucleic acid encodes a polypeptide involved in a function such as, for example, but
not limited to, carbon metabolism, photosynthesis, signal transduction, cell growth, reproduction,
disease processes, gene regulation, and differentiation. In a more preferred embodiment, the nucleic
acid encodes a polypeptide involved in abiotic stress tolerance, enhanced yield, disease resistance, or
nutritional content.
[0020] In a preferred embodiment, the isolated nucleic acid comprising or consisting of a nucleotide
sequence capable of hybridizing to a nucleotide sequence listed in odd numbered sequences of SEQ ID
Nos:1-63, or fragment, domain, or feature thereof. In a preferred embodiment, hybridization allows the
sequence to form a duplex atmedium or high stringency. Embodiments of the present invention also
encompass a nucleotide sequence complementary to a nucleotide sequence listed in odd numbered
sequences of SEQ ID Nos:1-63, or fragment, domain, or feature thereof. Embodiments of the present
invention further encompass a nucleotide sequence complementary to a nucleotide sequence that has
substantial similarity or is capable of hybridizing to a nucleotide sequence listed in odd numbered
sequences of SEQ ID Nos:1-63, or fragment, domain, or feature thereof.
[0021] In a preferred embodiment, the nucleotide sequence having substantial similarity is an allelic
variant of the nucleotide sequence listed in odd numbered sequences of SEQ ID Nos:1-63, or fragment,
domain, or feature thereof. In an alternate embodiment, the sequence having substantial similarity is a
naturally occurring variant. In another alternate embodiment, the sequence having substantial similarity
is a polymorphic variant of the nucleotide sequence listed in odd numbered sequences of SEQ ID
Nos:1-63, or fragment, domain, or feature thereof.
[0022] In a preferred embodiment, the isolated nucleic acid contains a plurality of regions having the
nucleotide sequence listed in odd numbered sequences of SEQ ID Nos:1-63, or exon, domain, or
feature thereof.
[0023] In a preferred embodiment, the isolated nucleic acid contains a polypeptide-encoding
sequence. In a more preferred embodiment, the polypeptide-encoding sequence contains a 20 base pair
nucleotide portion identical in sequence to a consecutive 20 base pair nucleotide portion of a nucleic
acid sequence listed in odd numbered sequences of SEQ ID Nos:1-63. In a more preferred
embodiment, the polypeptide contains a polypeptide sequence listed in even numbered sequences of
SEQ ID Nos:2-64, or a fragment thereof. In a more preferred embodiment, a polypeptide described in
Tables 1-4. In a more preferred embodiment, the polypeptide is a plant polypeptide. In a more preferred
embodiment, the plant is a dicot. In a more preferred embodiment, the plant is a gymnosperm. In a
more preferred embodiment, the plant is a monocot. In a more preferred embodiment, the monocot is a
181/503
cereal. In a more preferred embodiment, the cereal may be, for example, maize, wheat, barley, oats,
rye, millet, sorghum, triticale, secale, einkorn, spelt, emmer, teff, miloflax, gramma grass, Tripsacum,
and teosinte. In a most preferred embodiment, the cereal is rice.
[0024] In one embodiment, the polypeptide is expressed throughout the plant. In a more preferred
embodiment, the polypeptide is expressed in a specific location or tissue of a plant. In a more preferred
embodiment, the location or tissue may be, for example, epidermis, root, vascular tissue, meristem,
cambium, cortex, pith, leaf, and flower. In a most preferred embodiment, the location or tissue is a
seed.
[0025] In a preferred embodiment, the polypeptide is involved in a function such as abiotic stress
tolerance, enhanced yield, disease resistance or nutritional content.
[0026] In a preferred embodiment, the sequence of the isolated nucleic acid encodes a polypeptide
useful for generating an antibody having immunoreactivity against a polypeptide encoded by a
nucleotide sequence listed in even numbered sequences of SEQ ID Nos:2-64, or fragment, domain, or
feature thereof.
[0027] In a preferred embodiment, the sequence having substantial similarity contains a deletion or
insertion of at least one nucleotide. In a more preferred embodiment, the deletion or insertion is of less
than about thirty nucleotides. In a most preferred embodiment, the deletion or insertion is of less than
about five nucleotides.
[0028] In a preferred embodiment, the sequence of the isolated nucleic acid having substantial
similarity comprises or consists of a substitution in at least one codon. In a preferred embodiment, the
substitution is conservative.
[0029] Embodiments of the present invention also relate to the an isolated nucleic acid molecule
comprising or consisting of a nucleotide sequence, its complement, or its reverse complement,
encoding a polypeptide including:
(a) a polypeptide sequence listed in even numbered sequences of SEQ ID Nos:2-64, or a fragment,
domain, repeat, feature, or chimera thereof;
(b) a polypeptide sequence having substantial similarity to (a);
(c) a polypeptide sequence encoded by a nucleotide sequence identical to or having substantial
similarity to a nucleotide sequence listed in odd numbered sequences of SEQ ID Nos:1-63, or a
fragment, domain, or feature thereof, or a sequence complementary thereto;
(d) a polypeptide sequence encoded by a nucleotide sequence capable of hybridizing under medium
stringency conditions to a nucleotide sequence listed in odd numbered sequences of SEQ ID Nos:1-63,
or to a sequence complementary thereto; and
(e) a functional fragment of (a), (b), (c) or (d).
[0035] In another preferred embodiment, the polypeptide having substantial similarity is an allelic
variant of a polypeptide sequence listed in even numbered sequences of SEQ ID NOS:2-64, or a
fragment, domain, repeat, feature, or chimeras thereof. In another preferred embodiment, the isolated
nucleic acid includes a plurality of regions from the polypeptide sequence encoded by a nucleotide
sequence identical to or having substantial similarity to a nucleotide sequence listed in odd numbered
sequences of SEQ ID NOS:1-63, or fragment, domain, or feature thereof, or a sequence complementary
thereto.
[0036] In another preferred embodiment, the polypeptide is a polypeptide sequence listed in even
numbered sequences of SEQ ID NOS:2-64. In another preferred embodiment, the polypeptide is a
functional fragment or domain. In yet another preferred embodiment, the polypeptide is a chimera,
where the chimera may include functional protein domains, including domains, repeats, posttranslational modification sites, or other features. In a more preferred embodiment, the polypeptide is a
plant polypeptide. In a more preferred embodiment, the plant is a dicot. In a more preferred
embodiment, the plant is a gymnosperm. In a more preferred embodiment, the plant is a monocot. In a
more preferred embodiment, the monocot is a cereal. In a more preferred embodiment, the cereal may
be, for example, maize, wheat, barley, oats, rye, millet, sorghum, triticale, secale, einkorn, spelt,
emmer, teff, milo, flax, gramma grass, Tripsacum, and teosinte. In a most preferred embodiment, the
cereal is rice.
[0037] In a preferred embodiment, the polypeptide is expressed in a specific location or tissue of a
plant. In a more preferred embodiment, the location or tissue may be, for example, epidermis, root,
vascular tissue, meristem, cambium, cortex, pith, leaf, and flower. In a more preferred embodiment, the
location or tissue is a seed.
[0038] In a preferred embodiment, the polypeptide is involved in a function such as abiotic stress
tolerance, disease resistance, enhanced yield or nutritional quality or composition.
182/503
[0039] In a preferred embodiment, the polypeptide sequence encoded by a nucleotide sequence
having substantial similarity to a nucleotide sequence listed in odd numbered sequences of SEQ ID
Nos:1-63 or a fragment, domain, or feature thereof or a sequence complementary thereto, includes a
deletion or insertion of at least one nucleotide. In a more preferred embodiment, the deletion or
insertion is of less than about thirty nucleotides. In a most preferred embodiment, the deletion or
insertion is of less than about five nucleotides.
[0040] In a preferred embodiment, the polypeptide sequence encoded by a nucleotide sequence
having substantial similarity to a nucleotide sequence listed in odd numbered sequences of SEQ ID
Nos:1-63, or fragment, domain, or feature thereof or a sequence complementary-thereto, includes a
substitution of at least one codon. In a more preferred embodiment, the substitution is conservative.
[0041] In a preferred embodiment, the polypeptide sequences having substantial similarity to the
polypeptide sequence listed in even numbered sequences of SEQ ID Nos:2-64, or a fragment, domain,
repeat, feature, or chimeras thereof includes a deletion or insertion of at least one amino acid.
[0042] In a preferred embodiment, the polypeptide sequences having substantial similarity to the
polypeptide sequence listed in even numbered sequences of SEQ ID Nos:2-64, or a fragment, domain,
repeat, feature, or chimeras thereof includes a substitution of at least one amino acid.
[0043] Embodiments of the present invention also relate to a shuffled nucleic acid containing a
plurality of nucleotide sequence fragments, wherein at least one of the fragments corresponds to a
region of a nucleotide sequence listed in odd numbered sequences of SEQ ID NOS:1-63, and wherein
at least two of the plurality of sequence fragments are in an order, from 5' to 3' which is not an order in
which the plurality of fragments naturally occur in a nucleic acid. In a more preferred embodiment, all
of the fragments in a shuffled nucleic acid containing a plurality of nucleotide sequence fragments are
from a single gene. In a more preferred embodiment, the plurality of fragments originates from at least
two different genes. In a more preferred embodiment, the shuffled nucleic acid is operably linked to a
promoter sequence. Another more preferred embodiment is a chimeric polynucleotide including a
promoter sequence operably linked to the shuffled nucleic acid. In a more preferred embodiment, the
shuffled nucleic acid is contained within a host cell.
[0044] Embodiments of the present invention also contemplate an expression cassette including a
promoter sequence optably linked to an isolated nucleic acid containing a nucleotide sequence
including:
(a) a nucleotide sequence listed in odd numbered sequences of SEQ ID NOS:1-63, or fragment,
domain, or feature thereof;
(b) a nucleotide sequence having substantial similarity to (a);
(c) a nucleotide sequence capable of hybridizing to (a);
(d) a nucleotide sequence complementary to (a), (b) or (c); and
(e) a nucleotide sequence which is the reverse complement of (a), (b) or (c).
[0050] Further encompassed within the invention is a recombinant vector comprising an expression
cassette according to embodiments of the present invention. Also encompassed are plant cells, which
contain expression cassettes, according to the present disclosure, and plants, containing these plant
cells. In a preferred embodiment, the plant is a dicot. In another preferred embodiment, the plant is a
gymnosperm. In another preferred embodiment, the plant is a monocot. In a more preferred
embodiment, the monocot is a cereal. In a more preferred embodiment, the cereal may be, for example,
maize, wheat, barley, oats, rye, millet, sorghum, triticale, secale, einkorn, spelt, emmer, teff, milo, flax,
gramma grass, Tripsacum and teosinte. In a most preferred embodiment, the cereal is rice.
[0051] In one embodiment, the expression cassette is expressed throughout the plant. In another
embodiment, the expression cassette is expressed in a specific location or tissue of a plant. In a
preferred embodiment, the location or tissue may be, for example, epidermis, root, vascular tissue,
meristem, cambium, cortex, pith, leaf, and flower. In a more preferred embodiment, the location or
tissue is a seed.
[0052] In one embodiment, the expression cassette is involved in a function such as, for example, but
not limited to, disease resistance, yield, abiotic stress resistance, nutritional quality, carbon metabolism,
photosynthesis, signal transduction, cell growth, reproduction, disease processes, gene regulation, and
differentiation. In a more preferred embodiment, the chimeric polypeptide is involved in a function
such as, abiotic stress tolerance, enhanced yield, disease resistance or nutritional composition.
[0053] In one embodiment, the plant contains a modification to a phenotype or measurable
characteristic of the plant, the modification being attributable to theexpression cassette. In a preferred
embodiment, the modification may be, for example, nutritional enhancement, increased nutrient uptake
efficiency, enhanced production of endogenous compounds, and production of heterologous
183/503
compounds. In another preferred embodiment, the modification includes having increased or decreased
resistance to an herbicide, a stress, or a pathogen. In another preferred embodiment, the modification
includes having enhanced or diminished requirement for light, water, nitrogen, or trace elements. In
another preferred embodiment, the modification includes being enriched for an essential amino acid as
a proportion of a protein fraction of the plant. In a more preferred embodiment, the protein fraction
may be, for example, total seed protein, soluble protein, insoluble protein, water-extractable protein,
and lipid-associated protein. In another preferred embodiment, the modification includes
overexpression, underexpression, antisense modulation, sense suppression, inducible expression,
inducible repression, or inducible modulation of a gene.
[0054] Embodiments of the present invention also provide seed and isolated product from plants
which contain an expression cassette including a promoter sequence operably linked to an isolated
nucleic acid containing a nucleotide sequence including:
(a) a nucleotide sequence listed in odd numbered sequences of SEQ ID NOS:1-63, or fragment,
domain, or feature thereof;
(b) a nucleotide sequence encoding a polypeptide of even numbered sequences of SEQ ID NOS:2-64,
fragment, domain or feature thereof;
(c) a nucleotide sequence having substantial similarity to (a) or (b);
(d) a nucleotide sequence capable of hybridizing to (a), (b) or (c);
(e) a nucleotide sequence complementary to (a), (b), (c) or (d); and
(f) a nucleotide sequence that is the reverse complement of (a), (b), (c) or (d) according to the present
disclosure.
[0061] In a preferred embodiment the isolated product includes an enzyme, a nutritional protein, a
structural protein, an amino acid, a lipid, a fatty acid, a polysaccharide, a sugar, an alcohol, an alkaloid,
a carotenoid, a propanoid, a steroid, a pigment, a vitamin and a plant hormone.
[0062] Embodiments of the present invention also relate to isolated products produced by expression
of an isolated nucleic acid containing a nucleotide sequence including:
(a) a nucleotide sequence listed in odd numbered sequences of SEQ ID NOS:1-63, or fragment,
domain, or feature thereof;
(b) a nucleotide sequence encoding a polypeptide listed in even numbered sequences of SEQ ID NOS:
2-64, or fragment, domain or feature thereof;
(c) a nucleotide sequence having substantial similarity to (a) or (b);
(d) a nucleotide sequence capable of hybridizing to (a) or (b);
(e) a nucleotide sequence complementary to (a), (b), (c) or (d); and
(f) a nucleotide sequence that is the reverse complement of (a), (b) (c) or (d) according to the present
disclosure.
[0069] In a preferred embodiment, the product is produced in a plant. In another preferred
embodiment, the product is produced in cell culture. In another preferred embodiment, the product is
produced in a cell-free system. In another preferred embodiment, the product includes an enzyme, a
nutritional protein, a structural protein, an amino acid, a lipid, a fatty acid, a polysaccharide, a sugar, an
alcohol, an alkaloid, a carotenoid, a propanoid, a steroid, a pigment, a vitamin and a plant hormone.
[0070] In a preferred embodiment, the product is a polypeptide containing an amino acid sequence
listed in even numbered sequences of SEQ ID NOS:2-64. In a more preferred embodiment, the protein
is an enzyme.
[0071] Embodiments of the present invention further relate to an isolated polynucleotide including a
nucleotide sequence of at least 10 bases, which sequence is identical, complementary, or substantially
similar to a region of any sequence of odd numbered sequences of SEQ ID NOS:1-63, and wherein the
polynucleotide is adapted for any of numerous uses.
[0072] In a preferred embodiment, the polynucleotide is used as a chromosomal marker. In another
preferred embodiment, the polynucleotide is used as a marker for RFLP analysis. In another preferred
embodiment, the polynucleotide is used as a marker for quantitative trait linked breeding. In another
preferred embodiment, the polynucleotide is used as a marker for marker-assisted breeding. In another
preferred embodiment, the polynucleotide is used as a bait sequence in a two-hybrid system to identify
sequence-encoding polypeptides interacting with the polypeptide encoded by the bait sequence. In
another preferred embodiment, the polynucleotide is used as a diagnostic indicator for genotyping or
identifying an individual or population of individuals. In another preferred embodiment, the
polynucleotide is used for genetic analysis to identify boundaries of genes or exons.
184/503
[0073] Embodiments of the present invention also relate to an expression vector comprising or
consisting of a nucleic acid molecule including:
(a) a nucleic acid encoding a polypeptide as listed in even numbered sequences of SEQ ID NOS:2-64;
(b) a fragment, one or more domains, or featured regions listed in odd numbered sequences of SEQ ID
NOS:1-63; and
(c) a complete nucleic acid sequence listed in odd numbered sequences of SEQ ID NOS:1-63, or a
fragment thereof, in combination with a heterologous sequence.
[0077] In a preferred embodiment, the expression vector includes one or more elements such as, for
example, but not limited to, a promoter-enhancer sequence, a selection marker sequence, an origin of
replication, an epitope-tag encoding sequence, or an affinity purification-tag encoding sequence. In a
more preferred embodiment, the promoter-enhancer sequence may be, for example, the CaMV 35S
promoter, the CaMV 19S promoter, the tobacco PR-1a promoter, ubiquitin and the phaseolin promoter.
In another embodiment, the promoter is operable in plants, and more preferably, a constitutive or
inducible promoter. In another preferred embodiment, the selection marker sequence encodes an
antibiotic resistance gene. In another preferred embodiment, the epitope-tag sequence encodes V5, the
peptide Phe-His-His-Thr-Thr, hemagglutinin, or glutathione-S-transferase. In another preferred
embodiment the affinity purification-tag sequence encodes a polyamino acid sequence or a
polypeptide. In a more preferred embodiment, the polyamino acid sequence is polyhistidine. In a more
preferred embodiment, the polypeptide is chitin binding domain or glutathione-S-transferase. In a more
preferred embodiment, the affinity purification-tag sequence comprises an intein encoding sequence.
[0078] In a preferred embodiment, the expression vector is a eukaryotic expression vector or a
prokaryotic expression vector. In a more preferred embodiment, the eukaryotic expression vector
includes a tissue-specific promoter. More preferably, the expression vector is operable in plants.
[0079] Embodiments of the present invention also relate to a cell comprising or consisting of a
nucleic acid construct comprising an expression vector and a nucleic acid including a nucleic acid
encoding a polypeptide as listed in even numbered sequences of SEQ ID NOS:2-64, or a nucleic acid
sequence listed in odd numbered sequences of SEQ ID NOS:1-63, or a segment thereof, in combination
with a heterologous sequence.
[0080] In a preferred embodiment, the cell is a bacterial cell, a fungal cell, a plant cell, or an animal
cell. In a more preferred embodiment, the polypeptide is expressed in a specific location or tissue of a
plant. In a most preferred embodiment, the location or tissue may be, for example, epidermis, root,
vascular tissue, meristem, cambium, cortex, pith, leaf, and flower. In an alternate most preferred
embodiment, the location or tissue is a seed. In a preferred embodiment, the polypeptide is involved in
a function such as, for example, carbon metabolism, photosynthesis, signal transduction, cell growth,
reproduction, disease processes, gene regulation, and differentiation. More preferably, the polypeptide
is involved in a function such as, abiotic stress tolerance, enhanced yield, disease resistance or
nutritional composition.
[0081] Embodiments of the present invention also relate to polypeptides encoded by the isolated
nucleic acid molecules of the present disclosure including a polypeptide containing a polypeptide
sequence encoded by an isolated nucleic acid containing a nucleotide sequence including:
(a) a nucleotide sequence listed in odd numbered sequences of SEQ ID NOS:1-63, or exon, domain, or
feature thereof;
(b) a nucleotide sequence having substantial similarity to (a);
(c) a nucleotide sequence capable of hybridizing to (a);
(d) a nucleotide sequence complementary to (a), (b) or (c); and
(e) a nucleotide sequence which is the reverse complement of (a), (b) or (c);
(f) or a functional fragment thereof.
[0088] A polypeptide containing a polypeptide sequence encoded by an isolated nucleic acid
containing a nucleotide sequence, its complement, or its reverse complement, encoding a polypeptide
including a polypeptide sequence including:
(a) a polypeptide sequence listed in even numbered sequences of SEQ ID NOS:2-64, or a domain,
repeat, feature, or chimeras thereof;
(b) a polypeptide sequence having substantial similarity to (a);
(c) a polypeptide sequence encoded by a nucleotide sequence identical to or having substantial
similarity to a nucleotide sequence listed in odd numbered sequences of SEQ ID NOS:1-63, or an exon,
domain, or feature thereof, or a sequence complementary thereto;
185/503
(d) a polypeptide sequence encoded by a nucleotide sequence capable of hybridizing under medium
stringency conditions to a nucleotide sequence listed in odd numbered sequences of SEQ ID NOS:1-63,
or to a sequence complementary thereto; and
(e) a functional fragment of (a), (b), (c) or (d);
(f) or a functional fragment thereof.
[0095] Embodiments of the present invention contemplate a polypeptide containing a polypeptide
sequence encoded by an isolated nucleic acid which includes a shuffled nucleic acid containing a
plurality of nucleotide sequence fragments, wherein at least one of the fragments corresponds to a
region of a nucleotide sequence listed in odd numbered sequences of SEQ ID NOS:1-63, and wherein
at least two of the plurality of sequence fragments are in an order, from 5' to 3' which is not an order in
which the plurality of fragments naturally occur in a nucleic acid, or functional fragment thereof.
[0096] Embodiments of the present invention contemplate a polypeptide containing a polypeptide
sequence encoded by an isolated polynucleotide containing a nucleotide sequence of at least 10 bases,
which sequence is identical, complementary, or substantially similar to a region of any of sequences of
odd numbered sequences of SEQ ID NOS:1-63, and wherein the polynucleotide is adapted for a use
including:
(a) use as a chromosomal marker to identify the location of the corresponding or complementary
polynucleotide on a native or artificial chromosome;
(b) use as a marker for RFLP analysis;
(c) use as a marker for quantitative trait linked breeding;
(d) use as a marker for marker-assisted breeding;
(e) use as a bait sequence in a two-hybrid system to identify sequence encoding polypeptides
interacting with the polypeptide encoded by the bait sequence;
(f) use as a diagnostic indicator for genotyping or identifying an individual or population of
individuals; and
(g) use for genetic analysis to identify boundaries of genes or exons;
(h) or functional fragment thereof.
[0105] Embodiments of the present invention also contemplate an isolated polypeptide containing a
polypeptide sequence including:
(a) a polypeptide sequence listed in even numbered sequences of SEQ ID NOS:2-64, or exon, domain,
or feature thereof;
(b) a polypeptide sequence having substantial similarity to (a);
(c) a polypeptide sequence encoded by a nucleotide sequence identical to or having substantial
similarity to a nucleotide sequence listed in odd numbered sequences of SEQ ID NOS:1-63, or an exon,
domain, or feature thereof, or a sequence complementary thereto;
(d) a polypeptide sequence encoded by a nucleotide sequence capable of hybridizing under medium
stringency conditions to a nucleotide sequence listed in odd numbered sequences of SEQ ID NOS:1-63,
or to a sequence complementary thereto; and
(e) a functional fragment of (a), (b), (c) or (d).
[0111] In a preferred embodiment, the substantial similarity is at least about 65% identity. In a more
preferred embodiment, the substantial similarity is at least about 80% identity. In a most preferred
embodiment, the substantial similarity is at least about 95% identity. In a preferred embodiment, the
substantial similarity is at least three percent greater than the percent identity to the closest homologous
sequence listed in any of the Tables.
[0112] In a preferred embodiment, the sequence having substantial similarity is from a plant. In a
more preferred embodiment, the plant is a dicot. In a more preferred embodiment, the plant is a
gymnosperm. In a more preferred embodiment, the plant is a monocot. In a more preferred
embodiment, the monocot is a cereal. In a more preferred embodiment, the cereal may be, for example,
maize, wheat, barley, oats, rye, millet, sorghum, triticale, secale, einkorn, spelt, emmer, teff, milo, flax,
gramma grass, Tripsacum and teosinte. In a most preferred embodiment, the cereal is rice.
[0113] In a preferred embodiment, the polypeptide is expressed in a specific location or tissue of a
plant. In a more preferred embodiment, the location or tissue may be, for example, epidermis, root,
vascular tissue, meristem, cambium, cortex, pith, leaf, and flower. In a more preferred embodiment, the
location or tissue is a seed. In a preferred embodiment, the polypeptide is involved in a function such
as, for example, carbon metabolism, photosynthesis, signal transduction, cell growth, reproduction,
disease processes, gene regulation, and differentiation.
186/503
[0114] In a preferred embodiment, hybridization of a polypeptide sequence encoded by a nucleotide
sequence identical to or having substantial similarity to a nucleotide sequence listed in odd numbered
sequences of SEQ ID NOS:1-63, or an exon, domain, or feature thereof, or a sequence complementary
thereto, or a polypeptide sequence encoded by a nucleotide sequence capable of hybridizing under
medium stringency conditions to a nucleotide sequence listed in odd numbered sequences of SEQ ID
NOS:1-63, or to a sequence complementary thereto, allows the sequence to form a duplex atmedium or
high stringency.
[0115] In a preferred embodiment, a polypeptide having substantial similarity to a polypeptide
sequence listed in even numbered sequences of SEQ ID NOS:2-64, or exon, domain, or feature thereof,
is an allelic variant of the polypeptide sequence listed in even numbered sequences of SEQ ID NOS:264. In another preferred embodiment, a polypeptide having substantial similarity to a polypeptide
sequence listed in even numbered sequences of SEQ ID NOS:2-64, or exon, domain, or feature thereof,
is a naturally occurring variant of the polypeptide sequence listed in even numbered sequences of SEQ
ID NOS:2-64. In another preferred embodiment, a polypeptide having substantial similarity to a
polypeptide sequence listed in even numbered sequences of SEQ ID NOS:2-64, or exon, domain, or
feature thereof, is a polymorphic variant of the polypeptide sequence listed in even numbered
sequences of SEQ ID NOS:2-64.
[0116] In an alternate preferred embodiment, the sequence having substantial similarity contains a
deletion or insertion of at least one amino acid. In a more preferred embodiment, the deletion or
insertion is of less than about ten amino acids. In a most preferred embodiment, the deletion or
insertion is of less than about three amino acids.
[0117] In a preferred embodiment, the sequence having substantial similarity encodes a substitution
in at least one amino acid.
[0118] Also contemplated is a method of producing a plant comprising a modification thereto,
including the steps of: (1) providing a nucleic acid which is an isolated nucleic acid containing a
nucleotide sequence including:
(a) a nucleotide sequence listed in odd numbered sequences of SEQ ID NOS:1-63, or exon, domain, or
feature thereof;
(b) a nucleotide sequence having substantial similarity to (a);
(c) a nucleotide sequence capable of hybridizing to (a);
(d) a nucleotide sequence complementary to (a), (b) or (c); and
(e) a nucleotide sequence which is the reverse complement of (a), (b) or (c); and (2) introducing the
nucleic acid into the plant, wherein the nucleic acid is expressible in the plant in an amount effective to
effect the modification. In one embodiment, the modification comprises an altered trait in the plant,
wherein the trait corresponds to the nucleic acid introduced into the plant. In other preferred
embodiments, the altered trait is related to a feature listed in any of Tables 1-4, and it is particularly
preferred when the trait corresponds to disease resistance, yield, abiotic stress resistance, nutritional
composition, carbon metabolism, photosynthesis, signal transduction, cell growth, reproduction,
disease processes, or differentiation.
[0124] In another embodiment, the modification includes an increased or decreased expression or
accumulation of a product of the plant. Preferably, the product is a natural product of the plant. Equally
preferably, the product is a new or altered product of the plant. Preferably, the product includes, but is
not limited to, an enzyme, a nutritional protein, a structural protein, an amino acid, a lipid, a fatty acid,
a polysaccharide, a sugar, an alcohol, an alkaloid, a carotenoid, a propanoid, a steroid, a pigment, a
vitamin and a plant hormone. Another preferred embodiment provides method of controlling a
pathogen by delivering an effective amount of a product resulting from modification of the plant.
[0125] Embodiments of the present invention also include a method of controlling a pathogen
sensitive to a product, including expressing an isolated nucleic acid containing a nucleotide sequence
including:
(a) a nucleotide sequence listed odd numbered sequences of SEQ ID Nos:1-63, or exon, domain, or
feature thereof;
(b) a nucleotide sequence having substantial similarity to (a);
(c) a nucleotide sequence capable of hybridizing to (a);
(d) a nucleotide sequence complementary to (a), (b) or (c); and
(e) a nucleotide sequence which is the reverse complement of (a), (b) or (c); thereby causing the plant
to produce the product. In preferred embodiments, the product is selected from the group consisting of
an enzyme, a nutritional protein, a structural protein, an amino acid, a lipid, a fatty acid, a
187/503
polysaccharide, a sugar, an alcohol, an alkaloid, a carotenoid, a propanoid, a steroid, a pigment, a
vitamin and a plant hormone.
[0131] Also encompassed within the presently disclosed invention is a method of producing a
recombinant protein, comprising the steps of:
(a) growing recombinant cells comprising a nucleic acid construct under suitable growth conditions,
the construct comprising an expression vector and a nucleic acid including: a nucleic acid encoding a
protein as listed in even numbered nucleotide sequences of SEQ ID NOS:2-64, or a nucleic acid
sequence listed in odd numbered nucleotide sequences of SEQ ID NOS:1-63, or segments thereof; and
(b) isolating from the recombinant cells the recombinant protein expressed thereby.
[0134] Embodiments of the present invention provide a method of producing a recombinant protein
in which the expression vector includes one or more elements including a promoter-enhancer sequence,
a selection marker sequence, an origin of replication, an epitope-tag encoding sequence, and an affinity
purification-tag encoding sequence. In one preferred embodiment, the nucleic acid construct includes
an epitope-tag encoding sequence and the isolating step includes use of an antibody specific for the
epitope-tag. In another preferred embodiment, the nucleic acid construct contains a polyamino acid
encoding sequence and the isolating step includes use of a resin comprising a polyamino acid binding
substance, preferably where the polyamino acid is polyhistidine and the polyamino binding resin is
nickel-charged agarose resin. In yet another preferred embodiment, the nucleic acid construct contains
a polypeptide encoding sequence and the isolating step includes the use of a resin containing a
polypeptide binding substance, preferably where the polypeptide is a chitin binding domain and the
resin contains chitin-sepharose.
[0135] Embodiments of the present invention also relate to a plant modified by a method that
includes introducing into a plant a nucleic acid where the nucleic acid is expressible in the plant in an
amount effective to effect the modification. The modification can be, for example, nutritional
enhancement, increased nutrient uptake efficiency, enhanced production of endogenous compounds,
and production of heterologous compounds. In one embodiment, the modified plant has increased or
decreased resistance to an herbicide, a stress, or a pathogen. In another embodiment, the modified plant
has enhanced or diminished requirement for light, water, nitrogen, or trace elements. In yet another
embodiment, the modified plant is enriched for an essential amino acid as a proportion of a protein
fraction of the plant. The protein fraction may be, for example, total seed protein, soluble protein,
insoluble protein, water-extractable protein, and lipid-associated protein. The modification may include
overexpression, underexpression, antisense modulation, sense suppression, inducible expression,
inducible repression, or inducible modulation of a gene.
[0136] The invention further relates to a seed from a modified plant or an isolated product of a
modified plant, where the product may be an enzyme, a nutritional protein, a structural protein, an
amino acid, a lipid, a fatty acid, a polysaccharide, a sugar, an alcohol, an alkaloid, a carotenoid, a
propanoid, a steroid, a pigment, a vitamin and a plant hormone.
[0137] For purposes of summarizing the invention and the advantages achieved over the prior art,
certain objects and advantages of the invention have been described above. Of course, it is to be
understood that not necessarily all such objects or advantages may be achieved in accordance with any
particular embodiment of the invention. Thus, for example, those skilled in the art will recognize that
the invention may be embodied or carried out in a manner that achieves or optimizes one advantage or
group of advantages as taught herein without necessarily achieving other objects or advantages as may
be taught or suggested herein.
[0138] Further aspects, features and advantages of this invention will become apparent from the
detailed description of the preferred embodiments that follow.
BRIEF DESCRIPTION OF THE SEQUENCES IN THE SEQUENCE LIST
[0139] Odd numbered SEQ ID NOs:1-63 are nucleotide sequences isolated from Oryza sativa that
are more fully described in Tables 1-4 below.
[0140] Even numbered SEQ ID Nos: 2-64 are protein sequences encoded by the immediately
preceding nucleotide sequence, e.g., SEQ ID NO:2 is the protein encoded by the nucleotide sequence
of SEQ ID NO:1, SEQ ID NO:4 is the protein encoded by the nucleotide sequence of SEQ ID NO:3,
etc.
Definitions
[0141] For clarity, certain terms used in the specification are defined and presented as follows:
188/503
[0142] "Associated with/operatively linked" refer to two nucleic acid sequences that are related
physically or functionally. For example, a promoter or regulatory DNA sequence is said to be
"associated with" a DNA sequence that codes for an RNA or a protein if the two sequences are
operatively linked, or situated such that the regulator DNA sequence will affect the expression level of
the coding or structural DNA sequence.
[0143] A "chimeric construct" is a recombinant nucleic acid sequence in which a promoter or
regulatory nucleic acid sequence is operatively linked to, or associated with, a nucleic acid sequence
that codes for an mRNA or which is expressed as a protein, such that the regulatory nucleic acid
sequence is able to regulate transcription or expression of the associated nucleic acid sequence. The
regulatory nucleic acid sequence of the chimeric construct is not normally operatively linked to the
associated nucleic acid sequence as found in nature.
[0144] Co-factor: natural reactant, such as an organic molecule or a metal ion, required in an
enzyme-catalyzed reaction. A co-factor is e.g. NAD(P), riboflavin (including FAD and FMN), folate,
molybdopterin, thiamin, biotin, lipoic acid, pantothenic acid and coenzyme A, S-adenosylmethionine,
pyridoxal phosphate, ubiquinone, menaquinone. Optionally, a co-factor can be regenerated and reused.
[0145] A "coding sequence" is a nucleic acid sequence that is transcribed into RNA such as mRNA,
rRNA, tRNA, snRNA, sense RNA or antisense RNA. Preferably the RNA is then translated in an
organism to produce a protein.
[0146] Complementary: "complementary" refers to two nucleotide sequences that comprise
antiparallel nucleotide sequences capable of pairing with one another upon formation of hydrogen
bonds between the complementary base residues in the antiparallel nucleotide sequences.
[0147] Enzyme activity: means herein the ability of an enzyme to catalyze the conversion of a
substrate into a product. A substrate for the enzyme comprises the natural substrate of the enzyme but
also comprises analogues of the natural substrate, which can also be converted, by the enzyme into a
product or into an analogue of a product. The activity of the enzyme is measured for example by
determining the amount of product in the reaction after a certain period of time, or by determining the
amount of substrate remaining in the reaction mixture after a certain period of time. The activity of the
enzyme is also measured by determining the amount of an unused co-factor of the reaction remaining
in the reaction mixture after a certain period of time or by determining the amount of used co-factor in
the reaction mixture after a certain period of time. The activity of the enzyme is also measured by
determining the amount of a donor of free energy or energy-rich molecule (e.g. ATP,
phosphoenolpyruvate, acetyl phosphate or phosphocreatine) remaining in the reaction mixture after a
certain period of time or by determining the amount of a used donor of free energy or energy-rich
molecule (e.g. ADP, pyruvate, acetate or creatine) in the reaction mixture after a certain period of time.
[0148] Expression Cassette: "Expression cassette" as used herein means a nucleic acid molecule
capable of directing expression of a particular nucleotide sequence in an appropriate host cell,
comprising a promoter operatively linked to the nucleotide sequence of interest which is operatively
linked to termination signals. It also typically comprises sequences required for proper translation of
the nucleotide sequence. The coding region usually codes for a protein of interest but may also code for
a functional RNA of interest, for example antisense RNA or a nontranslated RNA, in the sense or
antisense direction. The expression cassette comprising the nucleotide sequence of interest may be
chimeric, meaning that at least one of its components is heterologous with respect to at least one of its
other components. The expression cassette may also be one that is naturally occurring but has been
obtained in a recombinant form useful for heterologous expression. Typically, however, the expression
cassette is heterologous with respect to the host, i.e., the particular DNA sequence of the expression
cassette does not occur naturally in the host cell and must have been introduced into the host cell or an
ancestor of the host cell by a transformation event. The expression of the nucleotide sequence in the
expression cassette may be under the control of a constitutive promoter or of an inducible promoter that
initiates transcription only when the host cell is exposed to some particular external stimulus. In the
case of a multicellular organism, such as a plant, the promoter can also be specific to a particular tissue
or organ or stage of development.
[0149] Gene: the term "gene" is used broadly to refer to any segment of DNA associated with a
biological function. Thus, genes include coding sequences and/or the regulatory sequences required for
their expression. Genes also include nonexpressed DNA segments that, for example, form recognition
sequences for other proteins. Genes can be obtained from a variety of sources, including cloning from a
source of interest or synthesizing from known or predicted sequence information, and may include
sequences designed to have desired parameters.
[0150] Heterologous/exogenous: The terms "heterologous" and "exogenous" when used herein to
refer to a nucleic acid sequence (e.g. a DNA sequence) or a gene, refer to a sequence that originates
189/503
from a source foreign to the particular host cell or, if from the same source, is modified from its
original form. Thus, a heterologous gene in a host cell includes a gene that is endogenous to the
particular host cell but has been modified through, for example, the use of DNA shuffling. The terms
also include non-naturally occurring multiple copies of a naturally occurring DNA sequence. Thus, the
terms refer to a DNA segment that is foreign or heterologous to the cell, or homologous to the cell but
in a position within the host cell nucleic acid in which the element is not ordinarily found. Exogenous
DNA segments are expressed to yield exogenous polypeptides.
[0151] A "homologous" nucleic acid (e.g. DNA) sequence is a nucleic acid (e.g. DNA) sequence
naturally associated with a host cell into which it is introduced.
[0152] Hybridization: The phrase "hybridizing specifically to" refers to the binding, duplexing, or
hybridizing of a molecule only to a particular nucleotide sequence under stringent conditions when that
sequence is present in a complex mixture (e.g., total cellular) DNA or RNA. "Bind(s) substantially"
refers to complementary hybridization between a probe nucleic acid and a target nucleic acid and
embraces minor mismatches that can be accommodated by reducing the stringency of the hybridization
media to achieve the desired detection of the target nucleic acid sequence.
[0153] Inhibitor: a chemical substance that inactivates the enzymatic activity of a protein such as a
biosynthetic enzyme, receptor, signal transduction protein, structural gene product, or transport protein.
The term "herbicide"(or "herbicidal compound" is used herein to define an inhibitor applied to a plant
at any stage of development, whereby the herbicide inhibits the growth of the plant or kills the plant.
[0154] Interaction: quality or state of mutual action such that the effectiveness or toxicity of one
protein or compound on another protein is inhibitory (antagonists) or enhancing (agonists).
[0155] A nucleic acid sequence is "isocoding with" a reference nucleic acid sequence when the
nucleic acid sequence encodes a polypeptide having the same amino acid sequence as the polypeptide
encoded by the reference nucleic acid sequence.
[0156] Isogenic: plants that are genetically identical, except that they may differ by the presence or
absence of a heterologous DNA sequence.
[0157] Isolated: in the context of the present invention, an isolated DNA molecule or an isolated
enzyme is a DNA molecule or enzyme that, by the hand of man, exists apart from its native
environment and is therefore not a product of nature. An isolated DNA molecule or enzyme may exist
in a purified form or may exist in a non-native environment such as, for example, in a transgenic host
cell.
[0158] Mature protein: protein from which the transit peptide, signal peptide, and/or propeptide
portions have been removed.
[0159] Minimal Promoter the smallest piece of a promoter, such as a TATA element, that can
support any transcription. A minimal promoter typically has greatly reduced promoter activity in the
absence of upstream activation. In the presence of a suitable transcription factor, the minimal promoter
functions to permit transcription.
[0160] Modified Enzyme Activity: enzyme activity different from that which naturally occurs in a
plant (i.e. enzyme activity that occurs naturally in the absence of direct or indirect manipulation of such
activity by man), which is tolerant to inhibitors that inhibit the naturally occurring enzyme activity.
[0161] Native: refers to a gene that is present in the genome of an untransformed plant cell.
[0162] Naturally occurring: the term "naturally occurring" is used to describe an object that can be
found in nature as distinct from being artificially produced by man. For example, a protein or
nucleotide sequence present in an organism (including a virus), which can be isolated from a source in
nature and which has not been intentionally modified by man in the laboratory, is naturally occurring.
[0163] Nucleic acid: the term "nucleic acid" refers to deoxyribonucleotides or ribonucleotides and
polymers thereof in either single- or double-stranded form. Unless specifically limited, the term
encompasses nucleic acids containing known analogues of natural nucleotides which have similar
binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally
occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly
encompasses conservatively modified variants thereof (e.g. degenerate codon substitutions) and
complementary sequences and as well as the sequence explicitly indicated. Specifically, degenerate
codon substitutions may be achieved by generating sequences in which the third position of one or
more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer et al,
Nucleic Acid Res. 19: 5081 (1991); Ohtsuka et al., J. Biol. Chem. 260: 2605-2608 (1985); Rossolini et
al., Mol. Cell. Probes 8: 91-98 (1994)). The terms "nucleic acid" or "nucleic acid sequence" may also
be used interchangeably with gene, cDNA, and mRNA encoded by a gene.
[0164] "ORF" means open reading frame.
190/503
[0165] Percent identity: the phrases "percent identical" or "percent identical," in the context of two
nucleic acid or protein sequences, refers to two or more sequences or subsequences that have for
example 60%, preferably 70%, more preferably 80%, still more preferably 90%, even more preferably
95%, and most preferably at least 99% nucleotide or amino acid residue identity, when compared and
aligned for maximum correspondence, as measured using one of the following sequence comparison
algorithms or by visual inspection. Preferably, the percent identity exists over a region of the sequences
that is at least about 50 residues in length, more preferably over a region of at least about 100 residues,
and most preferably the percent identity exists over at least about 150 residues. In an especially
preferred embodiment, the percent identity exists over the entire length of the coding regions.
[0166] For sequence comparison, typically one sequence acts as a reference sequence to which test
sequences are compared. When using a sequence comparison algorithm, test and reference sequences
are input into a computer, subsequence coordinates are designated if necessary, and sequence algorithm
program parameters are designated. The sequence comparison algorithm then calculates the percent
sequence identity for the test sequence(s) relative to the reference sequence, based on the designated
program parameters.
[0167] Optimal alignment of sequences for comparison can be conducted, e.g., by the local
homology algorithm of Smith & Waterman, Adv. Appl. Math. 2: 482 (1981), by the homology
alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48: 443 (1970), by the search for
similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci.USA 85: 2444 (1988), by computerized
implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin
Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by visual
inspection (see generally, Ausubel et al., infra).
[0168] One example of an algorithm that is suitable for determining percent sequence identity and
sequence similarity is the BLAST algorithm, which is described in Altschul et al., J. Mol. Biol. 215:
403-410 (1990). Software for performing BLAST analyses is publicly available through the National
Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/). This algorithm involves first
identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query
sequence, which either match or satisfy some positive-valued threshold score T when aligned with a
word of the same length in a database sequence. T is referred to as the neighborhood word score
threshold (Altschul et al., 1990). These initial neighborhood word hits act as seeds for initiating
searches to find longer HSPs containing them. The word hits are then extended in both directions along
each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are
calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching
residues; always ;0) and N (penalty score for mismatching residues; always >;0). For amino acid
sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in
each direction are halted when the cumulative alignment score falls off by the quantity X from its
maximum achieved value, the cumulative score goes to zero or below due to the accumulation of one
or more negative-scoring residue alignments, or the end of either sequence is reached. The BLAST
algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN
program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, an expectation (E) of 10, a
cutoff of 100, M=5, N=-4, and a comparison of both strands. For amino acid sequences, the BLASTP
program uses as defaults a wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring
matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89: 10915 (1989)).
[0169] In addition to calculating percent sequence identity, the BLAST algorithm also performs a
statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Nat'l.
Acad. Sci. USA 90: 5873-5787 (1993)). One measure of similarity provided by the BLAST algorithm
is the smallest sum probability (P(N)), which provides an indication of the probability by which a
match between two nucleotide or amino acid sequences would occur by chance. For example, a test
nucleic acid sequence is considered similar to a reference sequence if the smallest sum probability in a
comparison of the test nucleic acid sequence to the reference nucleic acid sequence is less than about
0.1, more preferably less than about 0.01, and most preferably less than about 0.001.
[0170] Pre-protein: protein that is normally targeted to a cellular organelle, such as a chloroplast, and
still comprises its native transit peptide.
[0171] Purified: the term "purified," when applied to a nucleic acid or protein, denotes that the
nucleic acid or protein is essentially free of other cellular components with which it is associated in the
natural state. It is preferably in a homogeneous state although it can be in either a dry or aqueous
solution. Purity and homogeneity are typically determined using analytical chemistry techniques such
as polyacrylamide gel electrophoresis or high performance liquid chromatography. A protein that is the
predominant species present in a preparation is substantially purified. The term "purified" denotes that
191/503
a nucleic acid or protein gives rise to essentially one band in an electrophoretic gel. Particularly, it
means that the nucleic acid or protein is at least about 50% pure, more preferably at least about 85%
pure, and most preferably at least about 99% pure.
[0172] Two nucleic acids are "recombined" when sequences from each of the two nucleic acids are
combined in a progeny nucleic acid. Two sequences are "directly" recombined when both of the
nucleic acids are substrates for recombination. Two sequences are "indirectly recombined" when the
sequences are recombined using an intermediate such as a cross-over oligonucleotide. For indirect
recombination, no more than one of the sequences is an actual substrate for recombination, and in some
cases, neither sequence is a substrate for recombination.
[0173] "Regulatory elements" refer to sequences involved in controlling the expression of a
nucleotide sequence. Regulatory elements comprise a promoter operatively linked to the nucleotide
sequence of interest and termination signals. They also typically encompass sequences required for
proper translation of the nucleotide sequence.
[0174] Significant Increase: an increase in enzymatic activity that is larger than the margin of error
inherent in the measurement technique, preferably an increase by about 2-fold or greater of the activity
of the wild-type enzyme in the presence of the inhibitor, more preferably an increase by about 5-fold or
greater, and most preferably an increase by about 10-fold or greater.
[0175] Significantly less: means that the amount of a product of an enzymatic reaction is reduced by
more than the margin of error inherent in the measurement technique, preferably a decrease by about 2fold or greater of the activity of the wild-type enzyme in the absence of the inhibitor, more preferably
an decrease by about 5-fold or greater, and most preferably an decrease by about 10-fold or greater.
[0176] Specific Binding/Immunological Cross-Reactivity: An indication that two nucleic acid
sequences or proteins are substantially identical is that the protein encoded by the first nucleic acid is
immunologically cross reactive with, or specifically binds to, the protein encoded by the second nucleic
acid. Thus, a protein is typically substantially identical to a second protein, for example, where the two
proteins differ only by conservative substitutions. The phrase "specifically (or selectively) binds to an
antibody," or "specifically (or selectively) immunoreactive with," when referring to a protein or
peptide, refers to a binding reaction which is determinative of the presence of the protein in the
presence of a heterogeneous population of proteins and other biologics. Thus, under designated
immunoassay conditions, the specified antibodies bind to a particular protein and do not bind in a
significant amount to other proteins present in the sample. Specific binding to an antibody under such
conditions may require an antibody that is selected for its specificity for a particular protein. For
example, antibodies raised to the protein with the amino acid sequence encoded by any of the nucleic
acid sequences of the invention can be selected to obtain antibodies specifically immunoreactive with
that protein and not with other proteins except for polymorphic variants. A variety of immunoassay
formats may be used to select antibodies specifically immunoreactive with a particular protein. For
example, solid-phase ELISA immunoassays, Western blots, or immunohistochemistry are routinely
used to select monoclonal antibodies specifically immunoreactive with a protein. See Harlow and Lane
(1988) Antibodies, A Laboratory Manual, Cold Spring Harbor Publications, New York "Harlow and
Lane"), for a description of immunoassay formats and conditions that can be used to determine specific
immunoreactivity. Typically a specific or selective reaction will be at least twice background signal or
noise and more typically more than 10 to 100 times background.
[0177] "Stringent hybridization conditions" and "stringent hybridization wash conditions" in the
context of nucleic acid hybridization experiments such as Southern and Northern hybridizations are
sequence dependent, and are different under different environmental parameters. Longer sequences
hybridize specifically at higher temperatures. An extensive guide to the hybridization of nucleic acids
is found in Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular BiologyHybridization with Nucleic Acid Probes part I chapter 2 "Overview of principles of hybridization and
the strategy of nucleic acid probe assays" Elsevier, New York. Generally, highly stringent
hybridization and wash conditions are selected to be about 5[deg.] C. lower than the thermal melting
point (Tm) for the specific sequence at a defined ionic strength and pH. Typically, under "stringent
conditions" a probe will hybridize to its target subsequence, but to no other sequences.
[0178] The Tm is the temperature (under defined ionic strength and pH) at which 50% of the target
sequence hybridizes to a perfectly matched probe. Very stringent conditions are selected to be equal to
the Tm for a particular probe. An example of stringent hybridization conditions for hybridization of
complementary nucleic acids which have more than 100 complementary residues on a filter in a
Southern or northern blot is 50% fonmamide with 1 mg of heparin at 42[deg.] C., with the
hybridization being carried out overnight. An example of highly stringent wash conditions is 0.1 5M
NaCl at 72[deg.] C. for about 15 minutes. An example of stringent wash conditions is a 0.2*SSC wash
192/503
at 65[deg.] C. for 15 minutes (see, Sambrook, infra, for a description of SSC buffer). Often, a high
stringency wash is preceded by a low stringency wash to remove background probe signal. An example
medium stringency wash for a duplex of, e.g., more than 100 nucleotides, is 1*SSC at 45[deg.] C. for
15 minutes. An example low stringency wash for a duplex of, e.g., more than 100 nucleotides, is 46*SSC at 40[deg.] C. for 15 minutes. For short probes (e.g., about 10 to 50 nucleotides), stringent
conditions typically involve salt concentrations of less than about 1.0 M Na ion, typically about 0.01 to
1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3, and the temperature is typically at least
about 30[deg.] C. Stringent conditions can also be achieved with the addition of destabilizing agents
such as formamide. In general, a signal to noise ratio of 2* (or higher) than that observed for an
unrelated probe in the particular hybridization assay indicates detection of a specific hybridization.
Nucleic acids that do not hybridize to each other under stringent conditions are still substantially
identical if the proteins that they encode are substantially identical. This occurs, e.g., when a copy of a
nucleic acid is created using the maximum codon degeneracy permitted by the genetic code.
[0179] The following are examples of sets of hybridization/wash conditions that may be used to
clone nucleotide sequences that are homologues of reference nucleotide sequences of the present
invention: a reference nucleotide sequence preferably hybridizes to the reference nucleotide sequence
in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO4, 1 mM EDTA at 50[deg.] C. with washing in
2*SSC, 0.1% SDS at 50[deg.] C., more desirably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO4,
1 mM EDTA at 50[deg.] C. with washing in 1*SSC, 0.1% SDS at 50[deg.] C., more desirably still in
7% sodium dodecyl sulfate (SDS), 0.5 M NaPO4, 1 mM EDTA at 50[deg.] C. with washing in
0.5*SSC, 0.1% SDS at 50[deg.] C., preferably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO4, 1
mM EDTA at 50[deg.] C. with washing in 0.1*SSC, 0.1% SDS at 50[deg.] C., more preferably in 7%
sodium dodecyl sulfate (SDS), 0.5 M NaPO4, 1 mM EDTA at 50[deg.] C. with washing in 0.1*SSC,
0.1% SDS at 65[deg.] C.
[0180] A "subsequence" refers to a sequence of nucleic acids or amino acids that comprise a part of a
longer sequence of nucleic acids or amino acids (e.g., protein) respectively.
[0181] Substrate: a substrate is the molecule that an enzyme naturally recognizes and converts to a
product in the biochemical pathway in which the enzyme naturally carries out its function, or is a
modified version of the molecule, which is also recognized by the enzyme and is converted by the
enzyme to a product in an enzymatic reaction similar to the naturally-occurring reaction.
[0182] Transformation: a process for introducing heterologous DNA into a plant cell, plant tissue, or
plant. Transformed plant cells, plant tissue, or plants are understood to encompass not only the end
product of a transformation process, but also transgenic progeny thereof.
[0183] "Transformed," "transgenic," and "recombinant" refer to a host organism such as a bacterium
or a plant into which a heterologous nucleic acid molecule has been introduced. The nucleic acid
molecule can be stably integrated into the genome of the host or the nucleic acid molecule can also be
present as an extrachromosomal molecule. Such an extrachromosomal molecule can be autoreplicating. Transformed cells, tissues, or plants are understood to encompass not only the end product
of a transformation process, but also transgenic progeny thereof. A "non-transformed," "nontransgenic," or "non-recombinant" host refers to a wild-type organism, e.g., a bacterium or plant, which
does not contain the heterologous nucleic acid molecule.
[0184] Viability: "viability" as used herein refers to a fitness parameter of a plant. Plants are assayed
for their homozygous performance of plant development, indicating which proteins are essential for
plant growth.
DETAILED DESCRIPTION OF THE INVENTION
I. General Description of Trait Functional Genomics Project
[0185] The goal of functional genomics is to assign functions to the genes of an organism using a
variety of methodologies, including but not limited to bioinformatics, gene expression studies, gene
and gene product interactions, genetics, biochemistry and molecular genetics. For example,
bioinformatics can assign function to a given gene by identifying genes in heterologous organisms with
a high degree of similarity (homology) at the amino acid or nucleotide level. Expression of a gene at
the mRNA or protein levels can assign function by linking expression of a gene to an environmental
response, a developmental process or a genetic (mutational) or molecular genetic (gene overexpression
or underexpression) perturbation. Expression of a gene at the mRNA level can be ascertained either
alone (Northern analysis) or in concert with other genes (microarray analysis), whereas expression of a
gene at the protein level can be ascertained either alone (native or denatured protein gel or immunoblot
analysis) or in concert with other genes (proteomic analysis). Knowledge of protein/protein and
193/503
protein/DNA interactions can assign function by identifying proteins and nucleic acid sequences acting
together in the same biological process. Genetics can assign function to a gene by demonstrating that
DNA lesions (mutations) in the gene have a quantifiable effect on the organism, including but not
limited to: its development; hormone biosynthesis and response; growth and growth habit (plant
architecture); mRNA expression profiles; protein expression profiles; ability to resist diseases;
tolerance of abiotic stresses; ability to acquire nutrients; photosynthetic efficiency; altered primary and
secondary metabolism; and the composition of various plant organs. Biochemistry can assign function
by demonstrating that the protein encoded by the gene, typically when expressed in a heterologous
organism, possesses a certain enzymatic activity, alone or in combination with other proteins.
Molecular genetics can assign function by overexpressing or underexpressing the gene in the native
plant or in heterologous organisms, and observing quantifiable effects as described in functional
assignment by genetics above.
[0186] It is recognized by those skilled in the art that these different methodologies can each provide
data as evidence for the function of a particular gene, and that such evidence is stronger with increasing
amounts of data used for functional assignment: preferably from a single methodology, more
preferably from two methodologies, and even more preferably from more than two methodologies. In
addition, those skilled in the art are aware that different methodologies can differ in the strength of the
evidence for the assignment of gene function. Typically, but not always, a datum of biochemical,
genetic and molecular genetic evidence is considered stronger than a datum of bioinformatic or gene
expression evidence. Finally, those skilled in the art recognize that, for different genes, a single datum
from a single methodology can differ in terms of the strength of the evidence provided by each distinct
datum for the assignment of the function of these different genes.
[0187] The objective of trait functional genomics is to identify crop trait genes, i.e. genes capable of
conferring useful agronomic traits in crop plants. Such agronomic traits include, but are not limited to:
enhanced yield, whether in quantity or quality; enhanced nutrient acquisition and enhanced metabolic
efficiency; enhanced or altered nutrient composition of plant tissues used for food, feed, fiber or
processing; enhanced resistance to plant diseases; enhanced tolerance of adverse environmental
conditions (abiotic stresses) including but not limited to drought, excessive cold, excessive heat, or
excessive soil salinity or extreme acidity or alkalinity; and alterations in plant architecture or
development, including changes in developmental timing. The deployment of such identified trait
genes could materially improve crop plants for the benefit of agriculture, potentially, irrespective of the
method of deployment of such genes.
[0188] Cereals are the most important crop plants on the planet, in terms of both human and animal
consumption. Genomic synteny (conservation of gene order within large chromosomal segments) is
observed in the rice, maize, wheat, barley, rye, oats and other agriculturally important monocots, which
facilitates the mapping and isolation of orthologous genes from diverse cereal species based on the
sequence of a single cereal gene. Rice has the smallest (420 Mb) genome among the cereal grains, and
has recently been a major focus of public and private genomic and EST sequencing efforts.
[0189] To identify crop trait genes in the rice genome, genes with likely or demonstrated effects on
agronomic traits of interest as defined above were identified in the scientific literature. The predicted
peptides encoded by these genes were then used to search a proprietary database of rice genomic
sequences for those with high similarity, using search algorithms familiar to those skilled in the art,
resulting in the identification of rice trait gene orthologs. Rice trait gene orthologs were assigned
function based on similarity searches of two different public databases: the SwissProt protein database
and the GenPept non-redundant (nr) database of conceptual translations of all of the nucleotide
sequences in Genbank.
[0190] To demonstrate the validity of this approach, and to provide additional evidence for the
function of a subset of these genes, full-length and partial cDNAs of rice trait gene orthologs were
isolated. Several different commercially available gene prediction programs were used to help predict
full-length cDNAs corresponding to the putative rice trait gene orthologs. Full-length and partial
cDNAs were isolated based on these predictions, using two different approaches. In one approach, a
similarity search algorithm was used to search a database of sequenced cDNA clones. In another
approach, the predicted cDNAs were used in combination with the genomic sequence to design primers
for PCR amplification using a commercially available PCR primer-picking program. Primers were use
d for PCR amplification of full-length or partial cDNAs from rice cDNA libraries or first-strand cDNA.
cDNA clones resulting from either approach were used for the construction of vectors designed for
overexpression or underexpression of corresponding genes in transgenic rice plants. Assays to identify
transgenic plants for alterations in traits of interest are to be used to unambiguously assign the utility of
194/503
these genes for the improvement of rice, and by extension, other cereals, either by transgenic or
classical breeding methods.
II. Identifying, Cloning and Sequencing cDNAs
[0191] The identification of genes of interest and determination of cDNA homologies is set forth in
Example 1. The cloning and sequencing of the cDNAs of the present invention are described in
Example 2.
[0192] The isolated nucleic acids and proteins of the present invention are usable over a range of
plants, monocots and dicots, in particular monocots such as rice, wheat, barley and maize. In a more
preferred embodiment, the monocot is a cereal. In a more preferred embodiment, the cereal may be, for
example, maize, wheat, barley, oats, rye, millet, sorghum, triticale, secale, einkorn, spelt, emmer, teff,
milo, flax, gramma grass, Tripsacum sp., or teosinte. In a most preferred embodiment, the cereal is rice.
Other plants genera include, but are not limited to, Cucurbita, Rosa, Vitis, Juglans, Gragaria, Lotus,
Medicago, Onobrychis; Trigonella, Vigna, Citrus, Linum, Geranium, Manihot, Daucus, Arabidopsis,
Brassica, Raphanus, Sinapis, Atropa, Capsicum, Datura, Hyoscyamus, Lycopersicon, Nicotiana,
Solanum, Petunia, Digitalis, Majorana, Ciahorium, Helianthus, Lactuca, Bromus, Asparagus,
Antirrhinum, Heterocallis, Nemesis, Pelargonium, Panieum, Pennisetum, Ranunculus, Senecio,
Salpiglossis, Cucumis, Browaalia, Glycine, Pisum, Phaseolus, Lolium, Oryza, Avena, Hordeum,
Secale, Allium, and Triticum.
[0193] The present invention also provides a method of genotyping a plant or plant part comprising a
nucleic acid molecule of the present invention. Optionally, the plant is a monocot such as, but not
limited rice or wheat. Genotyping provides a means of distinguishing homologs of a chromosome pari
and can be used to differentiate segregants in a plant population. Molecular marker methods can be
used in phylogenetic studies, characterizing genetic relationships among crop varieties, identifying
crosses or somatic hybrids, localizing chromosomeal segments affecting mongenic traits, map based
cloning, and the study of quantitative inheritance (see Plant Molecular Biology: A Laboratory Manual,
Chapter 7, Clark ed., Springer-Verlag, Berlin 1997; Paterson, A. H., "The DNA Revolution", chapter 2
in Genome Mapping in Plants, Paterson, A. H. ed., Academic Press/R. G. Lands Co., Austin, Tex.
1996).
[0194] The method of genotyping may employ any number of molecular marker analytical
techniques such as, but not limited to, restriction length polymorphisms (RFLPs). As is well known in
the art, RFLPs are produced by differences in the DNA restriction fragment lengths resulting from
nucleotide differences between alleles of the same gene. Thus, the present invention provides a method
of following segregation of a gene or nucleic acid of the present invention or chromosomal sequences
genetically linked by using RFLP analysis. Linked chromosomal sequences are within 50 centiMorgans
(50 cM), within 40 or 30 cM, preferably within 20 or 10 cM, more preferably within 5, 3, 2, or 1 cM of
the nucleic acid of the invention.
III. Traits of Interest
[0195] The present invention encompasses the identification and isolation of cDNAs encoding genes
of interest in the trait areas of abiotic stress tolerance, enhanced yield, disease resistance, and
nutritional composition. Abiotic stresses such as, but not limited to, cold, heat, drought or salt stress
can significantly affect the growth and/or yield of plants. Additionally, altering the expression of genes
related to these traits are used to improve or modify the rice plants and/or grain as desired. Examples 37 describe the isolated genes of interest and methods of analyzing the alteration of expression and their
effects on the plant characteristics.
[0196] One aspect of the present invention provides compositions and methods for altering (i.e.
increasing or decreasing) the level of nucleic acid molecules and polypeptides of the present invention
in plants. In particular, the nucleic acid molecules and polypeptides of the invention are expressed
constitutively, temporally or spatially, e.g. at developmental stages, in certain tissues, and/or quantities,
which are uncharacteristic of non-recombinantly engineered plants. Therefore, the present invention
provides utility in such exemplary applications as altering the specified characteristics identified above.
[0197] Pathogens of the invention include, but are not limited to, fungi, bacteria, nematodes, viruses
or viroids, etc.
[0198] Generally Viruses include tobacco or cucumber mosaic virus, ringspot virus, necrosis virus,
maize dwarf mosaic virus, etc. Specific fungal, bacterial and viral pathogens of major crops include,
but are not limited to: RICE: rice brown spot fungus (Cochliobolus miyabeanus), rice blast fungusMagnaporthe grisea (Pyricularia grisea), Magnaporthe salvinii (Sclerotium oryzae), Xanthomomas
oryzae pv. oryzae, Xanthomomas oryzae pv. oryzicola, Rhizoctonia spp. (including but not limited to
195/503
Rhizoctonia solani, Rhizoctonia oryzae and Rhizoctonia oryzae-sativae), Pseudomonas spp. (including
but not limited to Pseudomonas plantarii, Pseudomonas avenae, Pseudomonas glumae, Pseudomonas
fuscovaginae, Pseudomonas alboprecipitans, Pseudomonas syringae pv. panici, Pseudomonas syringae
pv. syringae, Pseudomonas syringae pv. oryzae and Pseudomonas syringae pv. aptata), Erwinia spp.
(including but not limited to Erwinia herbicola, Erwinia amylovaora, Erwinia chrysanthemi and
Erwinia carotovora), Achyla spp. (including but not limited to Achyla conspicua and Achyia
klebsiana), Pythium spp. (including but not limited to Pythium dissotocum, Pythium irregulare,
Pythium arrhenomanes, Pythium myriotylum, Pythium catenulatum, Pythium graminicola and Pythium
spinosum), Saprolegnia spp., Dictyuchus spp., Pythiogeton spp., Phytophthora spp., Alternaria
padwickii, Cochliobolus miyabeanus, Curvularia spp. (including but not limited to Curvularia lunata,
Curvularia affinis, Curvularia clavata, Curvularia eragrostidis, Curvularia fallax, Curvularia geniculata,
Curvularia inaequalis, Curvularia intermedia, Curvularia oryzae, Curvularia oryzae-sativae, Curvularia
pallescens, Curvularia senegalensis, Curvularia tuberculata, Curvularia uncinata and Curvularia
verruculosa), Sarocladium oryzae, Gerlachia oryzae, Fusarium spp. (including but not limited Fusarium
graminearum, Fusarium nivale and to different pathovars of Fusarium monoliforme, including pvs.
fujikuroi and zeae), Sclerotium rolfsii, Phoma exigua, Mucor fragilis, Trichoderma viride, Rhizopus
spp., Cercospora oryzae, Entyloma oryzae, Dreschlera gigantean, Scierophthora macrospora,
Mycovellosiella oryzae, Phomopsis oryzae-sativae, Puccinia graminis, Uromyces coronatus,
Cylindrocladium scoparium, Sarocladium oryzae, Gaeumannomyces graminis pv. graminis,
Myrothecium verrucaria, Pyrenochaeta oryzae, Ustilaginoidea virens, Neovossia spp. (including but
not limited to Neovossia horrida), Tilletia spp., Balansia oryzae-sativae, Phoma spp. (including but not
limited to Phoma sorghina, Phoma insidiosa, Phoma glumarum, Phoma glumicola and Phoma oryzina),
Nigrospora spp. (including but not limited to Nigrospora oryzae, Nigrospora sphaerica, Nigrospora
panici and Nigrospora padwickii), Epiococcum nigrum, Phyllostica spp., Wolkia decolorans, Monascus
purpureus, Aspergillus spp., Penicillium spp., Absidia spp., Mucor spp., Chaetomium spp., Dematium
spp., Monilia spp., Streptomyces spp., Syncephalastrum spp., Verticillium spp., Nematospora coryli,
Nakataea sigmoidea, Cladosporium spp., Bipolaris spp., Coniothyrium spp., Diplodia oryzae,
Exserophilum rostratum, Helococera oryzae, Melanomma glumarum, Metashaeria spp.,
Mycosphaerella spp., Oidium spp., Pestalotia spp., Phaeoseptoria spp., Sphaeropsis spp.,
Trematosphaerella spp., rice black-streaked dwarf virus, rice dwarf virus, rice gall dwarf virus, barley
yellow dwarf virus, rice grassy stunt virus, rice hoja blanca virus, rice necrosis mosaic virus, rice
ragged stunt virus, rice stripe virus, rice stripe necrosis virus, rice transitory yellowing virus, rice
tungro bacilliform virus, rice tungro spherical virus, rice yellow mottle virus, rice tarsonemid mite
virus, Echinochloa hoja blanca virus, Echinochloa ragged stunt virus, orange leaf mycoplasma-like
organism, yellow dwarf mycoplasma-like organism, Aphelenchoides besseyi, Ditylenchus angustus,
Hirschmanniella spp., Criconemella spp., Meloidogyne spp., Heterodera spp., Pratylenchus spp.,
Hoplolaimus indicus:
[0199] SOYBEANS: Phytophthora sojae, Fusarium solani f. sp. Glycines, Macrophomina
phaseolina, Fusarium, Pythium, Rhizoctonia, Phialophora gregata, Sclerotinia sclerotiorum, Diaporthe
phaseolorum var. sojae, Colletotrichum truncatum, Phomopsis longicolla, Cercospora kikuchii,
Diaporthe phaseolonum var. meridionalis (and var. caulivora), Phakopsora pachyrhyzi, Fusarium
solani, Microsphaera diffusa, Septoria glycines, Cercospora kikuchii, Macrophomina phaseolina,
Sclerotinia sclerotiorum, Corynespora cassiicola, Rhizoctonia solani, Cercospora sojina,Phytophthora
megasperma fsp. glycinea, Macrophomina phaseolina, Fusarium oxysporum, Diapothe phaseolorum
var. sojae (Phomopsis sojae), Diaporthe phaseolorum var. caulivora, Sclerotium rolfsii, Cercospora
kikuchii, Cercospora sojina, Peronospora manshurica, Colletotrichum dematium (Colletotichum
truncatum), Corynespora cassiicola, Phyllosticta sojicola, Alternaria alternata, Pseudomonas syringae
p.v. glycinea, Xanthomonas campestris p.v. phaseoli, Microspaera diffusa, Fusarium semitectum,
Phialophora gregata, Soybean mosaic virus, Glomerella glycines, Tobacco Ring spot virus, Tobacco
Streak virus, Phakopsora pachyrhizi, Pythium aphanidermatum, Pythium ultimum, Pythium
dearyanum, Tomato spotted wilted virus, Heterodera glycines, Fusarium solani, Soybean cyst and root
knot nematodes.
[0200] CORN: Fusarium moniliforme var. subglutinans, Erwinia stewartii, Fusarium moniliforme,
Gibberella zeae (Fusarium Graminearum), Stenocarpella maydi (Diplodia maydis), Pythium irregulare,
Pythium debaryanum, Pythium graminicola, Pythium splendens, Pythium ultimum, Pythium
aphanidermatum, Aspergillus flavus, Bipolaris maydis O, T (cochliobolus heterostrophus),
Helminthosporium carbonum I, II, and III (Cochliobolus carbonum), Exserohilum turcicum I, II and
III, Helminthosporium pedicellatum, Physoderma maydis, Phyllosticta maydis, Kabatie-maydis,
Cercospora sorghi, Ustilago maydis, Puccinia sorghi, Puccinia polysora, Macrophomina phaseolina,
196/503
Penicillium oxalicum, Nigrospora oryzae, Cladosporium herbarum, Curvularia lunata, Curvularia
inaequalis, Curvularia pallescens, Clavibacter michiganese subsp. Nebraskense, Trichoderma viride,
Maize dwarf Mosaic Virus A and B, Wheat Streak Mosaic Virus, Maize Chlorotic Dwarf Virus,
Claviceps sorghi, Pseudonomas avenae, Erwinia chrysantemi p.v. Zea, Erwinia corotovora, Cornstun
spiroplasma, Diplodia macrospora, Sclerophthora macrospora, Peronosclerospora sorghi,
Peronoscherospora philippinesis, Peronosclerospora maydis, Peronosclerospora sacchari, Spacelotheca
reiliana, Physopella zea, Cephalosporium maydis, Caphalosporium acremonium, Maize Chlorotic
Mottle Virus, High Plains Virus, Maize Mosaic Virus, Maize Rayado Fino Virus, Maize Streak Virus,
Maize Stripe Virus, Maize Rought Dwarf Virus:
[0201] WHEAT: Pseudomonas syringae p.v. atrofaciens, Urocystis agropyri, Xanthomonas
campestris p.v. translucens, Pseudomonas syringae p.v. syringae, Alternaria alternata, Cladosporium
herbarum, Fusarium graminearum, Fusarium avenaceum, Fusarium culmorum, Ustilago tritici,
Ascochyta tritici, Cephalosporium gramineum, Collotetrichum graminicola, Erysiphe graminis f. sp.
Tritici, Puccinia graminis f. sp. Tritici, Puccinia recondite f. sp. tritici, puccinia striiformis,
Pyrenophora triticirepentis, Septoria nodorum, Septoria tritici, Spetoria avenae, Pseudocercosporella
herpotrichoides, Rhizoctonia solani, Rhizoctonia cerealis, Gaeumannomyces graminis var. tritici,
Pythium aphanidermatum, Pythium arrhenomanes, Pythium ultimum, Bipolaris sorokiniana, Barley
Yellow Dwarf Virus, Brome Mosaic Virus, Soil Borne Wheat Mosaic Virus, Wheat Streak Virus,
Wheat Spindle Streak Virus, American Wheat Striate Virus, Claviceps purpurea, Tilletia tritici, Tilletia
laevis, Pstilago tritici, Tilletia indica, Rhizoctonia solani, Pythium arrhenomannes, Pythium gramicola,
Pythium aphanidermatum, High Plains Virus, European Wheat Striate Virus:
[0202] CANOLA: Albugo candida, Alternaria brassicae, Leptosharia maculans, Rhizoctonia solani,
Sclerotinia sclerotiorum, Mycospaerella brassiccola, Pythium ultimum, Peronospora parasitica,
Fusarium roseum, Alternaria alternata:
[0203] SUNFLOWER: Plasmophora halstedii, Scherotinia sclerotiorum, Aster Yellows, Septoria
helianthi, Phomopsis helianthi, Alternaria helianthi, Alternaria zinniae, Botrytis cinera, Phoma
macdonaldii, Macrophomina phaseolina, Erysiphe cichoracearum, Phizopus oryzae, Rhizopus arrhizus,
Rhizopus stolonifer, Puccinia helianthi, Verticillium Dahliae, Erwinia carotovorum p.v. carotovora,
Cephalosporium acremonium, Phytophthora cryptogea, Albugo tragopogonis: etc.
[0204] SORGHUM: Exserohilum turcicum, Colletotrichum graminicola (Glomerella graminicola),
Cercospora sorghi, Gloeocercospora sorghi, Ascochyta sorghi, Pseudomonas syringae p.v. syringae,
Xanthomonas campestris p.v. holcicola, Pseudomonas andropogonis, Puccinia purpurea,
Macrophomina phaseolina, Periconia circinata, Fusarium moniliforme, Alternaria alternate, Bipolaris
sorghicola, Helminthosporium sorghicola, Curvularia lunata, Phoma insidiosa, Pseudomonas avenae
(Pseudomonas alboprecipitans), Ramulispora sorghi, Ramulispora sorghicola, Phyllachara sacchari
Sporisorium relianum (Sphacelotheca reliana), Sphacelotheca cruenta, Sporisorium sorghi, Sugarcane
mosaic H, Maize Dwarf Mosaic Virus A & B, Claviceps sorghi, Rhizoctonia solani, Acremonium
strictum, Sclerophthona macrospora, Peronosclerospora sorghi, Peronosclerospora philippinensis,
Sclerospora graminicola, Fusarium graminearum, Fusarium Oxysporum, Pythium arrhenomanes,
Pythium graminicola, etc.
[0205] ALFALFA: Clavibater michiganensis subsp. Insidiosum, Pythium ultimum, Pythium
irregulare, Pythium splendens, Pythium debaryanum, Pythium aphanidermatum, Phytophthora
megasperma, Peronospora trifoliorum, Phoma medicaginis var. medicaginis, Cercospora medicaginis,
Pseudopeziza medicaginis, Leptotrochila medicaginis, Fusarium oxysporum, Rhizoctonia solani,
Uromyces striatus, Colletotrichum trifolii race 1 and race 2, Leptosphaerulina briosiana, Stemphylium
botryosum, Stagonospora meliloti, Sclerotinia trifoliorum, Alfalfa Mosaic Virus, Verticillium alboatrum, Xanthomonas campestris p.v. alfalfae, Aphanomyces euteiches, Stemphylium herbarum,
Stemphylium alfalfae.
VI. Controlling Gene Expression in Transgenic Plants
[0206] The invention further relates to transformed cells comprising the nucleic acid molecules,
transformed plants, seeds, and plant parts, and methods of modifying phenotypic traits of interest by
altering the expression of the genes of the invention.
A. Modification of Coding Sequences and Adjacent Sequences
[0207] The transgenic expression in plants of genes derived from heterologous sources may involve
the modification of those genes to achieve and optimize their expression in plants. In particular,
bacterial ORFs which encode separate enzymes but which are encoded by the same transcript in the
native microbe are best expressed in plants on separate transcripts. To achieve this, each microbial
197/503
ORF is isolated individually and cloned within a cassette which provides a plant promoter sequence at
the 5' end of the ORF and a plant transcriptional terminator at the 3' end of the ORF. The isolated ORF
sequence preferably includes the initiating ATG codon and the terminating STOP codon but may
include additional sequence beyond the initiating ATG and the STOP codon. In addition, the ORF may
be truncated, but still retain the required activity; for particularly long ORFs, truncated versions which
retain activity may be preferable for expression in transgenic organisms. By "plant promoter" and
"plant transcriptional terminator" it is intended to mean promoters and transcriptional terminators
which operate within plant cells. This includes promoters and transcription terminators which may be
derived from non-plant sources such as viruses (an example is the Cauliflower Mosaic Virus).
[0208] In some cases, modification to the ORF coding sequences and adjacent sequence is not
required. It is sufficient to isolate a fragment containing the ORF of interest and to insert it downstream
of a plant promoter. For example, Gaffney et al. (Science 261: 754-756 (1993)) have expressed the
Pseudomonas nahG gene in transgenic plants under the control of the CaMV 35S promoter and the
CaMV tml terminator successfully without modification of the coding sequence and with nucleotides
of the Pseudomonas gene upstream of the ATG still attached, and nucleotides downstream of the STOP
codon still attached to the nahG ORF. Preferably as little adjacent microbial sequence should be left
attached upstream of the ATG and downstream of the STOP codon. In practice, such construction may
depend on the availability of restriction sites.
[0209] In other cases, the expression of genes derived from microbial sources may provide problems
in expression. These problems have been well characterized in the art and are particularly common
with genes derived from certain sources such as Bacillus. These problems may apply to the nucleotide
sequence of this invention and the modification of these genes can be undertaken using techniques now
well known in the art. The following problems may be encountered:
[0210] 1. Codon Usage.
[0211] The preferred codon usage in plants differs from the preferred codon usage in certain
microorganisms. Comparison of the usage of codons within a cloned microbial ORF to usage in plant
genes (and in particular genes from the target plant) will enable an identification of the codons within
the ORF which should preferably be changed. Typically plant evolution has tended towards a strong
preference of the nucleotides C and G in the third base position of monocotyledons, whereas
dicotyledons often use the nucleotides A or T at this position. By modifying a gene to incorporate
preferred codon usage for a particular target transgenic species, many of the problems described below
for GC/AT content and illegitimate splicing will be overcome.
[0212] 2. GC/AT Content.
[0213] Plant genes typically have a GC content of more than 35%. ORF sequences which are rich in
A and T nucleotides can cause several problems in plants. Firstly, motifs of ATTTA are believed to
cause destabilization of messages and are found at the 3' end of many short-lived mRNAs. Secondly,
the occurrence of polyadenylation signals such as AATAAA at inappropriate positions within the
message is believed to cause premature truncation of transcription. In addition, monocotyledons may
recognize AT-rich sequences as splice sites (see below).
[0214] 3. Sequences Adjacent to the Initiating Methionine.
[0215] Plants differ from microorganisms in that their messages do not possess a defined ribosome
binding site. Rather, it is believed that ribosomes attach to the 5' end of the message and scan for the
first available ATG at which to start translation. Nevertheless, it is believed that there is a preference
for certain nucleotides adjacent to the ATG and that expression of microbial genes can be enhanced by
the inclusion of a eukaryotic consensus translation initiator at the ATG. Clontech (1993/1994 catalog,
page 210, incorporated herein by reference) have suggested one sequence as a consensus translation
initiator for the expression of the E. coli uidA gene in plants. Further, Joshi (N.A.R. 15: 6643-6653
(1987), incorporated herein by reference) has compared many plant sequences adjacent to the ATG and
suggests another consensus sequence. In situations where difficulties are encountered in the expression
of microbial ORFs in plants, inclusion of one of these sequences at the initiating ATG may improve
translation. In such cases the last three nucleotides of the consensus may not be appropriate for
inclusion in the modified sequence due to their modification of the second AA residue. Preferred
sequences adjacent to the initiating methionine may differ between different plant species. A survey of
14 maize genes located in the GenBank database provided the following results:
>;tb;Position Before the Initiating ATG in 14 Maize Genes:
>;tb;>;sep;-10>;sep;-9>;sep;-8>;sep;-7>;sep;-6>;sep;-5>;sep;-4>;sep;-3>;sep;-2>;sep;-1
>;tb;C>;sep;3>;sep;8>;sep;4>;sep;6>;sep;2>;sep;5>;sep;6>;sep;0>;sep;10 >;sep;7
>;tb;T>;sep;3>;sep;0>;sep;3>;sep;4>;sep;3>;sep;2>;sep;1>;sep;1>;sep;1>;sep;0
>;tb;A>;sep;2>;sep;3>;sep;1>;sep;4>;sep;3>;sep;2>;sep;3>;sep;7>;sep;2>;sep;3
198/503
>;tb;G>;sep;6>;sep;3>;sep;6>;sep;0>;sep;6>;sep;5>;sep;4>;sep;6>;sep;1>;sep;5 This analysis can be
done for the desired plant species into which the nucleotide sequence is being incorporated, and the
sequence adjacent to the ATG modified to incorporate the preferred nucleotides.
[0217] 4. Removal of Illegitimate Splice Sites.
[0218] Genes cloned from non-plant sources and not optimized for expression in plants may also
contain motifs which may be recognized in plants as 5' or 3' splice sites, and be cleaved, thus
generating truncated or deleted messages. These sites can be removed using the techniques well known
in the art.
[0219] Techniques for the modification of coding sequences and adjacent sequences are well known
in the art. In cases where the initial expression of a microbial ORF is low and it is deemed appropriate
to make alterations to the sequence as described above, then the construction of synthetic genes can be
accomplished according to methods well known in the art. These are, for example, described in the
published patent disclosures EP 0 385 962 (to Monsanto), EP 0 359 472 (to Lubrizol) and WO
93/07278 (to Ciba-Geigy), all of which are incorporated herein by reference. In most cases it is
preferable to assay the expression of gene constructions using transient assay protocols (which are well
known in the art) prior to their transfer to transgenic plants.
B. Construction of Plant Expression Cassettes
[0220] Coding sequences intended for expression in transgenic plants are first assembled in
expression cassettes behind a suitable promoter expressible in plants. The expression cassettes may
also comprise any further sequences required or selected for the expression of the transgene. Such
sequences include, but are not restricted to, transcription terminators, extraneous sequences to enhance
expression such as introns, vital sequences, and sequences intended for the targeting of the gene
product to specific organelles and cell compartments. These expression cassettes can then be easily
transferred to the plant transformation vectors described below. The following is a description of
various components of typical expression cassettes.
[0221] 1. Promoters
[0222] The selection of the promoter used in expression cassettes will determine the spatial and
temporal expression pattern of the transgene in the transgenic plant. Selected promoters will express
transgenes in specific cell types (such as leaf epidermal cells, mesophyll cells, root cortex cells) or in
specific tissues or organs (roots, leaves or flowers, for example) and the selection will reflect the
desired location of accumulation of the gene product. Alternatively, the selected promoter may drive
expression of the gene under various inducing conditions. Promoters vary in their strength, i.e., ability
to promote transcription. Depending upon the host cell system utilized, any one of a number of suitable
promoters can be used, including the gene's native promoter. The following are non-limiting examples
of promoters that may be used in expression cassettes.
[0223] a. Constitutive Expression, the Ubiquitin Promoter:
[0224] Ubiquitin is a gene product known to accumulate in many cell types and its promoter has
been cloned from several species for use in transgenic plants (e.g. sunflower-Binet et al. Plant Science
79: 87-94 (1991); maize-Christensen et al. Plant Molec. Biol. 12: 619-632 (1989); and ArabidopsisCallis et al., J. Biol. Chem. 265: 12486-12493 (1990) and Norris et al., Plant Mol. Biol. 21: 895-906
(1993)). The maize ubiquitin promoter has been developed in transgenic monocot systems and its
sequence and vectors constructed for monocot transformation are disclosed in the patent publication EP
0 342 926 (to Lubrizol) which is herein incorporated by reference. Taylor et al. (Plant Cell Rep. 12:
491495 (1993)) describe a vector (pAHC25) that comprises the maize ubiquitin promoter and first
intron and its high activity in cell suspensions of numerous monocotyledons when introduced via
microprojectile bombardment. The Arabidopsis ubiquitin promoter is ideal for use with the nucleotide
sequences of the present invention. The ubiquitin promoter is suitable for gene expression in transgenic
plants, both monocotyledons and dicotyledons. Suitable vectors are derivatives of pAHC25 or any of
the transformation vectors described in this application, modified by the introduction of the appropriate
ubiquitin promoter and/or intron sequences.
[0225] b. Constitutive Expression, the CaMV 35S Promoter:
[0226] Construction of the plasmid pCGN1761 is described in the published patent application EP 0
392 225 (Example 23), which is hereby incorporated by reference. pCGN1761 contains the "double"
CaMV 35S promoter and the tml transcriptional terminator with a unique EcoRI site between the
promoter and the terminator and has a pUC-type backbone. A derivative of pCGN1761 is constructed
which has a modified polylinker which includes Notl and XhoI sites in addition to the existing EcoRI
site. This derivative is designated pCGN1761ENX. pCGN1761ENX is useful for the cloning of cDNA
sequences or coding sequences (including microbial ORF sequences) within its polylinker for the
199/503
purpose of their expression under the control of the 35S promoter in transgenic plants. The entire 35S
promoter-coding sequence-tml terminator cassette of such a construction can be excised by HindIII,
SphI, SalI, and Xbal sites 5' to the promoter and Xbal, BamHI and BglI sites 3') to the terminator for
transfer to transformation vectors such as those described below. Furthermore, the double 35S
promoter fragment can be removed by 5' excision with HindIII, SphI, SalI, Xbal, or Pstl, and 3'
excision with any of the polylinker restriction sites (EcoRI, Notl or XhoI) for replacement with another
promoter. If desired, modifications around the cloning sites can be made by the introduction of
sequences that may enhance translation. This is particularly useful when overexpression is desired. For
example, pCGN1761ENX may be modified by optimization of the translational initiation site as
described in Example 37 of U.S. Pat. No. 5,639,949, incorporated herein by reference.
[0227] c. Constitutive Expression, the Actin Promoter:
[0228] Several isoforms of actin are known to be expressed in most cell types and consequently the
actin promoter is a good choice for a constitutive promoter. In particular, the promoter from the rice
Actl gene has been cloned and characterized (McElroy et al. Plant Cell 2: 163-171 (1990)). A 1.3 kb
fragment of the promoter was found to contain all the regulatory elements required for expression in
rice protoplasts. Furthermore, numerous expression vectors based on the Actl promoter have been
constructed specifically for use in monocotyledons (McElroy et al. Mol. Gen. Genet. 231: 150-160
(1991)). These incorporate the Actl-intron 1, Adhl 5' flanking sequence and Adhl-intron 1 (from the
maize alcohol dehydrogenase gene) and sequence from the CaMV 35S promoter. Vectors showing
highest expression were fusions of 35S and Actl intron or the Actl 5' flanking sequence and the Actl
intron. Optimization of sequences around the initiating ATG (of the GUS reporter gene) also enhanced
expression. The promoter expression cassettes described by McElroy et al. (Mol. Gen. Genet. 231: 150160 (1991)) can be easily modified for gene expression and are particularly suitable for use in
monocotyledonous hosts. For example, promoter-containing fragments is removed from the McElroy
constructions and used to replace the double 35S promoter in pCGN1761ENX, which is then available
for the insertion of specific gene sequences. The fusion genes thus constructed can then be transferred
to appropriate transformation vectors. In a separate report, the rice Actl promoter with its first intron
has also been found to direct high expression in cultured barley cells (Chibbar et al. Plant Cell Rep. 12:
506-509 (1993)).
[0229] d. Inducible Expression, PR-1 Promoters:
[0230] The double 35S promoter in pCGN1761 ENX may be replaced with any other promoter of
choice that will result in suitably high expression levels. By way of example, one of the chemically
regulatable promoters described in U.S. Pat. No. 5,614,395, such as the tobacco PR-1 promoter, may
replace the double 35S promoter. Alternately, the Arabidopsis PR-1 promoter described in Lebel et al.,
Plant J. 16: 223-233 (1998) may be used. The promoter of choice is preferably excised from its source
by restriction enzymes, but can alternatively be PCR-amplified using primers that carry appropriate
terminal restriction sites. Should PCR-amplification be undertaken, then the promoter should be resequenced to check for amplification errors after the cloning of the amplified promoter in the target
vector. The chemically/pathogen regulatable tobacco PR-1a promoter is cleaved from plasmid
pCIB1004 (for construction, see example 21 of EP 0332 104, which is hereby incorporated by
reference) and transferred to plasmid pCGN1761ENX (Uknes et al., Plant Cell 4: 645-656 (1992)).
pCIB1004 is cleaved with Ncol and the resultant 3' overhang of the linearized fragment is rendered
blunt by treatment with T4 DNA polymerase. The fragment is then cleaved with HindIII and the
resultant PR-1a promoter-containing fragment is gel purified and cloned into pCGN1761ENX from
which the double 35S promoter has been removed. This is done by cleavage with XhoI and blunting
with T4 polymerase, followed by cleavage with HindIII and isolation of the larger vector-terminator
containing fragment into which the pCIB1004 promoter fragment is cloned. This generates a
pCGN1761ENX derivative with the PR-1a promoter and the tml terminator and an intervening
polylinker with unique EcoRI and Notl sites. The selected coding sequence can be inserted into this
vector, and the fusion products (i.e. promoter-gene-terminator) can subsequently be transferred to any
selected transformation vector, including those described infra. Various chemical regulators may be
employed to induce expression of the selected coding sequence in the plants transformed according to
the present invention, including the benzothiadiazole, isonicotinic acid, and salicylic acid compounds
disclosed in U.S. Pat. Nos. 5,523,311 and 5,614,395.
[0231] e. Inducible Expression, an Ethanol-Inducible Promoter:
[0232] A promoter inducible by certain alcohols or ketones, such as ethanol, may also be used to
confer inducible expression of a coding sequence of the present invention. Such a promoter is for
example the alcA gene promoter from Aspergillus nidulans (Caddick et al. (1998) Nat. Biotechnol
16:177-180). In A. nidulans, the alcA gene encodes alcohol dehydrogenase 1, the expression of which
200/503
is regulated by the AlcR transcription factors in presence of the chemical inducer. For the purposes of
the present invention, the CAT coding sequences in plasmid palcA:CAT comprising a alcA gene
promoter sequence fused to a minimal 35S promoter (Caddick et al. (1998) Nat. Biotechnol 16:177180) are replaced by a coding sequence of the present invention to form an expression cassette having
the coding sequence under the control of the alcA gene promoter. This is carried out using methods
well known in the art.
[0233] f. Inducible Expression, a Glucocorticoid-lnducible Promoter:
[0234] Induction of expression of a nucleic acid sequence of the present invention using systems
based on steroid hormones is also contemplated. For example, a glucocorticoid-mediated induction
system is used (Aoyama and Chua (1997) The Plant Journal 11: 605-612) and gene expression is
induced by application of a glucocorticoid, for example a synthetic glucocorticoid, preferably
dexamethasone, preferably at a concentration ranging from 0.1 mM to 1 mM, more preferably from 10
mM to 100 mM. For the purposes of the present invention, the luciferase gene sequences are replaced
by a nucleic acid sequence of the invention to form an expression cassette having a nucleic acid
sequence of the invention under the control of six copies of the GAL4 upstream activating sequences
fused to the 35S minimal promoter. This is carried out using methods well known in the art. The transacting factor comprises the GAL4 DNA-binding domain (Keegan et al. (1986) Science 231: 699-704)
fused to the transactivating domain of the herpes viral protein VP16 (Triezenberg et al. (1988) Genes
Devel. 2: 718-729) fused to the hormone-binding domain of the rat glucocorticoid receptor (Picard et
al. (1988) Cell 54: 1073-1080). The expression of the fusion protein is controlled by any promoter
suitable for expression in plants known in the art or described here. This expression cassette is also
comprised in the plant comprising a nucleic acid sequence of the invention fused to the
6*GAL4/minimal promoter. Thus, tissue- or organ-specificity of the fusion protein is achieved leading
to inducible tissue- or organ-specificity of the insecticidal toxin.
[0235] g. Root Specific Expression:
[0236] Another pattern of gene expression is root expression. A suitable root promoter is the
promoter of the maize metallothionein-like (MTL) gene described by de Framond (FEBS 290: 103-106
(1991)) and also in U.S. Pat. No. 5,466,785, incorporated herein by reference. This "MTL" promoter is
transferred to a suitable vector such as pCGN1761ENX for the insertion of a selected gene and
subsequent transfer of the entire promoter-gene-terminator cassette to a transformation vector of
interest.
[0237] h. Wound-Inducible Promoters:
[0238] Wound-inducible promoters may also be suitable for gene expression. Numerous such
promoters have been described (e.g. Xu et al. Plant Molec. Biol. 22: 573-588 (1993), Logemann et al.
Plant Cell 1: 151-158 (1989), Rohrmeier & Lehle, Plant Molec. Biol. 22: 783-792 (1993), Firek et al.
Plant Molec. Biol. 22: 129-142 (1993), Warner et al. Plant J. 3: 191-201 (1993)) and all are suitable for
use with the instant invention. Logemann et al. describe the 5' upstream sequences of the
dicotyledonous potato wunl gene. Xu et al. show that a wound-inducible promoter from the
dicotyledon potato (pin2) is active in the monocotyledon rice. Further, Rohrmeier & Lehle describe the
cloning of the maize Wipl cDNA which is wound induced and which can be used to isolate the cognate
promoter using standard techniques. Similar, Firek et al. and Warner et al. have described a woundinduced gene from the monocotyledon Asparagus officinalis, which is expressed at local wound and
pathogen invasion sites. Using cloning techniques well known in the art, these promoters can be
transferred to suitable vectors, fused to the genes pertaining to this invention, and used to express these
genes at the sites of plant wounding.
[0239] i. Pith-Preferred Expression:
[0240] Patent Application WO 93/07278, which is herein incorporated by reference, describes the
isolation of the maize trpA gene, which is preferentially expressed in pith cells. The gene sequence and
promoter extending up to -1726 bp from the start of transcription are presented. Using standard
molecular biological techniques, this promoter, or parts thereof, can be transferred to a vector such as
pCGN1761 where it can replace the 35S promoter and be used to drive the expression of a foreign gene
in a pith-preferred manner. In fact, fragments containing the pith-preferred promoter or parts thereof
can be transferred to any vector and modified for utility in transgenic plants.
[0241] j. Leaf-Specific Expression:
[0242] A maize gene encoding phosphoenol carboxylase (PEPC) has been described by Hudspeth &
Grula (Plant Molec Biol 12: 579-589 (1989)). Using standard molecular biological techniques the
promoter for this gene can be used to drive the expression of any gene in a leaf-specific manner in
transgenic plants.
[0243] k. Pollen-Specific Expression:
201/503
[0244] WO 93/07278 describes the isolation of the maize calcium-dependent protein kinase (CDPK)
gene which is expressed in pollen cells. The gene sequence and promoter extend up to 1400 bp from
the start of transcription. Using standard molecular biological techniques, this promoter or parts
thereof, can be transferred to a vector such as pCGN1761 where it can replace the 35S promoter and be
used to drive the expression of a nucleic acid sequence of the invention in a pollen-specific manner.
[0245] 2. Transcriptional Terminators
[0246] A variety of transcriptional terminators are available for use in expression cassettes. These
are responsible for the termination of transcription beyond the transgene and correct mRNA
polyadenylation. Appropriate transcriptional terminators are those that are known to function in plants
and include the CaMV 35S terminator, the tml terminator, the nopaline synthase terminator and the pea
rbcS E9 terminator. These can be used in both monocotyledons and dicotyledons. In addition, a gene's
native transcription terminator may be used.
[0247] 3. Sequences for the Enhancement or Regulation of Expression
[0248] Numerous sequences have been found to enhance gene expression from within the
transcriptional unit and these sequences can be used in conjunction with the genes of this invention to
increase their expression in transgenic plants.
[0249] Various intron sequences have been shown to enhance expression, particularly in
monocotyledonous cells. For example, the introns of the maize Adhl gene have been found to
significantly enhance the expression of the wild-type gene under its cognate promoter when introduced
into maize cells. Intron 1 was found to be particularly effective and enhanced expression in fusion
constructs with the chloramphenicol acetyltransferase gene (Callis et al., Genes Develop. 1: 1183-1200
(1987)). In the same experimental system, the intron from the maize bronze1 gene had a similar effect
in enhancing expression. Intron sequences have been routinely incorporated into plant transformation
vectors, typically within the non-translated leader.
[0250] A number of non-translated leader sequences derived from viruses are also known to enhance
expression, and these are particularly effective in dicotyledonous cells. Specifically, leader sequences
from Tobacco Mosaic Virus (TMV, the "W-sequence"), Maize Chlorotic Mottle Virus (MCMV), and
Alfalfa Mosaic Virus (AMV) have been shown to be effective in enhancing expression (e.g. Gallie et
al. Nucl. Acids Res. 15: 8693-8711 (1987); Skuzeski et al. Plant Molec. Biol. 15: 65-79 (1990)). Other
leader sequences known in the art include but are not limited to: picornavirus leaders, for example,
EMCV leader (Encephalomyocarditis 5' noncoding region) (Elroy-Stein, O., Fuerst, T. R., and Moss,
B. PNAS USA 86:6126-6130 (1989)); potyvirus leaders, for example, TEV leader (Tobacco Etch
Virus) (Allison et al., 1986); MDMV leader (Maize Dwarf Mosaic Virus); Virology 154:9-20); human
immunoglobulin heavy-chain binding protein (BiP) leader, (Macejak, D. G., and Sarnow, P., Nature
353: 90-94 (1991); untranslated leader from the coat protein mRNA of alfalfa mosaic virus (AMV
RNA 4), (Jobling, S. A., and Gehrke, L., Nature 325:622-625 (1987); tobacco mosaic virus leader
(TMV), (Gallie, D. R. et al., Molecular Biology of RNA, pages 237-256 (1989); and Maize Chlorotic
Mottle Virus leader (MCMV) (Lommel, S. A. et al., Virology 81:382-385 (1991). See also, DellaCioppa et al., Plant Physiology 84:965-968 (1987).
[0251] In addition to incorporating one or more of the aforementioned elements into the 5' regulatory
region of a target expression cassette of the invention, other elements peculiar to the target expression
cassette may also be incorporated. Such elements include but are not limited to a minimal promoter. By
minimal promoter it is intended that the basal promoter elements are inactive or nearly so without
upstream activation. Such a promoter has low background activity in plants when there is no
transactivator present or when enhancer or response element binding sites are absent. One minimal
promoter that is particularly useful for target genes in plants is the Bz1 minimal promoter, which is
obtained from the bronze1 gene of maize. The Bz1 core promoter is obtained from the "myc" mutant
Bz1-luciferase construct pBz1LucR98 via cleavage at the Nhel site located at -53 to -58. Roth et al.,
Plant Cell 3: 317 (1991). The derived Bz1 core promoter fragment thus extends from -53 to +227 and
includes the Bz1 intron-1 in the 5' untranslated region. Also useful for the invention is a minimal
promoter created by use of a synthetic TATA element. The TATA element allows recognition of the
promoter by RNA polymerase factors and confers a basal level of gene expression in the absence of
activation (see generally, Mukumoto (1993) Plant Mol Biol 23: 995-1003; Green (2000) Trends
Biochem Sci 25: 59-63)
[0252] 4. Targeting of the Gene Product Within the Cell
[0253] Various mechanisms for targeting gene products are known to exist in plants and the
sequences controlling the functioning of these mechanisms have been characterized in some detail. For
example, the targeting of gene products to the chloroplast is controlled by a signal sequence found at
the amino terminal end of various proteins which is cleaved during chloroplast import to yield the
202/503
mature protein (e.g. Comai et al. J. Biol. Chem. 263: 15104-15109 (1988)). These signal sequences can
be fused to heterologous gene products to effect the import of heterologous products into the
chloroplast (van den Broeck, et al. Nature 313: 358-363 (1985)). DNA encoding for appropriate signal
sequences can be isolated from the 5' end of the cDNAs encoding the RUBISCO protein, the CAB
protein, the EPSP synthase enzyme, the GS2 protein and many other proteins which are known to be
chloroplast localized. See also, the section entitled "Expression With Chloroplast Targeting" in
Example 37 of U.S. Pat. No. 5,639,949.
[0254] Other gene products are localized to other organelles such as the mitochondrion and the
peroxisome (e.g. Unger et al. Plant Molec. Biol. 13: 411-418 (1989)). The cDNAs encoding these
products can also be manipulated to effect the targeting of heterologous gene products to these
organelles. Examples of such sequences are the nuclear-encoded ATPases and specific aspartate amino
transferase isoforms for mitochondria. Targeting cellular protein bodies has been described by Rogers
et al. (Proc. Natl. Acad. Sci. USA 82: 6512-6516 (1985)).
[0255] In addition, sequences have been characterized which cause the targeting of gene products to
other cell compartments. Amino terminal sequences are responsible for targeting to the ER, the
apoplast, and extracellular secretion from aleurone cells (Koehler & Ho, Plant Cell 2: 769-783 (1990)).
Additionally, amino terminal sequences in conjunction with carboxy terminal sequences are
responsible for vacuolar targeting of gene products (Shinshi et al. Plant Molec. Biol. 14: 357-368
(1990)).
[0256] By the fusion of the appropriate targeting sequences described above to transgene sequences
of interest it is possible to direct the transgene product to any organelle or cell compartment. For
chloroplast targeting, for example, the chloroplast signal sequence from the RUBISCO gene, the CAB
gene, the EPSP synthase gene, or the GS2 gene is fused in frame to the amino terminal ATG of the
transgene. The signal sequence selected should include the known cleavage site, and the fusion
constructed should take into account any amino acids after the cleavage site which are required for
cleavage. In some cases this requirement may be fulfilled by the addition of a small number of amino
acids between the cleavage site and the transgene ATG or, alternatively, replacement of some amino
acids within the transgene sequence. Fusions constructed for chloroplast import can be tested for
efficacy of chloroplast uptake by in vitro translation of in vitro transcribed constructions followed by in
vitro chloroplast uptake using techniques described by Bartlett et al. In: Edelmann et al. (Eds.) Methods
in Chloroplast Molecular Biology, Elsevier pp 1081-1091 (1982) and Wasmann et al. Mol. Gen. Genet.
205: 446-453 (1986). These construction techniques are well known in the art and are equally
applicable to mitochondria and peroxisomes.
[0257] The above-described mechanisms for cellular targeting can be utilized not only in
conjunction with their cognate promoters, but also in conjunction with heterologous promoters so as to
effect a specific cell-targeting goal under the transcriptional regulation of a promoter that has an
expression pattern different to that of the promoter from which the targeting signal derives.
C. Construction of Plant Transformation Vectors
[0258] Numerous transformation vectors available for plant transformation are known to those of
ordinary skill in the plant transformation arts, and the genes pertinent to this invention can be used in
conjunction with any such vectors. The selection of vector will depend upon the preferred
transformation technique and the target species for transformation. For certain target species, different
antibiotic or herbicide selection markers may be preferred. Selection markers used routinely in
transformation include the nptll gene, which confers resistance to kanamycin and related antibiotics
(Messing & Vierra. Gene 19: 259-268 (1982); Bevan et al., Nature 304:184-187 (1983)), the bar gene,
which confers resistance to the herbicide phosphinothricin (White et al., Nucl. Acids Res 18: 1062
(1990), Spencer et al. Theor. Appl. Genet 79: 625-631 (1990)), the hph gene, which confers resistance
to the antibiotic hygromycin (Blochinger & Diggelmann, Mol Cell Biol 4: 2929-2931), and the dhfr
gene, which confers resistance to methatrexate (Bourouis et al., EMBO J. 2(7): 1099-1104 (1983)), the
EPSPS gene, which confers resistance to glyphosate (U.S. Pat. Nos. 4,940,935 and 5,188,642), and the
mannose-6-phosphate isomerase gene, which provides the ability to metabolize mannose (U.S. Pat.
Nos. 5,767,378 and 5,994,629).
[0259] 1. Vectors Suitable for Agrobacterium Transformation
[0260] Many vectors are available for transformation using Agrobacterium tumefaciens. These
typically carry at least one T-DNA border sequence and include vectors such as pBIN19 (Bevan, Nucl.
Acids Res. (1984)). Below, the construction of two typical vectors suitable for Agrobacterium
transformation is described.
[0261] a. pCIB200 and pCIB2001:
203/503
[0262] The binary vectors pCIB200 and pCIB2001 are used for the construction of recombinant
vectors for use with Agrobacterium and are constructed in the following manner. pTJS75kan is created
by Narl digestion of pTJS75 (Schmidhauser & Helinski, J. Bacteriol. 164: 446-455 (1985)) allowing
excision of the tetracycline-resistance gene, followed by insertion of an Accl fragment from pUC4K
carrying an NPTII (Messing & Vierra, Gene 19: 259-268 (1982): Bevan et al., Nature 304: 184-187
(1983): McBride et al., Plant Molecular Biology 14: 266-276 (1990)). XhoI linkers are ligated to the
EcoRV fragment of PCIB7 which contains the left and right T-DNA borders, a plant selectable
nos/nptlI chimeric gene and the pUC polylinker (Rothstein et al., Gene 53: 153-161 (1987)), and the
XhoI-digested fragment are cloned into SalI-digested pTJS75kan to create pCIB200 (see also EP 0 332
104, example 19). pCIB200 contains the following unique polylinker restriction sites: EcoRI, SstI,
KpnI, BgmlI, Xbal, and SalI. pCIB2001 is a derivative of pCIB200 created by the insertion into the
polylinker of additional restriction sites. Unique restriction sites in the polylinker of pCIB2001 are
EcoRI, SstI, KpnI, BglII, Xbal, SalI, MluI, BclI, AvrlI, ApaI, HpaI, and StuI. pCIB2001, in addition to
containing these unique restriction sites also has plant and bacterial kanamycin selection, left and right
T-DNA borders for Agrobacterium-mediated transformation, the RK2-derived trfA function for
mobilization between E. coli and other hosts, and the OriT and OriV functions also from RK2. The
pCIB2001 polylinker is suitable for the cloning of plant expression cassettes containing their own
regulatory signals.
[0263] b. pCIB10 and Hygromycin Selection Derivatives Thereof:
[0264] The binary vector pCIB10 contains a gene encoding kanamycin resistance for selection in
plants and T-DNA right and left border sequences and incorporates sequences from the wide hostrange plasmid pRK252 allowing it to replicate in both E. coli and Agrobacterium. Its construction is
described by Rothstein et at (Gene 53: 153-161 (1987)). Various derivatives of pCIB10 are constructed
which incorporate the gene for hygromycin B phosphotransferase described by Gritz et al. (Gene 25:
179-188 (1983)). These derivatives enable selection of transgenic plant cells on hygromycin only
(pCIB743), or hygromycin and kanamycin (pCIB715, pCIB717).
[0265] 2. Vectors Suitable for Non-Agrobacterium Transformation
[0266] Transformation without the use of Agrobacterium tumefaciens circumvents the requirement
for T-DNA sequences in the chosen transformation vector and consequently vectors lacking these
sequences can be utilized in addition to vectors such as the ones described above which contain TDNA sequences. Transformation techniques that do not rely on Agrobacterium include transformation
via particle bombardment, protoplast uptake (e.g. PEG and electroporation) and microinjection. The
choice of vector depends largely on the preferred selection for the species being transformed. Below,
the construction of typical vectors suitable for non-Agrobacterium transformation is described.
[0267] a. pCIB3064:
[0268] pCIB3064 is a pUC-derived vector suitable for direct gene transfer techniques in combination
with selection by the herbicide basta (or phosphinothricin). The plasmid pCIB246 comprises the CaMV
35S promoter in operational fuson to the E. coli GUS gene and the CaMV 35S transcriptional
terminator and is described in the PCT published application WO 93/07278. The 35S promoter of this
vector contains two ATG sequences 5' of the start site. These sites are mutated using standard PCR
techniques in such a way as to remove the ATGs and generate the restriction sites SspI and PvulI. The
new restriction sites are 96 and 37 bp away from the unique SalI site and 101 and 42 bp away from the
actual start site. The resultant derivative of pCIB246 is designated pCIB3025. The GUS gene is then
excised from pCIB3025 by digestion with SalI and SacI, the termini rendered blunt and religated to
generate plasmid pCIB3060. The plasmid pJIT82 is obtained from the John Innes Centre, Norwich and
the a 400 bp SmaI fragment containing the bar gene from Streptomyces vifidochromogenes is excised
and inserted into the HpaI site of pCIB3060 (Thompson et al. EMBO J 6: 2519-2523 (1987)). This
generated pCIB3064, which comprises the bar gene under the control of the CaMV 35S promoter and
terminator for herbicide selection, a gene for ampicillin resistance (for selection in E. coli) and a
polylinker with the unique sites SphI, Pstl, HindIII, and BamHI. This vector is suitable for the cloning
of plant expression cassettes containing their own regulatory signals.
[0269] b. pSOG19 and pSOG35:
[0270] pSOG35 is a transformation vector that utilizes the E. coli gene dihydrofolate reductase
(DFR) as a selectable marker conferring resistance to methotrexate. PCR is used to amplify the 35S
promoter (-800 bp), intron 6 from the maize Adh1 gene (-550 bp) and 18 bp of the GUS untranslated
leader sequence from pSOG10. A 250-bp fragment encoding the E. coli dihydrofolate reductase type II
gene is also amplified by PCR and these two PCR fragments are assembled with a SacI-Pstl fragment
from pB1221 (Clontech) which comprises the pUC19 vector backbone and the nopaline synthase
terminator. Assembly of these fragments generates pSOG19 which contains the 35S promoter in fusion
204/503
with the intron 6 sequence, the GUS leader, the DHFR gene and the nopaline synthase terminator.
Replacement of the GUS leader in pSOG19 with the leader sequence from Maize Chlorotic Mottle
Virus (MCMV) generates the vector pSOG35. pSOG19 and pSOG35 carry the pUC gene for ampicillin
resistance and have HindIII, SphI, Pstl and EcoRI sites available for the cloning of foreign substances.
[0271] 3. Vector Suitable for Chloroplast Transformation
[0272] For expression of a nucleotide sequence of the present invention in plant plastids, plastid
transformation vector pPH143 (WO 97/32011, example 36) is used. The nucleotide sequence is
inserted into pPH143 thereby replacing the PROTOX coding sequence. This vector is then used for
plastid transformation and selection of transformants for spectinomycin resistance. Alternatively, the
nucleotide sequence is inserted in pPH143 so that it replaces the aadH gene. In this case, transformants
are selected for resistance to PROTOX inhibitors.
D. Transformation
[0273] Once a nucleic acid sequence of the invention has been cloned into an expression system, it is
transformed into a plant cell. The receptor and target expression cassettes of the present invention can
be introduced into the plant cell in a number of art-recognized ways. Methods for regeneration of plants
are also well known in the art. For example, Ti plasmid vectors have been utilized for the delivery of
foreign DNA, as well as direct DNA uptake, liposomes, electroporation, microinjection, and
microprojectiles. In addition, bacteria from the genus Agrobacterium can be utilized to transform plant
cells. Below are descriptions of representative techniques for transforming both dicotyledonous and
monocotyledonous plants, as well as a representative plastid transformation technique.
[0274] 1. Transformation of Dicotyledons
[0275] Transformation techniques for dicotyledons are well known in the art and include
Agrobacterium-based techniques and techniques that do not require Agrobacterium. NonAgrobacterium techniques involve the uptake of exogenous genetic material directly by protoplasts or
cells. This can be accomplished by PEG or electroporation mediated uptake, particle bombardmentmediated delivery, or microinjection. Examples of these techniques are described by Paszkowski et al.,
EMBO J 3: 2717-2722 (1984), Potrykus et al., Mol. Gen. Genet. 199: 169-177 (1985), Reich et al.,
Biotechnology 4: 1001-1004 (1986), and Klein et al., Nature 327: 70-73 (1987). In each case the
transformed cells are regenerated to whole plants using standard techniques known in the art.
[0276] Agrobacterium-mediated transformation is a preferred technique for transformation of
dicotyledons because of its high efficiency of transformation and its broad utility with many different
species. Agrobacterium transformation typically involves the transfer of the binary vector carrying the
foreign DNA of interest (e.g. pCIB200 or pCIB2001) to an appropriate Agrobacterium strain which
may depend of the complement of vir genes carried by the host Agrobacterium strain either on a coresident Ti plasmid or chromosomally (e.g. strain CIB542 for pCIB200 and pCIB2001 (Uknes et al.
Plant Cell 5: 159-169 (1993)). The transfer of the recombinant binary vector to Agrobacterium is
accomplished by a triparental mating procedure using E. coli carrying the recombinant binary vector, a
helper E. coli strain which carries a plasmid such as pRK2013 and which is able to mobilize the
recombinant binary vector to the target Agrobacterium strain. Alternatively, the recombinant binary
vector can be transferred to Agrobacterium by DNA transformation (Höfgen & Willmitzer, Nucl. Acids
Res. 16: 9877 (1988)).
[0277] Transformation of the target plant species by recombinant Agrobacterium usually involves
co-cultivation of the Agrobacterium with explants from the plant and follows protocols well known in
the art. Transformed tissue is regenerated on selectable medium carrying the antibiotic or herbicide
resistance marker present between the binary plasmid T-DNA borders.
[0278] Another approach to transforming plant cells with a gene involves propelling inert or
biologically active particles at plant tissues and cells. This technique is disclosed in U.S. Pat. Nos.
4,945,050, 5,036,006, and 5,100,792 all to Sanford et al. Generally, this procedure involves propelling
inert or biologically active particles at the cells under conditions effective to penetrate the outer surface
of the cell and afford incorporation within the interior thereof. When inert particles are utilized, the
vector can be introduced into the cell by coating the particles with the vector containing the desired
gene. Alternatively, the target cell can be surrounded by the vector so that the vector is carried into the
cell by the wake of the particle. Biologically active particles (e.g., dried yeast cells, dried bacterium or
a bacteriophage, each containing DNA sought to be introduced) can also be propelled into plant cell
tissue.
[0279] 2. Transformation of Monocotyledons
[0280] Transformation of most monocotyledon species has now also become routine. Preferred
techniques include direct gene transfer into protoplasts using PEG or electroporation techniques, and
205/503
particle bombardment into callus tissue. Transformations can be undertaken with a single DNA species
or multiple DNA species (i.e. co-transformation) and both these techniques are suitable for use with
this invention. Co-transformation may have the advantage of avoiding complete vector construction
and of generating transgenic plants with unlinked loci for the gene of interest and the selectable marker,
enabling the removal of the selectable marker in subsequent generations, should this be regarded
desirable. However, a disadvantage of the use of co-transformation is the less than 100% frequency
with which separate DNA species are integrated into the genome (Schocher et al. Biotechnology 4:
1093-1096 (1986)).
[0281] Patent Applications EP 0 292 435, EP 0 392 225, and WO 93/07278 describe techniques for
the preparation of callus and protoplasts from an elite inbred line of maize, transformation of
protoplasts using PEG or electroporation, and the regeneration of maize plants from transformed
protoplasts. Gordon-Kamm et al. (Plant Cell 2: 603-618 (1990)) and Fromm et al. (Biotechnology 8:
833-839 (1990)) have published techniques for transformation of A188-derived maize line using
particle bombardment. Furthermore, WO 93/07278 and Koziel et al. (Biotechnology 11: 194-200
(1993)) describe techniques for the transformation of elite inbred lines of maize by particle
bombardment. This technique utilizes immature maize embryos of 1.5-2.5 mm length excised from a
maize ear 14-15 days after pollination and a PDS-1000He Biolistics device for bombardment.
[0282] Transformation of rice can also be undertaken by direct gene transfer techniques utilizing
protoplasts or particle bombardment. Protoplast-mediated transformation has been described for
Japonica-types and Indica-types (Zhang et al. Plant Cell Rep 7: 379-384 (1988); Shimamoto et al.
Nature 338: 274-277 (1989); Datta et al. Biotechnology 8: 736-740 (1990)). Both types are also
routinely transformable using particle bombardment (Christou et al. Biotechnology 9: 957-962 (1991)).
Furthermore, WO 93/21335 describes techniques for the transformation of rice via electroporation.
[0283] Patent Application EP 0 332 581 describes techniques for the generation, transformation and
regeneration of Pooideae protoplasts. These techniques allow the transformation of Dactylis and wheat.
Furthermore, wheat transformation has been described by Vasil et al. (Biotechnology 10: 667-674
(1992)) using particle bombardment into cells of type C long-term regenerable callus, and also by Vasil
et al. (Biotechnology11:
[0284] 1553-1558 (1993)) and Weeks et al. (Plant Physiol. 102: 1077-1084 (1993)) using particle
bombardment of immature embryos and immature embryo-derived callus. A preferred technique for
wheat transformation, however, involves the transformation of wheat by particle bombardment of
immature embryos and includes either a high sucrose or a high maltose step prior to gene delivery.
Prior to bombardment, any number of embryos (0.75-1 mm in length) are plated onto MS medium with
3% sucrose (Murashiga & Skoog, Physiologia Plantarum 15: 473-497 (1962)) and 3 mg/l 2,4-D for
induction of somatic embryos, which is allowed to proceed in the dark. On the chosen day of
bombardment, embryos are removed from the induction medium and placed onto the osmoticum (i.e.
induction medium with sucrose or maltose added at the desired concentration, typically 15%). The
embryos are allowed to plasmolyze for 2-3 hours and are then bombarded. Twenty embryos per target
plate is typical, although not critical. An appropriate gene-carrying plasmid (such as pCIB3064 or
pSG35) is precipitated onto micrometer size gold particles using standard procedures. Each plate of
embryos is shot with the DuPont Biolistics(R)) helium device using a burst pressure of 1000 psi using a
standard 80 mesh screen. After bombardment, the embryos are placed back into the dark to recover for
about 24 hours (still on osmoticum). After 24 hrs, the embryos are removed from the osmoticum and
placed back onto induction medium where they stay for about a month before regeneration.
Approximately one month later the embryo explants with developing embryogenic callus are
transferred to regeneration medium (MS+1 mg/liter NAA, 5 mg/liter GA), further containing the
appropriate selection agent (10 mg/l basta in the case of pCIB3064 and 2 mg/l methotrexate in the case
of pSOG35). After approximately one month, developed shoots are transferred to larger sterile
containers known as "GA7s" which contain half-strength MS, 2% sucrose, and the same concentration
of selection agent.
[0285] Tranformation of monocotyledons using Agrobacterium has also been described. See, WO
94/00977 and U.S. Pat. No. 5,591,616, both of which are incorporated herein by reference. See also,
Negrotto et al., Plant Cell Reports 19: 798-803 (2000), incorporated herein by reference.
[0286] For this example, rice (Oryza sativa) is used for generating transgenic plants. Various rice
cultivars can be used (Hiei et al., 1994, Plant Journal 6:271-282; Dong et al., 1996, Molecular Breeding
2:267-276; Hiei et al., 1997, Plant Molecular Biology, 35:205-218). Also, the various media
constituents described below may be either varied in quantity or substituted. Embryogenic responses
are initiated and/or cultures are established from mature embryos by culturing on MS-CIM medium
(MS basal salts, 4.3 g/liter; B5 vitamins (200*), 5 ml/liter; Sucrose, 30 g/liter; proline, 500 mg/liter;
206/503
glutamine, 500 mg/liter; casein hydrolysate, 300 mg/liter; 2,4-D (1 mg/ml), 2 ml/liter; adjust pH to 5.8
with 1 N KOH; Phytagel, 3 g/liter). Either mature embryos at the initial stages of culture response or
established culture lines are inoculated and co-cultivated with the Agrobacterium tumefaciens strain
LBA4404 (Agrobacterium) containing the desired vector construction. Agrobacterium is cultured from
glycerol stocks on solid YPC medium (100 mg/L spectinomycin and any other appropriate antibiotic)
for 2 days at 28[deg.] C. Agrobacterium is re-suspended in liquid MS-CIM medium. The
Agrobacterium culture is diluted to an OD600 of 0.2-0.3 and acetosyringone is added to a final
concentration of 200 uM. Acetosyringone is added before mixing the solution with the rice cultures to
induce Agrobacterium for DNA transfer to the plant cells. For inoculation, the plant cultures are
immersed in the bacterial suspension. The liquid bacterial suspension is removed and the inoculated
cultures are placed on co-cultivation medium and incubated at 22[deg.] C. for two days. The cultures
are then transferred to MS-CIM medium with Ticarcillin (400 mg/liter) to inhibit the growth of
Agrobacterium. For constructs utilizing the PMI selectable marker gene (Reed et al., In Vitro Cell.
Dev. Biol.-Plant 37:127-132), cultures are transferred to selection medium containing Mannose as a
carbohydrate source (MS with 2% Mannose, 300 mg/liter Ticarcillin) after 7 days, and cultured for 3-4
weeks in the dark. Resistant colonies are then transferred to regeneration induction medium (MS with
no 2,4-D, 0.5 mg/liter IAA, 1 mg/liter zeatin, 200 mg/liter timentin 2% Mannose and 3% Sorbitol) and
grown in the dark for 14 days. Proliferating colonies are then transferred to another round of
regeneration induction media and moved to the light growth room. Regenerated shoots are transferred
to GA7 containers with GA7-1 medium (MS with no hormones and 2% Sorbitol) for 2 weeks and then
moved to the greenhouse when they are large enough and have adequate roots. Plants are transplanted
to soil in the greenhouse (To generation) grown to maturity, and the T1 seed is harvested.
[0287] 3. Transformation of Plastids
[0288] Seeds of Nicotiana tabacum c.v. 'Xanthienc' are germinated seven per plate in a 1" circular
array on T agar medium and bombarded 12-14 days after sowing with 1 [mu]m tungsten particles
(M10, Biorad, Hercules, CA) coated with DNA from plasmids pPH143 and pPH145 essentially as
described (Svab, Z. and Maliga, P. (1993) PNAS 90, 913-917). Bombarded seedlings are incubated on
T medium for two days after which leaves are excised and placed abaxial side up in bright light (350500 [mu]mol photons/m>;2; /s) on plates of RMOP medium (Svab, Z., Hajdukiewicz, P. and Maliga, P.
(1990) PNAS 87, 8526-8530) containing 500 [mu]g/ml spectinomycin dihydrochloride (Sigma, St.
Louis, Mo.). Resistant shoots appearing underneath the bleached leaves three to eight weeks after
bombardment are subcloned onto the same selective medium, allowed to form callus, and secondary
shoots isolated and subcloned. Complete segregation of transformed plastid genome copies
(homoplasmicity) in independent subclones is assessed by standard techniques of Southern blotting
(Sambrook et al., (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory,
Cold Spring Harbor). BamHI/EcoRI-digested total cellular DNA (Mettler, I. J. (1987) Plant Mol Biol
Reporter 5, 346349) is separated on 1% Tris-borate (TBE) agarose gels, transferred to nylon
membranes (Amersham) and probed with >;32; P-labeled random primed DNA sequences
corresponding to a 0.7 kb BamHI/HindIII DNA fragment from pC8 containing a portion of the
rps{fraction (7/12)}plastid targeting sequence. Homoplasmic shoots are rooted aseptically on
spectinomycin-containing MS/IBA medium (McBride, K. E. et al. (1994) PNAS 91, 7301-7305) and
transferred to the greenhouse.
V. Breeding and Seed Production
A. Breeding
[0289] The plants obtained via tranformation with a nucleic acid sequence of the present invention
can be any of a wide variety of plant species, including those of monocots and dicots; however, the
plants used in the method of the invention are preferably selected from the list of agronomically
important target crops set forth supra. The expression of a gene of the present invention in combination
with other characteristics important for production and quality can be incorporated into plant lines
through breeding. Breeding approaches and techniques are known in the art. See, for example, Welsh J.
R., Fundamentals of Plant Genetics and Breeding, John Wiley & Sons, NY (1981); Crop Breeding,
Wood D. R. (Ed.) American Society of Agronomy Madison, Wis. (1983); Mayo O., The Theory of
Plant Breeding, Second Edition, Clarendon Press, Oxford (1987); Singh, D.P., Breeding for Resistance
to Diseases and Insect Pests, Springer-Verlag, NY (1986); and Wricke and Weber, Quantitative
Genetics and Selection Plant Breeding, Walter de Gruyter and Co., Berlin (1986).
[0290] The genetic properties engineered into the transgenic seeds and plants described above are
passed on by sexual reproduction or vegetative growth and can thus be maintained and propagated in
207/503
progeny plants. Generally said maintenance and propagation make use of known agricultural methods
developed to fit specific purposes such as tilling, sowing or harvesting, Specialized processes such as
hydroponics or greenhouse technologies can also be applied. As the growing crop is vulnerable to
attack and damages caused by insects or infections as well as to competition by weed plants, measures
are undertaken to control weeds, plant diseases, insects, nematodes, and other adverse conditions to
improve yield. These include mechanical measures such a tillage of the soil or removal of weeds and
infected plants, as well as the application of agrochemicals such as herbicides, fungicides, gametocides,
nematicides, growth regulants, ripening agents and insecticides.
[0291] Use of the advantageous genetic properties of the transgenic plants and seeds according to the
invention can further be made in plant breeding, which aims at the development of plants with
improved properties such as tolerance of pests, herbicides, or stress, improved nutritional value,
increased yield, or improved structure causing less loss from lodging or shattering. The various
breeding steps are characterized by well-defined human intervention such as selecting the lines to be
crossed, directing pollination of the parental lines, or selecting appropriate progeny plants. Depending
on the desired properties, different breeding measures are taken. The relevant techniques are well
known in the art and include but are not limited to hybridization, inbreeding, backcross breeding,
multiline breeding, variety blend, interspecific hybridization, aneuploid techniques, etc. Hybridization
techniques also include the sterilization of plants to yield male or female sterile plants by mechanical,
chemical, or biochemical means. Cross pollination of a male sterile plant with pollen of a different line
assures that the genome of the male sterile but female fertile plant will uniformly obtain properties of
both parental lines. Thus, the transgenic seeds and plants according to the invention can be used for the
breeding of improved plant lines, that for example, increase the effectiveness of conventional methods
such as herbicide or pesticide treatment or allow one to dispense with said methods due to their
modified genetic properties. Alternatively new crops with improved stress tolerance can be obtained,
which, due to their optimized genetic "equipment", yield harvested product of better quality than
products that were not able to tolerate comparable adverse developmental conditions.
B. Seed Production
[0292] In seed production, germination quality and uniformity of seeds are essential product
characteristics. As it is difficult to keep a crop free from other crop and weed seeds, to control
seedborne diseases, and to produce seed with good germination, fairly extensive and well-defined seed
production practices have been developed by seed producers, who are experienced in the art of
growing, conditioning and marketing of pure seed. Thus, it is common practice for the farmer to buy
certified seed meeting specific quality standards instead of using seed harvested from his own crop.
Propagation material to be used as seeds is customarily treated with a protectant coating comprising
herbicides, insecticides, fungicides, bactericides, nematicides, molluscicides, or mixtures thereof.
Customarily used protectant coatings comprise compounds such as captan, carboxin, thiram
(TMTD(R)), methalaxyl (Apron(R)), and pirimiphos-methyl (Actellic(R)). If desired, these compounds
are formulated together with further carriers, surfactants or application-promoting adjuvants
customarily employed in the art of formulation to provide protection against damage caused by
bacterial, fungal or animal pests. The protectant coatings may be applied by impregnating propagation
material with a liquid formulation or by coating with a combined wet or dry formulation. Other
methods of application are also possible such as treatment directed at the buds or the fruit.
VI. Alteration of Expression of Nucleic Acid Molecules
[0294] For example, the alteration in expression of the nucleic acid molecules of the present
invention is achieved in one of the following ways:
[0295] A. "Sense" Suppression
[0296] Alteration of the expression of a nucleotide sequence of the present invention, preferably
reduction of its expression, is obtained by "sense" suppression (referenced in e.g. Jorgensen et al.
(1996) Plant Mol. Biol. 31, 957-973). In this case, the entirety or a portion of a nucleotide sequence of
the present invention is comprised in a DNA molecule. The DNA molecule is preferably operatively
linked to a promoter functional in a cell comprising the target gene, preferably a plant cell, and
introduced into the cell, in which the nucleotide sequence is expressible. The nucleotide sequence is
inserted in the DNA molecule in the "sense orientation", meaning that the coding strand of the
nucleotide sequence can be transcribed. In a preferred embodiment, the nucleotide sequence is fully
translatable and all the genetic information comprised in the nucleotide sequence, or portion thereof, is
translated into a polypeptide. In another preferred embodiment, the nucleotide sequence is partially
translatable and a short peptide is translated. In a preferred embodiment, this is achieved by inserting at
least one premature stop codon in the nucleotide sequence, which bring translation to a halt. In another
208/503
more preferred embodiment, the nucleotide sequence is transcribed but no translation product is being
made. This is usually achieved by removing the start codon, e.g. the "ATG", of the polypeptide
encoded by the nucleotide sequence. In a further preferred embodiment, the DNA molecule comprising
the nucleotide sequence, or a portion thereof, is stably integrated in the genome of the plant cell. In
another preferred embodiment, the DNA molecule comprising the nucleotide sequence, or a portion
thereof, is comprised in an extrachromosomally replicating molecule.
[0297] In transgenic plants containing one of the DNA molecules described immediately above, the
expression of the nucleotide sequence corresponding to the nucleotide sequence comprised in the DNA
molecule is preferably reduced. Preferably, the nucleotide sequence in the DNA molecule is at least
70% identical to the nucleotide sequence the expression of which is reduced, more preferably it is at
least 80% identical, yet more preferably at least 90% identical, yet more preferably at least 95%
identical, yet more preferably at least 99% identical.
[0298] B. "Anti-Sense" Suppression
[0299] In another preferred embodiment, the alteration of the expression of a nucleotide sequence of
the present invention, preferably the reduction of its expression is obtained by "anti-sense" suppression.
The entirety or a portion of a nucleotide sequence of the present invention is comprised in a DNA
molecule. The DNA molecule is preferably operatively linked to a promoter functional in a plant cell,
and introduced in a plant cell, in which the nucleotide sequence is expressible. The nucleotide sequence
is inserted in the DNA molecule in the "anti-sense orientation", meaning that the reverse complement
(also called sometimes non-coding strand) of the nucleotide sequence can be transcribed. In a preferred
embodiment, the DNA molecule comprising the nucleotide sequence, or a portion thereof, is stably
integrated in the genome of the plant cell. In another preferred embodiment the DNA molecule
comprising the nucleotide sequence, or a portion thereof, is comprised in an extrachromosomally
replicating molecule. Several publications describing this approach are cited for further illustration
(Green, P. J. et al., Ann. Rev. Biochem. 55:569-597 (1986); van der Krol, A. R. et al, Antisense Nuc.
Acids & Proteins, pp. 125-141 (1991); Abel, P. P. et al., PNAS. USA 86:6949-6952 (1989); Ecker, J.
R. et al., Proc. Natl. Acad. Sci. USA 83:5372-5376 (August 1986)).
[0300] In transgenic plants containing one of the DNA molecules described immediately above, the
expression of the nucleotide sequence corresponding to the nucleotide sequence comprised in the DNA
molecule is preferably reduced. Preferably, the nucleotide sequence in the DNA molecule is at least
70% identical to the nucleotide sequence the expression of which is reduced, more preferably it is at
least 80% identical, yet more preferably at least 90% identical, yet more preferably at least 95%
identical, yet more preferably at least 99% identical. Antisense suppression of the RARI nucleic acid
molecules of the invention is more specifically described below in Example 5.
[0301] C. Homologous Recombination
[0302] In another preferred embodiment, at least one genomic copy corresponding to a nucleotide
sequence of the present invention is modified in the genome of the plant by homologous recombination
as further illustrated in Paszkowski et al., EMBO Journal 7:4021-26 (1988). This technique uses the
property of homologous sequences to recognize each other and to exchange nucleotide sequences
between each by a process known in the art as homologous recombination. Homologous recombination
can occur between the chromosomal copy of a nucleotide sequence in a cell and an incoming copy of
the nucleotide sequence introduced in the cell by transformation. Specific modifications are thus
accurately introduced in the chromosomal copy of the nucleotide sequence. In one embodiment, the
regulatory elements of the nucleotide sequence of the present invention are modified. Such regulatory
elements are easily obtainable by screening a genomic library using the nucleotide sequence of the
present invention, or a portion thereof, as a probe. The existing regulatory elements are replaced by
different regulatory elements, thus altering expression of the nucleotide sequence, or they are mutated
or deleted, thus abolishing the expression of the nucleotide sequence. In another embodiment, the
nucleotide sequence is modified by deletion of a part of the nucleotide sequence or the entire
nucleotide sequence, or by mutation. Expression of a mutated polypeptide in a plant cell is also
contemplated in the present invention. More recent refinements of this technique to disrupt endogenous
plant genes have been described (Kempin et al., Nature 389:802-803 (1997) and Miao and Lam, Plant
J., 7:359-365 (1995).
[0303] In another preferred embodiment, a mutation in the chromosomal copy of a nucleotide
sequence is introduced by transforming a cell with a chimeric oligonucleotide composed of a
contiguous stretch of RNA and DNA residues in a duplex conformation with double hairpin caps on
the ends. An additional feature of the oligonucleotide is for example the presence of 2'-O-methylation
at the RNA residues. The RNA/DNA sequence is designed to align with the sequence of a
chromosomal copy of a nucleotide sequence of the present invention and to contain the desired
209/503
nucleotide change. For example, this technique is further illustrated in U.S. Pat. No. 5,501,967 and Zhu
et al. (1999) Proc. Natl. Acad. Sci. USA 96: 8768-8773.
[0304] D. Ribozymes
[0305] In a further embodiment, the RNA coding for a polypeptide of the present invention is
cleaved by a catalytic RNA, or ribozyme, specific for such RNA. The ribozyme is expressed in
transgenic plants and results in reduced amounts of RNA coding for the polypeptide of the present
invention in plant cells, thus leading to reduced amounts of polypeptide accumulated in the cells. This
method is further illustrated in U.S. Pat. No. 4,987,071.
[0306] E. Dominant-Negative Mutants
[0307] In another preferred embodiment, the activity of the polypeptide encoded by the nucleotide
sequences of this invention is changed. This is achieved by expression of dominant negative mutants of
the proteins in transgenic plants, leading to the loss of activity of the endogenous protein.
[0308] F. Aptamers
[0309] In a further embodiment, the activity of polypeptide of the present invention is inhibited by
expressing in transgenic plants nucleic acid ligands, so-called aptamers, which specifically bind to the
protein. Aptamers are preferentially obtained by the SELEX (Systematic Evolution of Ligands by
EXponential Enrichment) method. In the SELEX method, a candidate mixture of single stranded
nucleic acids having regions of randomized sequence is contacted with the protein and those nucleic
acids having an increased affinity to the target are partitioned from the remainder of the candidate
mixture. The partitioned nucleic acids are amplified to yield a ligand enriched mixture. After several
iterations a nucleic acid with optimal affinity to the polypeptide is obtained and is used for expression
in transgenic plants. This method is further illustrated in U.S. Pat. No. 5,270,163.
[0310] G. Zinc Finger Proteins
[0311] A zinc finger protein that binds a nucleotide sequence of the present invention or to its
regulatory region is also used to alter expression of the nucleotide sequence. Preferably, transcription
of the nucleotide sequence is reduced or increased. Zinc finger proteins are for example described in
Beerli et al. (1998) PNAS PNAS 95:14628-14633., or in WO 95/19431, WO 98/54311, or WO
96/06166, all incorporated herein by reference in their entirety.
[0312] H. dsRNA
[0313] Alteration of the expression of a nucleotide sequence of the present invention is also obtained
by dsRNA interference as described for example in WO 99/32619, WO 99/53050 or WO 99/61631, all
incorporated herein by reference in their entirety. In another preferred embodiment, the alteration of the
expression of a nucleotide sequence of the present invention, preferably the reduction of its expression,
is obtained by double-stranded RNA (dsRNA) interference. The entirety or, preferably a portion of a
nucleotide sequence of the present invention is comprised in a DNA molecule. The size of the DNA
molecule is preferably from 100 to 1000 nucleotides or more; the optimal size to be determined
empirically. Two copies of the identical DNA molecule are linked, separated by a spacer DNA
molecule, such that the first and second copies are in opposite orientations. In the preferred
embodiment, the first copy of the DNA molecule is in the reverse complement (also known as the noncoding strand) and the second copy is the coding strand; in the most preferred embodiment, the first
copy is the coding strand, and the second copy is the reverse complement. The size of the spacer DNA
molecule is preferably 200 to 10,000 nucleotides, more preferably 400 to 5000 nucleotides and most
preferably 600 to 1500 nucleotides in length. The spacer is preferably a random piece of DNA, more
preferably a random piece of DNA without homology to the target organism for dsRNA interference,
and most preferably a functional intron which is effectively spliced by the target organism. The two
copies of the DNA molecule separated by the spacer are operatively linked to a promoter functional in
a plant cell, and introduced in a plant cell, in which the nucleotide sequence is expressible. In a
preferred embodiment, the DNA molecule comprising the nucleotide sequence, or a portion thereof, is
stably integrated in the genome of the plant cell.
[0314] In another preferred embodiment the DNA molecule comprising the nucleotide sequence, or
a portion thereof, is comprised in an extrachromosomally replicating molecule. Several publications
describing this approach are cited for further illustration (Waterhouse et al. (1998) PNAS 95:1395913964; Chuang and Meyerowitz (2000) PNAS 97:49854990; Smith et al. (2000) Nature 407:319-320).
Alteration of the expression of a nucleotide sequence by dsRNA interference is also described in, for
example WO 99/32619, WO 99/53050 or WO 99/61631, all incorporated herein by reference in their
entirety
[0315] In transgenic plants containing one of the DNA molecules described immediately above, the
expression of the nucleotide sequence corresponding to the nucleotide sequence comprised in the DNA
molecule is preferably reduced. Preferably, the nucleotide sequence in the DNA molecule is at least
210/503
70% identical to the nucleotide sequence the expression of which is reduced, more preferably it is at
least 80% identical, yet more preferably at least 90% identical, yet more preferably at least 95%
identical, yet more preferably at least 99% identical.
[0316] I. Insertion of a DNA Molecule (Insertional Mutagenesis)
[0317] In another preferred embodiment, a DNA molecule is inserted into a chromosomal copy of a
nucleotide sequence of the present invention, or into a regulatory region thereof. Preferably, such DNA
molecule comprises a transposable element capable of transposition in a plant cell, such as e.g. Ac/Ds,
Em/Spm, mutator. Alternatively, the DNA molecule comprises a T-DNA border of an Agrobacterium
T-DNA. The DNA molecule may also comprise a recombinase or integrase recognition site which can
be used to remove part of the DNA molecule from the chromosome of the plant cell. Methods of
insertional mutagenesis using T-DNA, transposons, oligonucleotides or other methods known to those
skilled in the art are also encompassed. Methods of using T-DNA and transposon for insertional
mutagenesis are described in Winkler et al. (1989) Methods Mol. Biol. 82:129-136 and Martienssen
(1998) PNAS 95:2021-2026, incorporated herein by reference in their entireties.
[0318] J. Deletion Mutagenesis
[0319] In yet another embodiment, a mutation of a nucleic acid molecule of the present invention is
created in the genomic copy of the sequence in the cell or plant by deletion of a portion of the
nucleotide sequence or regulator sequence. Methods of deletion mutagenesis are known to those skilled
in the art. See, for example, Miao et al, (1995) Plant J. 7:359. In yet another embodiment, this deletion
is created at random in a large population of plants by chemical mutagenesis or irradiation and a plant
with a deletion in a gene of the present invention is isolated by forward or reverse genetics. Irradiation
with fast neutrons or gamma rays is known to cause deletion mutations in plants (Silverstone et al,
(1998) Plant Cell, 10:155-169; Bruggemann et al., (1996) Plant J., 10:755-760; Redei and Koncz in
Methods in Arabidopsis Research, World Scientific Press (1992), pp. 16-82). Deletion mutations in a
gene of the present invention can be recovered in a reverse genetics strategy using PCR with pooled
sets of genomic DNAs as has been shown in C. elegans (Liu et al., (1999), Genome Research, 9:859867.). A forward genetics strategy would involve mutagenesis of a line displaying PTGS followed by
screening the M2 progeny for the absence of PTGS. Among these mutants would be expected to be
some that disrupt a gene of the present invention. This could be assessed by Southern blot or PCR for a
gene of the present invention with genomic DNA from these mutants.
[0320] K. Overexpression in a Plant Cell
[0321] In yet another preferred embodiment, a nucleotide sequence of the present invention
encoding a polypeptide is over-expressed. Examples of nucleic acid molecules and expression cassettes
for over-expression of a nucleic acid molecule of the present invention are described above. Methods
known to those skilled in the art of over-expression of nucleic acid molecules are also encompassed by
the present invention.
[0322] In a preferred embodiment, the expression of the nucleotide sequence of the present invention
is altered in every cell of a plant. This is for example obtained though homologous recombination or by
insertion in the chromosome. This is also for example obtained by expressing a sense or antisense
RNA, zinc finger protein or ribozyme under the control of a promoter capable of expressing the sense
or antisense RNA, zinc finger protein or ribozyme in every cell of a plant. Constitutive expression,
inducible, tissue-specific or developmentally-regulated expression are also within the scope of the
present invention and result in a constitutive, inducible, tissue-specific or developmentally-regulated
alteration of the expression of a nucleotide sequence of the present invention in the plant cell.
Constructs for expression of the sense or antisense RNA, zinc finger protein or ribozyme, or for overexpression of a nucleotide sequence of the present invention, are prepared and transformed into a plant
cell according to the teachings of the present invention, e.g. as described infra.
VII. Polypeptides
[0323] The present invention further relates to isolated polypeptides comprising the amino acid
sequence of SEQ ID NO:2. In particular, isolated polypeptides comprising the amino acid sequence of
SEQ ID NO:2, and variants having conservative amino acid modifications. One skilled in the art will
recognize that individual substitutions, deletions or additions to a nucleic acid, peptide, polypeptide or
protein sequence which alters, adds or deletes a single amino acid or a small percent of amino acids in
the encoded sequence is a "conservative modification" where the modification results in the
substitution of an amino acid with a chemically similar amino acid. Conservative modified variants
provide similar biological activity as the unmodified polypeptide. Conservative substitution tables
listing functionally similar amino acids are known in the art. See Crighton (1984) Proteins, W.H.
Freeman and Company.
211/503
[0324] In a preferred embodiment, a polypeptide having substantial similarity to a polypeptide
sequence listed in even numbered SEQ ID NO:2-64, or exon, domain, or feature thereof, is an allelic
variant of the polypeptide sequence listed in even numbered SEQ ID NO:2-64. In another preferred
embodiment, a polypeptide having substantial similarity to a polypeptide sequence listed in even
numbered SEQ ID NO:2-64, or exon, domain, or feature thereof, is a naturally occurring variant of the
polypeptide sequence listed in even numbered SEQ ID NO:2-64. In another preferred embodiment, a
polypeptide having substantial similarity to a polypeptide sequence listed in even numbered SEQ ID
NO:2-64, or exon, domain, or feature thereof, is a polymorphic variant of the polypeptide sequence
listed in even numbered SEQ ID NO:2-64.
[0325] In an alternate preferred embodiment, the sequence having substantial similarity contains a
deletion or insertion of at least one amino acid. In a more preferred embodiment, the deletion or
insertion is of less than about ten amino acids. In a most preferred embodiment, the deletion or
insertion is of less than about three amino acids.
[0326] In a preferred embodiment, the sequence having substantial similarity encodes a substitution
in at least one amino acid.
[0327] Embodiments of the present invention also contemplate an isolated polypeptide containing a
polypeptide sequence including:
(f) a polypeptide sequence listed in even numbered SEQ ID NO:2-64, or exon, domain, or feature
thereof;
(g) a polypeptide sequence having substantial similarity to (a);
(h) a polypeptide sequence encoded by a nucleotide sequence identical to or having substantial
similarity to a nucleotide sequence listed in odd numbered SEQ ID NO:1-63, or an exon, domain, or
feature thereof, or a sequence complementary thereto;
(i) a polypeptide sequence encoded by a nucleotide sequence capable of hybridizing under medium
stringency conditions to a nucleotide sequence listed in odd numbered SEQ ID NO:1-63, or to a
sequence complementary thereto; and
(j) A Functional Fragment of (a), (b), (c) or (d).
[0333] In another preferred embodiment, the polypeptide having substantial similarity is an allelic
variant of a polypeptide sequence listed in even numbered SEQ ID NO:2-64, or a fragment, domain,
repeat, feature, or chimeras thereof. In another preferred embodiment, the isolated nucleic acid includes
a plurality of regions from the polypeptide sequence encoded by a nucleotide sequence identical to or
having substantial similarity to a nucleotide sequence listed in odd numbered SEQ ID NO:1-63, or
fragment, domain, or feature thereof, or a sequence complementary thereto.
[0334] In another preferred embodiment, the polypeptide is a polypeptide sequence listed in odd
numbered SEQ ID NO:2-64. In another preferred embodiment, the polypeptide is a functional fragment
or domain. In yet another preferred embodiment, the polypeptide is a chimera, where the chimera may
include functional protein domains, including domains, repeats, post-translational modification sites, or
other features. In a more preferred embodiment, the polypeptide is a plant polypeptide. In a more
preferred embodiment, the plant is a dicot. In a more preferred embodiment, the plant is a
gymnosperm. In a more preferred embodiment, the plant is a monocot. In a more preferred
embodiment, the monocot is a cereal. In a more preferred embodiment, the cereal may be, for example,
maize, wheat, barley, oats, rye, millet, sorghum, triticale, secale, einkorn, spelt, emmer, teff, milo, flax,
gramma grass, Tripsacum, and teosinte. In a most preferred embodiment, the cereal is rice.
[0335] In a preferred embodiment, the polypeptide is expressed in a specific location or tissue of a
plant. In a more preferred embodiment, the location or tissue is for example, but not limited to,
epidermis, vascular tissue, meristem, cambium, cortex or pith. In a most preferred embodiment, the
location or tissue is leaf or sheath, root, flower, and developing ovule or seed. In a more preferred
embodiment, the location or tissue may be, for example, epidermis, root, vascular tissue, meristem,
cambium, cortex, pith, leaf, and flower. In a more preferred embodiment, the location or tissue is a
seed.
[0336] In a preferred embodiment, the polypeptide sequence encoded by a nucleotide sequence
having substantial similarity to a nucleotide sequence listed in odd numbered SEQ ID NO:1-63 or a
fragment, domain, or feature thereof or a sequence complementary thereto, includes a deletion or
insertion of at least one nucleotide. In a more preferred embodiment, the deletion or insertion is of less
than about thirty nucleotides. In a most preferred embodiment, the deletion or insertion is of less than
about five nucleotides.
[0337] In a preferred embodiment, the polypeptide sequence encoded by a nucleotide sequence
having substantial similarity to a nucleotide sequence listed in odd numbered SEQ ID NO:1-63, or
212/503
fragment, domain, or feature thereof or a sequence complementary thereto, includes a substitution of at
least one codon. In a more preferred embodiment, the substitution is conservative.
[0338] In a preferred embodiment, the polypeptide sequences having substantial similarity to the
polypeptide sequence listed in even numbered SEQ ID NO:2-64, or a fragment, domain, repeat,
feature, or chimeras thereof includes a deletion or insertion of at least one amino acid.
[0339] The polypeptides of the invention, fragments thereof or variants thereof can comprise any
number of contiguous amino acid residues from a polypeptide of the invention, wherein the number of
residues is selected from the group of integers consisting of from 10 to the number of residues in a fulllength polypeptide of the invention. Preferably, the portion or fragment of the polypeptide is a
functional protein. The present invention includes active polypeptides having specific activity of at
least 20%, 30%, or 40%, and preferably at least 505, 60%, or 70%, and most preferably at least 805,
90% or 95% that of the native (non-synthetic) endogenous polypeptide. Further, the substrate
specificity (kcatKm) is optionally substantially similar to the native (non-synthetic), endogenous
polypeptide. Typically the Km will be at least 30%, 40%, or 50% of the native, endogenous
polypeptide; and more preferably at least 605, 70%, 80%, or 90%. Methods of assaying and
quantifying measures of activity and substrate specificity are well known to those of skill in the art.
[0340] The isolated polypeptides of the present invention will elicit production of an antibody
specifically reactive to a polypeptide of the present invention when presented as an immunogen.
Therefore, the polypeptides of the present invention can be employed as immunogens for constructing
antibodies immunoreactive to a protein of the present invention for such purposes, but not limited to,
immunoassays or protein purification techniques. Immunoassays for determining binding are well
known to those of skill in the art such as, but not limited to, ELISAs or competitive immunoassays.
[0341] Embodiments of the present invention also relate to chimeric polypeptides encoded by the
isolated nucleic acid molecules of the present disclosure including a chimeric polypeptide containing a
polypeptide sequence encoded by an isolated nucleic acid containing a nucleotide sequence including:
(g) a nucleotide sequence listed in odd numbered SEQ ID NO:1-63, or exon, domain, or feature
thereof;
(h) a nucleotide sequence having substantial similarity to (a);
(i) a nucleotide sequence capable of hybridizing to (a);
(j) a nucleotide sequence complementary to (a), (b) or (c); and
(k) a nucleotide sequence which is the reverse complement of (a), (b) or (c);
(l) or a functional fragment thereof.
[0348] A polypeptide containing a polypeptide sequence encoded by an isolated nucleic acid
containing a nucleotide sequence, its complement, or its reverse complement, encoding a polypeptide
including a polypeptide sequence including:
(g) a polypeptide sequence listed in even numbered SEQ ID NO:2-64, or a domain, repeat, feature, or
chimeras thereof;
(h) a polypeptide sequence having substantial similarity to (a);
(i) a polypeptide sequence encoded by a nucleotide sequence identical to or having substantial
similarity to a nucleotide sequence listed in odd numbered SEQ ID NO:1-63, or an exon, domain, or
feature thereof, or a sequence complementary thereto;
(j) a polypeptide sequence encoded by a. nucleotide sequence capable of hybridizing under medium
stringency conditions to a nucleotide sequence listed in odd numbered SEQ ID NO:1-63, or to a
sequence complementary thereto; and
(k) a functional fragment of (a), (b), (c) or (d);
(l) or a functional fragment thereof.
[0355] The isolated nucleic acid molecules of the present invention are useful for expressing a
polypeptide of the present invention in a recombinantly engineered cell such as a bacteria, yeast, insect,
mammalian or plant cell. The cells produce the polypeptide in a non-natural condition (e.g. in quantity,
composition, location and/or time) because they have been genetically altered to do so. Those skilled in
the art are knowledgeable in the numerous expression systems available for expression of nucleic acids
encoding a protein of the present invention, and will not be described in detail below.
[0356] Briefly, the expression of isolated nucleic acids encoding a polypeptide of the invention will
typically be achieved, for example, by operably linking the nucleic acid or cDNA to a promoter
(constitutive or regulatable) followed by incorporation into an expression vector. The vectors are
suitable for replication and/or integration in either prokaryotes or eukaryotes. Commonly used
expression vectors comprise transcription and translation terminators, initiation sequences and
213/503
promoters for regulation of the expression of the nucleic acid molecule encoding the polypeptide. To
obtain high levels of expression of the cloned nucleic acid molecule, it is desirable to use expression
vectors comprising a strong promoter to direct transcription, a ribosome binding site for translation
initiation, and a transcription/translation terminator. One skilled in the art will recognize that
modifications may be made to the polypeptide of the present invention without diminishing its
biological activity. Some modifications may be made to facilitate the cloning, expression or
incorporation of the polypeptide of the invention into a fusion protein. Such modification are well
known in the art and include, but are not limited to, a methionine added at the amino terminus to
provide an initiation site, or additional amino acids (e.g. poly Histadine) placed on either terminus to
create conveniently located purification sequences. Restricton sites or termination codons can also be
introduced into the vector.
[0357] In a preferred embodiment, the expression vector includes one or more elements such as, for
example, but not limited to, a promoter-enhancer sequence, a selection marker sequence, an origin of
replication, an epitope-tag encoding sequence, or an affinity purification-tag encoding sequence. In a
more preferred embodiment, the promoter-enhancer sequence may be, for example, the CaMV 35S
promoter, the CaMV 19S promoter, the tobacco PR-la promoter, the ubiquitin promoter, and the
phaseolin promoter. In another embodiment, the promoter is operable in plants, and more preferably, a
constitutive or inducible promoter. In another preferred embodiment, the selection marker sequence
encodes an antibiotic resistance gene. In another preferred embodiment, the epitope-tag sequence
encodes V5, the peptide Phe-His-His-Thr-Thr, hemagglutinin, or glutathione-S-transferase. In another
preferred embodiment the affinity purification-tag sequence encodes a polyamino acid sequence or a
polypeptide. In a more preferred embodiment, the polyamino acid sequence is polyhistidine. In a more
preferred embodiment, the polypeptide is chitin binding domain or glutathione-S-transferase. In a more
preferred embodiment, the affinity purification-tag sequence comprises an intein encoding sequence.
[0358] Prokaryotic cells may be used a host cells, for example, but not limited to, Escherichia coli,
and other microbial strains known to those in the art. Methods for expressing proteins in prokaryotic
cells are well known to those in the art and can be found in many laboratory manuals such as Molecular
Cloning: A Laboratory Manual, by J. Sambrook et al. (1989, Cold Spring Harbor Laboratory Press). A
variety of promoters, ribosome binding sites, and operators to control expression are available to those
skilled in the art, as are selectable markers such as antibiotic resistance genes.
* The type of vector chosen is to allow for optimal growth and expression in the selected cell type.
[0359] A variety of eukaryotic expression systems are available such as, but not limited to, yeast,
insect cell lines, plant cells and mammalian cells. Expression and synthesis of heterologous proteins in
yeast is well known (see Sherman et al., Methods in Yeast Genetics, Cold Spring Harbor Laboratory
Press, 1982). Commonly used yeast strains widely used for production of eukaryotic proteins are
Saccharomyces cerevisiae and Pichia pastoris, and vectors, strains and protocols for expression are
available from commercial suppliers (e.g., Invitrogen).
[0360] Mammalian cell systems may be transfected with expression vectors for production of
proteins. Many suitable host cell lines are available to those in the art, such as, but not limited to the
HEK293, BHK21 and CHO cells lines. Expression vectors for these cells can include expression
control sequences such as an origin of replication, a promoter, ( e.g., the CMV promoter, a HSV tk
promoter or phosphoglycerate kinase (pgk) promoter), an enhancer, and protein processing sites such
as ribosome binding sites, RNA splice sites, polyadenylation sites, and transcription terminator
sequences. Other animal cell lines useful for the production of proteins are available commercially or
from depositories such as the American Type Culture Collection.
[0361] Expression vectors for expressing proteins in insect cells are usually derived from the SF9
baculovirus or other viruses known in the art. A number of suitable insect cell lines are available
including but not limited to, mosquito larvae, silkworm, armyworm, moth and Drosophila cell lines.
[0362] Methods of transfecting animal and lower eukaryotic cells are known. Numerous methods are
used to make eukaryotic cells competent to introduce DNA such as but not limited to: calcium
phosphate precipitation, fusion of the recipient cell with bacterial protoplasts containing the DNA,
treatment of the recipient cells with liposomes containing the DNA, DEAE dextrin, electroporation,
biolistics, and microinjection of the DNA directly into the cells. Tranfected cells are cultured using
means well known in the art (see, Kuchler, R. J., Biochemical Methods in Cell Culture and Virology,
Dowden, Hutchinson and Ross, Inc. 1997).
[0363] Once a polypeptide of the present invention is expressed it may be isolated and purified from
the cells using methods known to those skilled in the art. The purification process may be monitored
using Western blot techniques or radioimmunoassay or other standard immunoassay techniques.
Protein purification techniques are commonly known and used by those in the art (see R. Scopes,
214/503
Protein Purification: Principles and Practice, Springer-Verlag, New York 1982: Deutscher, Guide to
Protein Purification, Academic Press (1990). Embodiments of the present invention provide a method
of producing a recombinant protein in which the expression vector includes one or more elements
including a promoter-enhancer sequence, a selection marker sequence, an origin of replication, an
epitope-tag encoding sequence, and an affinity purification-tag encoding sequence. In one preferred
embodiment, the nucleic acid construct includes an epitope-tag encoding sequence and the isolating
step includes use of an antibody specific for the epitope-tag. In another preferred embodiment, the
nucleic acid construct contains a polyamino acid encoding sequence and the isolating step includes use
of a resin comprising a polyamino acid binding substance, preferably where the polyamino acid is
polyhistidine and the polyamino binding resin is nickel-charged agarose resin. In yet another preferred
embodiment, the nucleic acid construct contains a polypeptide encoding sequence and the isolating step
includes the use of a resin containing a polypeptide binding substance, preferably where the
polypeptide is a chitin binding domain and the resin contains chitin-sepharose.
[0364] The polypeptides of the present invention cam be synthesized using non-cellular synthetic
methods known to those in the art. Techniques for solid phase synthesis are described by Barany and
Mayfield, Solid-Phase Peptide Synthesis, pp. 3-284 in the Peptides: Analysis, Synthesis, Biology,
Vol.2 Special Methods in Peptide Synthesis, Part A; Merrifield, et al., J. Am. Chem. Soc. 85:2149-56
(1963) and Stewart et al., Solid Phase Peptide Synthesis, 2>;nd ; ed. Pierce Chem. Co., Rockford, Ill.
(1984).
[0365] The present invention further provides a method for modifying (i.e. increasing or decreasing)
the concentration or composition of the polypeptides of the invention in a plant or part thereof.
Modification can be effected by increasing or decreasing the concentration and/or the composition (i.e.
the ration of the polypeptides of the present invention) in a plant. The method comprised introducing
into a plant cell with an expression cassette comprising a nucleic acid molecule of the present
invention, or an nucleic acid encoding a RAR1 sequence as described above to obtain a transformed
plant cell or tissue, culturing the transformed plant cell or tissue. The nucleic acid molecule can be
under the regulation of a constitutive or inducible promoter. The method can further comprise inducing
or repressing expression of a nucleic acid molecule of a sequence in the plant for a time sufficient to
modify the concentration and/or composition in the plant or plant part.
[0366] A plant or plant part having modified expression of a nucleic acid molecule of the invention
can be analyzed and selected using methods known to those skilled in the art such as, but not limited to,
Southern blot, DNA sequencing, or PCR analysis using primers specific to the nucleic acid molecule
and detecting amplicons produced therefrom.
[0367] In general, concentration or composition in increased or decreased by at least 5%, 10%, 20%,
30%, 40%, 50%, 60%, 70%, 80% or 90% relative to a native control plant, plant part or cell lacking the
expression cassette.
[0368] The invention will be further described by reference to the following detailed examples.
These examples are provided for purposes of illustration only, and are not intended to be limiting
unless otherwise specified.
EXAMPLES
[0369] Standard recombinant DNA and molecular cloning techniques used here are well known in
the art and are described by J. Sambrook, et al., Molecular Cloning: A Laboratory Manual, 3d Ed.,
Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press (2001); by T. J. Silhavy, M. L.
Berman, and L. W. Enquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold
Spring Harbor, N.Y. (1984) and by Ausubel, F. M. et al., Current Protocols in Molecular Biology, New
York, John Wiley and Sons Inc., (1988), Reiter, et al., Methods in Arabidopsis Research, World
Scientific Press (1992), and Schultz et al., Plant Molecular Biology Manual, Kluwer Academic
Publishers (1998).
Example 1
Identification of Nucleic Acid Molecules (cDNAs) from Rice
[0370] A list of over 250 genes from diverse plant species was compiled based on their adjudged
potential to confer an agronomic trait in a crop plant. Genes were identified by the species name and
the name of the gene. For example the Arabidopsis ethylene insensitive 2 (EIN2) gene is referred to as
AtEIN2. The traits of interest included, but were not limited to, disease resistance, abiotic stress
tolerance, enhanced nutritional value, yield, flowering time, and hormone response. These genes were
conceptually translated, and the resultant predicted peptides encoded by these genes (defined as
215/503
"queries") were used to search for similar genes in the Syngenta/Myriad Genetics proprietary rice
genomic database ( Myriad contigs version 8). Similarity searching was done using the TBlastN
algorithm and both a Blosum 62 and a Pam70 matrix, with other parameters at default settings. Similar
results were obtained with the two matrices. Searches were carried out on the TimeLogic DeCypher
server at TMRI in San Diego, or locally, using the same database. High scoring genomic contig hits (P
value >;10>;-10; ) were designated as containing homologs; the highest scoring genomic contig was in
most, but not all, cases designated as containing the rice ortholog. Orthologs were given an "Os"
designation in front of their gene. Thus, the rice ortholog to the AtEIN2 query was designated OsEIN2.
In exceptional cases, more than one putative rice ortholog to a single query was identified and further
pursued (eg. OsEIN2, OsEIN2b, etc. . . ).
[0371] The rice ortholog thus identified resided in a contiguous stretch ("genomic contig") of rice
genomic DNA sequence. Various commercially available gene prediction algorithms (FGENESH,
GenMark, GenMarkHMM, Genescan, GeneWise) were used to predict partial or full-length cDNAs of
the rice orthologs. Predicted cDNAs (sequences in SBI predicted cDNAs.doc; conceptual translations
in SBI predicted peptides) were used to search a database of assembled consensus sequences of
sequenced rice cDNA library clones ("cDNA contigs") using BlastN with default settings on the
TimeLogic DeCypher server at TMRI in San Diego. cDNA contigs with identity or near-identity to the
predicted cDNA were identified and DNA from the longest cDNA clone was obtained from stocks at
Torrey Mesa Research Institute ("TMRI") (San Diego). Additional cDNAs were obtained from
designing primers to the full-length, or partial predicted cDNAs, amplifying the cDNAs by PCR from
rice cDNA libraries or first-strand cDNA, and cloning them by conventional TA cloning or
Gateway(TM) technology (using pCR2.1TOPO or pDONR201 vectors (Invitrogen), respectively). In
either case, cDNA clones were sequenced to confirm their identity. These cDNAs constitute a subset of
those included in the SBI predicted cDNAs and are physical DNA clones that have been validated by
sequencing (Listing 3) and by comparing them against the original target rice ortholog sequence using
similarity search algorithms as outlined above. BLASTX-compares a translation of the DNA
sequencing in 6 frames to a protein database. The protein database used was GenBank non-reduntant
peptides.
[0372] To assign function to these genes, the conceptual translations of the sequences in SBI
Predicted cDNAs.doc and in SBI cDNAs.doc were used to search the SwissProt protein database and
GenPept non-redundant conceptual translation database using the BlastP algorithm at default settings.
Functional assignments to rice cDNAs, based on similarity for the corresponding peptides to proteins
and genes of known function, are included in Tables 1-4 and the Examples below.
Example 2
Cloning and Sequence of Nucleic Acid Molecules from Rice
[0373] The longest clones corresponding to full-length contigs identified in the rice cDNA library
were streaked out and DNA. was made from these cells. Alternatively, oligonucleotide primers to the 5'
and 3' ends end of the predicted gene, and inclusive of the predicted start and stop codons, were used to
PCR amplify the gene from rice first strand cDNA or the cDNA library. In some instances, these PCR
primers included additional 5' sequences for Gateway(TM) recombination-based cloning (invitrogen).
PCR amplification was carried out using the HF Advantage II (Clonetech) or EXPAND (Roche) PCR
kits according to the manufacturer's instructions. PCR products were cloned into pCR2.1-TOPO or
pDONR201 according to the manufacturer's instructions (Invitrogen).
[0374] DNA preps for 24 independent clones was miniprepped following the manufacturer's
instructions. DNA was subjected to sequencing analysis using the BigDyeT(TM) Terminator Kit
according to manufacturer's instructions (ABI). Sequencing made use of primers designed to both
strands of the predicted gene. Alternatively, the DNA was transformed into a strain with an active
transposon, followed by sequencing of random independent colonies using primers from each of the
transposon ends using the EZ::TN(TM) TET-1 Insertion kit (Epicentre). All sequencing data were
analyzed and assembled using the Phred/Phrap/Consed software package (University of Washington)
to an error ratio equal to or less than 10>;-4 ; at the consensus sequence level.
[0375] Consensus sequences were validated as being intact and the correct gene in several ways. The
coding region was checked for being full length (predicted start and stop codons present) and
uninterrupted (no internal stop codons). Alignment with the gene prediction and BLAST analysis was
used to ascertain if this was the intended target gene. Most of the cDNA clones included 5' and 3'
untranslated sequences, providing additional evidence that these were indeed full length. In some
instances, silent or missense changes were observed (changes encoding the same or a different amino
216/503
acid, respectively). These changes were most likely due to sequencing errors in the genomic reference
sequence, although errors generated during PCR amplification could not be completely ruled out for
clones generated using PCR.
[0376] Full-length cDNA clones or full-length open reading frames generated by PCR were cloned
into custom-made binary destination vectors using Gateway(TM) recombination-based cloning per the
manufacturer's instructions (Invitrogen). Alternatively, PCR products were cloned using conventional
restriction enzyme-based cloning.
Example 3
Expression Vectors and Tranformation of Plants
[0377] Binary destination vectors for plant transformation consist of a binary backbone and a TDNA portion. The binary backbone contains the sequences necessary for selection and growth in
Escherichia coli DH-5- (Invitrogen) and Agrobacterium tumefaciens LBA4404, including the bacterial
spectinomycin antibiotic resistance aadA gene from E. coli transposon Tn7, origins of replication for E.
coli (ColE1) and A. tumefaciens (VS1), and the A. tumefaciens virG gene. The T-DNA portion was
flanked by the right and left border sequences and includes the Positech(TM) (Syngenta) plant
selectable marker and a gene expression cassette which varies depending on the application. The
Positech(TM) plant selectable marker in this instance consists of a rice ACT1 (actin) promoter driving
expression of the PMI (phosphomannose isomerase) gene, followed by the cauliflower mosaic virus
transcriptional terminator, and confers resistance to mannose.
[0378] The gene expression cassette portion of the binary destination vectors varies depending on
the application. In general, the cassette consists of a promoter designed to express the gene in certain
tissues of the plant, followed by cloning sites (in some cases interrupted by a segment of spacer DNA),
and finally by the A. tumefaciens nos 3' end transcriptional terminator. The promoters used are
designed to express the gene of interest in specific target tissues (eg. endosperm: maize ADPgpp or -zein, or barley --thionin; eg. embryo: maize globulin or oleosin; eg. aleurone: barley a-amylase; eg.
root: maize MSR1 and MRS3; eg. green tissue: maize PEPC) or constitutively (eg. maize UBI plus
intron), depending on the gene of interest. The cloning site contains either unique restriction enzyme
sites (for conventional cloning) and/or a Gateway(TM) recombination-based cloning cassette
(Invitrogen), in either the forward or reverse orientation. In gene expression cassettes designed for
double-stranded interfering RNA (dsRNAi) production, the cloning site is divided by a spacer region
(eg. first intron of the rice SH1 gene), thus permitting the cloning of two gene fragments, in the forward
and reverse orientations respectively. dsRNAi and antisense are two technologies available for
silencing genes of interest.
[0379] Transformation of the nucleic acid molecules of the present invention into plants is
performed using methods described above in the Detailed Description.
Example 4
Abiotic Stress Tolerance cDNAs and Analysis
[0380] The function of the protein encoded by each abiotic stress tolerance gene is determined from
analysis of the open reading frame (ORF) in each cDNA as described in Example 1. Table 1 describes
the assigned functions for the abiotic stress tolerance genes described in this application.
>;tb;TABLE 1
>;tb;Abiotic Stress Tolerance Genes
>;tb;>;sep;SEQ ID>;sep;Putative Function & Similar>;sep;>;sep;Homology Reference
>;tb;Gene>;sep;Nos:>;sep;Genes>;sep;E value>;sep;and % Homology
>;tb;ABF3>;sep;1-2>;sep;drought tolerance>;sep;1.00E-100>;sep;Hobo et al., Proc. Natl.
>;tb;>;sep;>;sep;TRAB1 from rice (Oryza>;sep;>;sep;Acad. Sci. U.S.A. 96
>;tb;>;sep;>;sep;sativa) - bZIP transcription>;sep;>;sep;(26), 15348-15353
>;tb;>;sep;>;sep;factor, interacts with VP1>;sep;>;sep;(1999)
>;tb;>;sep;>;sep;transcription factor, a key>;sep;>;sep;203/326 (62%)
>;tb;>;sep;>;sep;regulator of ABA
>;tb;>;sep;>;sep;response genes. ABA
>;tb;>;sep;>;sep;plant hormone mediates
>;tb;>;sep;>;sep;drought tolerance
>;tb;>;sep;>;sep;response.
>;tb;ASK1>;sep;3-4>;sep;drought & salt tolerance>;sep;1.00E-162>;sep;Yoon et al., Mol. Gen.
217/503
>;tb;>;sep;>;sep;Protein kinase SPK-3>;sep;>;sep;Genet. 255 (4), 359-371
>;tb;>;sep;>;sep;from soybean (Glycine>;sep;>;sep;(1997)
>;tb;>;sep;>;sep;max); upregulated by>;sep;>;sep;279/365 (76%)
>;tb;>;sep;>;sep;drought and salt.
>;tb;ES147>;sep;5-6>;sep;salt tolerance>;sep;0>;sep;Galvez et al., Plant
>;tb;>;sep;>;sep;E5I47 protein kinase from>;sep;>;sep;Physiol. 103, 257-265
>;tb;>;sep;>;sep;Lophopyrum elongatum;>;sep;>;sep;(1993)
>;tb;>;sep;>;sep;upregulated by salt stress.>;sep;>;sep;365/442 (82%)
>;tb;FAD8>;sep;7-8>;sep;cold tolerance>;sep;0>;sep;Horiguchi et al.,
>;tb;>;sep;>;sep;Fatty acid desaturase>;sep;>;sep;Physiol. Plantarum 96,
>;tb;>;sep;>;sep;from wheat (Triticum>;sep;>;sep;275-283 (1996)
>;tb;>;sep;>;sep;aestivum); overexpression>;sep;>;sep;300/353 (84%)
>;tb;>;sep;>;sep;of Arabidopsis thaliana
>;tb;>;sep;>;sep;gene confers cold
>;tb;>;sep;>;sep;tolerance.
>;tb;SAL1>;sep; 9-10>;sep;salt tolerance>;sep;0>;sep;Peng and Verma, J.
>;tb;>;sep;>;sep;3'(2'),5'-bisphosphate>;sep;>;sep;Biol. Chem. 270 (49),
>;tb;>;sep;>;sep;nucleotidase from rice>;sep;>;sep;29105-29110 (1995)
>;tb;>;sep;>;sep;(Oryza sativa);>;sep;>;sep;355/358 (99%)
>;tb;>;sep;>;sep;overexpression enhances
>;tb;>;sep;>;sep;salt tolerance
[0381] The abiotic stress tolerance genes are evaluated for their effect(s) in transformed plants by
testing the transgenic transformed plants or progeny plants as compared with non-transgenic plants.
The plants are tested for their altered tolerance cold, drought, salt and heat using methods known to
those skilled in the art, and examples of such assays are described below.
[0382] Cold tolerance is tested by placing transgenic and non-transgenic plants of the same age in
growth chambers at 5[deg.] C., with a 12 hr light/dark cycle, at 80% humidity for 72 hours. The plants
are observed for enhanced tolerance or sensitivity to cold.
[0383] Tolerance to salt is measured by using any salt tolerance assay known to those skilled in the
art. In particular, the salt tolerance assay is performed essentially as follows:
[0384] Seeds from transformed plants and untransformed parental lines are sown on filter paper
soaked with Yoshida solution placed in petri dishes. After 7 days of growth in the climate chamber
seedlings (about 4 cm shoot length and 4 cm root length) will be exposed to salt stress as follows:
seedlings will be transferred to 24 well plates supplemented with Yoshida solution (control) or Yoshida
solution enriched with two different salt concentrations (as below). To ensure the contact of the entire
root with the solution a piece of moistened absorbent cotton is placed on top of the root within the well
flooded with the solution. Alternatively, the seeds may be grown in sand as a growth medium.
Control: Yoshida Solution Without Supplementary Salt
[0386] 1) Yoshida solution enriched with NaCl 3.2 mg/l (48 mM)+CaCl2 3.6 mg/l (24 mM). This
salt concentration evoked 50% growth reduction in shoot length.
[0387] 2) Yoshida solution enriched with NaCl 6.4 mg/l (96 mM)+CaCl2 7.1 mg/l (48 mM).
[0388] Tissue is harvested at: 0, 6, 12, 24, and 36 hours. After exposure, the seedlings are separated
into shoots and roots, or whole seedlings (whichever you prefer) and then immediately frozen in liquid
nitrogen for RNA extraction and analysis. Total RNA extraction is performed using any known method
in the art such as, an RNA extraction kit from Qiagen.
[0389] Alternatively, seedlings are observed for enhanced or decreased tolerance to grown under salt
stress as compared to the untransformed parental variety or line. Samples are also taken for analysis of
protein expression.
>;tb;Yoshida Solutions
>;tb;>;sep;>;sep;Stock preparation>;sep;Culture solution>;sep;Final conc.
>;tb;Elem.>;sep;Chemical names>;sep;(g/10 L stock)>;sep;(ml stock/10 L solutions)>;sep;(mM (ppm))
>;tb;(Macro)>;sep;>;sep;>;sep;>;sep;>;sep;
>;tb;N>;sep;NH4NO3>;sep;914>;sep;12.5>;sep;1.43>;sep;mM (114 pm)
>;tb;P>;sep;NaH2PO4.2H2O>;sep;403>;sep;12.5>;sep;0.33>;sep;mM (51 ppm)
>;tb;K>;sep;K2SO4>;sep;714>;sep;12.5>;sep;0.51>;sep;mM (89 ppm)
>;tb;Ca>;sep;CaCl2>;sep;886>;sep;12.5>;sep;1.0>;sep;mM (111 ppm)
>;tb;Mg>;sep;MgSO4.7H2O>;sep;3240>;sep;12.5>;sep;1.6>;sep;mM (394 ppm)
>;tb;(Micro)*
>;tb;Mn>;sep;MnCl2.4H2O>;sep;15-20>;sep;>;sep;;0.01>;sep;mM
218/503
>;tb;Mo>;sep;(NH4)6.MO7O24.4H2O>;sep;1.5>;sep;>;sep;1.5 * 10>;-4; >;sep;mM
>;tb;B>;sep;H3BO3>;sep;12>;sep;>;sep;0.02>;sep;mM
>;tb;Zn>;sep;ZnSO4.7H2O>;sep;0.7>;sep;>;sep;3 * 10>;-4; >;sep;mM
>;tb;Cu>;sep;CuSO4.5H2O>;sep;0.31>;sep;>;sep;1.6 * 10>;-4; >;sep;mM
>;tb;>;sep;Citric acid>;sep;119>;sep;12.5 of mixture>;sep;0.071>;sep;mM
>;tb;(Iron)
>;tb;Fe>;sep;Iron chelate>;sep;160>;sep;12.5
>;tb;*Mix microelements in 10 L distilled water in the order above.
>;tb;pH, 5.8 adjust with H2SO4 if necessary
[0390] For drought tolerance, substitute 20% polyethylene glycol (PEG; MW 8000) for the salt
solution.
Example 5
Disease Resistance Genes and Analysis
[0391] The function of the protein encoded by each disease resistance gene is determined from
analysis of the open reading frame (ORF) in each cDNA as described in Example 1. Table 2 describes
the assigned functions for the disease resistance genes described in this application.
>;tb;TABLE 2
>;tb;Disease Resistance Genes
>;tb;>;sep;>;sep;>;sep;>;sep;Homology
>;tb;>;sep;SEQ>;sep;Putative Function>;sep;>;sep;Reference and
>;tb;Gene>;sep;ID NO:>;sep;and Similar Genes>;sep;E value>;sep;% Homology
>;tb;AOS2>;sep;11-12>;sep;disease resistance>;sep;1.00E-163>;sep;Sivasankar
>;tb;>;sep;>;sep;Allene oxide>;sep;>;sep;et al.,
>;tb;>;sep;>;sep;synthase from>;sep;>;sep;unpublished
>;tb;>;sep;>;sep;tomato>;sep;>;sep;271/418 (64%)
>;tb;>;sep;>;sep;(Lycopersicon
>;tb;>;sep;>;sep;esculentum); key
>;tb;>;sep;>;sep;jasmonic acid
>;tb;>;sep;>;sep;biosynthetic
>;tb;>;sep;>;sep;enzyme gene.
>;tb;BWMK1>;sep;13-14>;sep;disease resistance>;sep;0>;sep;He et al., Mol.
>;tb;>;sep;>;sep;MAP kinase from>;sep;>;sep;Plant Microbe
>;tb;>;sep;>;sep;rice (Oryza sativa);>;sep;>;sep;Interact.
>;tb;>;sep;>;sep;upregulated by>;sep;>;sep;12: 1064-1073
>;tb;>;sep;>;sep;pathogen infection.>;sep;>;sep;(1999).
>;tb;>;sep;>;sep;>;sep;>;sep;505/506 (99%)
>;tb;DDE1>;sep;15-16>;sep;disease resistance>;sep;1.00E-170>;sep;Strassner et al.,
>;tb;>;sep;>;sep;12->;sep;>;sep;unpublished
>;tb;>;sep;>;sep;oxophytodienoate>;sep;>;sep;283/374 (75%)
>;tb;>;sep;>;sep;reductase 3 from
>;tb;>;sep;>;sep;tomato
>;tb;>;sep;>;sep;(Lycopersicon
>;tb;>;sep;>;sep;esculentum) - key
>;tb;>;sep;>;sep;jasmonic acid
>;tb;>;sep;>;sep;biosynthetic
>;tb;>;sep;>;sep;enzyme gene.
>;tb;ERF1>;sep;17-18>;sep;disease resistance>;sep;2.00E-36 >;sep;Solano et al.,
>;tb;>;sep;>;sep;Arabidopsis>;sep;>;sep;Genes Dev.
>;tb;>;sep;>;sep;thaliana ethylene>;sep;>;sep;12(23):
>;tb;>;sep;>;sep;reponse factor>;sep;>;sep;3703-3714
>;tb;>;sep;>;sep;transcription factor.>;sep;>;sep;(1998)
>;tb;>;sep;>;sep;Ethylene plant>;sep;>;sep;80/140 (57%)
>;tb;>;sep;>;sep;hormone mediates
>;tb;>;sep;>;sep;defense responses.
>;tb;JISP6>;sep;19-20>;sep;disease resistance>;sep; 1E-126>;sep;Sasaki et al.,
>;tb;>;sep;>;sep;Bowman Birk>;sep;>;sep;unpublished
>;tb;>;sep;>;sep;trypsin inhibitor>;sep;>;sep;194/195 (99%)
219/503
>;tb;>;sep;>;sep;from rice (Oryza>;sep;>;sep; 61/145 (42%)
>;tb;>;sep;>;sep;sativa); induced by
>;tb;>;sep;>;sep;jasmonic acid, plant
>;tb;>;sep;>;sep;hormone mediating
>;tb;>;sep;>;sep;plant defense
>;tb;>;sep;>;sep;responses.
>;tb;LOX1>;sep;21-22>;sep;disease resistance>;sep;0>;sep;Peng et al., J.
>;tb;>;sep;>;sep;Lipoxygenase from>;sep;>;sep;Biol. Chem.
>;tb;>;sep;>;sep;rice (Oryza sativa)>;sep;>;sep;269 (5),
>;tb;>;sep;>;sep;induced by>;sep;>;sep;3755-3761
>;tb;>;sep;>;sep;incompatible>;sep;>;sep;(1994)
>;tb;>;sep;>;sep;pathogen infection.>;sep;>;sep;906/924 (98%)
>;tb;PIPLC1>;sep;23-24>;sep;disease resistance>;sep;0>;sep;Song and
>;tb;>;sep;>;sep;Phosphoinositide->;sep;>;sep;Goodman,
>;tb;>;sep;>;sep;specific>;sep;>;sep;unpublished
>;tb;>;sep;>;sep;phospholipase C>;sep;>;sep;562/599 (93%)
>;tb;>;sep;>;sep;from rice (Oryza
>;tb;>;sep;>;sep;sativa); upregulated
>;tb;>;sep;>;sep;by pathogen
>;tb;>;sep;>;sep;infection
[0392] Assays for testing disease resistance to a variety of pathogens known to those skilled in the
art are performed on transgenic plants and non-transgenic parental lines to determine alteration in
disease resistance.
[0393] For example, but by no means limiting, such disease resistance assays are performed
essentially as described below.
Rice Detached Leaf Assay for Bacterial Blight
[0395] This example describes the disease resistance assay of the rice gene transformed rice plants
and control plants using the detached leaf assays for bacterial blight (Xanthomonas oryzae pv otyzae
(Xoo or Xanthomonas; Mmixture of isolates XOO 698 and PXO 112)). Transgenic plants are also
compared to resistance of rice plants treated with Bion(TM).
[0396] 1. Rice seedlings are planted 1 seed per pot in 4 cm*4 cm pots with a mix of 50% peat and
50% John Innes Potting compost number 3 soil. Plants are checked twice daily and spot watered if soil
appears dry on the surface. Plants are grown in a growth room (16 hour light cycle at a light intensity of
15000 [mu]Mol; 27[deg.] C. day 80% humidity; 20[deg.] C. night 90% humidity) until testing.
[0397] 2. Plants treated with Bion(TM) (formulation type and strength e.g. azibenzolar-s-methly 800
g/kg wettable powder) are subjected to soil drench application is used 7 days prior to inoculating with
bacteria. The 4 cm*4 cm pots have a volume of 40 ml with a headspace of 4 ml for the solution. Thus,
applying a 600 ppm solution to the top of the plants in the pots will result in a 60 ppm treatment. A 600
ppm solution comprises 60 mg active ingredient in 100 ml water. Dilutions from this solution are made
for treatments with lower concentrations. Prior to application of Bion(TM), the plants to be treated are
placed in saucers 2 cm deep and are not watered 24-hours pre treatment. The Bion(TM) application is
made by pipetting 40 ml of the chemical solution onto the surface of the soil in each pot. After 24 hours
post treatment the saucers are removed and normal watering regime is restored
[0398] 3. Xooanthomonas oryzae pv oryzae cultures for inoculation are produced from single isolate
bacterial stocks (kept at 4[deg.] C. stored on) 2 days prior test date. Xooanthomonas oryzae pv oryzae
bacterial cultures are grown in 500 ml nutrient broth. Bacteria are picked up on the tip of a sterile
pipette and resuspended in 500 ml nutrient broth (recipe below). Cultures are incubated at 25[deg.] C.
on a platform shaker (115 rpm) for between 1 and 4 days (typically flasks are used 2 days after
introduction of the bacteria). Successful bacterial growth is indicated by the nutrient broth becoming
opaque and a more intense yellow colour. Immediately before inoculation of leaf pieces flasks of
Isolates XOO 698 (JH code K4214) and PXO 112 (JH code K4211) are mixed to produce a dual isolate
inoculation.
[0399] 4. For the Xanthomonas detached leaf assay, plants approximately 12 weeks old are used. A
total of 15 leaf samples are cut from randomly selected plants of each line of interest (i.e. transgenic
event or non transgenic germplasm), or each individual treatment (i.e. combination of line and
chemical application). A leaf sample is a section of the leaf between 5 cm and 6 cm long, and the width
of the leaf wide, and may include the tip of the leaf. Multiple leaf samples can be obtained from one
leaf. Leaf samples are always taken from the youngest fully expanded leaf available on the plant.
220/503
[0400] Control lines and treatments are included consisting of leaf 30 leaf samples from 12-week-old
non-transgenic (wildtype) plants of the same variety as that used in the generation of the transgenic
events and 30 leaf samples from Bion(TM) treated wildtype plants (12-week-old). As some level of
senescence regularly occurs in detached leaf assays further plates of leaves that are only inoculated
with nutrient broth (i.e. uninoculated controls) are also prepared. These plates consist of 30 leaf
samples from wfildtype plants, 30 leaf samples from Bion(TM) treated wildtype plants and 15 leaf
samples from 2 transgenic lines selected at random. These control plates allow assessors to clearly
establish the difference in appearance between disease symptomology and unrelated senescence in the
leaf samples.
[0401] 5. Leaf samples are placed adaxial side up onto petri dishes containing 1% tap water agar
amended with 75 ppm benzimidazole. Leaf samples are fully randomised between plates with a
maximum of 6 samples per plate.
[0402] 6. Leaf samples are inoculated individually with a syringe by twice injecting approximately
0.1 ml of Xooanthomonas oryzae pv ofyzae (isolates XOO 698 mixed with PXO 112) bacterial culture
solution into the tip end of the leaf sample (one injection either side of the vascular bundle).
Inoculations are completed in a laminar flow hood to reduce contamination of the bacterial cultures.
After inoculation the plates are placed into a controlled environment incubator with conditions set at
32[deg.] C. day, 25[deg.] C. night and a 16 hour light cycle. A maximum humidity of 90% is
maintained in the cabinet throughout the plate incubation time.
[0403] Assessments of disease development and senescence levels are completed every 48 hours, for
up to 10 days after inoculation. Assessments made after 2 days for "spontaneous suicide" and every 3
days for curl, health and levels of "ooze." The key indication of disease establishment within the leaf
sample was the presence of yellow bacterial exudates (ooze) at one or both cut ends of the leaf. Lower
incidence of exudates is a measure of decreased disease development and, hence, enhanced disease
resistance and in the line(s) of interest resistance within the leaf sample.
[0404] The data for the blight assay is collated from the levels of ooze that is observed on the leaf
pieces. Ooze is a symptom of XZanthomonas infection documented as occurring in detached leaf
assays and is based on a method described by G. L. Xie (Plant Disease 82:1007-1011 (September
1998). Ooze manifests as a yellow exudated that occurs at the cut ends of an infected leaf. Leaf pieces
are scored differently depending on if the ooze is observed at the inoculated end only or if the ooze had
developed through the leaf and is also present at the opposing end of the leaf to the end innocuated. It is
assumed that if ooze is observed at both ends, the leaf sample is exhibiting no resistance to the disease.
If the inoculated end only exhibited ooze, there is some indication that the leaf piece is showing some
resistance to the disease. If no ooze is observed at either end of the leaf piece there is an indication of
strong resistance to the disease. Leaf pieces are scored as having presense or absense of ooze at each
end (no quantification of the amount of ooze present). Transgenic plants expressing disease resistance
genes show improved disease resistance and produce less ooze than wildtype plants.
Recipes
[0406] Nutrient broth for Xanthornonas oryzae pv oiyzae inoculum production 6.5 g Nutrient Broth
(Oxoid CM1) into 500 ml Demonized Water. Stir until fully dissolved (about 5 minutes). Autoclave at
121[deg.] C. for 20 minutes.
Rice Assay for Rice Blast Disease (Caused by Pyricularia Grisea; Also Known as Magnaporthe
Grisea)
[0408] This example describes the bioassay for resistance of RAR1 transgenic rice to rice blast
Pyricularia grisea (strain K4005).
[0409] 1. Rice seedlings are planted 1 seed per pot in 4 cm*4 cm pots with a mix of 50% peat and
50% John Innes Potting compost number 3 soil. Plants are checked twice daily and spot watered if soil
appears dry on the surface. Plants are grown in a growthroom (16 hour light cycle at a light intensity of
15000 [mu]Mol; 27[deg.] C. day 80% humidity; 20[deg.] C. night 90% humidity) until testing.
[0410] 2. Plants treated with Bion, are treated using a drench application 7 days prior to inoculation.
The 4 cm*4 cm diameter pots have a volume of 150 mis with a headspace of 15 mls for the solution.
Thus, applying a 600 ppm solution to the top of the plants in the pots will result in a 60 ppm treatment.
A 600 ppm solution is made up of 60 mg active ingredient in 100 ml water. Make dilutions from that
solution for treatments with lower concentrations.
[0411] 3. Pyricularia grisea inoculum is prepared from 5 day old single isolate stock plates (kept at
25[deg.] C. on rice leaf extract agar-recipe below) immediately before required for inoculation. 20 ml
sterile deionised water is added to a plate of Pyricularia grisea, which is then rubbed with a small soft
brush to encourage the spores into solution. The resulting spore and mycelium solution is then filtered
through one layer of fine mesh muslin. Spores are counted in with using haemocytometer and the
221/503
inoculum solution was diluted to produce a concentration of 200,000 spores/ml. The inoculum is used
within one hour of production. It is recommended to allow 5 ml of inoculum per plate. Rice leaf extract
agar for Pyricularia inoculum production: 45 g Czapek Dox Agar, 10 g Oxide Agar No.3, 1000 ml rice
leaf extract. Extract 50 g of dried straw with 1000 ml of water at 100[deg.] C. for 1 hour. Autoclave at
121[deg.] C. for 20 minutes.
[0412] For the Pyricularia grisea detached leaf assay plants approximately 12 weeks old were used.
A total of 15 leaf samples are cut from randomly selected plants of each line of interest (i.e. transgenic
event or non transgenic germplasm), or each individual treatment (i.e. combination of line and
chemical application). A leaf sample is a section of the leaf between 5 cm and 6 cm long, and the width
of the leaf wide, and may include the tip of the leaf. Leaf pieces are placed so that both ends of the leaf
were buried into the agar as this increases the green life of the leaf samples. Multiple leaf samples can
be obtained from one leaf. Leaf samples are always taken from the youngest fully expanded leaf
available on the plant. Control lines and treatments are included consisting of leaf 30 leaf samples from
12 week old non-transgenic (wildtype) plants of the same variety as that used in the generation of the
transgenic events and 30 leaf samples from Bion(TM) treated wildtype plants (12 weeks old). As some
level of senescence regularly occurs in detached leaf assays further plates of leaves that are inoculated
with only sterile deionized water (i.e. uninoculated controls) were also prepared. These plates consisted
of 30 leaf samples from wildtype plants, 30 leaf samples from Bion(TM) treated wildtype plants and 15
leaf samples from 2 transgenic lines selected at random. These control plates allow assessors to
establish clearly the difference in appearance between disease symptomology and unrelated senescence
in the leaf samples.
[0413] 5. Leaf samples are placed adaxial surface upwards onto petri dishes containing 1% tap water
agar amended with 75 ppm benzimidazole. Leaf samples are fully randomised .between plates with a
maximum of 6 samples per plate.
[0414] 6. Inoculum is sprayed onto the plates using a Devilbiss spray gun. Leaf pieces are sprayed to
produce an equal coverage of droplets over the exposed leaf surface. The petri dish plate lids are
replaced immediately and plates are incubated in a controlled environment cabinet for up to 8 days
(conditions-14 hour light cycle; 24[deg.] C. day; 24[deg.] C. night constant 90% humidity).
[0415] 7. Plates are assessed for disease development (expressed as a estimated % disease coverage)
and senescence levels every 48 hours for up to 8 days.
Medium for Xanthomonas otyzae pv oryzae Storage-Wakimoto Media
[0417] The data from the rice blast assay show that the transgenic lines assayed showed less disease
coverage than the wildtype Kaybonnet rice line, demonstrating enhanced disease resistance in these
lines. The wildtype treated with Bion(TM) showed the expected effect of decreased disease coverage.
[0418] This data clearly demonstrates that overexpression of the disease resistance gene in
transgenic plants enhances disease resistance.
Example 6
Grain Quality and Nutritional Composition Genes and Analysis
[0419] The function of the protein encoded by each grain quality or nutritional composition gene is
determined from analysis of the open reading frame (ORF) in each cDNA as described in Example 1.
Table 3 describes the assigned functions for these genes described in this application.
>;tb;TABLE 3
>;tb;Grain Quality and Nutritional Composition Genes
>;tb;>;sep;SEQ>;sep;Putative Function and>;sep;>;sep;Homology Reference and %
>;tb;Gene>;sep;ID NO>;sep;Similar Gene>;sep;E value>;sep;Homology
>;tb;BT1>;sep;25-26>;sep;starch level>;sep;8.00E-70 >;sep;Sullivan et al., Plant Cell 3
>;tb;>;sep;>;sep;Adenylate transporter>;sep;>;sep;(12), 1337-1348 (1991)
>;tb;>;sep;>;sep;from maize (Zea mays) ->;sep;>;sep;165/305 (54%)
>;tb;>;sep;>;sep;brittle-1, key starch>;sep;>;sep; 53/165 (32%)
>;tb;>;sep;>;sep;biosynthesis protein>;sep;>;sep; 29/90 (32%)
>;tb;BTH1>;sep;27-28>;sep;thiamin level>;sep;1.00E-180>;sep;Theologis et al., Nature 408
>;tb;>;sep;>;sep;Arabidopsis thaliana>;sep;>;sep;(6814), 816-820 (2000)
>;tb;>;sep;>;sep;phosphomethylpyrimidine>;sep;>;sep;328/499 (65%)
>;tb;>;sep;>;sep;kinase - thiamin B vitamin
>;tb;>;sep;>;sep;biosynthetic enzyme gene
>;tb;DHPS1>;sep;29-30>;sep;lysine level>;sep;1.00E-139>;sep;Suh et al., unpublished
>;tb;>;sep;>;sep;Dihydrodipicolinate>;sep;>;sep;308/336 (91%)
222/503
>;tb;>;sep;>;sep;synthase from rice (Oryza
>;tb;>;sep;>;sep;sativa) - key lysine
>;tb;>;sep;>;sep;biosynthetic enzyme
>;tb;FER>;sep;31-32>;sep;iron level>;sep;1.00E-139>;sep;Wu et al., unpublished
>;tb;>;sep;>;sep;Ferritin iron storage>;sep;>;sep;251/255 (98%)
>;tb;>;sep;>;sep;protein from rice (Oryza
>;tb;>;sep;>;sep;sativa).
>;tb;FER1>;sep;33-34>;sep;iron level>;sep;1.00E-135>;sep;Wu et al., unpublished
>;tb;>;sep;>;sep;Ferritin iron storage>;sep;>;sep;245/255 (96%)
>;tb;>;sep;>;sep;protein from rice (Oryza
>;tb;>;sep;>;sep;sativa).
>;tb;GAMYB1>;sep;35-36>;sep;enzyme activation>;sep;0>;sep;Gubler, F. et al. Plant Cell
>;tb;>;sep;>;sep;Myb transcription factor>;sep;>;sep;Physiol. 38(3): 362-365
>;tb;>;sep;>;sep;from rice; barley ortholog>;sep;>;sep;(1997)
>;tb;>;sep;>;sep;mediates activation of>;sep;>;sep;478/555 (86%)
>;tb;>;sep;>;sep;aleurone enzymes for
>;tb;>;sep;>;sep;mobilization of endoperm
>;tb;>;sep;>;sep;food stores for the
>;tb;>;sep;>;sep;developing embryo.
>;tb;GTMT>;sep;37-38>;sep;vitamin E level>;sep;1.00E-120>;sep;Shintani and DellaPenna,
>;tb;>;sep;>;sep;Arabidopsis thaliana>;sep;>;sep;Science 282(5396): 2098-2100
>;tb;>;sep;>;sep;gamma-tocopherol>;sep;>;sep;(1998)
>;tb;>;sep;>;sep;methyltransferase, key>;sep;>;sep;215/331 (64%)
>;tb;>;sep;>;sep;Vitamin E biosynthetic
>;tb;>;sep;>;sep;enzyme. Overexpression
>;tb;>;sep;>;sep;in Arabidopsis increases
>;tb;>;sep;>;sep;Vitamin E levels.
>;tb;ISPE>;sep;39-40>;sep;vitamin A level>;sep;1.00E-154>;sep;Lawrence et al., Plant Mol.
>;tb;>;sep;>;sep;4-diphosphocytidyl-2-C->;sep;>;sep;Biol. 33 (3), 483-492 (1997)
>;tb;>;sep;>;sep;methyl-D-erythritol kinase>;sep;>;sep;258/336 (76%)
>;tb;>;sep;>;sep;from tomato
>;tb;>;sep;>;sep;(Lycopersicon
>;tb;>;sep;>;sep;esculentum) - key Vitamin
>;tb;>;sep;>;sep;A biosynthetic enzyme.
>;tb;OHP1>;sep;41-42>;sep;protein level>;sep;0>;sep;Nakase et al., Plant Mol.
>;tb;>;sep;>;sep;bZIP transcription factor>;sep;>;sep;Biol. 33 (3), 513-522 (1997)
>;tb;>;sep;>;sep;from rice (Oryza sativa);>;sep;>;sep;423/425 (99%)
>;tb;>;sep;>;sep;positive regulator of seed
>;tb;>;sep;>;sep;storage protein genes.
[0420] Assays for testing for a variety of grain quality or nutritional composition qualities known to
those skilled in the art are performed on transgenic plants and non-transgenic parental lines to
determine alteration in any such qualities.
[0421] For example, but by no means limiting, such quality assays are performed essentially as
described below.
[0422] An assay to analyze alterations in vitamin E content or beta-carotene (pro-vitamin A) content
are performed essentially as described using high performance liquid chromatography (HPLC) in
Fraser et al. Plant J. (2000) 24:551-458.
[0423] Assays for alteration of iron content are performed essentially as described in Goto et al.
(1999) Nat. Biotech. 17:282-286 or Kamachi et al. (1992) Plant Physiol. 99:1481-1486.
[0424] Assays for alteration of enhanced phosphorus uptake are performed by growing plants under
phosphorus limiting conditions for their entire life cycle, and growth (final dry mass) and yield (seed
size and weight) are measured essentially as described in Fohse et al. (1988) Plant Soil 110:101-109.
[0425] Assays for alterantion of thiamin levels are performed essentially as described in Esteve et al.
(2001) J. Agric. Food Chem. 49:1450.
[0426] The malting assays below are used for analyzing alterations due to the presence of
GAMYB1. Malt and bacterial beta glucanase and cellulase assay procedure (azo barley glucan method)
from Megazyme, Megazyme Int'l Ireland Ltd., Bray, co. Wicklow, Ireland, www.megazyme.com and
the Amylazyme- alpha- amylase assay procedure from Megazyme.
[0427] A preferred assay for amino acid content of seeds is as follows:
223/503
[0428] Prepare: 80% EtOH in 45[deg.] C. water bath; 80% EtOH at room temp.; hexane; sealable
glass tubes; 2M NH4OH; 0.02M HCl; ddH2O; and Dowex columns.
[0429] This protocol has been used for extraction of amino acids from seeds at 4DAF to mature. All
samples are stored at -30[deg.] C. until extraction. Seeds are separated from the siliques and counted.
Approximately 600 seeds are required for the each sample. This protocol is for extraction from
approximately 600 seeds. Amino acids are quantified according to amount per 100 seeds (total
amount), NOT amount per mg seeds (concentration). We believe this is a more accurate approach.
Crude Extract Preparation:
[0431] Homogenise approximately 600 seeds in 1 ml 45[deg.] C. 80% EtOH
1. Split the sample into 2 eppendorf tubes
2. Rinse the homogeniser 4 times with 300 [mu]l of 45[deg.] C. 80% EtOH, transfering each rinse
evenly into the 2 eppen tubes
3. Centrifuge sample at 5,000 rpm for 10 min at 4[deg.] C.
4. Transfer sup to fresh eppen tubes on ice
5. Re-suspend pellets in 100 [mu]l of 45[deg.] C. 80% EtOH (pellet wash)
6. Vortex to re-suspend and place on shaker for 5 min
7. Centrifuge sample at 5,000 rpm for 10 min at 4[deg.] C.
8. Transfer sup to the eppen tubes on ice
9. Supernatant fraction: Soluble amino acids fraction Pellet fraction: Protein-bound amino acids
fraction
[0441] For the soluble amino acids fraction, go direct to Dowex Column Purification (step 23). For
the protein-bound fraction, continue with Extraction of Protein-bound Amino Acids (step 12)
[0442] Extraction of Protein Bound Amino Acids
12. Evaporate excess EtOH by putting sample on 45[deg.] C. heat block for 3 min
13. Add 600 [mu]l hexane and vortex on shaker for 30 min (in draft hood)
14. Centrifuge sample at 5,000 rpm for 10 min at 4[deg.] C.
15. Discard sup and resuspend pellet as much as possible in 1 ml 6M HCl
16. Transfer the 2 solutions/sample into 1 sealable glass tube
17. Seal the glass tube under vacuum and incubate at 110[deg.] C. for 18 hr to hydrolyze the protein
18. After samples have cooled to rt, break open glass tube and transfer to eppen tubes
19. Dry up samples in vacuum centrifuge (takes 3 to 4 hrs)
20. Add 500 [mu]l of 45[deg.] C. 80% EtOH. Vortex to resuspend and place on shaker for 5 min
21. Centrifuge sample at 5,000 rpm for 10 min at 4[deg.] C.
[0453] Transfer sup to new eppen (solubilised protein-bound amino acids) and continue to Dowex
Column Purification (step 23)
23. Prepare 200 [mu]l Dowex H>;+; column
24. Flow through about 1 ml of rt 80% EtOH
25. Apply sample in 4 stages, allowing to flow through by gravity
26. Wash 3 times with 400 [mu]l (2* column volume) of rt 80% EtOH (total=1.2 ml, 6* column
volume)
27. Wash 3 times with 400 [mu]l (2* column volume) of ddH2O (total1 .2 ml, 6* column volume)
28. Elute sample into fresh eppen tubes over 4 stages with 250 [mu]l of 2M NH4OH (total=1.0 ml, 5*
column volume)
29. Keep samples on ice-samples can be stored o/n at 4[deg.] C. if desired
30. Split the samples into 2 eppen tubes and dry sample in vacuum centrifuge with heater (approx. 2.5
hrs). Although sample can fit in 1 eppen, drying is quicker with the 2 smaller volumes
31. Add 40 [mu]l ice-cold 0.02M HCl to each eppen
32. Vortex to re-suspend, place on a medium-speed shaker for 15 minutes
33. Combine the samples into one of the eppen tubes then rinse the empty eppen with another 30 [mu]l
and add to the sample
34. Transfer to millipore columns (yellow lid)
35. Centrifuge for 1 min at 7,000 rpm at 4[deg.] C.
36. Discard the filter column from the tube and seal with parafilm
37. Store samples in 4[deg.] C., can be stored for up to 3 months
[0469] For the soluble amino acid fraction samples, use undiluted for HPLC analysis. The proteinbound samples may also need to be diluted
224/503
[0470] The millipore columns we use are Ultrafre-MC 0.22 [mu]m filter units that resemble an
eppendorf tube. The samples are analyzed by HPLC, preferably an M analyzer L8800 from Hitachi.
[0471] See references, Inaba, K., Fujiwara, T., Hayashi, H., Chino, M., Komeda, Y. and Naito, S.
(1994). Isolation of an Arabidopsis thaliana mutant mto1 that overaccumulates soluble methionine:
temporal and spatial patterns of soluble methionine accumulation. Plant Physiol. 10 104: 881-887, and
Kho, C. and De Lumen, B. O. (1988). Identification and isolation of methionine-cysteine rich protein in
soybean seed. Plant Food for Human Nutrition. 38: 287-296.
Example 7
Enhanced Yield Genes and Analysis
[0472] The function of the protein encoded by each yield related gene is determined from analysis of
the open reading frame (ORF) in each cDNA as described in Example 1. Table 4 describes the assigned
functions for these genes described in this application.
>;tb;TABLE 4
>;tb;Enhanced Yield Genes
>;tb;>;sep;SEQ ID>;sep;Putative Function and>;sep;>;sep;Homology References
>;tb;Gene>;sep;NO>;sep;Similar Gene>;sep;E value>;sep;and % Homology
>;tb;FT>;sep;43-44>;sep;time to harvest>;sep;1.00E-197>;sep;Kardailsky et al., Science 286
>;tb;>;sep;>;sep;Arabidopsis thaliana>;sep;>;sep;(5446), 1962-1965 (1999)
>;tb;>;sep;>;sep;flowering locus T (FT)>;sep;>;sep;173/176 (98%)
>;tb;>;sep;>;sep;gene; mutation results in
>;tb;>;sep;>;sep;delay of flowering.
>;tb;IDS1>;sep;45-46>;sep;seed number>;sep;1.00E-66 >;sep;Chuck et al., Genes Dev. 12 (8),
>;tb;>;sep;>;sep;IDS1 indeterminate>;sep;>;sep;1145-1154 (1998)
>;tb;>;sep;>;sep;spikelet 1 from maize (Zea>;sep;>;sep;135/214 (63%)
>;tb;>;sep;>;sep;mays) - regulator of floral>;sep;>;sep; 24/42 (57%)
>;tb;>;sep;>;sep;meristem determinacy
>;tb;IDS2>;sep;47-48>;sep;iron acquisition>;sep;1.00E-115>;sep;Mori and Nakanishi, unpublished
>;tb;>;sep;>;sep;Iron siderophore>;sep;>;sep;204/344 (59%)
>;tb;>;sep;>;sep;biosynthetic enzyme gene
>;tb;>;sep;>;sep;IDS3 from barley
>;tb;>;sep;>;sep;(Hordeum vulgare);
>;tb;>;sep;>;sep;enhances iron uptake by
>;tb;>;sep;>;sep;roots.
>;tb;IDS3>;sep;49-50>;sep;iron acquisition>;sep;1.00E-120>;sep;Mori and Nakanishi, unpublished
>;tb;>;sep;>;sep;Iron siderophore>;sep;>;sep;204/315 (64%)
>;tb;>;sep;>;sep;biosynthetic enzyme gene
>;tb;>;sep;>;sep;IDS3 from barley
>;tb;>;sep;>;sep;(Hordeum vulgare);
>;tb;>;sep;>;sep;enhances iron uptake by
>;tb;>;sep;>;sep;roots.
>;tb;IFL1>;sep;51-42>;sep;seed number>;sep;0>;sep;Zhong and Ye, Plant Cell 11
>;tb;>;sep;>;sep;Arabidopsis thaliana>;sep;>;sep;(11), 2139-2152 (1999)
>;tb;>;sep;>;sep;homeodomain-leucine>;sep;>;sep;576/840 (68%)
>;tb;>;sep;>;sep;zipper transcription factor
>;tb;>;sep;>;sep;IFL1 - positive regulator of
>;tb;>;sep;>;sep;inflorescence branching
>;tb;IRT1>;sep;53-54>;sep;iron acquisition>;sep;2.00E-97 >;sep;Eckhardt et al., Plant Mol. Biol.
>;tb;>;sep;>;sep;Iron transporter 1 (IRT1)>;sep;>;sep;45 (4), 437-448 (2001)
>;tb;>;sep;>;sep;from tomato (Lycopersicon>;sep;>;sep;186/338 (55%)
>;tb;>;sep;>;sep;esculentum).
>;tb;NAAT>;sep;55-56>;sep;iron acquisition>;sep;1.00E-139>;sep;Takahashi et al., Plant Physiol.
>;tb;>;sep;>;sep;Nicotianamine>;sep;>;sep;121 (3), 947-956 (1999)
>;tb;>;sep;>;sep;aminotransferase from>;sep;>;sep;228/379 (60%)
>;tb;>;sep;>;sep;barley (Hordeum vulgare)
>;tb;>;sep;>;sep;iron siderophore
>;tb;>;sep;>;sep;biosynthetic enzyme gene;
>;tb;>;sep;>;sep;enhances iron uptake by
225/503
>;tb;>;sep;>;sep;roots.
>;tb;NAS1>;sep;57-58>;sep;iron acquisition>;sep;0>;sep;Higuchi et al., Plant J. 25 (2),
>;tb;>;sep;>;sep;Nicotianamine synthase 1>;sep;>;sep;159-167 (2001)
>;tb;>;sep;>;sep;(NAS1) from rice (Oryza>;sep;>;sep;331/332 (99%)
>;tb;>;sep;>;sep;sativa); iron siderophore
>;tb;>;sep;>;sep;biosynthetic enzyme gene;
>;tb;>;sep;>;sep;enhances iron uptake by
>;tb;>;sep;>;sep;roots.
>;tb;NRAMP1>;sep;59-60>;sep;iron acquisition>;sep;0>;sep;Belouchi et al., Plant Mol. Biol.
>;tb;>;sep;>;sep;Iron transporter Nramp1>;sep;>;sep;29 (6), 1181-1196 (1995)
>;tb;>;sep;>;sep;from rice (Oryza sativa);>;sep;>;sep;512/518 (98%)
>;tb;>;sep;>;sep;enhances iron uptake by
>;tb;>;sep;>;sep;roots.
>;tb;NRAMP2>;sep;61-62>;sep;iron acquisition>;sep;0>;sep;Belouchi et al., Plant Mol. Biol.
>;tb;>;sep;>;sep;Iron transporter from rice>;sep;>;sep;33 (6), 1085-1092 (1997)
>;tb;>;sep;>;sep;(Oryza sativa); enhances>;sep;>;sep;459/464 (98%)
>;tb;>;sep;>;sep;iron uptake by roots.
>;tb;PT1>;sep;63-64>;sep;phosphate acquisition>;sep;0>;sep;Kai and Adachi, unpublished
>;tb;>;sep;>;sep;Phospate transporter from>;sep;>;sep;414/518 (79%)
>;tb;>;sep;>;sep;tobacco (Nicotiana
>;tb;>;sep;>;sep;tabacum); functions in
>;tb;>;sep;>;sep;uptake of phoshphate, a
>;tb;>;sep;>;sep;key plant nutrient, in roots.
[0473] There are a wide variety of methods for analyzing grain quality including, but not limited to,
starch analysis, protein content and analysis, phosphate acquisition, and iron acquisition.
[0474] A preferred starch content assay is the Sigma Starch Assay Kit (Product no. STA-20; Sigma
Chemical Co., St. Louis, Mo.). The protocol is available from the manufacturer.
[0475] A preferred protein content assay is the Biorad Bradford Assay Kit (#500-0002; Biorad,
Hercules, Calif.).
[0476] The phosphate acquisition assay, is essentially performed by growing plants hydroponically
under phosphate-limiting conditions (for example, 10 uM final concentration). Leaf phosphorus levels
(Murphy and Riley (1962) Anal. Chim. Acta 27: 31-36) and growth (final dry weight and seed weight)
are measured, comparing transgenic and non-transgenic plants.
[0477] Similarly, for the iron acquisition assay, plants are grown hydroponically under iron-limiting
conditions, essentially as described in Thoiron et al. (1997) Plant Cell Env. 20:1051-1060. Assays
include measurement of the extent of low iron-induced chlorosis (essentially as described in Takahashi
et al. (2001) Nat. Biotech. 19: 466469) and growth measurements (final dry weight and seed weight),
comparing transgenic and non-transgenic plants.
NIRS Assay
[0479] Near Infrared Reflectance Spectroscopy (NIRS) is used for evaluation of protein and amino
acids in seeds by those in the art. Techniques are used to test individual grains or a sample of ground
seeds as preferred or required. A number of NIRS assay techniques and devices are available to those
in the art for analyzing a variety of samples, including grain quality.
[0480] NIRS calibrations for evaluation of a number of feed components (including protein) can be
purchased on the open market and the best place to find what is available is probably the manufacturers
of NIRS equipment. There are two main suppliers of NIRS-FOSS NIRS systems and Bran & Lubbe.
There is also a group run by Pierre Dardenne at the University of Gembloux in Belgium who produce
and sell calibrations.
[0481] Similarly, Perten Instruments, provides for all sorts of applications for NIR including
measuring starch and protein. For altered protein composition, the highest resolution methods available
currently are believed to be, for example, high performance capillary electrophoresis as described by
George Lookhart in Journal of Chromatography A, 881 (2000) 23-36 and in Electrophoresis 2001,
1503-1509. There is a review in Current Opinion in Biotechnology 1999 on Production of modified
polymeric carbohydrates 10,169-174, which is a good source of a range of methods.
[0482] The USDA intemet page, also has application notes with a list of methods to analyze grain
quality listed under cultivar development, and the ARS News and Information section. And a general
reference for the analysis of rice is by Barton et al., Agricultural Research, August 1998, pages 18-21.
[0483] The above-disclosed embodiments are illustrative. This disclosure of the invention will place
one skilled in the art in possession of many variations of the invention. All such obvious and
226/503
foreseeable variations are intended to be encompassed by the present invention. All references cited
within are hereby incorporated by reference in their entirety.Data supplied from the esp@cenet
database - Worldwide
Claims:
Claims of US2004219675
1. An isolated nucleic acid molecule comprising or consisting of a nucleotide sequence, its
complement, or its reverse complement, encoding a polypeptide including:
a) a polypeptide sequence listed in even numbered sequences of SEQ ID Nos:2-64, or a fragment,
domain, repeat, feature, or chimera thereof;
b) a polypeptide sequence having substantial similarity to (a);
c) a polypeptide sequence encoded by a nucleotide sequence identical to or having substantial
similarity to a nucleotide sequence listed in odd numbered sequences of SEQ ID Nos:1-63, or a
fragment, domain, or feature thereof, or a sequence complementary thereto;
d) a polypeptide sequence encoded by a nucleotide sequence capable of hybridizing under medium
stringency conditions to a nucleotide sequence listed in odd numbered sequences of SEQ ID Nos:1-63,
or to a sequence complementary thereto; and
e) a functional fragment of (a), (b), (c) or (d).2. An isolated nucleic acid of claim 1, comprising a
nucleotide sequence including:
a) a nucleotide sequence listed in odd numbered sequences of SEQ ID NO:1-63, fragment, domain, or
feature thereof;
b) a nucleotide sequence having substantial similarity to (a);
c) a nucleotide sequence capable of hybridizing to (a);
d) a nucleotide sequence complementary to (a), (b) or (c); and
e) a nucleotide sequence which is the reverse complement of (a), (b) or (c).
3. An expression cassette comprising a promoter and the nucleic acid molecule of claim 1.
4. A recombinant vector comprising the expression cassette of claim 3.
5. A cell comprising the expression cassette of claim 3.
6. A transgenic plant comprising the expression cassette of claim 3.
7. Progeny and seed from the transgenic plant of claim 6.
8. The transgenic plant of claim 6, wherein the expression cassette is expressed in the tissue of the
epidermis, root, vascular tissue, meristem, cambium, cortex, pith, leaf, and flower.
9. The plant of claim 6, wherein the plant has altered abiotic stress tolerance, enhanced yield, altered
disease resistance, or altered nutritional content.
10. The transgenic plant of claim 6, wherein the plant is selected from the group consisting of: rice,
wheat, barley, rye, corn, potato, canola, soybean, sunflower, carrot, sweet potato, sugarbeet, bean, pea,
chicory, lettuce, cabbage, cauliflower, broccoli, turnip, radish, spinach, asparagus, onion, garlic,
eggplant, pepper, celery, squash, pumpkin, cucumber, apple, pear, quince, melon, plum, cherry, peach,
nectarine, apricot, strawberry, grape, raspberry, blackberry, pineapple, avocado, papaya, mango,
banana, soybean, tobacco, tomato, sorghum and sugarcane.
11. The transgenic plant of claim 10, wherein the plant is rice.
12. The transgenic plant of claim 6, wherein the plant is a monocot.
13. The transgenic plant of claim 12, wherein the monocot is selected from the group consisting ofL
maize, wheat, barley, oats, rye, millet, sorghum, trticale, secale, einkorn, spelt, emmer, teff, milo, flax,
gramma grass, Tripsacum, and teosinte.
14. A transgenic plant comprising the nucleic acid molecule of claim 2.
227/503
15. Progeny and seed from the transgenic plant of claim 14.
16. A method of altering the abiotic stress tolerance of a plant, comprising expressing an expression
cassette comprising a nucleic acid molecule encoding a polypeptide having SEQ ID NO:2, 4, 6, 8, or
10 in a plant.
17. A method of altering pathogen or disease resistance in a plant, comprising expressing an expression
cassette comprising a nucleic acid molecule encoding a polypeptide having SEQ ID NO:12, 14, 16, 18,
20, 22, or 24 in the plant.
18. A method of altering the grain quality, nutritional composition or yield of a plant, comprising
expressing an expression cassette comprising a nucleic acid molecule encoding a polypeptide having
SEQ ID NO:26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62 or 64.
19. The method of claim 18, wherein the altered grairi quality, nutritional composition or yield is
altered starch level, altered thiamin level, altered lysine level, altered iron level, altered aleurone
enzyme levels, altered vitamin E content, altered protein level, altered time to harvest, altered seed
number, altered iron acquisition, or altered phosphate acquisition.
20. A shuffled nucleic acid containing a plurality of nucleotide sequence fragments, wherein at least
one of the fragments corresponds to a region of a nucleotide sequence listed in odd numbered
sequences of SEQ ID NOS:1-63, and wherein at least two of the plurality of sequence fragments are in
an order, from 5' to 3' which is not an order in which the plurality of fragments naturally occur in a
nucleic acid.
21. A polypeptide comprising:
a) a polypeptide sequence of SEQ ID NO:2;
b) a polypeptide sequence having substantial similarity to (a);
c) a polypeptide sequence encoded by a nucleotide sequence identical or substantially similar to a
nucleotide sequence of SEQ ID NO:1;
d) a polypeptide sequence encoded by a nucleic acid molecule capable of hybridizing under high
stringency conditions to a nucleic acid molecule listed in SEQ ID NO:1 or to a sequence
complementary thereto; and
e) a functional fragment of (a), (b), (c) or (d).
22. A method of producing a polypeptide of claim 21, comprising the steps of:
a) growing recombinant cells comprising an expression cassette under suitable growth conditions, the
expression cassette comprising a nucleic acid molecule of claim 1; and
b) isolating the polypeptide from the recombinant cells.
23. A method of decreasing the expression of a nucleic acid molecule of claim 1 in a plant comprising:
(a) expressing in said plant a DNA molecule of claim 1 or a portion thereof in "sense" orientation; or
(b) expressing in said plant a DNA molecule of claim 1 or a portion thereof in "anti-sense" orientation;
or
(c) expressing in said plant a ribozyme capable of specifically cleaving a messenger RNA transcript
encoded by an endogenous gene corresponding to a DNA molecule of claim 1; or
(d) expressing in a plant an aptamer specifically directed to a protein encoded by a DNA molecules of
claim 1; or
(e) expressing in a plant a mutated or a truncated form of a DNA molecule of claim 1;
(f) modifying by homologous recombination in a plant at least one chromosomal copy of the gene
corresponding to a DNA molecule of claim 1; or
g) modifying by homologous recombination in a plant at least one chromosomal copy of the regulatory
elements of a gene corresponding to any one of the DNA molecules of claim 1; or
h) expressing in said plant a DNA molecule of claim 1 or a portion thereof in the "sense" and
"antisense" orientation.
28. An antibody cross-reactive to the polypeptide of claim 21.
228/503
29. The polypeptide of claim 21, wherein the polypeptide is involved in a function such as abiotic
stress tolerance, enhanced yield, disease resistance or nutritional content.
30. A method of altering the expression of a polypeptide of claim 21 in a plant, comprising the step of
expressing an expression cassette of claim 3 in the plant.
31. The method of claim 30, wherein the polypeptide is expressed in a specific location or tissue of a
plant.
32. The method of claim 31, wherein the location or tissue is the epidermis, root, vascular tissue,
meristem, cambium, cortex, pith, leaf, flower or seed.
33. An isolated product from the plant which comprises an expression cassette comprising a promoter
sequence operably linked to an isolated nucleic acid comprising a nucleotide sequence including:
a) a nucleotide sequence listed in odd numbered sequences of SEQ ID NOS:1-63, or fragment, domain,
or feature thereof;
b) a nucleotide sequence encoding a polypeptide listed in even numbered sequences of SEQ ID NOS:
2-64;
c) a nucleotide sequence having substantial similarity to (a) or (b);
d) a nucleotide sequence capable of hybridizing to (a) or (b);
e) a nucleotide sequence complementary to (a), (b), (c) or (d); and
f) a nucleotide sequence that is the reverse complement of (a), (b), (c) or (d) according to the present
disclosure.
34. The isolated product of claim 33, wherein the isolated product includes an enzyme, a nutritional
protein, a structural protein, an amino acid, a lipid, a fatty acid, a polysaccharide, a sugar, an alcohol,
an alkaloid, a carotenoid, a propanoid, a steroid, a pigment, a vitamin or a plant hormone.
35. A method of producing a recombinant protein, comprising the steps of:
(a) growing recombinant cells comprising a nucleic acid construct under suitable growth conditions,
the construct comprising an expression vector and a nucleic acid including: a nucleic acid encoding a
protein as listed in even numbered nucleotide sequences of SEQ ID NOS:2-64, or a nucleic acid
sequence listed in odd numbered nucleotide sequences of SEQ ID NOS:1-63, or segments thereof; and
(b) isolating from the recombinant cells the recombinant protein expressed thereby.
36. The method of claim 35, wherein the expression vector includes one or more elements of a
promoter-enhancer sequence, a selection marker sequence, an origin of replication, an epitope-tag
encoding sequence, an affinity purification-tag encoding sequence, a polyamino acid binding
substance, or chitin-binding domain.Data supplied from the esp@cenet database - Worldwide
229/503
33. WO0026389
- 5/11/2000
DNA COMPRISING RICE ANTHER-SPECIFIC GENE AND TRANSGENIC
PLANT TRANSFORMED THEREWITH
URL EPO =
http://v3.espacenet.com/textdoc?F=3&CY=ep&LG=en&IDX=WO0026389
Inventor(s):
AN GYNHEUNG (KR); CHUNG YONG-YOON (KR); LEE SICHUL (KR); JEON
JONG-SEONG (KR)
Applicant(s):
NOVARTIS AG (CH); NOVARTIS ERFIND VERWALT GMBH (AT); AN
GYNHEUNG (KR); JEON JONG SEONG (KR); CHUNG YONG YOON (KR); LEE SICHUL (KR)
IP Class 4 Digits: C07K; C12N; A01H
IP Class:C07K14/415; C12N15/82; A01H5/00; C12N15/11
E Class: C07K14/415; C12N15/82B20; C12N15/82B20B2; C12N15/82C8D2
Application Number:
WO1999EP08360 (19991102)
Priority Number: KR19980046973 (19981103); KR19980050126 (19981119)
Family: AU759042
Equivalent:
WO0026389; EP1127143; US2001051713; CA2347675; TR200101137T;
CN1185350C; AU759042
Cited Document(s):
XP002135814
WO8910396; WO9640925; XP002033709; XP000619376; XP002135815;
Abstract:
Abstract of WO0026389
This invention describes novel DNA sequences which function as promoters of anther-specific
transcription of coding DNA sequences in recombinant or chimeric DNA sequences. The invention
also describes recombinant or chimeric DNA sequences, which are expressed specifically in the anther
of a plant. The said recombinant or chimeric DNA sequences may be used to create transgenic plants,
but especially transgenic male-sterile plants.Claims:
Claims of WO0026389
What is claimed is: 1. DNA comprising a promoter sequence and associated coding sequence wherein
the promoter sequence drives expression of the coding sequence specifically in the tapetum,
endothecium and connective tissues of anthers but not in microspores or pollen, and wherein
expression of the coding sequence starts at the tetrad stage and reaches a maximum level at the
vacuolated pollen stage.
2. The DNA according to claim 1, wherein the sequence comprises a nucleotide sequence having 50%
or more sequence identity with the sequence shown in SEQ ID NO: 1.
3. The DNA according to claim 1, wherein the sequence comprises the nucleotide sequence shown in
SEQ ID NO: 1.
4. The DNA according to any one of claims 1 to 3, wherein the coding sequence is in antisense
orientation.
230/503
5. The DNA according to any one of claims 1 to 3, wherein the coding sequence encodes a polypeptide
which will disrupt formation of viable pollen when expressed in the anther cells.
6. The DNA according to claim 5, wherein the coding sequence encodes a polypeptide selected from
the group consisting of RNase, DTA, TURF-13, pectate tyase, gin recombinase, iaaL and cytA toxin.
7. A DNA sequence having more than 80% sequence identity in the consecutive 30 bases of any sites
of SEQ ID NO: 1.
8. DNA comprising a promoter sequence capable of driving expression of an associated coding
sequence specifically in the tapetum, endothecium and connective tissue of anthers but not in
microspores or pollen, wherein expression of the coding sequence starts at the tetrad stage and reaches
a maximum level at the vacuolated pollen stage.
9. The DNA of claim 8, wherein the promoter sequence has 50% or more sequence identity with the
nucleotide sequence of SEQ ID NO: 3.
10. The DNA of claim 9, wherein the promoter sequence has the nucleotide sequence shown in SEQ ID
NO: 3.
11. The DNA according to any one of claims 1 to 10, wherein the promoter sequence comprises an
addition sequence that can be operatively linked to a coding sequence of interest.
12. The DNA according to claim 11, wherein the addition sequence comprises a sequence having 50%
or more sequence identity with SEQ ID NO: 10.
13. The DNA according to claim 11, wherein the addition sequence comprises SEQ ID
NO: 10.
14. The DNA according to claims 9 to 13, wherein the promoter sequence and addition sequence have
50% or more sequence identity with the respective sequences of SEQ ID
NO: 2.
15. The DNA according to claims 9 to 13, wherein the promoter sequence and addition sequence are
characterized by the nucleotide sequence of SEQ ID NO: 2.
16. The DNA according to claim 15, wherein the promoter comprises a fragment obtainable from SEQ
ID NO: 2.
17. DNA comprising an open reading frame encoding a protein characterized by an amino acid
sequence having 50% or more sequence identity with SEQ ID NO: 4.
18. The DNA according to claim 17, wherein the open reading frame encodes a protein characterized
by the amino acid sequence of SEQID NO: 4.
19. The DNA according to any one of claims 17 or 18 characterized by SEQ ID N0: 7.
20. An expression vector comprising a first expression cassette comprising a DNA of any one of claims
1 to 19 for expression in a host organism such as a microorganism or a plant and, optionally, a second
expression cassette comprising a gene of interest.
21. The protein encoded by the open reading frame of any one of claims 17 to 19.
22. A transgenic plant and the sexual and/or asexual progeny thereof, which has been transformed with
a DNA sequence according to any one of claims 1 to 19.
23. A transgenic, male-sterile plant which has been transformed with a DNA sequence according to any
one of claims 1 to 19.
231/503
24. A transgenic plant according to claims 22 or 23, wherein the plant is rice, wheat, maize,
Sorghum bicolor or orchardgrass.
25. A process for the production of a transgenic plant comprising a DNA comprising a promoter
sequence and associated coding sequence wherein the promoter sequence drives expression of the
coding sequence specifically in the tapetum, endothecium and connective tissues of anthers but not in
microspores or pollen, and wherein expression of the coding sequence starts at the tetrad stage and
reaches a maximum level at the vacuolated pollen stage.
26. A process according to claim 25, wherein the plant is rice, wheat, maize, Sorghum bicoloror
orchardgrass.Data supplied from the esp@cenet database - Worldwide
232/503
34. WO0077036
- 12/21/2000
GENE
URL EPO =
http://v3.espacenet.com/textdoc?F=3&CY=ep&LG=en&IDX=WO0077036
Inventor(s):
COTS JOAQUIM (FR); GOURGUES MATHIEU (FR); LATORSE MARIEPASCALE (FR); LEBRUN MARC-HENRI (FR)
Applicant(s):
AVENTIS CROPSCIENCE SA (FR); COTS JOAQUIM (FR); GOURGUES
MATHIEU (FR); LATORSE MARIE PASCALE (FR); LEBRUN MARC HENRI (FR)
IP Class 4 Digits: C07K
IP Class:C07K14/00
E Class: C07K14/375
Application Number:
WO2000FR01666 (20000616)
Priority Number: FR19990007867 (19990616); FR20000004102 (20000331)
Family: AU6287200
Equivalent:
WO0077036
Cited Document(s):
XP002107758
WO9913094; XP002154521; XP000874586; XP002091580; XP002131415;
Abstract:
Abstract of WO0077036
The invention concerns novel polypeptides of the >;i;psl1>;/i; gene of the causal fungus of
>;i;Magnaporthe grisea>;/i; rice coding for a Pls1 protein whereof the presence and integrity are
indispensable to the pathogenesis of said fungus with respect to rice and barley. The invention also
concerns the promoter of said gene and the Psl1 protein in the research for novel fungicidal molecules.
The invention further concerns compounds inhibiting the pathogenesis of fungi related to the
expression of the >;i;psl1>;/i;.Description:
Description of WO0077036
Gène plsl (ou gène421) du champignon pathogène du riz Magnaporthe grisea
indispensable à la pathogénie du champignon
La présente invention concerne un nouveaugène plsl (ou gène 421) indispensable à la pathogénie du
champignon. L'invention a pour objet despolynucléotides plsl, des polypetidesPlsl, des organismes
hôtes exprimant un polypeptidePlsl et leurs utilisations pour l'identification de nouvelles molécules
antifongiques.
Le principe d'employer des gènes de champignons pathogènes, entièrement ou en partie, dans des tests
pour identifier de nouvelles molécules actives contre ces champignons est connu en soi (in Antifungal
Agents : Discovery and Mode of Action.
Dixon GK, Coppong LG and Hollomon DW eds, BIOS Scientific publisher Ldt, Oxford,
UK). Dans ce but, la connaissance du génomed'un champignon pathogène donné constitue une étape
importante pour la réalisation de tels tests. Toutefois, la simple connaissance d'un gène donné n'est pas
suffisante pour atteindre cet objectif, encore faut-il que le gène choisi comme cible de molécules
fongicides potentielles soit essentiel à la vie du champignon, son inhibition par la molécule fongicide
233/503
entraînant la mort du champignon, ou essentiel à la pathogénie du champignon, son inhibition n'étant
pas létale pour le champignon mais inhibant simplement son pouvoir pathogène. Cette deuxième
catégorie de gènes cibles potentielles de molécules fongicides est particulièrement importante pour le
développement d'une nouvelle génération de produits fongicides plus respectueux de l'environnement,
s'attaquant de manière spécifique au seul pouvoir pathogène des champignons pathogènes.
L'identification des gènes indispensables à la pathogénie du champignon est donc necessaire au
développement de nouveaux produits fongicides.
La présente invention concerne l'identification et le clonage d'un nouveau gène indispensable à la
pathogénie du champignon intitulé gène 421 ougène plus (punchless 1) codant pour un
polypeptidePlsl. Un mutant pis de Magnaporthe grisea, dans lequel le gène est inactivé,n'est plus
pathogène pour le riz et l'orge. L'expression dugène plsl est donc indispensable à la pathogénie du
champignon. L'invention concerne également l'utilisation du gène plsl et du polypeptidePlsl pour
identifier de nouvelles molécules antifongiques.
Description de la liste de séquences
SEQ ID No.1 : Gène plsl ou gène 421 de Magnaporthe grisea.
SEQ ID No. 2 : Promoteur du gène plsl de Magnaporthe grisea.
SEQID No. 3 : ADNc du gène plsl de Magnaporthe grisea.
SEQ ID No. 4 : Exons et introns dugène plsl de Magnaporthe grisea.
SEQ ID No. 5 : Cadre ouvert de lecture dugène plus de Magnaporthe grisea.
SEQ ID No. 6 : Polypeptide Plsl de Magnaporthe grisea.
SEQ ID No. 7 : ADN gnomique dugène plsl de P. higginsii.
SEQ ID No. 8 : ADNc partiel du gène plsl de P. higginsii.
SEQ ID No. 9 : Fragment du polypeptide Plsl deP. higginsii.
SEQ ID No. 10 : ADN gnomique dugène plsl de N. crassa.
SEQ ID No. 11 : ADNc partiel du gène plsl de N. crassa.
SEQ ID No. 12 : Fragment du polypeptide Plsl de N. crassa.
SEQ ID No. 13 : ADNc partiel du gène plsl de Botrytis.
SEQ ID No. 14 : Fragment du polypeptidePlsl de Botrytis.
SEQ ID No. 15-24 : Amorces pour PCR.
Description de l'invention
Polvnucléotides
La présente invention concerne des polynucleotides comprenant ungène plus de champignon. Legène
plsl peut tre isolé chez les champignonsphytopathogènes comme par exemple Botrytis cinerea,
Mycosphaerella graminicola, Stagnospora nodorum,
Blumeria graminis, Colleotrichum lindemuthianum, Puccinia graminis, Leptosphaeria maculans,
Fusarium oxysporum, Fusarium graminearum et Venturia inaequalis. De manière avantageuse, legène
plus est isolé chez les champignonsphytopathogènes du genre Magnaporthe. De préférence,
lespolynucleotides de l'invention comprennent un gène plsl de Magnaporthe grisea. Préférentiellement,
lespolynucléotides de la présente invention comprennent la séquence codante d'ungène plus de
Magnaporthe grisea.
234/503
Leterme"polynucléotidesplsl"désigne ltensemble despolynucléotides de la présente invention, de
préférence, lespolynucléotides de la séquence gnomiquede plsl, lespolynucléotides de la séquence
del'ADNc de plsl, ainsi que lespolynucléotides codant pour les polypeptides Plsl de la présente
invention. Leterme"polynucléotides plsl" désigne également despolynucléotides recombinants
comprenant les ditspolynucléotides.
Selon la présente invention, on entendpar"polynucléotide"une chaine nucléotidique simple brin ou son
complémentaire ou une chaine nucléotidique double brin pouvant tre de type ADN ou ARN. De
préférence, lespolynucléotides de l'invention sont de type ADN, notamment d'ADN double brin.
Leterme"polynucléotide"désigne également les oligonucléotides et lespolynucléotides modifiés.
Les polynucléotides de la présente invention sont isolés ou purifiés de leur environnement naturel. De
préférence, les polynucléotides de la présente invention peuvent tre préparés par les techniques
classiques de biologie moléculaire telles que décrites par Sambrook et al. (voir Sambrook et al.,
Molecular Cloning : A Labratory
Manual, 1989) ou par synthèse biochimique.
L'invention concerne des polynucléotides comprenant la séquence gnomique du gène plsl de
Magnaporthe grisea de la SEQ ID No.1 et de la Seq ID No. 4. Cette séquence gnomique comprend 3
exons (positions 2363-2764,2861-3025 et 3104-3214 de la SEQ ID NO. 1), 2 introns (positions 27652860 et 3026-3104 de la SEQ ID NO. 1) et des séquences régulatrices en 5'et en 3'.
Dans un mode de réalisation préféré de l'invention, les polynucléotides de la séquence gnomique de
plsl comprennent unpolynucléotide choisi parmi lespolynucléotides suivants :
a) lepolynucléotide de la SEQ ID NO. 1,
b) unpolynucléotide comprenant au moins un exon de la SEQ ID NO. 1 ;
c) unpolynucléotide comprenant une combinaison d'exons de la SEQ ID NO. 1.
La présente invention concerne également unpolynucléotide comprenant une séquence régulatrice en
5'ou en 3'dugène plsl de Magnaporthe grisea. Dans un premier mode de réalisation, l'invention
concerne unpolynucléotide comprennent le promoteur du gène plsl de Magnaporthe grisea dont la
séquence est comprise entre la position 1 et la position1636 de la SEQ ID NO.1. La séquence du
promoteur dugène plsl est également représentée par la SEQ ID No. 2. Dans un autre mode de
réalisation, l'invention concerne unpolynucléotide comprenant un fragment biologiquement actif du
promoteur du gène plsl de Magnaporthe grisea de la SEQ ID NO. 2.
Par"fragment biologiquement actif'on entend ci-dessus unpolynucléotide ayant une activité
promotrice et plus particulièrement une activité promotrice dans les champignons.
Les techniques permettant d'évaluer l'activité promotrice d'un polynucléotide sont bien connues de
l'homme du métier. Ces techniques impliquent classiquement l'utilisation d'un vecteur d'expression
comprenant dans le sens de la transcription le polynucléotide à tester et un gène rapporteur (voir
Sambrook et al., Molecular Cloning : A Labratory Manual, 1989).
L'invention concerne aussi des polynucléotides comprenant1'ADNc de plsl de
Magnaporthe grisea de la SEQ ID NO. 3.L'ADNc du gène plsl de Magnaporthe grisea comporte la
séquence codante du gène plsl ainsi qu'une séquence régulatrice5'UTR et une séquence régulatrice
3'UTR. L'invention concerne plus particulièrement despolynucléotides comprenant la séquence
codante du gène plsl de Magnaporthe grisea de la
SEQ ID No. 5.
L'invention s'étend également aux polynucléotides comprenant un polynucléotide choisi parmi les
polynucléotides suivants : a) le polynucléotide de la SEQ ID NO. 1 ; b) le polynucléotide de la SEQ
IDNO. 2 ; c) le polynucléotide de la SEQ IDNO. 3 ; d) le polynucléotide de la SEQ ID NO. 4 ; e) le
polynucléotide de la SEQ ID NO. 5 ;f) un polynucléotide homologue à un polynucléotide tel que
défini en a), b), c), d) ou e) ; g) un polynucléotide capable de s'hybrider de manière sélective à un
polynucléotide tel
que défini en a), b), c), d) ou e).
235/503
Par"homologue"on entend selon l'invention un polynucléotide présentant une ou plusieurs
modifications de séquence par rapport à la séquence de référence. Ces modifications peuvent tre des
délétions, des additions ou des substitutions d'un ou plusieurs nucléotides de la séquence de référence.
De manière avantageuse, le pourcentage d'homologie sera d'au moins 70 %, 75%, 80%, 85%, 90%,
95% et de préférence d'au moins 98% et plus préférentiellement d'au moins 99% par rapport à la
séquence de référence. Les méthodes de mesure et d'identification des homologies entre les séquences
d'acides nucléiques sont bien connues de l'homme du métier. On peut employer par exemple les
programmes PILEUP ou BLAST (notamment Altschul et al., J. Mol.Evol.
36 : 290-300,1993 ; Altschul et al., J. Mol. Biol. 215 : 403-10,1990). De préférence on utilisera les
paramètres par défaut. L'invention concerne donc despolynucléotides comprenant des polynucléotides
présentant au moins 70 %, 75%, 80%, 85%, 90%, 95%, 98% et de préférence au moins 98% et plus
préférentiellement au moins 99% d'homologie avec unpolynucléotide des SEQ ID No. 15,7,8,10,11oul 3. De préférence l'invention concerne unpolynucléotide comprenant unpolynucléotide
d'au moins 50,100,200,300, 400,500,1000 nucléotides présentant au moins 70 %, 75%, 80%, 85%,
90%, 95%, 98% et de préférence au moins 98% et plus préférentiellement au moins 99% d'homologie
avec unpolynucléotide de SEQID NO. 1-5,7,8,10,11 oul3. De préférence, lespolynucléotides
homologues à unpolynucléotide de référence conservent la fonction de la séquence de référence.
Par"séquence capable de s'hybrider de manière sélective", on entend selon l'invention les séquences
qui s'hybrident avec la séquence de référence à un niveau supérieur au bruit de fond de manière
significative. Le niveau du signal généré par l'interaction entre la séquence capable de s'hybrider de
manière sélective et les séquences de référence est généralement 10 fois, de préférence 100 fois plus
intense que celui de l'interaction des autres séquences d'ADN générant le bruit de fond. Les conditions
d'hybridation stringentes permettant une hybridation sélective sont bien connues de 1'homme du
métier. En général la température d'hybridation et de lavage est inférieure d'au moins5 C au Tm de la
séquence de référence à un pH donné et pour une force ionique donnée. Typiquement la température
d'hybridation est d'au moins30 C pour unpolynucléotide de 15 à 50 nucléotides et d'au moins60 C
pour unpolynucléotide de plus de 50 nucléotides. A titre d'exemple, l'hybridation est réalisée dans le
tampon suivant : 6X
SSC, 50 mMTris-HCl (pH 7.5), 1 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.02% BSA, 500 pg/ml
denatured salmon sperm DNA. Les lavages sont par exemple réalisés successivement à faible
stringence dans un tampon 2X SSC, 0,1% SDS, a moyenne stringence dans un tampon0,5X SSC,01%
SDS et à forte stringence dans un tampon0,1X
SSC,0,1% SDS. L'hybridation peut bien entendu tre effectuée selon d'autres méthodes usuelles bien
connues de l'homme du métier (voir notamment Sambrook et al., Molecular
Cloning : A Labratory Manual, 1989). L'invention concerne donc despolynucléotides comprenant
unpolynucléotide capable de s'hybrider de manière sélective avec unpolynucléotide des SEQ ID No.15,7,8,10,11 ou 13. De préférence, l'invention concerne unpolynucléotide comprenant
unpolynucléotide d'au moins 50,100,200,300,
nucléotides capable de s'hybrider de manière sélective avec unpolynucléotide des SEQ ID No. 15,7,8,10,11 ou 13. De préférence, lespolynucléotides s'hybridant de manière sélective à
unpolynucléotide de référence conservent la fonction de la séquence de référence.
De préférence, les polynucléotides de la présente invention conservent la fonction dugène plsl de
Magnaporthe grisea et codent pour une tétraspanine indispensable à la pathogénie du champignon. Le
gène plsl contrôle différentes fonctions biologiques del'appressorium comme la différenciation de
l'aiguille d'infection. Le gène plsl code pour un polypeptide de la famille des tétraspanines. Ces
protéines membranaires font partie de complexes membranaires jouant un rôle dans la signalisation
cellulaire contrôlant le mouvement des cellules animales. Les tétraspanines sont impliquées dans la
réorganisation du cytosquellette et notamment du réseau d'actine et dans la signalisation cellulaire par
les
PKC-phosphoinositides.
Préférentiellement, les polynucléotides de la présente invention complémentent un mutant plsl de
Magnaporthe grisea et restaurent sapathogenicité pour le riz etl'orge. Un mutant plsl selon l'invention
est un mutant de Magnaporthe grisea dans lequel le gène plsl de la SEQ ID No.1 est inactivé par des
techniques bien connues de l'homme du métier.
236/503
La présente invention concerne également des variantsallèliques dugène plsl de
Magnaporthe grisea.
La présente invention concerne également l'identification et le clonage de gènes homologues au gène
plsl de Magnaporthe grisea chez d'autres champignons phytopathogènes. De préférence, ces gènes
homologues sont susceptibles d'tre isolés ou clones à partir d'un champignonphytopathogène choisi
parmi Botrytis cinerea,
Mycosphaerella graminicola, Stagnospora nodorum, Blumeria graminis, Colleotrichum
lindemuthianum, Puccinia graminis, Leptosphaeria maculans, Fusarium oxysporum,
Fusarium graminearum et Venturia inaequalis. L'invention a ainsi pour objet l'utilisation
d'unpolynucléotide ou d'un fragment d'unpolynucléotide de la SEQ ID NO.1 selon l'invention pour
l'identification de gènes homologues dans d'autres champignonsphytopathogènes. Les techniques
permettant le clonage degènes plus homologues chez d'autres champignonsphytopathogènes sont bien
connues de l'homme du métier. Le clonage s'effectue par exemple par criblage de banques d'ADNc ou
de banques d'ADN gnomique avec unpolynucléotide ou un fragment d'unpolynucléotide de la SEQ ID
NO. 1. Ces banques peuvent également tre criblées par PCR à l'aided'oligonucléotides spécifiques ou
dégénérés dérivés de la SEQ ID No. l ou de la SEQ ID No. 3. On utilisera par exemple les amorces
PCR des SEQ ID Nos. 17-22. Les techniques de construction et de criblage de ces banques sont bien
connues de 1'homme du métier (voir notamment
Sambrook et al., Molecular Cloning : A Labratory Manual, 1989). Des gènes plsl de
champignonphytopathogène peuvent également tre identifiés dans les bases de données par BLAST
nucléotidique ou protéique à l'aide des SEQ ID NO. 1-6.
De préférence, les gènes clones conservent la fonction du gène plsl de Magnaporthe grisea et codent
pour un polypeptide de la famille destétraspanines essentiel à la pathogénie du champignon. Les
séquences des gènes clonées peuvent tre analysées selon des méthodes connues afin d'établir qu'ils
codent pour un polypeptide de la famille des tétraspanines. Par ailleurs, les techniques permettant
d'établir qu'un gène connu est essentiel à la pathogénie d'un champignon sont connues de 1'homme du
métier. Par exemple, le gène étudié est inactivé dans le champignon par des techniques classiques de
biologie moléculaire, on citera notamment le remplacement du gène par un gène marqueur par
recombinaison homlogue. La réduction de la pathogénie du champignon comportant le gène inactivé
est analysée par des tests phénotypiques. D'autres techniques bien connues de l'homme du métier
peuvent tre utilisées afin d'établir que les polynucléotides de l'invention conservent la fonction du gène
plsl de Magnaporthe grisea. On citera notamment la complémentation de mutants plsl suivis de tests de
restauration de la pathogénie du champignon.
La distribution du gène plsl au sein de l'espèce M. grisea a été analysée par hybridation. L'ADN
gnomique de cinq isolats pathogènes du riz de différentes régions du monde (Mali,Cameroun, Brésil,
Japon, Chine), ainsi que celui de six isolats provenant d'autres plantes hôtes que le riz (blé, éleusine,
mil, gingembre, Cyperus) a été hybridée avec une sonde correspondant à la phase codante du gène plsl
en conditions d'hybridation hétérologue(55 C, 2 SSC). Un signal d'hybridation correspondant à un
gène en copie unique a été détecté chez tous les isolats analysés, dont celui d'une espèce apparentée à
M. grisea (PH54, Pyriculariahigginsii) pathogène des Cypéracées. Ce résultat montre que legène plsl
est fortement conservé au sein de l'espèce Magnaporthe grisea.
Une recherche dans les bases de données d'EST fongiques du domaine public a également été
effectuée. Deux séquences homologues du gène plsl ont été détectées chez
Botrytis cinerea qui ont de fortes identités de séquence au niveau nucléotidique (50%) et protéique
(50%)(WOAA019ZD10C1 etWOAA063ZD05C1, Base de donnée duGénoscope, Evry,France ;
correspondants au numéros GenbankA1114936. 1-CSS01COW et AL113969. 1-CNSO1BA).
L'utilisation d'amorces PCR dégénérées a également permis de cloner des homologues du gène plsl
chez d'autres champignonsphytopathogènes (voir exemple 3).
Les séquences nucléotidiques et protéiques de gènes homologues au gène plsl de
Magnaporthe grisea ont été clones et sont représentés par les SEQ ID Nos 7-14.
237/503
La présente invention concerne également unpolynucléotide comprenant unpolynucléotide antisens
de la séquence codante du gène plsl. Par séquence antisens on entend selon l'invention une séquence
codant pour une séquence antisens totale ou partielle de la séquence codante du polypeptide Plsl.
L'expression de cette séquence dans un champignon, et en particulier Magnaporthe grisea permet
d'inhiber 1'expression du polypeptide Plsl et lapathogénicité du champignon. Les techniques
d'inhibition de 1'expression d'une protéine par un antisens sont bien connues de l'homme du métier et
largement décrites dans la littérature, notamment Judelson et al. (1993, Gene 133 : 63-69) ainsi que
Prokish et al. (1997, Mol.
Gen. Genet. 256 : 104-114).
L'invention a également pour objet des polynucléotides comprenant unpolynucléotide codant pour un
polypeptide choisi parmi les polypeptides suivants :
a) le polypeptide de la SEQ ID No. 6 ;
b) un polypeptide homologue à un polypeptide de la SEQ ID No. 6 ;
c) un fragment biologiquement actif d'un polypeptide tel que défini en a) ou b).
Polypeptides
La présente invention concerne également des polypeptidesPlu 1 de champignonphytopathogène et
plus particulièrement de Magnaporthe grisea. Le terme"polypeptidesPlsl"désigne 1'ensemble des
polypeptides de la présente invention ainsi que les polypeptides pour lesquels codent les
polynucléotides de la présente invention. Le terme "polypeptides Plsl"désigne également des protéines
de fusion, des protéines recombinantes ou des protéines chimères comprenant ces polypeptides. Dans la
présente description leterme"polypeptide"désigne également des protéines et des peptides ainsi que des
polypeptides modifiés.
Les polypeptides de l'invention sont isolés ou purifiés de leur environnement naturel.
Les polypeptides peuvent tre préparés au moyen de différents procédés. Ces procédés sont notamment
la purification à partir de sources naturelles telles que des cellules exprimant naturellement ces
polypeptides, la production de polypeptides recombinants par des cellules hôtes appropriées et leur
purification ultérieure, la production par synthèse chimique ou, enfin, une combinaison de ces
différentes approches. Ces différents procédés de production sont bien connus de l'homme du métier.
Ainsi, les polypeptides Plsl de la présente invention peuvent tre isolés à partir de champignons
exprimant des polypeptidesPls 1. De préférence, les polypeptidesPlu 1 de la présente invention sont
isolés à partir d'organisme hôtes recombinants exprimant un polypeptidePisl hétérologue. Ces
organismes sont préférentiellement choisis parmi les bactéries, les levures, les champignons, les
cellules animales ou d'insectes.
La présente invention a pour objet un polypeptide comprenant un polypeptide Plsl de
Magnaporthe grisea de la SEQ ID No. 6. L'invention concerne également des polypeptides comprenant
un fragment biologiquement actif ou un homologue du polypeptide Plsl de la SEQ ID No. 6
Le terme"fragment"d'un polypeptide désigne un polypeptide comprenant une partie mais pas la totalité
du polypeptide dont il est dérivé. L'invention concerne un polypeptide comprenant un fragment d'au
moins 10,15,20,25,30,35,40,50,100,200 acides aminés d'un polypeptide de la SEQ ID No. 6.
Leterme"fragment biologiquement actif désigne un fragment d'un polypeptide conservant la fontion
du polypeptide dont il est dérivé. Les fragments biologiquement actifs du polypeptide de la SEQ ID
No. 6 conservent ainsi la fonction du polypeptide Plsl de Magnaporthe grisea. Ces fragments
biologiquement actifs ont donc une activité de tétraspanines de champignon. Préférentiellement, cette
activité est essentielle à la pathogénie du champignon.
Le terme"homologue"désigne un polypeptide pouvant présenter une délétion, une addition ou une
substitution d'au moins un acide aminé. L'invention a pour objet un polypeptide présentant au moins
75%, 80%, 85%, 90%, 95%, 98% et préférentiellement au moins 99% d'homologie avec un
polypeptide de la SEQ ID No. 6. Les méthodes de mesure et d'identification des homologies entre
polypeptides ou protéines sont connues de l'homme du métier. On peut employer par exemple le >;
238/503
package UWGCG et le programme BESTFITT pour calculer les homologies (Devereux et al., Nucleic
Acid Res.
12,387-395,1984). De préférence, on utilise les paramètres par défaut.
De préférence, ces polypeptides homologues conservent la mme activité biologique que le polypeptide
Plsl de Magnaporthe grisea de la SEQ ID No. 6. Préférentiellement, ces polypeptides ont donc une
activité de tétraspanine de champignon et contrôlent différentes fonctions biologiques
del'appressorium comme la différenciation de l'aiguille d'infection. Préférentiellement, cette activité
est essentielle à la pathogénie du champignon. Dans un mode de réalisation préféré, ces polypeptides
homologues sont suceptibles d'tre isolés à partir de champignonsphytopathogènes.
L'invention a également pour objet un polypeptide de fusion comprenant un polypeptide Plsl tel que
décrit ci-dessus fusionné à un polypeptide rapporteur. Le polypeptide rapporteur permet la détection
rapide de 1'expression d'un polypeptide Plsl dans un champignon ou dans un autre organisme hôte.
Parmi les polypeptides pouvant ainsi trefusionés avec un polypeptide Plsl on citera notamment la GFP
(green fluorescent protein) et la protéine GUS(ss-glucuronidase).
Cassettes d'expression, vecteurs et organismes hôtes
Legène plsl peut tre exprimé dans différents organismes hôtes tels que les bacteries, les levures, les
champignons, les cellules animales ou d'insectes. Le gène plsl peut tre exprimé dans un organisme hôte
sous le contrôle dupromoteurplsl de la présente invention ou sous le contrôle d'un promoteur
hétérologue.
Cassettes d'expression
Selon un mode de réalisation de l'invention, unpolynucléotide codant pour un polypeptide Plsl est
inséré dans une cassette d'expression en utilisant des techniques de clonage bien connues de l'homme
du métier. Cette cassette d'expression comprend les éléments nécessaires à la transcription et à la
traduction des séquences codant pour le polypeptidePlsl. Avantageusement, cette cassette d'expression
comprend à la fois des éléments permettant de faire produire un polypeptide Plsl par une cellule hôte et
des éléments nécessaires à la régulation de cette expression. Dans un premier mode de réalisation, les
cassettes d'expression selon l'invention comprennent, dans le sens de la transcription, un promoteur
fonctionnel dans un organisme hôte, legène plsl ou la séquence codante du gène plsl et une séquence
terminatrice dans ledit organisme hôte.
Préférentiellement, la cassette d'expression comprend, dans le sens de la transcription, un promoteur
fonctionnel dans un organisme hôte, unpolynucléotide choisi parmi lespolynucléotides suivants :
a) unpolynucléotides codant pour le polypeptide Plsl de la SEQ ID No. 6 ou pour un
fragment biologiquement actif du polypeptide Plsl de la SEQ ID No. 6 ;
b) unpolynucléotide de la SEQ ID No. 1 ;
c) unpolynucléotide de la SEQ ID No. 3 ;
d) unpolynucléotide de la SEQ IDNO. 4 ;
e) unpolynucléotide de la SEQ IDNO. 5 ;
f) un polynucléotide homologue à unpolynucléotide tel que défini en b), c), d) ou e) ;
g) unpolynucléotide capable de s'hybrider de manière spécifique à unpolynucléotide
tel que défini en b), c), d) ou e) ;
et une séquence terminatrice dans ledit organisme hôte.
Dans un autre mode de réalisation préféré de l'invention, la cassette d'expression comprend, dans le
sens de la transcription, un promoteur fonctionnel dans un organisme hôte, unpolynucléotide choisi
parmi les polynucléotides suivants :
a) unpolynucléotides codant pour le polypeptide comprenant un polypeptide Plsl de la
SEQ ID No. 6 ou pour un fragment biologiquement actif du polypeptide Plsl de la
SEQ ID No. 6 ;
h) unpolynucléotide codant pour un polypeptide comprenant un plypeptide
homologue au polypeptide Plsl de la SEQ ID No. 6 ;
i) unpolynucléotide codant pour un polypeptide comprenant un polypeptide Plsl
fusionné à un polypeptide rapporteur ;
et une séquence terminatrice dans ledit organisme hôte.
239/503
Tout type de séquence promotrice peut tre utilisée dans les cassettes d'expression selon l'invention. Le
choix du promoteur metallothionein et les promoteurs de virus etd'adénovirus. Tous ces promoteurs
sont décrits dans la littérature et bien connus de l'homme du métier.
Le promoteur du gène plsl de Magnaporthe grisea peut tre utilisé pour exprimer un gène hétérologue
dans un organisme hôte et notamment dans les champignons. L'invention a donc également pour objet
des cassettes d'expression comprenant le promoteur d'un gène plsl associé de manière fonctionnelle à
une séquence codant pour une protéine hétérologue, permettant 1'expression de ladite protéine dans les
champignons.
De préférence, la cassette d'expression selon l'invention comprend, dans le sens de la transcription,
unpolynucléotide de la SEQ IDNO. 2 ou un fragment biologiquement actif dupolynucléotide de la
SEQ IDNO. 2, une séquence codant pour un polypeptide hétérologue et une séquence terminatrice
fonctionnelle dans champignons.
Par séquence codant pour un polypeptide hétérologue on entend selon l'invention une séquence codant
pour un polypeptide différent du polypeptidePlsl. Tout gène d'intért peuttre exprimé dans un
organisme hôte sous le contrôle d'un promoteur plsl. De préférence, le promoteur plsl est utilisé pour
1'expression d'un gène hétérologue dans les champignons. Dans un mode de réalisation préféré de
l'invention, le promoteur plsl est associé de manière fonctionnelle à la séquence codante d'un gène
rapporteur. L'activité du promoteur plsl dans différentes conditions peut ainsi tre évalué à l'aide d'un
gène rapporteur tel que les gènes rapporteurs GUS(P-glucuronidase), GFP (green fluorescent protein),
LUC (luciferase), CAT (chloramphenicol transferase)ou-galactosidase (lacZ).
Dans un mode de réalisation préféré de l'invention, le promoteur plsl est associé de manière
fonctionnelle à la séquence codante d'un gène marqueur. L'expression du gène marqueur permet la
sélection des organismes transformés par leur résistance aux antibiotiques ou aux herbicides par
exemple. On citera notamment les séquences codantes pour un gène de tolérance à un antibiotique ou
un herbicide, comme les gènes de résistance à 1'hygromycine (hph : Punt et al., 1987), à la
phléomycine(ble : Drocourt, 1990) ou à l'herbicide bialaphos (Bar : Pall et Brunelli, 1993).
Dans un autre mode de réalisation, la cassette d'expression selon l'invention comprend dans le sens de
la transcription, un promoteur fonctionnel dans un champignon, en particulier Magnaporthe grisea, la
séquence antisens de la séquence codante du gène plsl et une séquence terminatrice fonctionnelle dans
ledit champignon.
Les cassettes d'expression, selon la présente invention, peuvent en outre inclure toute autre séquence
nécessaire à 1'expression du gène plsl ou d'un gène hétérologue, comme par exemple des éléments de
régulation ou des séquences signal permettant l'adressage du polypeptide Plsl. On peut notamment
utiliser toute séquence de régulation permettant d'augmenter le niveau d'expression de la séquence
codante insérée dans ladite cassette d'expression. Selon l'invention, on peut notamment utiliser, en
association avec la séquence de régulation promotrice, d'autres séquences de régulation, qui sont
situées entre le promoteur et la séquence codante, telles que des activateurs de transcription
("enhancer"). Comme signal d'adressage membranaire dans les organismes hôtes on citera notamment
celui de la proteine A chez les bactéries (Nilsson et al., Methods in
Enzymology 198 : 3,1991).
Une grande variété de séquences terminatrices sont utilisables dans les cassettes d'expression selon
l'invention, ces séquences permettent la terminaison de la transcription et lapolyadénylation
del'ARNm. Toute séquence terminatrice fonctionnelle dans l'organisme hôte sélectionné peut tre
utilisée.
La présente invention a également pour objet unpolynucléotide comprenant une cassette d'expression
selon l'invention, avantageusement les cassettes d'expression selon la présente invention sont insérées
dans un vecteur.
Vecteurs
240/503
La présente invention concerne donc également des vecteurs de réplication ou d'expression pour la
transformation d'un organisme hôte comprenant au moins un polynucléotideplsl ou une cassette
d'expression selon la présente invention. Ce vecteur peut notamment tre constitué par un plasmide, un
cosmide, un bactériophage ou un virus dans lequel est inséré un polynucléotideplsl ou une cassette
d'expression selon l'invention.
Les techniques de construction de ces vecteurs et d'insertion d'unpolynucléotide de l'invention dans ces
vecteurs sont bien connues de l'homme du métier. De manière générale, tout vecteur capable de se
maintenir, de s'autorépliquer ou de se propager dans une cellule hôte et notamment afin d'induire
l'expression d'unpolynucléotide ou d'un polypeptide peut tre utilisé. Avantageusement, les vecteurs
selon l'invention comprennent au moins une origine de réplication pour leur réplication dans un
organisme hôte. De manière préférée, les vecteurs de l'invention comprennent également au moins un
marqueur de sélection tel qu'un gène de résistance à un antibiotique. On citera notamment des vecteurs
tels quepBluescript (Stratagene, La Jolla,Ca), pTrcHis (Invitrogen, La Jolla,Ca) et des des vecteurs
d'expression dérivés de baculovirus tels que ceux dérivés du virus de lapolyhédrine d'Sutographica
californica (AcMNPV). Un système préfère combinant un baculovirus et une cellule d'insecte est le
système baculoviruspV 111392/cellules Sf21 (Invitrogen, la Jolla,Ca). Pour 1'expression dans les
cellules animales on utilise notamment des vecteurs dérivésd'adénovirus. L'homme du métier choisira
les vecteurs appropriés notamment en fonction de l'organisme hôte à transformer et en fonction de la
technique de transformation mise en oeuvre. Les méthodes de transformation des organismes hôtes
sont bien connus de l'homme du métier (Inoue etal., Gene 96 : 23-28, 1990 ; Fincham, Microbiological
Reviews 53 : 148-170,1989)
Les vecteurs de la présente invention sont notamment utilisés pour transformer un organisme hôte en
vue de la réplication du vecteuret/ou de 1'expression d'un polypeptide
Plsl dans ledit organisme hôte. L'invention concerne une méthode pour préparer un polypeptide Plsl
comprenant les étapes suivantes :
-on transforme un organisme hôte avec un vecteur d'expression comprenant une cassette d'expression
selon l'invention,
-on cultive l'organisme hôte transformé dans des conditions permettant 1'expression du polypeptide
Plsl,
-on isole les polypeptides Plsl produits par l'organisme hôte.
Les polypeptidesPlsl recombinants produits par un organisme hôte transformé avec unpolynucléotide
peuvent tre purifiés ou isolés selon des méthodes connues de 1'homme du métier. Les polypeptidesPlsl
peuvent tre exprimés dans un organisme hôte sous la forme de protéines de fusion. On citera
notamment les vecteurspGEX pour 1'expression de protéines de fusion comprenant la glutathione Stransférase (GST). Ces protéines de fusion sont facilement purifiées par adsorption sur des billes de
glutathione-agarose. Le groupement GST peut ensuite tre éliminé par digestion avec la protéase Xa.
D'autres systèmes pour 1expression et la purification de protéines de fusion sont connues de l'homme
du métier. On citera également les protéines de fusion comprenant un polypeptide rapporteur tel que la
GFP ou la protéine GUS. L'expression de ces protéines de fusion est facilement mesurée.
Organismes hôtes
La présente invention a également pour objet, un procédé de transformation d'un organisme hôte par
intégration dans ledit organisme hôte d'au moins unpolynucléotide plsl ou d'une cassette d'expression
ou d'un vecteur selon l'invention. Lepolynucléotide peut tre intégré dans le génome de l'organisme hôte
ou se repliquer de manière stable dans l'organisme hôte. Les méthodes de transformation des
organismes hôtes sont bien connus de l'homme du métier et largement décrits dans la littérature (Inoue
etal., Gene 96 : 23-28, 1990 ;Fincham, Microbiological Reviews 53 : 148-170,1989).
La présente invention concerne également un organisme hôte transformé avec un polynucléotide plsl,
une cassette d'expression ou un vecteur selon l'invention. Par organisme hôte, on entend en particulier
selon l'invention tout organisme mono ou pluricellulaire, inférieur ou supérieur, en particulier choisi
parmi les bactéries, les levures, les champignons, les cellules animales et les cellules d'insectes. De
manière avantageuse, les bactéries sont choisies parmi Escherichia coli et Bacillus subtilis, les levures
sont choisies parmi Pichia pastoris et Saccharomyces cerevisae, les cellules d'insectes sont choisis
parmiSpodoptera frugiperda et Drosophila melanogaster, les cellules animales sont choisis parmi les
cellules CHO, HeLa et COS.
241/503
Les techniques de construction de vecteurs, de transformation d'organismes hôtes et d'expression de
polynucléotides et de polypeptides hétérologues dans ces organismes sont largement décrites dans la
littérature (Ausubel F. M. et al.,"Current Protocols in Molecular
Biology"Volumes 1 et 2, Greene Publishing Associates et Wiley-Interscience, 1989 ;
T. Maniatis, E. F. Fritsch, J. Sambrook, Molecular Cloning A laboratory Handbook, 1982).
La présente invention concerne également l'utilisation de polynucléotides plsl et de polypeptides Plsl
pour l'identification des gènes impliqués dans la pathogénie des champignons ou pour l'identification
de nouvelles molécules fongicides inhibitrices de la pathogénie des champignons.
Identification des gènes impliqués dans la pathogénie des champignons
Le gène plsl contrôle différentes fonctions biologiques del'appressorium comme la différenciation de
l'aiguille d'infection et une croissance dans la plante infectée. La diversité des fonctions contrôlées par
le gène plsl suggère qu'il agit soit dans une voie de signalisation contrôlant l'activité d'autres gènes, soit
dans un processus de différenciation dont le blocage entraine de nombreux effets secondaires. Il est par
exemple possible d'identifier les gènes dont 1'expression dépend du gène plsl par l'étude comparative
des gènes exprimés chez un mutant de M. grisea dont 1'expression de la protéine aura été inhibée,
notamment au moyen d'un antisens selon l'invention défini auparavant, et la souche sauvage de
M.grisea.
Inhibition de la pathogénie des champignons
Des champignons dans lesquels le gène plsl est inactivé ou inhibé sont incapables de différencier
l'aiguille de pénétration essentielle à l'infection. L'invention concerne des procédés pour inhiber la
pathogénie des champignons en inactivant ou en inhibant l'expression du gène plsl. De préférence, les
champignons sont choisis parmi Botrytis cinerea, Mycosphaerella graminicola, Stagnospora nodorum,
Blumeria graminis,
Colleotrichum lindemuthianum, Puccinia graminis, Leptosphaeria maculans, Fusarium oxysporum,
Fusarium graminearum et Venturia inaequalis.
De manière préférée, l'invention concerne des procédés pour inhiber la pathogénie d'un champignon,
les dits procédés comprenant l'inhibition de 1'expression d'unpolynucléotide plsl selon l'invention dans
ledit champignon, ou l'inhibition de 1'expression d'un polypeptidePlsl selon l'invention dans ledit
champignon ou l'inhibition de l'activité biologique d'un polypeptidePlsl selon l'invention dans ledit
champignon. De préférence, cette inhibition affecte spécifiquement 1'expression dugène plsl et
l'activité biologique du polypeptidePlsl. L'invention ne concerne donc pas les procédés comprenant
l'inhibition générale de 1'expression des gènes dans le champignon. On comprendra que l'inhibition de
1'expression dugène plsl peut cependant entrainer l'inhibition d'autres gènes appartenant par exemple à
la mme voie de signalisation ou au mme complexe membranaire.
Différentes méthodes bien connues de l'homme du métier peuvent tre mises en oeuvre pour inhiber la
pathogénie des champignons en inhibant 1'expression du gène plsl dans ces champignons. Dans un
mode de réalisation de l'invention, le gène plsl est inactivé par mutagenèse insertionnelle ou par
recombinaison homologue (techniques de remplacement de gène ou de"knock out"). Dans un autre
mode de réalisation de l'invention, 1'expression d'un polypeptide Plsl est inhibé par 1'expression
d'unpolynucléotide antisens du gène plsl dans les champignons. Dans un troisième mode de réalisation
de l'invention, 1'expression dugène plsl est inhibée par un composé inhibiteur.
Le niveau d'expression d'unpolynucléotide plsl ou d'un polypeptide PLS 1 dans les champignons peut
tre mesuré selon des techniques décrites dans la littérature. On citera notamment leNorthern blot, la
PCR et les DNA arrays (puces à ADN) pour lespolynucléotides et le Western blot pour les
polypeptides.
Identification de nouvelles molécules fongicides inhibitrices de la pathogénie des champignons
L'inactivation du gène plsl chez Magnaporthe grisea, champignon pathogène du riz, entraine une perte
de la pathogénie de ce champignon. Par ailleurs, des gènes homologues ont pu tre clones chez d'autres
champignonsphytopathogènes. Par conséquent, des composés inhibiteurs de 1'expression du gène plsl
ou de l'activité biologique du polypeptide Plsl dans les champignons pourraient tre utilisés pour inhiber
la pathogénie des champignons. L'invention concerne donc des procédés pour l'identification de
composés inhibant la pathogénie des champignons comprenant une étape d'identification d'un composé
242/503
inhibant spécifiquement 1'expression d'unpolynucléotide plsl dans ledit champignon, ou une étape
d'identification d'un composé inhibant 1'expression d'un polypeptide Plsl dans ledit champignon ou une
étape d'identification d'un composé inhibant l'activité biologique d'un polypeptide Plsl dans ledit
champignon.
De préférence, les champignons sont choisis parmi Botrytis cinerea,
Mycosphaerella graminicola, Stagnospora nodorum, Blumeria graminis, Colleotrichum
lindemuthianum, Puccinia graminis, Leptosphaeria maculans, Fusarium oxysporum,
Fusarium graminearum et Venturia inaequalis.
Lespolynucléotides plsl, les polypeptides Plsl, les vecteurs et les organismes hôtes de la présente
invention peuvent ainsi tre utilisés dans différents tests de criblage afin d'identifier de nouveaux
composés antifongiques.
Identification d'inhibiteurs se fixant sur la protéine Plsl de champignon
Des molécules inhibant directement l'activité du polypeptide Plsl pourraient inhiber la pathogénie du
champignon et conduire au développement de nouveaux fongicides.
L'invention concerne donc un procédé pour l'identification de composés inhibant la pathogénie des
champignons comprenant les étapes suivantes : -mettre en contact ledit composé avec un
polypeptidePlsl, et -détecter la fixation dudit composé audit polypeptide.
Préférentiellement, le procédé comprend également une étape dans laquelle on détermine si ledit
composé inhibe la pathogénie des champignons.
Toute méthode permettant de préparer un polypeptide Plsl et de le purifier ou de l'isoler peut tre
utilisée dans les procédés de la présente invention. De préférence, le polypeptide Plsl est exprimée dans
un système d'expression hétérologue (par exemple bactérie, levure, cellule animale ou d'insecte) au
moyen d'unpolynucléotide plsl selon l'invention, la purification simplifiée du polypeptide Plsl permet
ensuite d'identifier de nouvelles molécules se fixant sur la protéinePlsl. De manière préférée, la
protéine Plsl est sur-exprimée dans les membranes d'une cellule d'un système d'expression hétérologue
puis la purification simplifiée des membranes des organismes hôtes exprimant la protéine Plsl permet
d'identifier de nouvelles molécules se fixant sur la protéinePlsl. L'identification des dites molécules se
fait par des méthodes bien connues de l'homme du métier, notamment des méthodes de détection
physique de la fixation des composés testés sur la protéine Plsl (système BIACORE ; Karlson & al.,
J.of Biomolecular Interaction Analysis, special issue Drug Discovery : 18-22).
Identification d'inhibiteurs interagissant avec les complexes membranaires contenant la protéine Plsl
Les protéines de la famille des tétraspanines auxquelles appartient la protéinePlsl, interagissent avec
d'autres protéines membranaires (Maecker et al., FASEB J., 11 : 428-442, 1997). La première étape
consiste à identifier les protéines formant un complexe membranaire avec la protéine Plsl par des
méthodes moléculaires comme la méthode du double hybride (Van Aeist et al., PNAS. 90 : 62136217,1993) ou le clonage des gènes de
M. grisea homologues des genes codant les protéines de ces complexes connues chez les animaux
comme lesintégrines (Hemler, Current Opinion in Cell Biology 10 : 578-585, 1988), ou des méthodes
biochimiques (immuno précipitation des complexes membranaires auquel appartiendrait la protéine
Plsl et caractérisation des protéines de ce complexe comme cela a été réalisé dans le cas des
tétraspanines animales (Horvath et al., J.
Biological Chem. 273 : 30537-30543,1998). La connaissance des protéines interagissant avec la
protéinePlsl permet de construire un système de détection de molécules capables d'inhiber l'interaction
entre ces protéines et la protéine Plsl. De tels systèmes de détection sont bien connus de l'homme du
métier, notamment le système double hybride de la levure (Van Aeist et al., PNAS. 90 : 62136217,1993) avec des fragments de la protéine Plsl et de celles interagissant avecPlsl, ou un système de
mesure de la fixation d'une des protéines du complexe à la protéine Plsl présente dans une préparation
membranaire en utilisant un couple Europium-allophycocyanine, chaque élément du dispositif de
fluorescence par transfert étant greffé aux protéines testées (Mathis, Clin. Chem. 39 : 1953-1959,1993).
Identification d'inhibiteurs des régulateurs de 1'expression dugène plsl
243/503
Des molécules inhibant 1'expression du gène plsl pourraient également inhiber la pathogénie du
champignon et conduire au développement de nouveaux fongicides. Dans la présente
invention1'expression"inhibition de 1expression dugène plsl"désigne l'inhibition de 1'expression
d'unpolynucléotide plsl ainsi que l'inhibition de 1'expression d'un polypeptide Plsl dans les organismes
hôtes et préférentiellement dans les champignonsphytopathogènes.
L'invention a également pour objet un procédé pour l'identification de composés inhibant la pathogénie
des champignons comprenant les étapes suivantes : -mettre en contact ledit composé avec un
organisme hôte transformé avec unpolynucléotide ou un vecteur selon l'invention tel que cet
organisme hôte exprime un gène rapporteur sous le contrôle du promoteur dugène plsl ; et -détecter
l'inhibition de 1'expression dudit gène rapporteur.
Préférentiellement, le procédé comprend également une étape dans laquelle on détermine si ledit
composé inhibe la pathogénie des champignons.
L'utilisation d'unpolynucléotide selon l'invention comprenant lepromoteurplsl associé à la séquence
codante d'un gène reporteur (GUS ou GFP par exemple) permet de mesurer l'activité promotrice du
promoteur plsl dans une cellule fongique ou dans une cellule hôte. Ce procédé permet d'identifier des
composés inhibant l'activité du promoteur plsl et donc 1'expression dugène plsl au niveau
transcriptionnel. Une souche recombinée comprenant le gène ci-dessus est ainsi utilisée pour identifier
des molécules inhibant 1'expression du gène plsl, ce qui se manifeste par une inhibition de 1'expression
de la protéine rapporteur de la souche recombinée dans les conditions d'expression du gène plsl.
Ce type de test est bien connu de l'homme du métier et décrit dans la littérature, notamment Axiotis et
al. (1995. pp. 1-7 in Antifungal Agents : Discovery and Mode of
Action. Dixon GK, Coppong LG and Hollomon DW eds, BIOS Scientific publisher Ldt,
Oxford, UK).
Dans un autre mode de réalisation, l'invention concerne un procédé pour l'identification de composés
inhibant la pathogénie des champignons comprenant les étapes suivantes : -mettre en contact ledit
composé avec un organisme hôte transformé avec unpolynucléotide selon l'invention ou un vecteur
selon l'invention, ledit organisme hôte exprimant un polypeptide Plsl ; et -détecter l'inhibition de
1'expression dudit polypeptidePlsl.
De préférence, le polypeptide Plsl est un polypeptide de fusion comprenant un polypeptide rapporteur
tel que GUS ou GFP dont 1'expression est facilement mesurée.
Préférentiellement, le procédé comprend également une étape dans laquelle on détermine si ledit
composé inhibe la pathogénie des champignons. Ce procédé permet d'identifier des composés inhibant
1'expression dugène plsll au niveau transcriptionnel ou au niveau traductionnel. Une souche
recombinée exprimant un polypeptide Pls l et de préférence un polypeptide Plsl fusionné à un
rapporteur est ainsi utilisée pour identifier des molécules inhibant 1'expression du gène plsl, ce qui se
manifeste par une inhibition de 1'expression du polypeptide Plsl de la souche recombinée dans les
conditions d'expression dugène plsl.
La présente invention concerne donc un procédé pour identifier des composés inhibant la pathogénie
des champignons liée à 1'expression du gène plsl, ledit procédé consistant à soumettre un composé, ou
un mélange de composés, à un test approprié pour l'identification des composés inhibiteurs de ladite
pathogénie des champignons et à sélectionner les composés réagissant de manière positive audit test, le
cas échéant à les isoler, puis à les identifier.
De manière préférentielle, le test approprié est un test tel que défini ci-dessus.
De manière préférée, un composé identifie selon ces procédés est ensuite testé pour ces propriétés antifongiques et pour sa capacité à inhiber la pathogénie du champignon pour les plantes selon des
méthodes connues de l'homme du métier. Préférentiellement, le composé est évalué à l'aide de tests
phénotypiques tels que des essais de pathogénie sur feuilles ou sur plantes entières.
244/503
Par composé on entend selon l'invention tout composé chimique ou mélange de composés chimiques,
y compris les peptides et les protéines.
Par mélange de composés on comprend selon l'invention au moins deux composés différents, comme
par exemple les (dia) stéréoisomères d'une molécule, des mélanges d'origine naturelle issus de
1'extraction de matériel biologique (plantes, tissus végétaux, culture bactériennes, cultures de levures
ou de champignons, insectes, tissus animaux, etc.) ou des mélanges réactionnels non purifiés ou
purifiés totalement ou en partie, ou encore des mélanges de produits issus de techniques de chimie
combinatoire.
La présente invention concerne enfin de nouveaux composés inhibiteurs de la pathogénie des
champignons liée à 1'expression du gène plsl, notamment les composés identifiées par les procédés
selon l'inventionet/ou les composés dérivés des composés identifiés par les procédés selon l'invention.
De manière préférentielle, les composés inhibiteurs de la pathogénie des champignons liée à
1'expression du gène plsl ne sont pas des inhibiteurs généraux d'enzymes. De manière également
préférentielle, les composés selon l'invention ne sont pas des composés déjà connus pour avoir une
activité fongicide et/ou une activité sur la pathogénie des champignons.
L'invention a également pour objet un procédé pour traiter des plantes contre un
champignonphytopathogène caractérisé en ce qu'il comprend le traitement desdites plantes avec un
composé identifié par un procédé selon l'invention.
La présente invention concerne également un procédé de préparation d'un composé inhibiteur de la
pathogénie des champignons, ledit procédé comprenant les étapes d'identification d'un composé
inhibant la pathogénie des champignons liée à 1'expression dugène plsl par le procédé d'identification
selon l'invention, puis de préparation dudit composé identifié par les méthodes usuelles de synthèse
chimique, de synthèse enzymatique et/ou d'extraction de matériel biologique. L'étape de préparation du
composé peut tre précédée le cas échéant par une étape dite d'optimisation par laquelle on identifie un
composé dérivé du composé identifié par le procédé d'identification selon l'invention, ledit composé
dérivé étant ensuite préparé par les méthodes usuelles.
Les exemples ci-après permettre d'illustrer l'invention, sans toutefois chercher à en limiter la portée.
Toutes les méthodes ou opérations décrites ci-dessous dans ces exemples sont données à titre
d'exemples et correspondent à un choix, effectué parmi les différentes méthodes disponibles pour
parvenir au mme résultat. Ce choix n'a aucune incidence sur la qualité du résultat et par conséquent,
toute méthode adaptée peut tre utilisée par 1'homme de l'art pour parvenir au mme résultat. La plupart
des méthodes d'ingénierie des fragments d'ADN sont décrites dans"Current Protocols in Molecular
Biology"Volumes 1 et 2,
Ausubel F. M. et al, publiés par Greene Publishing Associates et Wiley-Interscience (1989) ou dans
Molecular cloning, T. Maniatis, E. F. Fritsch, J. Sambrook (1982). Les méthodes spécifiques des
champignons sont décrites dans Sweigard et al. (Fungal Genetics
Newletter. 44 : 52-53,1997) pour les vecteurs de transformation fongiques utilisés, dans
Orbach (Gene 150 : 159-162,1994) pour la construction d'une banque cosmidique, dans
Sweigard et al. (Fungal Genetics Newletter. 37 : 4-5,1990) pour la préparation d'ADN gnomiques
fongiques et dans Agnan et al. (Fungal Genetics and Biology 21 : 292-301, 1997).
L'homme du métier sera à mme de reproduire l'invention, isoler et cloner les polynucléotides selon
l'invention, totalement ou en partie, notamment lepromoteur plsl ou la séquence codante de la protéine
Plsl sur la base des informations et séquences contenues dans la présente demande brevet, notamment
au moyen des techniques de biologie moléculaire usuelles dans le domaine technique comme la PCR
(revue sur l'utilisation de ces techniques chez les champignons : Agnan et al., Fungal Genetics and
Biology 21 : 292-301,1997).
Description des figures
Figure la : Profil d'hybridation de digestions d'ADN gnomique du mutant psll par une sonde pAN7.1.
Figurelb : Structure de la région du génome du mutant plsl où s'est intégré le plasmide pAN7.1 ; EcoRI
(E) ;HindIII (H) ; Ssp I (S) ; BamHI (B).
245/503
Figure 2 : Fragment de restriction chevauchant les extrémités plasmidique et gnomique chez le
mutantplus 1. 421 (+) et 421 (-) indiquent les positions des primers utilisés pour la
PCR inverse.
Figure 3 : Cartographie des inserts *NotI32H7 (15 kb) et BamHI32H7 (8,5 kb) du cosmide 32H7
clones dans le vecteurpCB1265 (résistance à la phosphinothricine).
Figure 4 : Structure du gène de pathogénie inactivé chez le mutant plsl ; P (Promoteur),I (site
d'insertion).
Figure 5 : Structure hypothétique de la protéine déduite dugène plsl. E (extracellulaire),
PM (membrane plasmique), DT (domaine transmembranaire), C (cystéine), D (acide aspartique), N
(asparagine), la position des acides aminés est indiqué entre parenthèses.
(142-145) indique un site de N-glycosilation.
Figure 6 : Comparaison des séquences protéiques déduites des gènes homologues de plsl de
Magnaporthe grisea obtenu par PCR chez les champignons Ascomycètes Neurospora crassa(N. crassa),
Pyricularia higginssi (P. higgin
1) L'inactivation d'un gène essentiel à la pathogénie par l'insertion de manière aléatoire dans sa
séquence nucléotidique d'un fragment d'ADN étranger (mutagenèse insertionnelle).
2) La récupération et la caractérisation de la séquence nucléotidique fongique ainsi modifiée, puis la
démonstration de son implication dans la pathogénie du champignon visà-vis du riz et del'orge.
Les étapes méthodologiques à franchir successivement ont été les suivantes :
1) L'obtention d'une collection d'isolats du champignon ayant intégré de manière aléatoire un fragment
d'ADN étranger dans leur génome (transformants). En l'occurence,1'ADN étranger est un plasmide
comportant le gène hph d'Escherichia coli, ce qui permet leur sélection sur la base de la résistance
àl'hygromycine. Il a été introduit dans le génome du champignon par transformation de protoplastes.
2) La recherche de transformants non pathogènes vis-à-vis du riz et de l'orge parmi la collection
(mutants de pathogénie). Le critère retenu pour la non pathogénie d'un transformant a été l'incapacité à
provoquer des lésions foliaires suite à l'inoculation de spores de ce transformant à des plants de riz et
d'orge.
3) La démonstration génétique de l'inactivation d'un gène de pathogénie par le plasmide chez les
mutants incapables d'infecter le riz etl'orge. Il s'agissait d'établir une liaison génétique complète entre
le caractère de résistance àl'hygromycine, qui traduit la présence du plasmide dans le génome du
mutant, et celui de la non pathogénie, qui traduit l'inactivation d'un gène essentiel à la capacité
infectieuse du champignon. Ce degré de liaison a été évalué par l'analyse de la ségrégation des
caractères de résistance àl'hygromycine et de non pathogénie chez les descendants d'un croisement
entre le mutant étudié et une souche sauvage, pathogène vis-à-vis du riz et de l'orge et de signe sexuel
compatible avec celui du mutant.
4) La récupération de la région gnomique du champignon où s'est produite l'insertion du plasmide
mutateur. Le principe a consisté à isoler un fragment d'ADN du mutant comportant à la fois des
séquences plasmidiques et génomiques, repérable grâce à une expérience d'hybridation avec une sonde
d'origine plasmidique. La partie gnomique incluse dans ce fragment peut ensuite servir à isoler la
région gnomique sauvage complète selon le mme principe.
5) La démonstration que la région gnomique avoisinant le point d'insertion du plasmide contient le
gène de pathogénie. Si le gène de pathogénie recherché se trouve dans la région gnomique avoisinant
le point d'insertion du plasmide, son introduction dans legénôme de l'isolat mutant, à l'aide d'un
vecteur plasmidique comportant un autre marqueur de sélection, doit permettre de restaurer la
pathogénie par complémentation de la fonction rendue déficiente par l'insertion du premier plasmide.
La preuve en est donnée si les spores d'au moins un transformant obtenu par cette expérience sont
capables de provoquer autant de lésions foliaires que la souche sauvage.
246/503
6) La caractérisation de la séquence gnomique du champignon à proximité du point d'insertion du
plasmide. Le produit du séquençage de la région gnomique avoisinante au point d'insertion du plasmide
a été analysé avec des logiciels de traitement de séquences, de manière à mettre en évidence une
séquence nucléotidique susceptible d'tre traduite en séquence protéique (cadre de lecture ouvert). Cette
recherche se fait sur la base de la recherche des signaux consensus d'initiation et de terminaison de la
traduction en protéine. La preuve de l'existence d'un cadre de lecture ouvert (et donc d'un gène) dans
cette région a été apportée par le clonage de l'unité transcriptionnelle correspondante, grâce au criblage
d'une banque d'ADN complémentaires des ARN messagers(ADNc) avec une sonde produite à partir
d'un fragment de cette région. La séquence de cet ADNc a permis de déterminer avec précision la taille
et la séquence primaire de la protéine correspondante, ainsi que la position d'éventuels introns dans la
séquence gnomique du gène.
7) La démonstration que le cadre de lecture ouvert localisé au niveau du point d'insertion du plasmide
est celui du gène de pathogénie. Elle a été faite grâce à une expérience de remplacement, qui a consisté
à provoquer au moyen d'une transformation la substitution de la séquence du gène étudié par un
marqueur de sélection. Elle fait intervenir, au niveau des séquences gnomiques situées de par et d'autre
du gène, un double événement de recombinaison homologue entre le génome de la souche sauvage et
un vecteur de remplacement. Ce vecteur est constitué d'un grand fragment d'ADN de séquence
homologue à celle de la région contenant le gène de pathogénie supposé, à 1'exception du gène luimme, qui a été supprimé par restriction et remplacé par le gène de résistance à l'hygromycine. Les
spores des transformants résistants àl'hygromycine pour lesquels il est possible de montrer par une
expérience d'hybridation qu'ils ont perdu la séquence du gène étudié et qu'ils n'ont qu'une copie du gène
de résistance àl'hygromycine, sont inoculés à des plants de riz et d'orge. S'ils sont tous incapables de
provoquer la moindre lésion foliaire, la séquence nucléotidique étudiée est bien celle du gène de
pathogénie.
Expérience 1 : mutagenèse insertionnelle (fabrication du mutant)
Les conditions de culture, d'obtention des protoplastes, de transformation ainsi que de purification et
de stockage des transformants de Magnaporthe grisea sont décrites par
Siluéet al. (1998,Physiol. Mol. plant Pathol., 53,239-251). La transformation a été réalisée avec 1pg
de plasmide pAN7.1 (Punt etal., 1987 Gene 78 : 147-156) et107 protoplastes de la soucheP1.2 deM.
grisea. Cette souche provient de la collection du laboratoire de Phytopathologie du CIRAD de
Montpellier. La sélection des transformants a été réalisée par incorporation d'hygromycine dans les
milieux de culture géloses, aux concentrations de 240 ppm pour le milieu de sélection primaire et de
120 ppm pour celui de sélection secondaire.
Expérience 2 : criblage de la collection de transformants (isolement du mutant non pathogène plsl ou
mutant 421)
A) Essais de pathogénie sur feuilles en survie
Les essais de pathogénie ont été réalisés sur deux variétés de riz, Maratelli et
Sariceltick, et une variétéd'orge, Express. Maratelli sont des variétés très sensibles à la pyriculariose et
qui ne possèdent pas de gènes de résistance à la soucheP1.2. Les variétés d'orge sont extrmement
sensibles à la pyriculariose. Le riz a été cultivé à25 C le jour,
15 C la nuit avec une hygrométrie supérieure à 70%, l'orge en conditions froides (222 C). Des
fragments de feuilles (2,5 cm) de riz et d'orge ont été prélevés dans la partie médiane de la plus jeune
feuille de plants âgés d'une vingtaine de jours. Ces fragments ont été déposés dans des boites
multicompartimentées contenant de 1'eau gélosé à1 % additionné de 2mg/1 dekinétine, milieu
permettant leur survie durant 14 jours. Il est important de noter que le riz développe une forte
résistance physiologique à la pyriculariose durant les périodes de fortes chaleurs. Cette résistance peut
tre atténuée par un apport de fertilisant azoté aux plants : deux arrosages avec une solution de sulfate
d'ammonium5g/m2 à une semaine d'intervalle. Le deuxième arrosage a lieu 2 à 3 jours avant
l'inoculation.
Les conditions de sporulation et de la préparation d'inoculum de spores deM grisea sont décrites par
Silué et al. (op.cit.). L'inoculation a été réalisée à l'aide d'un coton tige humide trempé dans une
suspension de spores et passé sur les fragments de feuilles en survie. La quantité de spores déposée a
été estimée en déposant une goutte de la suspension sur une lame de verre. Les symptômes ont été
observés après 4-7 jours d'incubation à24 C, 100 % d'hygrométrie. Chaque transformant a été testé sur
247/503
quatre fragments de feuille de riz de chaque variété et quatre d'orge lors du criblage primaire. Le
transformant plsl ne présentant aucun symptôme de la maladie sur riz et sur orge a été inoculé une
seconde fois afin de confirmer son phénotype avec une suspension de spores de concentrationajustée à
105 spores par ml.
B) Essais de pathogénie sur plantes entières
De manière à confirmer le phénotype du mutant non pathogène plsl (ou mutant 421) détecté par
l'inoculation de feuilles en survie, le département de Phytopathologie du
CIRAD de Montpellier a réalisé des inoculations de plantes entières avec les spores de ce mutant. Les
deux cultivars de riz sensibles à la souche PI. 2, Maratelli et Sariceltick ont été semés et cultivés en
serre. Trois applications d'azote ont été effectuées durant les trois premières semaines de culture(à 5,10
et 20 jours après le semis). L'inoculation par pulvérisation d'une suspension de spores a lieu 10 à 15
jours après le dernier apport d'azote, selon le degré de maturité des plantes. La concentration en spores
a été déterminée par comptage avec une cellule de Thoma et ajustée à une valeur 20000 spores/ml. Les
suspensions de spores du mutant plsl et de la souche PI. 2 non transformée ont été pulvérisées sur trente
plantes à raison de 1 ml de suspension de spores par plante avec un aérographe. Une feuille de chacune
de ces plantes a été collectée pour comptage du nombre de lésions après développement de celles-ci (5
à 7 jours). Aucune lésion typique de la maladie n'est apparue sur les plantes inoculées avec les spores
du mutant plsl.
Expérience 3 : Analyse phénotypique des descendants d'un croisement entre le mutant plsl et la souche
sauvage M4 (confirmation de l'existence de la liaison génétique entre la mutation d'un gène de
pathogénie et l'insertion du plasmide conférant la résistance à l'hygromycine).
Les conditions de croisement et d'isolement des ascospores produites sont décrites par Silué et al.
(op.cit.). Les cultures issues de chacune des ascospores ont été repiquées sur milieu complet avec
120mg/1 d'hygromycine et leurs spores inoculées à des feuilles d'orge et de riz en survie. Les
descendants de ce croisement étaient disponibles sous la forme de cinq tétrades (7 à 8 descendants issus
d'un mme asque). Les résultats de l'analyse phénotypique de ces descendants figurent dans le tableau 1
ci-dessous.
EMI27.1
>;tb;
>;SEP; Tétrade >;SEP; 12345
>;tb; Ascospore >;SEP; H >;SEP; P >;SEP; M >;SEP; H >;SEP; P >;SEP; M >;SEP; H >;SEP; P
>;SEP; M >;SEP; H >;SEP; P >;SEP; M >;SEP; H >;SEP; P >;SEP; M
>;tb; >;SEP; 1 >;SEP; s >;SEP; + >;SEP; GA >;SEP; R-GA >;SEP; R-GA >;SEP; R-GA >;SEP; s
>;SEP; + >;SEP; GA
>;tb; >;SEP; 2 >;SEP; s >;SEP; + >;SEP; GA >;SEP; R-GA >;SEP; R-GA >;SEP; R-GA >;SEP; RGA
>;tb; >;SEP; 3 >;SEP; s >;SEP; + >;SEP; GA >;SEP; R-GA >;SEP; R-GA >;SEP; s-rc >;SEP; s
>;SEP; + >;SEP; GA
>;tb; >;SEP; 4 >;SEP; s >;SEP; + >;SEP; GA >;SEP; R-GA >;SEP; R-GA >;SEP; s-rc >;SEP; R-GA
>;tb; >;SEP; 5 >;SEP; R-rc >;SEP; s-rc >;SEP; s-rc >;SEP; s-rc >;SEP; s-rc
>;tb; >;SEP; 6 >;SEP; R-rc >;SEP; s-rc >;SEP; s-rc >;SEP; s-rc >;SEP; s-rc
>;tb; >;SEP; 7 >;SEP; R-rc >;SEP; s-rc >;SEP; s-rc >;SEP; R-GA >;SEP; R-rc
>;tb; >;SEP; 8 >;SEP; R-rc >;SEP; s-rc >;SEP; R-rc
>;tb;
Tableau 1 : Analyse phénotypique des descendants du croisement M4xMutant plsl
H : hygromycine, s : sensible àl'hygromycine, R : résistant àl'hygromycine ; P : pathogénie ;
M : mycélium, GA : mycélium gris et aérien, rc : mycélium ras et clair.
En plus des phénotypes liés à la pathogénie et à la résistance àl'hygromycine, un troisième caractère
ayant trait à la morphologie du mycélium a été clairement mis en évidence chez les descendants sous la
forme de deux allèles : un allèle conférant un mycélium gris et aérien (GA, théoriquement le phénotype
sauvage de morphologie mycélienne des deux souches de M grisea utilisées,P1.2 et M4) et un allèle
conférant un mycélium clair et ras (rc). Cette observations'est révélée tre très précieuse pour
248/503
l'interprétation des résultats de ce croisement. En effet, si aucun descendant n'a le phénotype HygR et
Path+, de nombreux descendants ont le phénotype HygS et Path-. Mais par ailleurs, ce double
phénotype coségrège avec rc, alors que HygS et Path+ coségrège avec GA. Cette observation, couplée
au fait que l'analyse des descendants en tétrades permet de reconstituer les génotypes des parents et des
descendants, permet de mettre en évidence la ségrégation de deux gènes de pathogénie indépendants.
L'un, A, est étiqueté par le plasmide (son allèle muté est lié à HygR) etl'autre, B, est lié au gène
contrôlant la morphologie du mycélium (phénotypes GA et rc). Il a été possible de montrer par la suite
que l'allèle muté de B provenait du parent M4 utilisé lors du croisement et qui avait dérivé lors de sa
multiplication végétative. Le gène A est donc étiqueté par le plasmide pAN7.1 chez le mutantplsl.
Expérience 4 : Récupération de la séquence gnomique deM. grisea cible de l'insertion du plasmide
chez le mutant plsl.
A) Préparation d'ADN gnomique de M grisea
Le protocole d'extraction et de purification employé est celui décrit par Sweigard et al. (1990 Fungal
Genet.Newsl 37 : 4)
B) Cartographie de la région d'insertion du plasmide chez le mutant plsl par hybridation
L'ADN gnomique a été quantifié au transilluminateur UV (310nm) en comparaison avec une gamme
étalon de concentration, après électrophorèse dans un gel de tampon TAE (40 mM Tris ; 40 mM
acétate ;1mM EDTA ; pH8,3) à 0,7% d'agarose et 0,2mg/1 de bromured'éthidium. Des aliquotes de
5pLg d'ADN ont été digérés pendant une nuit à37 C avec les enzymes de restriction EcoRI,SspI,
BglII,SacI et HindIII (Boehringer
Mannheim) dans au moins 20g d'eau avec le tampon approprié. Les fragments de restriction obtenus
ont été séparés par une électrophorèse d'une nuit, sous une tension de 35 V et dans un gel TAE à 0,7%
d'agarose et 0,2mg/1 de BET. Après migration, le gel d'électrophorèse est placé sur une membrane de
nylon (Hybond N+, Amersham), 1'ensemble reposant sur un plateau poreux relié à une pompe à vide
(réglée à35mm d'Hg).
Le transfert des fragments d'ADN gnomique sur la membrane est précédé d'un traitement du gel par
une solution de 0,25 M HC1 (deux fois4mn), une solution dénaturante(NaOH 0,5 M,NaCl 1,5 M ;
20mn) puis une solution neutralisante(Tris-HCI 0, 5M, EDTA lmM,NaCl 1,5 M, pH 7,2 ; deux
fois4mn). Le transfert sous vide a été réalisé dans un tampon
SSC 20X pendant 20 mn. La membrane a été séchée à37 C puis enveloppée dans un film de Saranwrap. L'ADN a été fixé de façon covalente à la membrane par une exposition de 5 mn aux UV (310
nm). Les fragments de restriction de1'ADN gnomique du mutant comportant des séquences
plasmidiques ont ensuite été repérés par une expérience d'hybridation avec une sonde radioactive
synthétisée à partir du plasmide pAN7.1. Le marquage de1'ADN plasmidique a été réalisé par la
méthode d'amorçage aléatoire (random priming) conformément aux instructions du kit Megaprime
(Pharmacia), avec dudCTP marqué au phosphore 32 (Amersham). Lapréhybridation de la membrane a
été effectuée dans une solution SDS 0,5%, SSC 6X (NaCl et citrate trisodique 0,9M),
Denhardt's 5X(Ficoll 0,1%, polyvinylpyrolidone 0,1%, sérum d'albumine bovine fraction
V 0,1%), durant 30 mn à lh à65 C (four à hybridationAppligène). La sonde radioactive a été dénaturée
par chauffage 5 mn à95 C puis ajoutée au tampon depréhybridation. Le mélange a été placé 15 h à65
C. La membrane a été lavée à65 C une première fois dans un tampon SSC 2X SDS 0,1% (deux fois
30 mn), puis dans un tampon SSC 0,2x, SDS 0,1%. (lh). La membrane a été enveloppée dans un film
deSaran-wrap puis placéeà-80 C au contact d'un film photographique(Hyperfilm MP, Amersham)
entre deux écrans amplificateurs.
Les deux bandes d'hybridation avec la sonde plasmidique obtenues par la digestion
EcoRI (figure 1) ne correspondent à aucun des fragments d'une digestion témoin du plasmide : il s'agit
donc de l'insertion d'une copie unique du plasmide, avec perte du site
EcoRI situé à l'extrémité du promoteurgpdA (l'autre site, situé dans le gène de structure hph, ne
pouvant tre perdu car situé dans la séquence nécessaire pour la sélection du transformant).
L'hybridation de la digestionSspI donne également deux bandes, dont l'une correspond au
fragmentSspI de 4 kb interne au plasmide. Les deux sitesSspI sont donc conservés et l'intégration a eu
lieu dans le fragment de 2,75 kb situé entre ces deux sites (soit la région comprenant AmpR, ORI et le
début du promoteur gpdA). La digestion par
BgllI donne une bande unique d'hybridation de très haut poids moléculaire, témoignant de la perte de
ce site. La jonction gauche de l'insertion serait donc située entre le siteBgIII et le siteSspI du
249/503
promoteurgpdA. Une double digestionEcoRI-HindIII a été réalisé (non présentée dans la figure 1) et
donne trois bandes d'hybridation, dont l'une est présente sur le profil de la digestion EcoRI (la plus
petite, située vers 3 kb). Le site HindIII est donc conservé et situé dans le grand fragment visible sur le
profil d'hybridation de la digestion
EcoRI. La cartographie de cette région montre (figure 2) qu'au maximum un fragment de 2,75 kb du
plasmide a été perdu lors de l'intégration, en particulier la séquence codant pour la résistance à
l'ampicilline et l'origine de réplication (figure 2). Le fragment de digestion
EcoRI de 3 kb chevauchant une extrémité plasmidique, constitué d'un morceau du promoteurgpdA
d'au moins 1,86 kb et d'un morceau d'ADN gnomique est sensé appartenir au gène de pathogénie muté.
Par ailleurs, l'hybridation par une sonde plasmidique de la double digestion EcoRIlSacI a permis de
montrer qu'il n'existait dans ce fragment que deux sitesSacI très proches, situés à peu près au milieu de
la région plasmidique (voir la figure 2). La stratégie d'Inverse-PCR est donc envisageable pour le
clonage de ce fragment.
C) Récupération et clonage d'un fragment d'ADN gnomique du mutant plsl contenant une partie
gnomique et une partie plasmidique par Inverse-PCR
Le-r~ ue cerLe expérience est décrit parOchmann et al. (1988 Genetics 120 : 621-623). L'ADN
gnomique du mutant plsl est digéré par l'enzyme de restriction EcoRI.
Les fragments de restriction ont été séparés selon leur taille par une électrophorèse en gel d'agarose.
Après migration, la zone du gel contenant les fragments de restriction d'une taille voisine de 3 kb a été
découpée au scalpel. Les fragments d'ADN qu'elle contenait ont été récupérés par désorption. Ces
fragments ont fait l'objet d'une ligature dans un grand volume (DNA Ligation System, Amersham dans
1001), de manière à ne favoriser que le circularisation des fragments par autoligature. L'ADN a été
précipité avec 300pI d'éthanol absolu et resuspendu dans20 gel d'eau. Les fragments circularisés ont
été digérés pendant 1 heure à37 C par l'enzyme de restriction SacI. La totalité du produit de digestion a
fait l'objet d'une PCR (PTE 100 MJ research) en conditions moyennement stringentes (30 cycles de 1'à
95 C ;1'à 50 C ;1'30"à 72 C) à l'aide des amorces oligonucléotidiques 421 (+) et421 (-) (voir la figure
2). Ces amorces ont été définies à partir de leur position sur la séquence du promoteurgpdA et avec
une structure secondaire compatible avec une réaction de PCR performante (programme OLIGO). La
taille attendue du fragment de PCR correspondant à la bordure du point d'insertion, déduite de la
cartographie faite par hybridation, était de 1,6 kb. Les produits d'amplification ont été séparés par
électrophorèse.
Deux bandes très ténues étaient visibles, l'une d'une taille de 1 kb, l'autre de 1,6 kb. Une deuxième
amplification dans les mmes conditions et en prenant comme matrice ce premier produit de PCR a
permis d'augmenter la quantité de ces deux fragments de PCR.
Le transfert sur membrane de nylon de ces deux fragments séparés par électrophorèse, suivi de
l'hybridation par une sonde synthétisée à partir du fragment de restriction BgIII-SacI du promoteur du
gène gpdA, ont pu démontrer qu'ils portent tous les deux des séquences homologues à cette sonde
(conditions d'hybridation : op.cit.). Ils ont alors été extraits du gel et ont fait l'objet d'une ligature dans
un vecteur de clonage des produits de PCR(pGEM-T Easy, Promega). Les produits de ligation ont été
utilisé pour transformer des bactéries compétentes selon le protocole décrit par Inoue et al. (1990 Gene
96 : 23-28). Des minipréparations d'ADN plasmidique et des digestions de contrôle ont permis de
confirmer que le fragment amplifié de 1,6 kb était bien celui déduit de la cartographie. Une expérience
d'hybridation avec une sonde plasmidique du fragment de PCR transféré sur membrane de nylon après
électrophrèse en gel d'agarose, a permis de montrer qu'une partie de sa. séquence est homologue à celle
du plasmide pAN7.1 (conditions de transfert et d'hybridation : op.cit.).
a. de la region génomique cible de l'insertion du plasmide chez le mutantPIS 1.
Cette région a été isolée sous la forme d'un cosmide par hybridation d'une réplique sur membrane de
nylon de la banque cosmidique de la souche 96/0/76 de M. grisea construite par Dioh et al.
(1997NucleicAcids Res. 25 (24) :5130-5131). La sonde utilisée a été préparée à partir d'un fragment
de 350 bp, produit d'une double digestion par les enzymes de restriction EcoRI etSall du fragment
d'IPCR clone lors de l'étape précédente (voir figure 2 et 3 :421CI), de manière à ne conserver qu'une
séquence strictement gnomique et homologue à celle recherchée dans la banque cosmidique. Le
siteSall de la portion gnomique du fragment d'IPCR a été identifié lors de digestions de contrôle sur ce
fragment (conditions d'hybridation op.cit.). La colonie bactérienne du cosmide 32H7 de cette banque
250/503
hybridant avec cette sonde a été multipliée et1'ADN cosmidique extrait et purifié grâce au Plasmid
Midi Kit (QIAGEN). Après quantification de1'ADN extrait par spectrophotométrie dansl'UV
(260nm), le cosmide a été cartographie par restriction.
L'ADN du cosmide a été digéré par plusieurs enzymes de restriction, les produits de digestion séparés
par électrophorèse en gel d'agarose et transférés sur membrane de nylon.
Cette membrane a été hybridée avec le fragment gnomiqueEcoRI-SaII de 350 bp clone suite à
l'expérience d'Inverse-PCR (conditions de digestion, séparation et transfert des fragments de restriction
et hybridation : op.cit.). Deux sous-clones de ce cosmide ont été réalisés suite au résultat de cette
hybridation : deux fragments de restriction chevauchants (NotI de 15 kb etBamHI de 8,5 kb ; voir la
figure 3) hybridant avec la sonde utilisée ont été ligaturés dans le vecteur pCB1265 (Sweigard et al.
(1997) Fungal Genet. Newsl. 44 : 5253) pour donner les plasmides pC421-15 et pCM421-8,5. Ces deux
plasmides ont été clones et extraits en vue de transformations fongiques.
Expérience 5 :Complémentation de la mutation avec un fragment d'ADN de la région gnomique cible
de l'insertion chez le mutant plsl.
Le vecteurpCB1256 contient le gène bar sous contrôle de séquences régulatrices fongiques qui permet
la sélection de transformants de M grisea résistants à la phosphinothricine. Les sous-clones gnomiques
isolés par hybridation avec la séquence jouxtant le plasmide dans legénôme du mutant plsl peuvent
donc tre introduits par transformation chez ce mutant pour savoir s'ils contiennent la séquence complète
nécessaire à la complémentation fonctionnelle de la mutation. Des protoplates du mutant plsl ont été
transformés avec les plasmides pCM421-15 et pCM421-8,5 et les spores des transfr'Tn"-..es ooienus
ont été inoculés à des feuilles de riz et d'orge en survie, puis à des plantes entières de riz (conditions de
préparation des protoplastes, de transformation, de sélection et de purification des transformants et
d'essais de pathogénie : op.cit.). Dans les deux cas, au moins un transformant présentait un niveau de
pathogénie semblable à celui de la souche sauvage, ce qui indique que la séquence complète du gène de
pathogénie altéré chez le mutant plsl est contenue dans ces deux fragments.
Expérience 6 : Localisation et caractérisation de la séquence nucléotidique du gène de pathogénie muté
A) Séquençage de1'ADN gnomique au voisinage du point d'insertion du plasmide chez le mutant pls
1.
Le fragment clone suite à l'expérience d'Inverse-PCR a été entièrement séquence à partir des
amorcesM 13 et Reverse des bordures du polylinker du plasmidepGEM-T Easy.
Des amorces de réactions de séquençage ont ensuite été désignées sur les deux brins de la séquence
gnomique du fragment d'Inverse-PCR pour étendre les données de séquences de part et d'autre du point
d'insertion du plasmide pAN7.1 chez le mutant plsl grâce au plasmide pCM421-8,5. La synthèse des
oligonucléotides ainsi que les réactions de séquençage ont été réalisées par la sociétéGénôme Express
S. A. (Grenoble, France).
B) Isolement et séquençage de1'ADN complémentaire
Une banque d'ADN complémentaires des ARN messagers de M. grisea a été construite et criblée pour
localiser une unité transcriptionnelle correspondant à un gène dans la région de1'ADN gnomique
isolée par Inverse-PCR.
Un inoculum de M. grisea préparé par broyage dans de 1'eau stérile de petits fragments de culture sur
milieu riz gélose a été ajouté à 200 ml de milieu complet liquide en erlenmeyer de 11 (composition :
voir Silué et al. (op.cit.). Le champignon a ensuite été cultivé à26 C avec une agitation de 150 tpm
pendant une nuit. Le mycélium a été alors récupéré par centrifugation puis à nouveau broyé dans de
1'eau stérile. La moitié du broyat a été ajouté à 200 ml de milieu complet et cultivé dans les mme
étéiuement pendant au moins 15', puis centrifugés pendant20'à 4000 tpm à température ambiante. La
phase aqueuse a été récupérée et mélangée dans de nouveaux tubes avec 2 ml de chloroforme. La phase
aqueuse a été extraite deux fois avec 2 ml de chloroforme par agitation pendant 10'. Elle a été récupérée
après séparation par centrifugation (mmes conditions), puis transférée dans un tube à centrifugation
traité contre les RNase par autoclavage contenant le mme volume de 6 MLiCI traité au DEPC.
251/503
Les ARN totaux ont été précipités une nuit à4 C. Les tubes ont été ensuite centrifugés 20' à 10000 tpm
à4 C. Le surnageant éliminé a été et les culots resuspendus dans50-100 pl de
TE (10 mM Tris-HCl ;1 mM EDTA ; pH8,0) traité au DEPC. Les ARN totaux ont été quantifiés par
spectrophotométrie dansl'LTV (260 et 280nm). Les ARN messagers poly
A (+) ont été ensuite extraits au moyen du kit DynabeadsmRNA Direct Purification Kit (Dynal) par
affinité avec des billes greffées avec une séquence oligo (dT) 25.5 pg d'ARNm ont été utilisés pour la
synthèse des ADN complémentaires et leur ligature dans un vecteur d'encapsidation avec le kit Zap
ExpresscDNA Synthesis Kit (Stratagene) selon les recommandations du fabricant. La banque d'ADNc
a été encapsidée grâce au kit Gigapack
III Gold Packaging Extract (Stratagene), amplifiée et stabilisée selon les recommandations du
fabricant. Le criblage de la banque a été réalisée par l'hybridation d'une réplique transférée sur
membrane de nylon de 1 million de plages de lyse. La sonde radioactive utilisée pour le criblage a été
synthétisée à partir d'un fragment de restrictionStuI-ClaI de 1 kb du cosmide 32H7 (figure 4) hybridant
avec la partie gnomique du fragment récupéré par Inverse-PCR (conditions d'hybridation : op.cit).
L'ADNc isolé (d'une taille de 1,9 kb) a ensuite été également séquence.
C) Analyse informatique des séquences nucléotidiques
L'analyse des séquences de1'ADN gnomique et de1'ADN complémentaire grâce au programme DNA
Strider 1.2 ont permis de localiser le cadre ouvert de lecture d'un gène de 675 bp interrompu par deux
introns de 77 et 96 bp (figure 4). Les programmes BLAST (Altschul et al. (1990) J.Mol. Biol. 215 :
403-410 ; Gish et al. (1993) Nat. Genet 3 : 266272 ; Altschul et al. (1997) Nucleic Acids Res. 25 :
3389-3402) et FASTA (Pearson et
Lipman (1988) Proc. Natl. Acad. Sci. USA 85 : 2444-2448) n'ont pas permis de trouver de séquences
de gènes déjàcaratérisés présentant des homologies significatives au niveau nucléotidique avec celuici. La traduction in silico du gène prédit l'existence d'une protéine de 225 acides aminés (figure 5). Les
programmes de prédiction de la topologie des protéines (Profil d'hydropathie selon Kytes et Doolittle
de DNA Strider 1.2 ; Predict Protp.1993) Y. Mo/./o/. 232 : 584-599) ; PSORT ; Scan Prosite du
serveurinternet ExPASy) indiquent l'existence probable de quatre domaines transmembranaires et d'au
moins un site deN-glycosylation pour cette protéine. Le programme Profile Scan (serveur internet de
l'ISREC) l'inclut dans la superfamille de protéines TM4 (outétraspanines). De mme, parmi les
protéines identifiées grâce au programmes blastp et fasta3, figurent plusieurs protéines de cette
superfamille, bien que les degrés d'identité et de similarité des séquences en acides aminés soient
faibles. Un alignement de plusieurs protéines de cette famille avec le programme Clustal X montre
cependant qu'il s'agit de la seule famille de protéines présentant des éléments de séquences identiques
ou similaires à celle prédite pour la protéine de pathogénie de M. grisea qui ont une taille et une
topologie comparables à celles de cette protéine. Cette superfamille de protéines n'a pas de fonction
biochimique clairement établie. Ses membres n'ont jusqu'alors été identifiés que dans le
Règne Animal (chez les Mammifères et le Schisostome), le plus souvent comme marqueurs
immunologiques de la différenciation cellulaire ou tissulaire (Horejsi et Vlcek(1991) FEBSLetters 288
(1,2) : 1-4. Le seul autre mutant connu pour un gène codant pour l'une de ces protéines est un mutant de
la drosophile affecté dans la différenciation des synapses (Kpoczynski et al. (1996) Science 271 (5257)
: 1867-1870). Une protéine de cette famille pour laquelle les données expérimentales sont un peu plus
complètes estl'uroplakine I des Mammifères : cette protéine est associée avec au moins deux autres
types de protéines au niveau de la membrane plasmique de l'épithélium de la vessie (Wu et al.
(1994) J. Biol. Chem. 269 (18) : 13716-13724). Ces complexes tapissent la paroi de vésicules
membranaires (Severs et Hicks(1979) J. Ultrastruct. Res. 69 : 279-296), en réserve dans le cytoplasme
lorsque la vessie est vide. Ces vésicules sont tractées passivement vers la membrane plasmique par un
réseau de microfilaments qui se tend lorsque la vessie se gonfle (Sarikas et Chlapowski (1989) Cell
Tissue Res. 258 : 393-401).
Ces vésicules auraient à la fois pour rôle d'augmenter la surface de l'épithélium et de le renforcer, grâce
aux complexes protéiques qui les tapissent (Wu et al. (1994) : op.cit.).
D'une manière plus générale, une hypothèse biochimique avancée dans plusieurs autres publications
attribuerait à ce type de protéine le rôle de faciliter l'intégration et la stabilisation au niveau de la
membrane plasmique d'autres protéines impliquées dans la signalisation pour un grand nombre de
processus cellulaires, comme l'activation, la prolifération, l'adhésion, la mobilité, la différenciation et le
cancer (Maecker et al. (1997
252/503
Mai)FASEB J. 11 (6) :428-442).
..4t:nce7 : Remplacement du gène interrompu par le plasmide pAN7.1 chez le mutant plsl
A) Construction du vecteur de remplacement
Le vecteur pCB1003 (Sweigard et al. (1997) : op.cit.) a été digéré par l'enzyme de restriction EcoRI
pour en libérer la cassette de résistance àl'hygromycine (1 kb), constituée du cadre ouvert de lecture du
gène hph (op.cit.) et du promoteur du gènetrpC D'A. nidulans. Ce fragment a été ligaturé au site
EcoRI du polylinker du plasmide pBL pour donner le plasmidepBLHYG. Ce plasmide a été clone et
l'orientation de la cassette de résistance àl'hygromycine contrôlée par restriction : l'orientation
depBLHYG est telle que le début du promoteur de la cassette se trouve du côté du site SmaI. Cette
cassette a été extraite de ce nouveau plasmide par une double digestionSmaI-ClaI.
Le plasmide pCM421-8,5 a été digéré par les enzymes StuI etClaI. Le fragmentStuI-ClaI de 1 kb a
été éliminé et les deux autres récupérés. Le plus grand(StuI-ClaI de 7,3 kb) a été ligaturé avec le
fragmentSmaI-ClaI de 1 kb contenant la cassette de résistance àl'hygromycine (voir ci-dessus). Après
clonage et extraction, ce plasmide a été digéré parClaI, déphosphorylé par la Shrimp Alkaline
Phosphatase (Amersham) selon les recommandations du fabricant et ligaturé avec le troisième
fragment(CIaI de 3,5 kb) issu de la double digestionStuI-ClaI de pCM421-8,5. Le plasmide obtenu
pRM421 a été clone et l'orientation du fragmentClaI de 3,5 kb contrôlée par une réaction de PCR à
l'aide des amorces hphl(5'-CAGCGAGAGCCTGACCTATTGC-3', SEQ ID No. 15), située au début
du gène hph et pos421 (5'-TCAAGACGCTCACAGAGTGC-3', SEQ ID No. 16), située sur le
fragmentClaI de 3,5 kb, au niveau du signal de terminaison de la traduction du cadre ouvert de lecture
du gène de pathogénie supposé (programme de 30 cycles déjà cité avec une température d'hybridation
de60 C). 10ig de ce plasmide ont été digérés par 1'enzymeBamHI. Après séparation par
électrophorèse dans un gel d'agarose LMP (Sea
Plaque GTG, Tebu) à 1 % dans du tampon TAE, le fragment de 8,5 kb de région gnomique contenant
le gène de pathogénie remplacé par la cassette de résistance àl'hygromycine a été extrait avec le kit
GELase (Tebu) selon le protocole du fabricant. Le produit d'extraction a été quantifié par
spectrophotométrie dansFUV.
B) Transformation et sélection d'un mutant de pathogénie par remplacement du gène interrompu par le
plasmide pAN7.1 chez le mutantpls 1.
107 protoplastes de la souche sauvagepl. 2 ont été transformés avec 1llg de vecteur de remplacement
pRM421 préparé selon le protocole décrit ci-dessus. 47 transformants r ygromycine obtenus ont été
analysés par un test de pathogénie ; 26 d'entre eux, qui n'étaient pas pathogènes, ont ensuite été
analysés par hybridation de digestionsBamHI de1'ADN gnomique à l'aide de sondes synthétisées à
partir des fragments gnomiquesBamHI de 8,5 kb etStuI-ClaI de 0,7 kb. Il a pu tre démontré par ces
deux expériences que 24 des transformants non pathogènes obtenus étaient dépourvus du fragmentStuIClaI de 0,7 kb et ne comportaient qu'un seul fragmentBamHI hybridant avec le fragment d'ADN
gnomique demme taille ayant servi à la construction du vecteur pRM421 : le phénotype de non
pathogénie résulte donc bien de la délétion de la quasitotalité de la séquence du gène interrompu par le
plasmide pAN7.1 chez le mutant plsl et non de l'intégration ectopique du vecteur de remplacement
pRM421 dans la séquence d'un autre gène de pathogénie.
Expérience 8 : Caractérisation phénotypique du mutant
Les preuves que la région de1'ADN gnomique de Magnaporthe grisea cible de l'insertion du plasmide
pAN7.1 chez le mutant plsl est bien celle d'un gène indispensable à la pathogénie du champignon vis-àvis du riz et de l'orge sont établies. Cependant, la séquence de la protéine pour laquelle coderait ce gène
ne renseigne pas sur la fonction biochimique qu'elle contrôlerait. Une analyse phénotypique à la fois
plus large et plus complète du mutant de ce gène est donc indispensable sil'on veut pouvoir préciser ce
point.
A) Phénotypes de mycologie générale
La morphologie du mutant a été comparée à celle de la souche sauvage selon les critères suivants :
pigmentation, morphologie mycélienne et morphologie des conidies.
Aucune différence particulière n'a été relevée.
253/503
Le rythme de croissance radiale a été mesuré sur milieu gélose complet ou minimum. Le mutant est
prototrophe et n'a pas un rythme de croissance différent de celui de la souche sauvage.
B) Phénotypes en relation avec l'infection
Les taux de germination des conidies et de différenciation des appressoria ont été mesurés pour le
mutant et la souche sauvage suite à des dépôts sur lames de verre et de
PVC (Rinzl) de gouttelettes de suspensions de spores à 5.105 spores/ml et observées toutes les trois
heures jusqu'à 9 heures après dépôt. Les taux de germination sont similaires. Ceux de différenciation
des appressoria le sont 9 heures après dépôt, mais le rythme de différenciation semble plus rapide chez
le mutant.
, fusion de turgescence des appressoria a été évaluée selon la méthode de de
Jong et al. (1997 Nature 389 : 244-245). Elle n'est pas réduite de manière significative chez le mutant.
Un test de pathogénie sur feuilles de riz et d'orge en survie préalablement abrasées selon le protocole
de Surieux (1998, Rapport de Maîtrise de Sciences de la Vie de
L'Université de Lyon) a été réalisé avec des suspensions de spores du mutant et de la souche sauvage à
105 spores/ml. Aucune lésion typique de la maladie ne se sont développées sur les feuilles infectées par
les spores du mutant, contrairement à la souche sauvage.
Un test de pénétration de cellules épidermiques de la face inférieure de feuilles d'orge (cultivar
Baraka) a été réalisé comme suit : des gouttelettes de suspension de spores à 5.105 spores/ml ont été
déposées sur la face inférieure de feuilles d'orge récoltées sur des plants au stade 3 feuilles cultivées en
conditions identiques à celles des plantes utilisées pour les tests de pathogénie sur feuilles en survie).
Ces feuilles ont été déposées sur de le gélose à 1% et incubées à23 C et une humidité relative de 75%
pendant 1-6 jours.
L'épiderme infecté a été décollé en incisant la face supérieure juste au dessus du niveau de l'infection
avec une lame de rasoir en prenant garde de ne pas trancher complètement la feuille, en collant la partie
de la face supérieure correspondante à la zone infectée sur un morceau de ruban adhésif à double face,
puis en tirant très délicatement sur la partie encore libre au dessus de la ligne d'incision. L'épiderme a
été monté sur une lame de verre dans une goutte d'eau et, éventuellement, du bleu delactophénol avant
d'tre observé au microscope. La colonisation des cellules épidermiques par les hyphes infectieux du
champignon est visible entre 24 et 48 heures après le dépôt des gouttelettes chez la souche sauvage.
Dans le cas du mutant, les observations faites jusqu'à6 jours après le dépôt des gouttelettes de spores
n'ont pas permis de mettre en évidence d'autres structures infectieuses que les appressoria à la surface
des feuilles.
La formation de l'aiguille d'infection a été recherchée sur des coupes de feuilles d'orge infectées dans
les mmes conditions que celles de test de pénétration des cellules épidermiques. Les fragments de
feuilles infectés ont été prélevés 24 heures après le dépôt des gouttelettes de spores. La fixation du
matériel biologique et l'inclusion dans la résine durcissante LR White ont été réalisées selon le
protocole suivant :
Matériel biologique : Les plantes hôtes sont constituées par des segments de feuilles d'orge en survie
sur milieu gélosé infecté par dépôt de gouttes de suspension de spores de
uvage ou mutant). Les prélèvements sont faits 24 heures après dépôt des gouttes. Un contrôle est fait
au microspcope au moment du prélèvement. Les 2 souches ont développé de très abondants
appressoria. Un disque comportant toute l'épaisseur du segment de feuille est découpé dans la zone du
dépôt et fixé pour une étude cytologique fine.
* Préparation des échantillons : Les disques de feuilles de quelquesmilimètres sont fixés dans un
mélange de glutaraldéhyde à 2% et de paraformaldéhyde à 0,5 % dans un tampon deMcIlvaine 0,1 M à
pH 7 pendant 4 heures à température ambiante (environ20 C). Les échantillons sont ensuite rincés dans
le tamponMcIlvaine 0,2M puis une partie est post fixée pat letétroxyde d'osmium à 0,5 % dans le
tampon pendant 15 heures et incluse àl'épon. Des coupes d'une épaisseur de 0,4im sont effectuées puis
collées sur lames de verre et la résine est extraite auméthoxyde de sodium saturé dilué au 1/3 pendant
3 minutes. Elles sont colorées selon la technique de Richardson (bleu de méthylène-Azur 2) à80 C.
254/503
Les coupes ont été faites avec un ultramicrotome à des épaisseurs comprises entre 1 et 0,4pm. Elles
ont été observées avec un microscope NIKKON Optipot sur des coupes débarassées de la résine par un
trempage dans de la soude méthanolique et une coloration par un mélange de Bleu Azur et de Bleu de
Méthylène. 24 heures après le dépôt des gouttelettes, la souche sauvage a déjà pénétré la cuticule et la
paroi des cellules épidermiques et commencé à former un hyphe infectieux à l'intérieur. Dans le cas du
mutant, aucune aiguille de pénétration, ni aucun hyphe infectieux n'a pu tre mis en évidence. Aucun
signe d'une perforation de la cuticule et de la paroi, pourtant nettement visible avec la souche sauvage,
n'est observable.
L'observation de coupes sériées a pu montrer que certains appressoria mutants présentaient un
décollement de la zone périphérique de leur base normalement rendue adhérente à la surface de la
feuille par le dépôt d'un anneau d'une substance de composition inconnue. Ce dépôt semblait tre présent
chez le mutant, mais non adhérent à la surface de l'épiderme foliaire. Ce type de décollement est aussi
observé chez la souche sauvage, mais en moindre proportion.
La mélanisation de la paroi des appressoria du mutant ne semble pas tre affectée, mais 40 % des
appresoria formés à la surface de la feuille sont déformés (applatissement,écrassement). Dans le cas de
la souche sauvage seuls 10% des appressoria formés à la surface de la feuille sont déformés.
ant pas ne semble affecté dans aucune fonction végétative, mais plutôt dans un aspect du
développement strictement restreint à la formation et au fonctionnement del'appressorium : celui
semble se développer normalement, mais il est incapable de différencier la structure (hyphe de
pénétration) nécessaire à perforer la cuticule et la paroi des cellules épidermiques de la feuille d'orge.
Par ailleurs, sa capacité d'adhésion à la surface de la feuille est altérée.
Exemple 2 : Préparation d'une cassette d'expression d'un gène rapporteur GFP sous le contrôle du
promoteur du gène plsl et son introduction dans le génôme d'une souche sauvage et pathogène de
Magnaporthe grisea
Le fragment PstI de 3 kb du cosmide 32H7 portant la totalité de la phase codante du gène plsl a été
clone dans le vecteurpCB1265 (Sweigard etal., op.cit.). Son orientation a été contrôlée par restriction,
de manière à ce que la phase codante du gène plsl se trouve orienté dans le sens positif d'orientation du
plasmide. Le fragment d'ADN gnomique de
M. grisea se trouvant immédiatement en 5'de la phase codante dugénépi 7 a été amplifié par PCR avec
les amorces Pr et GFP421, permettant l'introduction d'un site de restrictionNcoI dans la séquence de ce
fragment située immédiatement en amont du signal de démarrage de la traduction (ATG) de la phase
codante du gène plsl. Le fragment d'amplification obtenu a été digéré par PstI etNcoI, puis clone dans
le vecteurpE-GFP (Clontech, USA ; Haas et al., 1996, Current Biology, 6 : 315-324), préalablement
digéré les mmes enzymes. Le plasmide obtenu a été digéré par les enzymes PstI et EcoRI. Le fragment
d'ADN comprenant le morceau de séquence promotrice du gène plsl fusionné à la phase codante du
gène GFP a été clone dans le vecteur pCB1265, préalablement digéré par les mmes enzymes. Le
fragment PstI de 3 kb du cosmide 32H7 situé immédiatement en 5'de celui ayant servi à réaliser la
construction précédente a été clone au site PstI de cette construction. Son orientation a été contrôlée de
manière à maintenir la continuité entre la séquence de ce fragment et celle du fragment de PCR clone
devant le gène GFP telle qu'elle existe dans le cosmide 32H7. Cette séquence de 3,65 kb comporte la
région promotrice de 1'expression du gène plsl (région allant du siteBamHl en amont de1'ATG du
gène 421 à1'ATG du gène plsl). Le plasmide qui résulte de ce clonage a été appelé pEM421-GFP. Il a
été introduit par transformation de protoplastes dans legénôme d'une souche sauvageP12 et pathogène
de M grisea (Mutant plsl). La sélection des transformants a été réalisée pour la résistance à la
phosphinothricine conférée par le plasmidepCB1265 et les spores des transformants purifiés obtenus
ont été analysés pour leur fluorescence en microscopie photonique (conditions de préparation des
protoplastes, de transformation, de sélection et de purification des transformants : op.cit.).
Exemple 3 : Clonage de gènes homologues augène plsl deMagnaporthe grisea chez d'autres
champignons
Des gènes homologues au gène plsl de Magnaporthe grisea ont été identifiés et clones chez d'autres
champignons par PCR en utilisant des amorces dégénérées. Dans certains cas une double amplification
s'est avérée nécessaire.
La réaction d'amplification a été réalisée avec 100 ng d'ADN gnomique de deux espèces
fongiques(Neurospora crassa et Pyricularia higginsi) en présence de dNTPs, de
255/503
Taq polymerase (Aplligene) et de tampon(1 X) dans un volume de 100 microlitres.
Lesoligonucléotides T4+ (AATGCNATCTTNATCTTC) et T3 (TCYYKCTTCTTACGRTCCTT) ont
été utilisés pour la première amplification. Le programme d'amplification utilisé comprend 5 premiers
cycles à une température d'hybridation de45 C, suivis par 30 cycles à une température d'hybridation
à50 C. Les produits d'amplification (20 microlitres) ont été séparés par électrophorèse en gel d'agarose
et visualisés par coloration au bromured'éthidium. Un fragment de la taille attendue (580 bp) a été
observé pour Pyriculariahiginsi.
Dans le cas de Neurospora crassa, 5 microlitres de ce premier produit d'amplification ont été utilisés
pour une deuxième amplification avec les oligonucléotides
T4+ (AATGCNATCTTNATCTTC) et T2- (GTACTATTGWARTANCCACA) dans les mme
conditions expérimentales que pour la première amplification. Les produits d'amplification (20
microlitres) ont été séparés par électrophorèse en gel d'agarose et visualisés par coloration au
bromured'éthidium. Un fragment de la taille attendue (320 bp) a alors été observé pour Neurospora
crassa.
Les produits d'amplification ont ensuite été purifiés sur une colonne et clones dans le vecteurpGEM-T
(Promega). Les clones bactériens ont été analysés par PCR avec les oligonucléotides universelsforward
et reverse afin d'amplifier leurs inserts. Ces clones ont ensuite été séquences a l'aide des
oligonucléotides universels. Les séquences nucléotidiques obtenues ont été comparées à celle du gène
plsl. La traduction des séquences nucléotidiques a également permis de comparer les gènes au niveau
de la séquence protéique de plsl (figure 6). Les alignements montrent une forte identité entre ces
séquences aussi bien au niveau nucléotidique que protéique, montrant quelles appartiennent à la mme
famille de gènes. A partir de cet aligment de séquences protéiques, nous avons choisi de nouveaux
oligonucléotides dégénérés afin d'amplifier les gènes homologues de plsl dans d'autres espèces
fongiques. Les oligonucléotides Tl+bis (CCNGCNCGIGGNTGGCTNAA), T3-bis
(YTCYYGTCYTTICGRTCYTT) et T4+bis (GTNAAYGCNATITTYATNTT) ont été synthétisés. Ces
oligonucléotides permettent d'amplifier des fragments de 580 bp(T1/T3) et 630 bp (T3/T4) chez
Magnaporthe grisea.
Ces oligonucleotides ont été utilisé pour amplifier des homologues de plsl chez les espèces fongiques
suivantes : Botrytis cinerea, Mycosphaerella graminicola, Stagnospora nodorum,
Blumeria graminis, Colleotrichum lindemuthianum, Puccinia graminis, Leptosphaeria maculans,
Fusarium oxysporum, Fusarium graminearum, Venturia inaequalis,
Pseudocercosporella herpotrichoide, Rhizoctonia solani et oryzae, Rhychosporium secalis,
Ustilago maydis, Sclerotinia sclerotiorum, Neurospora crassa, Aspergillus nidulans et fumigatus,
Gaeumannomyces graminis, Claviceps purpurea, Pyrenophora teres.
Exemple 4 : Expression dugène plsl
La détection des transcrits du gène plsl a été réalisé par hybridation deNorthern en utilisant des ARN
totaux extraits soit de tissus fongiques de Magnaporthe grisea tels que du mycelium, des spores et des
appressoria différenciés sur membrane artificielle (24h) ou de feuilles d'orge infectées par des spores de
Magnaporthe grisea prélevées à différents moments (2,8,16,24,48 et 66 heures) après l'inoculation. La
différentiation des appressoria sur une surface artificielle est réalisée en déposant des gouttes de 50
microlitres de spores (500 000 spores par ml) de la souche sauvage pathogène de M. grisea sur une
membrane de téflon disposée à plat dans une boite de Pétri humide pendant 24h à26 C.
L'inoculation des feuilles d'orge est réalisée avec des gouttes de 35 microlitres de spores (500 000
spores par ml) de la souche sauvage pathogène de M. grisea. Ces gouttes sont déposées à la surface de
fragments de 5 cm de jeunes feuilles d'orge (10-15 jours après
germination) disposées sur de 1'eau gélosée contenant de lakinétine (2mg/1). L'ARN total
est extrait en broyant ces différents tissus dans un mortier contenant de l'azote liquide, puis
en suivant le protocole d'extraction d'ARN totaux au phénol chaud (Ausabel, F. M., Brent,
R., Kingston, R. E., Moore, D., D., Seidman, J. G., Smith & J. A., Struhl, K. (1994).
Current Protocols in Molecular Biology. John Wiley and Sons,NY). Les ARN totaux sont quantifiés
par absorption U. V. et déposés sur un gel d'agarose à 1% contenant un tampon
256/503
MOPS (10 microgrammes par puits pour chaque condition), séparés par électrophorèse en conditions
dénaturantes (Glyoxal, DMSO et Bromured'éthidium mélangés au tampon de dépôt des ARN)
pendant1 heure 30 minutes à 70 volts et transférés sur une membrane de
Nylon (Hybond N+). Après migration le gel est observé sous un transilluminateur U. V. et la
fluorescence est quantifiée par une caméra haute définition (FluoroS Imager, Biorad). La quantification
des ARN ribosomiques 18S et 28S situés à 1.8 et 2.8 kb, permet d'estimer la quantité réelle d'ARN
dans chaque piste de migration. Cette membrane est hybridée avec une sonde de 600 bp correspondant
à la phase codante du gène plsl obtenu par amplification à l'aide desoligonuléotides 39+
(CCTGATGCTGGGCTTCTC) et 548 (ACARGCCGAAAACACCAG) en utilisant le kit d'hybridation
Ultrahyb (Ambion,
USA). Ce protocole d'hybridation permet d'amplifier les signaux d'hybridationNorthern en
tamponformamide (50 %) à42 C sans augmenter le bruit de fond. Les membranes sont lavées deux
fois à42 C avec un tampon 2 SSC/0.1 % SDS pendant 5 à 15 minutes, et mises en cassettes
d'exposition pour Phosphoimager de 3h à 72h, puis révélées.
Des signaux d'hybridation correspondant à un ARN messager de 1.9 kb (taille identique à celle des
ADNc clones) ont été détectées en 3h dans toutes les conditions analysées (mycelium cultivé in vitro,
spores, appressorium différentié in vitro, feuilles d'orge infectée). Ce résultat montre que le gène plsl
est exprimé constitutivement par les différents tissus du champignon (mycelium, spore, appressorium).
Dans le cas des feuilles d'orge infectée, les ARN totaux ne contiennent que très peu d'ARN fongique
(moins de1% 24 heures après l'inoculation). Les signaux d'hybridation obtenus dans le cas des feuilles
d'orge infectée 24 heures après l par l'enzyme de restrictionNruI du plasmide pCM421-8.5 pour donner
le p421. Après modification, le fragment de 941 pb est excisé par la mme enzyme de restriction et
réintroduit dans son contexte d'origine(à savoir entre le promoteur et le terminateur du gène, au niveau
des sitesNruI).
L'utilisation du p421 a permis d'introduire des gènes rapporteurs en aval du promoteur de plsl. Deux
sites de restriction ont été ajoutés par PCR au niveau du cadre ouvert de lecture du gène. Un siteNcoI
au niveau du codon initiateur (ATG) et un siteXbaI au niveau du STOP permettent à la fois d'enlever
le cadre ouvert de lecture du gène par digestion du p421 (modifié par PCR) par les deux enzymes et de
le remplacer par les gènes rapporteurs. Ceux-ci ont été excisés par les mme enzymes de restriction de
vecteurs commerciaux(pEGFP pour la GFP et pGL3-Basic pour la Luciférase, Clontech).
Une fois modifiée, le fragment NruI du vecteur navette p421 comportant les différentes fusions
promoteur 421/gene reporter est réintroduit dans son contexte d'origine à savoir le sousclone pCM4218.5. Cette étape est à nouveau effectuée au moyen des sites de restrictionsNruI présents à la fois de
part et d'autre du cadre ouvert de lecture du gène plsl dans le p421 et dans le pCM421-8.5. Ce vecteur
est alors utilisé pour la transformation de la souchePI. 2 de Magnaporthe grisea. Les transformants
obtenus permettent de suivre 1'expression du gène plsl soit par observation au microscope à
fluorescence des différents stades de développement (GFP), soit par mesure de l'activité luciférase dans
des extraits protéiques bruts réalisés aux différents stades.
Exemple 6 : Vecteurs permettant la localisation de la protéinePlsl dans les cellules fongiques
Suivant le mme mode opératoire que pour les fusions transcriptionelles, différents vecteurs permettant
la localisation cellulaire de la protéine Plsl ont été réalisées. Ces vecteurs permettent d'obtenir des
protéines de fusion entre Plsl et la GFP ou l'épitope tag
Flag. La GFP ou le Flag ont été fusionnés soit l'extrémité N-terminale soit à l'extrémité Cterminale de
la protéinePlsl.
Le p421 a servi de matrice pour des amplifications PCR permettant d'introduire un siteNcoI et un site
XbaI soit au niveau du codon initiateur soit au niveau du stop du gène plsl.
Après digestion des plasmides obtenus par les deux enzymes de restriction, la GFP (obtenue par
digestion du plasmide pEGFP,clontech, par les enzymes de restrictionNcoI et
XbaI) ou le Flag (obtenu de grâce à deux oligonucléotides comportant la séquence du Flag aux
extrémités de laquelle ont été rajoutés les séquences des sites de restriction employés, synthétisés et
appariés et digérés par les deux enzymes de restriction) ont été ajoutés soit en 5'soit en 3'du cadre
ouvert de lecture dugène plsl.
257/503
Le fragment de digestion NruI du p421 modifié, comportant les différentes fusions protéine 421/GFP
ou Flag, a été réintroduit comme plus haut dans le sous-clone pCM4218.5 au niveau des sites de
restriction NruI.
Les plasmides obtenus sont transformés dans la souche PI. 2 ou le mutantA421 de
Magnaporthe grisea. Les transformants purifiés permettent alors de visualiser la localisation cellulaire
de la protéinePlsl soit par observation au microscope à fluorescence soit par immunolocalisation au
moyen des anticorps anti-flag M2 (Sigma). La localisation de la protéine Plsl peut en particulier tre
étudiée dansl'appressorium en utilisant comme matériel d'observation des spores germées sur support
artificiel (téflon, cellophane...) qui permettent la différentiation appressoriale.
Exemple 7 : Localisation de la protéine 421 (Plsl)
L'utilisation d'un fragment d'acide nucléique comprenant le promoteur plsl associé aux séquences
codantes du gène 421 (plsl) et del'octapeptide antigénique FLAG (Asp
Tyr-Lys-Asp-Asp-Asp-Asp-Lys) permet la localisation de la protéine Plsl.
Une souche recombinante comprenant le gène ci-dessus est utilisée permettant la localisation de la
protéine 421 après purification des différentes membranes cellulaires, puis extractions différentielles
des protéines membranaires par des méthodes biochimiques classiques (notamment Bordier. 1981. J.
Biol. Chem. 256 : 1604-1607 ainsi que Seigneurin
Berny et al. 1999. Plant J. 19 : 217-228). Cette localisation est effectuée, après séparation des protéines
extraites sur SDS-PAGE et transfert de celles-ci sur membrane, par immuno détection de la protéine
recombinante par l'anticorps monoclonal anti-FLAG M2 (Sigma), puis par détection de l'anticorps par
une protéine A couplée à la phosphatase alcaline (PA).
La mise en évidence de la PA se fait par une réaction colorimétrique ou dechémiluminescence.
Exemple 8 : Identification des composants des complexes comprenant la protéine 421 par immuno
précipitation
L'utilisation d'un fragment d'acide nucléique comprenant le promoteur plsl associé aux séquences
codantes du gène plsl et de l'octapeptide FLAG permet la caractérisation des protéines des complexes
membranaires auxquels appartiendrait la protéinePlsl.
Une souche recombinante comprenant le gène ci-dessus est utilisée permettant l'identification, après
immuno précipitation par l'anticorps monoclonal anti-FLAG M2 (Sigma) conjugué à la protéine Aagarose (ou sépharose), des différents composants des complexes membranaires comprenant la
protéine Plsl. La caractérisation des protéines de ce complexe sera effectuée comme cela a été fait lors
de l'étude des tétraspanines animales (Horvath et al. 1998. J. Biol. Chem. 273 : 30537-30543).
Ces techniques d'immuno précipitation permettent également la purification de la protéine
recombinante et l'analyse de celle-ci. Cette analyse permettra le choix d'un fragment de la protéine Plsl
pour la production d'anticorps spécifiquement dirigés contre celui-ci.Data supplied from the esp@cenet
database - Worldwide
Claims:
Claims of WO0077036
REVENDICATIONS 1)Polynucléotide caractérisé en ce qu'il comprend unpolynucléotide choisi
parmi les
polynucléotides suivants : a) lepolynucléotide de la SEQ ID No. 1 ; et b) lepolynucléotide de la SEQ
ID No. 3 ; et c) lepolynucléotide de la SEQ ID No. 4 ; et d) lepolynucléotide de la SEQ ID No. 5.
2)Polynucléotide caractérisé en ce qu'il comprend unpolynucléotide choisi parmi les
polynucléotides suivants : a) unpolynucléotide capable de s'hybrider de manière sélective à
unpolynucléotide selon
la revendication 1 ; et b) unpolynucléotide homologue à au moins 80% à unpolynucléotide selon la
revendication 1.
3)Polynucléotide selon la revendication 2 caractérisé en ce qu'il code pour une
tétraspanine indispensable à la pathogénie du champignon.
258/503
4)Polynucléotide caractérisé en ce qu'il comprend unpolynucléotide codant pour le
polypeptide de la SEQ IDNO. 3 ou pour un fragment biologiquement actif du
polypeptide de la SEQ IDNO. 3.
5)Polynucléotide caractérisé en ce qu'il comprend le promoteur dugène plus de la SEQ
ID No. 2 ou un fragment biologiquement actif du promoteur dugène plsl de la SEQ ID
No. 2.
6) Polypeptide caractérisé en ce qu'il comprend le polypeptidePlsl de la SEQ ID No. 6 ou
un fragment biologiquement actif du polypeptidePlsl de la SEQ ID No. 6.
7) Polypeptide caractérisé en ce qu'il comprend un polypeptide homologue à au moins
80% au polypeptide Plsl de la SEQ ID No. 6.
8) Polypeptide selon la revendication 7 caractérisé en ce qu'il comprend une tétraspanine
de champignon indispensable à la pathogénie du champignon.
9) Polypeptide de fusion comprenant un polypeptide selon l'une des revendications 6-8
fusionné à un polypeptide rapporteur.
10) Cassette d'expression caractérisée en ce qu'elle comprend dans le sens de la
transcription : a) un promoteur fonctionnel dans un organisme hôte ; et b) unpolynucléotide selon
l'une des revendications 1-4 ; et c) une séquence terminatrice dans ledit organisme hôte.
11) Cassette d'expression caractérisée en ce qu'elle comprend dans le sens de la
transcription : a) un promoteur fonctionnel dans un organisme hôte ; et b) unpolynucléotide codant
pour un polypeptide selon l'une des revendications 6-9 ; et c) une séquence terminatrice dans ledit
organisme hôte.
12) Cassette d'expression caractérisée en ce qu'elle comprend dans le sens de la
transcription : a) le promoteur du gène plsl ou un fragment biologiquement actif du promoteur du gène
plsl selon la revendication 5 ; et b) un gène rapporteur ; et c) une séquence terminatrice.
13) Vecteur comprenant unpolynucléotide selon l'une des revendications1-5 et 10-12.
14) Organisme hôte transformé avec unpolynucléotide selon l'une des revendications1-5
et 10-13.
15) Procédé de transformation d'un organisme hôte par intégration dans ledit organisme
hôte d'au moins unpolynucléotide selon l'une des revendications1-5 et 10-13.
16) Procédé pour inhiber la pathogénie d'un champignon caractérisé en ce qu'il comprend
l'inhibition de 1'expression d'unpolynucléotide selon l'une des revendications 1-3 dans
ledit champignon, ou l'inhibition de 1'expression d'un polypeptide selon l'une des
revendications 5-7 dans ledit champignon ou l'inhibition de l'activité biologique d'un
polypeptide selon l'une des revendications 5-7 dans ledit champignon.
17) Procédé pour l'identification de composés inhibant la pathogénie des champignons
comprenant les étapes suivantes : a) mettre en contact ledit composé avec un polypeptide selon l'une
des revendications 6-9 ;
et b) détecter la fixation dudit composé audit polypeptide.
18) Procédé pour l'identification de composés inhibant la pathogénie des champignons
comprenant les étapes suivantes : a) mettre en contact ledit composé avec un organisme hôte
transformé avec un
polynucléotide selon l'une des revendications 5 et 12 ou un vecteur selon la
revendication 13, ledit organisme hôte exprimant un gène rapporteur sous le contrôle
du promoteur dugène plsl ; et b) détecter l'inhibition de 1'expression dudit gène rapporteur.
259/503
19) Procédé pour l'identification de composés inhibant la pathogénie des champignons
comprenant les étapes suivantes : a) mettre en contact ledit composé avec un organisme hôte
transformé avec un
polynucléotide selon l'une des revendications 1-4,10 et 11 ou un vecteur selon la
revendication 13, ledit organisme hôte exprimant un polypeptide Plsl ; et b)détecter l'inhibition de
l'expression dudit polypeptide Plsl.
20) Procédé pour l'identification de composés inhibant la pathogénie des champignons
comprenant une étape d'identification d'un composé inhibant spécifiquement
1'expression d'unpolynucléotide selon l'une des revendications 1-4 dans ledit
champignon, ou une étape d'identification d'un composé inhibant 1'expression d'un
polypeptide selon l'une des revendications 6-8 dans ledit champignon ou une étape
d'identification d'un composé inhibant l'activité biologique d'un polypeptide selon l'une
des revendications 6-8 dans ledit champignon.
21) Procédé selon l'une des revendications 17-20 comprenant une étape dans laquelle on
détermine si ledit composé inhibe la pathogénie du champignon.
22) Procédé pour traiter des plantes contre un champignonphytopathogène caractérisé en
ce qu'il comprend le traitement desdites plantes avec un composé identifié par un
procédé selon l'une des revendications17-21.
23) Utilisation d'unpolynucléotide, d'un organisme hôte ou/et du polypeptide Plsl selon
l'une des revendications1-14, pour l'identification des gènes impliqués dans la
pathogénie des champignons ou pour l'identification de nouvelles molécules fongicides
inhibitrices de la pathogénie des champignons.
24) Composés inhibiteurs de la pathogénie des champignons identifiés par un procédé
selon l'une des revendications17-21.Data supplied from the esp@cenet database - Worldwide
260/503
35. WO0079001
- 12/28/2000
MEANS FOR IDENTIFYING A NOVEL CLASS OF GENES RESISTANT TO
THE RICE YELLOW MOTTLE VIRUS AND THE LOCUS OF A MAJOR GENE
OF RESISTANCE TO THE VIRUS, AND THEIR APPLICATIONS
URL EPO =
http://v3.espacenet.com/textdoc?F=3&CY=ep&LG=en&IDX=WO0079001
Inventor(s):
ALAIN (FR)
BRUGIDOU CHRISTOPHE (FR); BRIZARD JEAN-PAUL (FR); GHESQUIERE
Applicant(s):
INST RECH POUR LE DEV I R D (FR); BRUGIDOU CHRISTOPHE (FR);
BRIZARD JEAN PAUL (FR); GHESQUIERE ALAIN (FR)
IP Class 4 Digits: C07K; C12Q
IP Class:C07K14/415; C12Q1/68
E Class: A01H1/04; C07K14/415; C12Q1/70B
Application Number:
WO2000FR01723 (20000621)
Priority Number: FR19990007831 (19990621)
Family: AU6451100
Equivalent:
EP1185708; FR2795093
Cited Document(s):
US5898097; WO9830721; XP002149717; XP002149718; XP000892947;
XP000892950; XP002149653
Abstract:
Abstract of WO0079001
The invention concerns a method for capturing the target proteins indispensable to the infectious cycles
of a pathogenic virus, in particular the rice yellow mottle virus (RYMV) and for cloning the genes
involved in said processes. The invention therefore concerns a method for identifying molecular
markers of the resistance to RYMV. The method involves the isolation of said protein complexes with
viral particles. The method consists in subjecting the samples containing said complexes to
electrophoresis and Western Blot using a capsid anti-protein monoclonal antibody, and in recuperating
the non-immunodetected bands. The invention also concerns a cDNA capable of being hybridized with
a BAC (Bacterial Artificial Chromosome) screened from a bank consisting of DNA fragments of a
variety of rice such as IR64. Said BAC clone contains DNA sequences of the markers identified from
the rice by means of a process which consists in comparing the AFLP (Amplified Length
Polymorphism) of resistant and sensitive rice plants.Description:
Description of WO0079001
Moyens pour l'identification d'une nouvelle classe de gènes de résistance au virus de la panachure
jaune du riz et du locus d'un gène majeur de la résistance au virus, et leurs applications.
L'invention a pour objet des moyens, outils et procédés, pour l'identification d'une nouvelle classe de
gènes de résistance au virus de la panachure jaune du riz (en abrégé RYMV pour Rice Yellow Mottle
Virus) et du locus d'un gène majeur de la résistance au virus.
261/503
Elle vise plus spécialement, en tant qu'outils, des protéines essentielles pour le cycle infectieux ainsi
que des marqueurs et des amorces PCR et leurs applications à l'établissement de la cartographie
physique de la résistance et au clonage du gène.
RYMV est un virus endémique en Afrique. Il présente des caractéristiques communes avec les autres
sobémovirus ; à savoir un seul ARN simple brin de polarité positive nonpolyadénylé et de petite taille,
et des particules icosahédriques de symétrie T=3 produites en très grande quantité dans la plante.
Les particules virales sont aussi très présentes dans les tissus vasculaires et principalement dans les
vaisseaux. Chez quelques rares variétés de l'espèce africaine de riz cultivéOryza glaberrima, une
résistance très élevée au RYMV a été identifiée. Mais comme les hybridesinterspécifiques entre les
deux espèces de riz cultivées sont extrêmement stériles, les recherches antérieuresn'ont pas permis de
décrire ni de bases génétiques, ni de mécanisme de cette résistance.
Les travaux des inventeurs dans ce domaine ont montré qu'une variété dénommée Gigante, originaire
du Mozambique et identifiée parl'ADRAO, de l'espèce asiatique de riz cultivéOryza sativa,
manifestait les mêmes caractéristiques que celles observées chez0. glaberrima. Les inventeurs ont
caractérisé la résistance à RYMV en mettant en évidence qu'elle est liée à un gène majeur de résistance
récessif et identique chez les deux sources de résistance considérée (O.Sativa et 0. glaberrima).
Cette résistance intervient au niveau du mouvement de cellule à cellule et se traduit par un blocage du
virus au niveau des cellules infectées alors que la réplication du virus est normale.
Les travaux des inventeurs sur le RYMV ont montré que ce virus bouge et se multiplie différemment
au cours du cycle infectieux. Dans la feuille inoculée(I, figure 11), c'est sous forme d'un complexe
ARN viral et protéines virales (protéines de capside, PI et le cas échéant P3) qu'il se déplace localement
en traversant les plasmodesmes des cellules épidermiques, des cellules dumésophylle, des cellules de
la gainepérivasculaire (méstome et cellule de la gaine) pour atteindre les cellules vasculaires
(parenchymephloérnien etxylémien). Il se multiplie plus particulièrement dans les cellules du
parenchymexylèmien (II, figure 11). Dans les cellules vasculaires, avant le mouvement dit de longue
distance, il s'encapside et se stabilise sous forme d'une particule compacte dans la vacuole à un pH
acide et grâce aux ions divalents Ca2+ (II, figure 11). L'infection systémique ne peut se faire que si un
grand nombre de particules stables sont produites. Dans les feuilles systématiquement infectées, le
virus sort des tissus conducteurs pour se multiplier soit dans les jeunes tissus vasculaires, soit dans les
cellules dumésophylle. A ce stade de l'infection le mouvement local se fait sous formedécapsidée
(complexe viral RNA et protéines) ou encapsidée toujours à travers les plasmodesmes(III, figure 11).
Lors de ces différentes étapes du cycle infectieux, le complexe viral et/ou le virion ont besoin d'être
identifié et transporté par des protéines de la plante pour bouger, d'un compartiment cellulaire à un
autre, d'une cellule à l'autre.
Par exemple, les protéines de plantes liées au transport du virus ou de son complexe apparaissent
présenter une fonction similaire (transport), mais sont spécifiques du tissu traversé
(épiderme,mésophylle, mestome, gainepérivasculaire, phloème, xylème). Lorsque ces protéines sont
traduites de l'allèle sauvage, ce sont des protéines de susceptibilité qui permettent au virus de se
déplacer. Au contraire, l'allèle muté apparaît conduire soit à une protéine moins fonctionnelle
(résistance partielle), soit non fonctionnelle (résistance totale).
Il est donc considéré que ces protéines appartiennent à une famille de gènes dont la fonction cellulaire
commune serait la reconnaissance du substrat et le transport à travers les plasmodesmes, mais sont
différentes au niveau de la spécificité tissulaire (épiderme,mésophylle, mestome, gaine
périvasculaire,phloème, xylème).
La régulation du transport symplastique est très probablement la fonction essentielle de cette famille
de gènes.
Le RYMV est aussi un virus très stable et il se présente dans la cellule sous plusieurs isoformes dont
trois ont été déterminées : compacte, gonflée et intermédiaire. Ainsi, suivant le pH cellulaire
(cytoplasme 7-8, vacuoles, vésicules et vaisseaux 4,5-6,5) la conformation et la charge extérieure de la
262/503
particule changent. Cette charge lui permet de s'accrocher aux membranes et d'entrer dans une cellule
saine par un mécanisme d'endocytose. Enfin, au niveau cellulaire, les inventeurs ont montré que ce
virus s'accumule principalement dans les vacuoles.
La présence in planta de trois isoformes, la compartimentation et l'accumulation virale dans les plantes
partiellement résistantes ont ainsi permis de proposer un mécanisme original pour la tolérance au
RYMV, distinct de la résistance.
La tolérance au RYMV apparaît en effet s'effectuer grâce à une accumulation dans les vacuoles. Le
tonoplaste, en séparant physiquement les particules virales du compartiment cellulaire, empêcherait
toute interaction dommageable pour la machinerie cellulaire. Ainsi, le virus se multiplie, s'accumule
sans tuer la cellule (donc pas de symptômes).
L'association entre la cellule hôte et le virus est tel que la plante se comporte alors comme une plante
réservoir.
Dans ce modèle laco-évolution entre le virus et la plante hôte a conduit le virus à s'adapter pour
finalement être reconnu par la plante comme une simple protéine de réserve qui serait produite par la
plante, transportée via le reticulum et l'appareil de Golgi vers la vacuole. Une invagination intense du
tonoplaste (mécanismed'autophagie) pourrait aussi permettre au virus produit dans le cytoplasme de
s'accumuler dans la vacuole.
De même, ce mécanisme est également similaire à celui observé pour ladétoxification de la cellule
pour les métaux lourds ou le sel par exemple.
Compte tenu de ces résultats, les inventeurs ont élaboré une méthode pour identifier des protéines
impliquées dans la reconnaissance et le transport ciblé de virus pathogènes dans les plantes, et cloner
les gènes impliqués dans ces processus.
L'invention a donc pour but de fournir une méthode pour capturer les protéines cibles indispensables
au cycle infectieux d'un virus pathogène notamment du virus RYMV et vise les protéines ainsi isolées.
L'invention a également pour but de fournir un procédé pour l'identification de marqueurs moléculaires
du locus de résistance au RYMV.
Elle vise également, en tant que tels, les fragments d'ADN tels que révélés par ce procédé, et
utilisables en tant que marqueurs.
L'invention vise en outre les applications de tels marqueurs, notamment pour définir d'autres
marqueurs de haute spécificité vis-à-vis du locus de résistance et pour prédire un phénotype résistant.
L'invention vise tout particulièrement l'application desdits marqueurs pour établir la cartographie
physique de la résistance et pour le clonage du gène.
L'invention vise encore, en tant que nouveaux produits, les séquences des amorces utilisées dans les
techniques PCR mises en oeuvre.
La méthode d'isolement de protéines impliquées dans la reconnaissance et le transport ciblé d'un virus
pathogène circulant via les plasmodermes dans une plante est caractérisée en ce qu'on soumet des
échantillons renfermant des complexes desdites protéines avec des particules virales à une
électrophorèse et un Western Blot en utilisant un anticorps monoclonal anti-protéine de capside, et on
récupère les bandes nonimmunodétectées.
Selon une variante, le complexe est obtenu à partir de virus extrait de plantes sensibles infectées.
Le virus est plus particulièrement le virus de RYMV et on récupère des protéines de
5,24,42,49,59,66,70,77 et 210 kDa.
263/503
Selon une autre variante, le complexe est obtenu à partir de virus purifié et mis en contact avec les
protéines d'une suspension cellulaire de plante sensible.
En particulier, le virus est le virus de RYMV et on récupère des protéines de 24,45,51,57,63,85 et audelà de 120 kDa.
Les protéines telles qu'obtenues par la méthode définie ci-dessus entrent également dans le cadre de
l'invention en tant que produits nouveaux.
L'invention vise l'application de ces protéines en particulier pour le clonage des gènes de résistance à
des virus pathogènes circulant via les plasmodermes dans une plante.
L'invention vise en outre l'identification de marqueurs du locusd'un gène majeur de résistance à
RYMV, comprend l'utilisation de marqueurs AFLP (Amplified Fragments Length Polymorphism) et
fait appel à la technique PCR.
Ce procédé d'identification est caractérisé en ce qu'il comprend
-l'amplification sélective de fragments d'ADN de riz d'une part d'individus résistants, d'autre part
d'individus sensibles, descendant de variétés parentales, ces fragments ayant été préalablement soumis
à une étape de digestion, puis de ligation pour fixer des adaptateurs complémentaires d'amorces ayant,
à leur extrémité, un ou plusieurs nucléotides spécifiques, l'une des amorces du couple étant marquée
aux fins de révélation,
-la séparation des produits d'amplification, par électrophorèse sur gel dans des conditions dénaturantes,
et
-la comparaison des profils d'électrophorèse obtenus avec des mélanges de fragments issus de
descendants résistants et des mélanges issus de descendants sensibles, avec les fragments provenant des
variétés parentales, aux fins d'identification de bandes dont le polymorphisme est génétiquement lié au
locus de résistance, cette identification étant suivie le cas échéant, à titre de validation, d'une
vérification sur chacun des individus et du calcul du taux de recombinaison génétique entre le
marqueur et le locus de résistance.
Dans un mode de réalisation de l'invention, les fragments d'ADN sont obtenus par digestion des ADN
gnomiques de plantes résistantes d'une part, et de plantes sensibles d'autre part, et de leurs parents, à
l'aide d'enzymes de restriction.
Des enzymes de restriction qui se sont révélées appropriées comprennentEcoRI et MseI.
De courtes séquences nucléotidiques sont fixées aux fragments de digestion (adaptateurs) pour générer
des extrémités franches auxquelles sont ensuite fixés des adaptateurs.
Les amorces utilisées dans l'étape d'amplification sont complémentaires de
ces adaptateurs avec, à leur extrémité 3', de 1 à 3 nucléotides qui peuvent être
variables.
L'étape d'amplification est conduite avantageusement selon la technique
PCR.
Des profils d'amplification spécifiques sont obtenus avec des couples d'amorces possédant à leur
extrémité, respectivement, des motifs AAC et CAG,
ACC et CAG, ou encore AGC et CAG.
Les séquences correspondant aux adaptateursEcoRI et MseI sont respectivement GAC TGC GTA
CCA ATT C (SEQ IDN 1) et GAT GAG TCCTGAGTAA (SEQIDN 2).
Les couples d'amorces mis en oeuvre pour l'amplification sont alors avantageusement choisis parmi EAAC/M-CAG ; E-ACC/M-CAG ; et E
AGC/M-CAG ; dans lesquels E et M correspondent respectivement à SEQ IDN 1 et SEQ IDN 2.
D'autres couples sont donnés dans le tableau 6 dans les exemples.
264/503
L'étude comparative des profils d'amplification obtenus permet de révéler des bandes polymorphes
spécifiquement présentes chez les variétés sensibles et leurs descendants sensibles, comme exposé dans
les exemples, et correspondant en conséquence à des marqueurs de résistance.
En particulier, la révélation sur gel d'électrophorèse en conditions dénaturantes conduit à
l'identification de 2 bandes marqueurs MI et M2 respectivement de510 pb et 140 pb.
Ces 2 bandes déterminent, d'après l'analyse des données de ségrégation, un
segment chromosomique de 10 à 15cM portant le locus de résistance et sont
situées de part et d'autre de ce locus, à 5-10 cM.
Selon une disposition du procédé de l'invention, les bandes polymorphes identifiées en tant que
marqueurs spécifiques du locus de la résistance au RYMV sont isolées à partir des gels. On opère
avantageusement par excision des gels d'électrophorèse. Cette étape d'isolement est suivie d'une
purification en procédant selon les techniques classiques. On dispose ainsi de fragments d'ADN.
Selon une autre disposition de l'invention, lesdits fragments purifiés sont clones dans un vecteur
approprié, tel qu'un plasmide, introduit dans des cellules hôtes, notamment des cellules bactériennes
comme celles de E. coli.
Selon encore une autre disposition de l'invention, les fragments d'ADN purifiés et clones sont
séquences.
Mettant à profit les séquences des inserts correspondantauxdits fragments d'ADN, l'invention fournit
également un procédé d'obtention de marqueurs de grande spécificité vis-à-vis du locus d'un gène
majeur de résistance au RYMV.
Ce procédé est caractérisé en ce qu'on définit des couples d'amorces PCR complémentaires de
fragments de la séquence d'un insert donné, on procède à une amplification spécifique de l'insert à
l'aide de ces couples d'amorces, puis on soumet les produits d'amplification à une migration sur gel
d'électrophorèse.
Ces séquences d'ADN sont utilisables pour identifier un polymorphisme lié au locus de résistance dans
une variété de riz à étudier suivant différents procédés, ainsi que décrit dans les exemples :
1) en identifiant directement un polymorphisme de taille de ces séquences
d'ADN après amplification spécifique et séparation des fragments sur gel d'agarose,
2) en digérant les produits d'amplification par des enzymes de restriction pour séparer les produits de
digestion sur gel d'agarose,
3) en utilisant ces séquences comme des sondes pour hybrider1'ADN de variétés de riz préalablement
digérées par une enzyme de restriction et déterminer un polymorphisme de restriction.
L'invention vise, en tant que nouveaux produits, les bandes AFLP polymorphes telles qu'identifiées par
le procédé défini ci-dessus, à partir d'ADN de plantes de riz, et le cas échéant isolées, purifiées
etséquencées.
Ces bandes AFLP sont caractérisées en ce qu'elles sont spécifiquement mises en évidence dans une
variété sensible au RYMV (IR64) et dans la fraction de plantes sensibles issues du croisement de cette
variété avec la variété résistance Gigante comme décrit dans les exemples.
L'invention vise tout spécialement les séquences d'ADN correspondant à ces bandes polymorphes, et
qui permettent de définir un segment du chromosome 4 de 10-15 cM portant le locus de résistance au
RYMV.
Compte tenu de leur procédé d'obtention, les bandes AFLP correspondent à des fragments de
restriction et en particulier, conformément à un mode de réalisation du procédé de l'invention, à des
fragments EcoRI-MseI.
Des fragments de ce type sont appelés marqueurs MI et M2 et sont
caractérisés par une taille, respectivement, de510 pb et de 140 pb en gel
265/503
d'électrophorèse en conditions dénaturantes.
Ces fragments sont caractérisés en ce qu'ils correspondent à des séquences
d'ADN flanquant le locus de résistance et situés de part et d'autre de ce dernier à
5-10 cM.
L'invention vise unADNc tel que défini ci-dessus, caractérisé en ce que
lesdites séquences d'ADN correspondant auxdites bandes polymorphes, portent le
locus de résistance à RYMV et définissent un segment inférieur àlOcM.
L'invention vise également des fragments clones dans des vecteurs tels que plasmides, ces vecteurs de
clonage en tant que tels, caractérisés par le fait qu'ils comportent de tels fragments, et les cellules hôtes
transformées à l'aide de ces vecteurs, tels que des cellules bactériennes comme E. coli. L'invention vise
notamment la séquence d'ADN correspondant au fragment identifié comme marqueurM1 et répondant
à la séquence SEQ ID? 3 suivante :
CGTGCTTGCTTATAGCACTACAGGAGAAGGAAGGGGAACACAACAGC
CATGGCGAGCGAAGGTTCAACGTCGGAGAAACAGGCTGCGACGGGCA
GCAAGGTGCCGGCGGCGGATCGGAGGAAGGAAAAGGAGGAAATCGA
AGTTATGCTGGAGGGGCTTGACCTAAGGGCAGATGAGGAGGAGGATG
TGGAATTGGAGGAAGATCTAGAGGAGCTTGAGGCAGATGCAAGATGG
CTAGCCCTAGCCACAGTTCATACGAAGCGATCGTTTAGTCAAGGGGCT
TTCTTTGGGAGTATGCGCTCAGCATGGAACTGCGCGAAAGAAGTAGAT
TTCAGAGCAATGAAAGACAATCTGTTCTCGATCCAATTCAATTGTTTG
GGGGATTGGGAACGAGTTATGAATGAAGGTCCATGGACCTTTCGAGGATGTTCGGTGCTC
CTCGCAGAATATGATGGCTGGTCCAAGATTGAAT
La séquence d'ADN du marqueur M1 présente une taille de 471 pb.
L'invention vise encore, en tant que nouveaux produits, les séquences de nucléotides utilisées comme
amorces d'amplification en PCR.
De telles amorces comprennent les couples E-AAC/M-CAG; E- ACC/M-CAG ; E-ACC/M-CAG ;
dans lesquels E et M correspondent respectivement à SEQ ID N 1 et SEQ IDN 2.
D'autres amorces encore sont complémentaires de séquences identifiées dans la séquence du fragment
désigné par marqueurM 1. Il s'agit en particulier de séquences(5', 3') choisies parmi
AGGAAGGGGAACACAACAGCC(21 pb) (SEQ IDN 4)
TTATGCTGGAGGGGCTTGACC(21 pb) (SEQ IDN 5)
GCAGTTCCATGCTGAGCGCAT(21 pb) (SEQ IDN 6) CCGAACATCCTCGAAAGGTCC (21 pb)
(SEQ IDN 7)
TCATATTCTGCGAGGAGCACC (21 pb) (SEQ IDN 8)>;/RTI;
L'invention vise également la séquence d'ADN correspondant au fragment identifié comme marqueur
M2 et répondant à la séquence SEQ ID N 9
AATTCACCCC ATGCCCTAAG TTAGGACGTT CTCAGCTTAG TGGTGTGGTA
GCTTTTTCTA TTTTCCTAAG CACCCATTGA AGTATTTTGC ATTGGAGGTG
GCCTTAGGTT TGCCTCTGTTA
La taille de M2 est de 120 pb.
Des amorces spécifiques complémentaires des séquences identifiées dans la séquence de M2 ont été
définies. De telles séquences répondent aux enchaînements suivants(5', 3') :SEQ ID N 10
AACCTAAGGCCACCTCCAATSEQ ID N 11
GCAAACCTAAGGCCACCTC SEQIDN 12
ATTCACCCCATGCCCTAAG
Selon encore un autre aspect, 1'invention vise l'utilisation des séquences d'ADN obtenues avec les
amorces ci-dessus pour définir des polymorphismes permettant l'identification de phénotypes
résistants.
L'invention concerne également un procédé d'identification de la séquence d'ADN portant le gène
majeur de la résistance au RYMV. Ce procédé est caractérisé par le criblage d'une banque constituée de
266/503
fragments d'ADN de 100 à 150 kb de la variété IR64 ou autre, telle que la banque BAC (Bacterial
Artificial
Chromosomes), clones dans des bactéries, pour sélectionner le ou les clones de la banque renfermant
les marqueurs définis ci-dessus et le gène de résistance au
RYMV.
Une telle banque BAC est disponible auprès de l'IRRI
Pour identifier le gène du ou des clones sélectionnés, on procède à l'identification à partir du jus brut
de protéines extraites de plantes, de la fraction, puis de proche en proche, de la protéine qui mise en
présence de virus purifié permet le mouvement de cellule à cellule dans la variété résistante. La ou les
protéines candidates sont alors séquencées partiellement soit à partir de l'extrémité N-terminale, soit à
partir de fragments internes libérés par hydrolyse.
Des amorces peuvent être ainsi définies et sont utilisées pour amplifier desADNc correspondants. Aux
fins de validation, on vérifie que cesADNc vont obligatoirement aller hybrider les clones BAC placés
dans l'intervalle compris entre les marqueurs microsatellites.
En variante, on procède au sous-clonage du fragment BAC contenant le gène en éléments de plus
petite taille sous forme decosmides qui sont ensuite
réordonnés de manière à couvrir 1'ensemble du clone BAC de départ. Ces
cosmides sont utilisés en transformation génétique pour réaliser un test de
complémentation fonctionnelle permettant de valider la séquence contenue dans
le cosmide et correspondant à l'ADNc isolé par l'approche protéine. Il s'agit en
l'occurence de démontrer que la synthèse de la protéine responsable du mouvement du virus de cellule
à cellule permet de rendre sensible la variété résistante.
L'invention vise ainsi unADNc capable de s'hybrider avec un clone BAC criblé à partir d'une banque
constituée comme indiqué ci-dessus de fragments d'ADN de 100 à 150 lcb d'une variété de riz telle que
IR64, par exemple de banque BAC (Bacterial Artificial Chromosomes), ce clone BAC appartenant à un
contig (ou ensemble de clones BAC chevauchant) de clones BAC renfermant les séquences d'ADN des
marqueurs identifiés à partir de riz grâce au procédé défini ci-dessus.
Conformément à l'invention, le gène de résistance peut être transféré à des variétés sensibles par voie
conventionnelle grâce à l'utilisation de marqueurs génétiques spécifiques qui lui sont liés. Ainsi des
variétés résistantes pourront être développées beaucoup plus facilement et beaucoup plus rapidement.
On notera de plus avec intérêt que la séquence de ce gène facilite l'accès à des gènes de résistance
d'autres virus(Potyvirus par exemple) qui sont pathogènes d'autres plantes, mais caractérisés par le
même mécanisme (mouvement de cellule à cellule). L'invention fournit ainsi des moyens de grand
intérêt pour l'amélioration des plantes basés sur des résistances naturelles aux pathogènes des végétaux.
D'autres caractéristiques et avantages de l'invention seront donnés dans les exemples qui suivent, dans
lesquels il est fait référence aux figures 1 à 15 qui représentent respectivement
-la figure 1 : le clonage du marqueur M1 dans le plasmide PGEMTeasy.
La digestion du plasmide montre un fragment d'ADN de510 pb correspondant à la bande Ml ;
-la figure 2 : l'amplification du marqueur Ml dans les quatre variétés de riz (Azucena, Gigante, IR64
etTog5681) en utilisant les couples d'amorces 2-4) : 291 pb; (2-5) : 310 pb ; (1-3) : 288 pb ; (1-4) :
406 pb ; (1-5) : 425 pb ; (2-3). Le fragment Ml est légèrement plus grand chez Tog5681 que chez les
autres variétés ;
-la figure 3 : l'identification de sites de restriction sur la séquence du marqueur MI chez les 4 variétés
IR64, Azucena, Gigante et Tog5681 ;
-la figure 4 : la digestion du marqueur MI avec 1'enzymeHpaII après amplification PCR en utilisant
les couples d'amorces (1-3), (1-4) et (1-5) sur les quatre variétés (Azucena, Gigante IR64 et Tog5681).
La présence d'un site de restrictionHpaII dans les variétés IR64 et Tog5681 libère un fragment de 86
pb qui réduit d'autant la taille du fragment amplifié,
-la figure 5 : la caractérisation du marqueur Ml sur les plantes sensibles et résistantes de la
descendance F2 (IR64 x Gigante). Les plantes F2 résistantes ont le profil du parent résistant (IR64-
267/503
absence du siteHpaII), à 1'exception d'un seul recombinant, les plantes résistantes ont le profil du
parent sensible(IR64-présence du siteHpaII) à l'exception de deux recombinants ;
-la figure 6 : la ségrégation du marqueur MI dans la population HD (IR64 x Azucena) :IR64-Azucena30 individus HD (IR64 x Azucena) ;
-la figure 7 : la carte de liaison génétique du chromosome 4 du riz avec le positionnement du marqueur
MI et l'identification de l'intervalle dans lequel se trouve le locus de résistance ;
-la figure 8 : l'hybridation du marqueur MI utilisé comme sonde sur des membranes portant1'ADN des
4 variétés (IR64, Azucena, Gigante et Tog5681) digérées par6 enzymes de restriction ApaI,KpnI, PstI,
ScaI,HaeIII. La variété
Tog5681 présente un profil de restriction différent des autres variétés pour r 1'enzyme ScaI qui peut
être utilisée pour marquer le locus de résistance de cette variété; et
-la figure 9 : l'hybridation du marqueur Ml utilisé comme sonde sur des membranes portant1'ADN
d'individus issus derecroisement (IR64 xTog5681) x
Tog 5681 et digérés avec 1'enzyme ScaI. Cette descendance est en ségrégation pour la résistance au
RYMV. Les individus sensibles (5) montrent tous la banded'IR64 associée à la bande de Tog5681
(individus hétérozygotes). Les individus résistants (9) ne montrent que la bande de Tog5681 à
1'exception d'un individu recombinant,
-la figure 10 : la cartographie et l'ancrage du locus de résistance élevée au
RYMV sur la carte IR64 x Azucena,
-la figure 11, le mouvement du virus de RYMV dans une plante, après inoculation dans une feuille,
-la figure 12, les chromatogrammes à partir de virus extraits de plantes sensibles infectées, et
-les figures13 à 15, un chromatogramme après injection de virus, un gel
SDS PAGE etun immunoblot avec un anticorps anti-protéine de capside.
Exemple 1 : Identification des variétés sources de résistance
Les variétés utilisées dans l'étude de la résistance et en particulier les deux variétés résistantes Gigante
etTog5681 ont été caractérisées grâce à des marqueurs microsatellites sur un échantillonnage
représentatif de loci.
Le polymorphisme se manifeste par le nombre de répétitions d'un court motifnucléotidique, le plus
souventbinucléotidique qui est caractéristique d'une variété donnée.
Sur un ensemble de loci, les allèles répertoriés permettent de disposer des caractéristiques spécifiques
de chaque variété.
La mise en évidence de ces marqueurs microsatellites s'effectue par r l'amplification de 1'ADN avec
des amorces spécifiques déterminées par Chen et al.(1), suivie d'une migration sur gel
depolyacrylamide en conditions dénaturantes suivant le protocole décrit par les mêmes auteurs.
Le tableau 1 donne les résultats à partir d'un système de référence établi par Chen etal., ci-dessus
suivant lequel les allèles sont identifiés par le nombre de répétitions du motif comparativement à la
variété IR36 qui sert de témoin. Les deux variétés Gigante et Tog5681 sont ainsi décrites
spécifiquement sur 15 loci vis-à-vis de toutes autres variétés (les marqueurs microsatellites sont donnés
dans la 1ère colonne).
Tableau 1
EMI17.1
>;tb; Locus >;SEP; Chr >;SEP; Taille >;SEP; référence >;SEP; IR36 >;SEP; Gigante >;SEP; IR64
>;SEP; Azucena >;SEP; TOG >;SEP; 568113
>;tb; >;SEP; surIR
>;tb; >;SEP; 36
>;tb; 113(2)nn-26nn-22n-26RM0011 >;SEP;
>;tb; RM005 >;SEP; 1 >;SEP; 113 >;SEP; (2) >;SEP; n >;SEP; n-6 >;SEP; n-4 >;SEP; n+16 >;SEP; n8
>;tb; 140(2)nn-4nn-24n-16RM0117 >;SEP;
>;tb; 157(2)nn+4n+6n+8n-6RM0187 >;SEP;
268/503
>;tb; RM019 >;SEP; 12 >;SEP; 226 >;SEP; (2) >;SEP; n >;SEP; n >;SEP; n+21 >;SEP; n-9 >;SEP; n21
>;tb; RM021 >;SEP; 11 >;SEP; 157 >;SEP; (2) >;SEP; n >;SEP; n+8 >;SEP; n >;SEP; n-14 >;SEP; n32
>;tb; RM148 >;SEP; 3 >;SEP; 129 >;SEP; (3) >;SEP; n >;SEP; n+6 >;SEP; n >;SEP; n >;SEP; n+6
>;tb; RM167 >;SEP; 11 >;SEP; 128 >;SEP; (3) >;SEP; n >;SEP; n+4 >;SEP; n >;SEP; n+32 >;SEP;
n+24
>;tb; RM168 >;SEP; 3 >;SEP; 116 >;SEP; (3) >;SEP; n >;SEP; n-20 >;SEP; n >;SEP; n-20 >;SEP; n24
>;tb; 158(1) nn-14nn-12n-16RM2323 >;SEP;
>;tb; RM022 >;SEP; 3 >;SEP; 194 >;SEP; (2) >;SEP; n >;SEP; n-2 >;SEP; n >;SEP; n-4 >;SEP; n-2
>;tb; RM252 >;SEP; 4 >;SEP; 216 >;SEP; (1) >;SEP; n >;SEP; n+38 >;SEP; n+2 >;SEP; n-20 >;SEP;
n+10
>;tb; RM255
Exemple 2 : Caractérisation de la résistance
La résistance a été caractérisée à partir de l'inoculation artificielle de jeunes plantules avec du virus
comparativement à une variété témoin IR64 extrêmement sensible.
Le contenu en virus a été suivi pendant 60 jours après inoculation grâce à des tests ELISA sur les
dernières feuilles émises.
Ces tests n'ont jamais pu mettre en évidence de signal significativement différent de plantes témoins
non inoculées par le virus.
Une autre expérimentation a été réalisée en inoculant des protoplastes isolés des deux variétés
Tog5681 et Gigante. Dans les deux cas, il possible de détecter la présence des protéines virales
(protéine de la capside et protéine de mouvement PI), ainsi que l'accumulation d'ARN viral, qui
témoignent de la capacité de ces protoplastes à multiplier le virus, et ceci de la même manière que les
protoplastes de variétés sensibles comme IR64.
Ainsi, si on considère que la réplication, le mouvement de cellule à cellule, et le transport à longue
distance à travers les vaisseaux, sont les trois étapes principales du déroulement du cycle infectieux
dans la plante, la résistance de ces deux variétés réside le plus logiquement dans un blocage du virus au
niveau des cellules infectées.
Exemple 3 : Génétique de la résistance
Différents croisements FI ont été réalisés entre la variété d'O. sativa résistante (Gigante), une variété
d'O. glaberrima résistante Tog5681 (également identifiée par1'ADRAO) et la variété de référence très
sensible IR64 (sélectionnée àl'IRRI).
La culture du matériel végétal, les croisements et la production des descendances ont été réalisés dans
les serres del'IRD à Montpellier.
Les hybrides FI obtenus entre les variétés sensibles et résistantes ont été testés pour la résistance au
virus du RYMV par test ELISA et suivi des symptômes.
Ces hybrides FI se sont tous révélés aussi sensibles que le parent sensible et ont donc montré que la
nature de la résistance était récessive.
En revanche, les hybrides entre les deux sources de résistance Gigante et
Tog5681 n'ont donné que des hybrides Fl résistants en faveur d'un seul et unique locus de résistance
chez ces deux sources de résistance.
Ces résultats sont résumés dans le tableau 2 ci-après.
Ce tableau donne la distribution des réponses ELISA (A 405 mn) dans les feuilles infectées par voie
systémique des hybridesFI, des backcross et des descendants F2 obtenus à partir des backcross entre la
variété IR64 sensible et les 2 cultivars résistants Gigante etTog5681.
269/503
TABLEAU 2 descendances hybrides F1 Présence Nombre Distribution des valeurs de @ de de
symptômes géotypes (0,01 - 0,05) (0,9 - 1) ; : dérivés de Tog 5681 1
F1. (IR64 x Tog 5681) Sensible - BCS: (IR64 x Tog 5681) x IR64 Sensible 19 - 4
RCG. (IR64 x Tog 5681) x Tog 5681 en ségrégation 22 12
Dérivés d'une plante fertile BSC
BCSF2 sensible 11 BCS x IR64 sensible 1
BCS x Tog5681 sensible 15 - dérivés de Gigante
F1 (IR64 x Gigante)
F2 (IR64 x Gigante) en ségrégation 65 15
F1 (Gigante x Tog5681) sensible - 10
Les réponses ELISA sont obtenues à partir de : i) 10 plantes régénérées par bouturage pour chaque
combinaison hybride F1 i i) 1 plante régénérée pour chaque génotype interspécifique dérivé de backere
i i i) tests directs sur des plantules jeunes (inoculation à 10 jours après ger lecture à 7 jours après
inoculation) pour les descendances interspécifiques @>;/RTI;
En ce qui concerne Gigante, l'hérédité de la résistance a été confirmée par un test de résistance sur 55
familles F3 du croisement (IR64 x Gigante). Les résultats sont donnés dans le tableau 3.
Ce tableau donne la ségrégation de la résistance à RYMV dans les descendances (IR64 x Gigante).
L'inoculation est effectuées 10 à 17 jours après la germinat
Burkina Faso et les symtômes sont suivis 45 jours après l'inoculation
Tableau 3
Classes de Nombre de Nombre de plantes@ résistance descendances Total Sensible Résistant
Sensilble 15 191 191 0 en ségrégation 10 343 262 81
Résistant 4 45 14 31 très résistant 6 87 0 87
Résistant* 7 73 23 50 très résistant* 4 56 0 56 # descendances F3 dérivées de plantes résistantes F2
analysées par tests ELI
L'examen de ce tableau montre que : -1/4 de plantes F2 ne donne que des plantes résistantes dans les
descendancesF3, et sont homozygotes pour la résistance -1/4 de plantes F2 ne donne que des plantes
sensibles dans les descendances F3, et sont homozygotes pour la sensibilité -1/2 des plantes F2 sont en
ségrégation pour la résistance et donnent des plantes sensibles et résistantes avec la même proportion (3
: 1) dans les descendancesF3.
L'ensemble des résultats s'accorde parfaitement avec un seul gène de résistance récessif présent chez
les deux variétés Gigante etTog5681.
Exemple 4 : Identification des marqueurs de résistance MI et M2 selon le protocole AFLP
a-Obtention de pools d'ADN
Les feuilles de 10 plantes sensibles et de 10 plantes résistantes issuesd'une
F2 (IR64 x Gigante) ont été prélevées pour extraire leur ADN.
Les ADN ont été ensuite mélangés de manièrestoechiométrique pour constituer deux pools d'ADN
correspondant respectivement à 10 plantes F2 sensibles ou résistantes avec une concentration finale du
mélange de 50ng/tI.
Ces mélanges ont servi de base à l'identification de marqueurs de résistance par la méthode AFLP
(Amplified Fragments Length Polymorphism) pour polymorphisme de longueur de fragments amplifiés
qui a été développée par
Zabeau et al (4), et Vos et al. (5). Les produits utilisés se présentent sous forme d'un kit commercial
(Gibco BRL) délivré par Keygene & Life Technologies.
b-Obtention de fragments de restriction 250 ng de chacun des pools d'ADN à 50ng/pl et des parents
sont digérés simultanément par deux enzymes de restriction(EcoRI etMseI).
Réaction de digestion (25 ul) :
5ul d'ADN (50 ng/ml)
(2U)deEcoRI(10U/ l)0,2 l
0,2ul (2 U) de MseI (5 U/ l)
5 ul de tampon T4 ligase 5X
270/503
14,5ul deH20.
La réaction de digestion s'effectue pendant deux heures à37 C, puis 15 mm. à70 C pour inactiver les
enzymes de restriction. Après digestion, il est procédé à une réaction de ligation.
Réaction de ligation (50 L ! I) :
25 l du milieu réactionnel de double digestion
1 p1 d'adaptateurEcoRI
1! d'adaptateur MseI
5 l de tampon T4 Ligase 5X
1pl (l U) de ligase (10U/pl)
17 RI H20.
La réaction de ligation s'effectue à37 C, pendant 3 heures, suivie d'une inactivation de 1'enzyme à60 C
pendant 10 mm
c-Amplification
L'amplification proprement dite a été réalisée en deux étapespréamplification et amplification
spécifique.
Cl-Réaction de pré amplification (50 l)
5 gel du milieu réactionnel renfermant l'ADN digéré et fixé aux adaptateurs, dilué au 1/10
0,5p1 d'amorce EcoRI (150ng/gl)
0,5ul d'amorce MseI (150 ng/ l)
2 l de mélange de nucléotides 5 mM
5ul de tampon 10 X, Promega
5p1 de MgCl2 25 mM
0,2p1 (1 U) de Taqpolymérase (5U/p1)
31, 81deH20.
Les caractéristiques de la pré-amplification par PCR sont les suivantes : 20 cycles avec dénaturation
>;RTI : 30 sec à 94 C
hybridation: 30 sec à 56 C
élongation :1 72 Cà
L'amplification sélective se fait à partir d'un aliquote de la première amplification diluée au1/30 en
utilisant des amorces ayant 3 nucléotides sélectifs à l'extrémité 3', et en marquant l'une des amorces
pour révéler les bandes sur un film autoradiographique.
On utilise les couples d'amorces suivants :
E-AAC/M-CAG
E-ACC/M-CAG
E-AGC/M-CAG, dans lesquels
E répond à la séquence
GAC TGC GTA CCA ATT C (SEQ IDN 1), et
M à la séquence
GAT GAG TCC TGA GTA A (SEQ IDN 2).
La température d'hybridation est diminuée de 0,7 C par cycle, pendant les 11 cycles suivants : 20
derniers cycles dénaturation: 30 sec à 90 C
hybridation : 30 sec à56 C
élongation :1 minà72 C
On procède au marquage de l'amorceEcoRI (ramené à un tube de0,5 l) :
0,18 1 de l'amorceEcoRI (5ng)
0,1 l de ;33P ATP (10mCu/R1)
0,05 ul de tampon kinase 10 X
0,02 l (0,2U) de T4polymérase kinase(lOU/pL1)
0,15H20.de
La réaction de marquage se fait à37 C pendant 1 heure et est arrêtée par 10 minutes à70 C.
C2-Réaction d'amplification spécifique
271/503
20 :
0,5 ul d'amorceEcoRI marquée
5gel du milieu réactionnel de pré-amplification, dilué au 1/30,
0,3ul d'amorce Msel (100ng/ul)
0,8u. l de mélange de nucléotides 5 mM
2 gel de tampon 10 X Promega
2p1 de MgC12 25 mM
0,1p1 (0,5 U) de Taq Polymérase (5 U/ l)
9,3ul de H20.
Les caractéristiques de l'amplification sont les suivantes :
32 cycles avec . pour le premier cycle :
dénaturation : 30 sec à94 C
hybridation : 30 sec à65 C
élongation : à72 Cmin. les 11 cycles suivants : les mêmes conditions que précédemment, avec
diminution à chaque cycle de 0,7 C de la température d'hybridation ; et pour . les 20 derniers cycles :
dénaturation : 30 sec à90 C
hybridation : 30 sec à56 C
élongation : à72 Cmin d-Electrophorèse et Autoradiographie
A la fin de la réaction d'amplification,20 ni de tampon de charge sont ajoutés (98 % de formamide,
0,005 % de xylène cyanol et 0,005 % de bleu debromophénol). Les produits d'amplification sont
séparés par électrophorèse sur gel depolyacrylamide dénaturant (6 %d'acrylamide, 8 M d'urée) avec
un tampon de migration TBE (Tris 18 mM, EDTA 0,4 mM, acide borique 18 mM, pH 8,0) pendant 3
heures de migration à puissance de 50 watts. Après migration, le gel est fixé dans une solution IV
d'acideacétique/2V d'éthanol absolu pendant 20 minutes. Le gel est transféré sur un papier Wattman
3M et séché pendant 45 minutes à80 C avec un sécheur de gel. Le gel est placé dans une cassette avec
un film ultrasensible. L'autoradiographie est révélée après deux jours d'exposition.
La comparaison des profils obtenus chez les parents et les pools de plantes sensibles ou résistantes
permet d'identifier des bandes présentes dans l'un des pools, mais absentes dans l'autre. Ces bandes
candidates au marquage de la résistance sont ensuite vérifiées individuellement sur chacune des plantes
composant les pools d'ADN. e-Résultats
L'étude des résultats obtenus montre que les deux marqueurs appelés M1 et M2 sont présents chez le
parent sensible (IR64) ainsi que dans toutes les plantes F2 (IR64 x Gigante) composant le pool de
plantes sensibles, alors que cette bande est absente chez le parent résistant (Gigante) et qu'un seul
individu du pool résistant manifeste cette bande. Le même type de variation est observé dans
lerecroisement (IR64 x Tog5681) x Tog5681. Les autres marqueurs identifiés dans cette analyse (M3 à
M6) montrent aussi la même variation :
-présence des bandes chez le parent sensible et le pool des plantes sensibles F2 (IR64 x Gigante) ainsi
que les plantes sensibles durecroisement (IR64 xTog5681) x Tog5681.
-absence de bande chez les parents résistants Gigante et Tog5681, chez le pool des plantes résistantes
F2 (IR64 x Gigante) et chez les plantes résistantes durecroisement (IR64 xTog5681) x Tog5681.
Les données de ségrégation entre les marqueurs AFLP MI à M6 et le locus de résistance pour les pools
F2 (IR64 x Gigante) et le backcross interspécifique (IR64 xTog5681) x Tog5681 sont résumées dans
les tableaux 4 et 5. L'analyse des données de ségrégation et des rares recombinants observés dans les
deux croisements permet d'évaluer les taux de recombinaison entre ces différents marqueurs et le locus
de résistance. En particulier, les marqueurs MI d'une part et les marqueurs M2 à M6 d'autre part
déterminent un segment inférieur à 10-15 cM portant le locus de résistance. Ml etM2 sont ainsi à
moins de 5-10 cM et placés de part et d'autre de ce locus.
TABLEAU4
Résistance/MarqueurM1Nombred'individusobservés
Phénotype Résistant Sensible
RYMVtt/ggttggItItItGénotyperésistance
It
Marqueur+/-+/-/-+/--/--/+/
272/503
Pool F2 résistant (IR64 x gigante) 10
Pool F2 sensible (IR64 xgigante)-----0
10
Backcross interspécifique 1-08--11
Résistance/MarqueurM2, M3, M4, M6 Nombres d'individus observés
Phénotype Résistant Sensible
Génotype résistance RYMV ttlgg tt gg It It 11 11
Marqueur+/-+/-/-+/--/-+/-/Pool F2 résistant (IR64x gigante) 11 - 0 - - - Pool F2 sensible (IR64 xgigante)-----0 10
Backcross interspécifique >;RTI Tog5681 102-0 8
Résistance/Marqueur M5 Nombre d'individus observés
Phénotype Résistant Sensible
Génotype résistace RYMV ttlgg tt gg It It 11
I1
Marqueur+/-+/-/-+/--/--/
+/
Pool F2 résistant (IR64x gigante)11----- 0
Pool F2 sensible (IR64x gigante)-----0
-10
Backcross interspécifique Tog5681 9 3 08TABLEAU 5
Marqueur Ml/Marqueurs M2, M3, M4, M6 Nombre d'individus observés
GénotypeM1-/* +/*
GénotypeM2, M3, M4, M6 +/* -/- +/* -/
Pool F2 résistant (IR64 x gigante) 0 1 0 10
Pool F2 sensible (IR64 x gigante) 10 0 0 0
Backcross interspécifiqueTog5681 11 2 2 11
MarqueurMl/Marqueur. M5 Nombres d'individus observés
GénotypeMl7*V7 +/*-/-+/*-/-GénotypeM5
Pool F2résistant (IR64 x gigante) 0 1 0 10
Pool F2 sensible (IR64 x gigante) 10 0 0 0
Backcross interspécifique Tog5681 11 2 3 10
Marqueur M5/Marqueurs M2, M3, M4, M6 Nombre d'individus observés +/*+/*-/--/-GénotypeM5
Génotype M2, M3, M4, M6 +/*-/Pool F2 résistant (IR64 x gigante) 0 0 0 11
Pool F2 sensible (IR64 x gigante) 10 0 0 0
Backcross interspécifique Tog5681 13 1 0 12 * : (-)backcross interspécifique Tog5681. (+ ou-) pool
F2
Exemple 5 : Isolement du >;RTI margeur mol
Une nouvelle amplification, avec le même couple d'amorces, a été réalisée, suivie d'une migration sur
gel depolyacrylamide dans les mêmes conditions que celles énoncées ci-dessus. La révélation a été
faite par une coloration au nitrate d'argent, avec le kit silver staining (Promega), pour visualiser
directement les bandes sur le gel. Après révélation, la bande MI a été excisée du gel, puis1'ADN a été
élue dans 50ul d'eau à4 C pendant une nuit.
Un aliquot de 5p1 a été prélevé etréamplifié avec les mêmes couples d'amorces avec un marquage
auP33. Le produit d'amplification a été séparé à nouveau sur geld'acrylamide dénaturant à 6%, et
comparé aux parents et aux pools sensibles et résistants. La piste correspondant à ce produit
d'amplification montre une seule bande de 510 pb migrant exactement au même niveau que la bande
d'origine qui avait été excisée. Un autre aliquot de5 ul a été également amplifié avec les mêmes
amorces et a été séparé sur gel d'agarose à1,8%. La bande correspondant à la taille attendue (510pb) a
été à nouveau excisée et purifiée avec un kit gene clean (Promega).
Exemple 6 : Clonage et Séquençage du Marqueur MI
clonage
3 p1 du produit de purification ont été utilisés pour une réaction de clonage pendant une nuit à37 C.
3ul de produit de purification
273/503
1 ul de vecteurPGEMTeasy
1ul de T4 Tampon ligase 10 X
1ul de T4 DNA Ligase
4ul deH20
La transformation a été réalisée avec la souche E.Coli JM109 en ajoutant 5ul du produit de clonage à
100ul de cellules compétentes de E. Coli
JM109. Une préculture a été réalisée sur milieu de culture LB pendant 1 heure, à37 C. Ensuite les
bactéries ont été étalées sur boîte de Pétri contenant del'agar à
1/1000 d'ampicilline. 50 uld'IPTG-XGal sont ajoutés juste avant l'étalement des bactéries pour
sélectionner les bactéries transformées. Une colonie blanche (transformée) a été sélectionnée et remise
en culture dans les mêmes conditions(Agar plus ampicilline).
A partir de cette culture, une mini-préparation d'ADNplasmidique a été réalisée avec le kit Wizard
plus (Promega). L'ADN plasmidique contenant l'insert a été digéré avec 1'enzymeEcoRI pour vérifier
la présence du marqueur
M1. Un gel d'agarose à 1,8% a permis de vérifier la présence de la bande de 3kb correspondant au
plasmide et de la bande de510 pb corespondant au marqueur
Ml (photo 1).
. Séquençage
La séquence de l'insert (SEQ ID N 3) est la suivante (5', 3') :
SEQ ID N 3 20 30 40 50 60 70
GTGCTTGCTTATAGCACTACAGGAGAAGGAAGGGGAACACAACAGCC
ATGGCGAGCGAAGGTTCAACGTCGGAGAAACAGGCTGCGACGGGCAG
CAAGGTGCCGGCGGCGGATCGGAGGAAGGAAAAGGAGGAAATCGAA
GTTATGCTGGAGGGGCTTGACCTAAGGGCAGATGAGGAGGAGGATGT
GGAATTGGAGGAAGATCTAGAGGAGCTTGAGGCAGATGCAAGATGGC
TAGCCCTAGCCACAGTTCATACGAAGCGATCGTTTAGTCAAGGGGCTT
TCTTTGGGAGTATGCGCTCAGCATGGAACTGCGCGAAAGAAGTAGATT
TCAGAGCAATGAAAGACAATCTGTTCTCGATCCAATTCAATTGTTTGG
GGGATTGGGAACGAGTTATGAATGAAGGTCCATGGACCTTTCGAGGAT
GTTCGGTGCTCCTCGCAGAATATGATGGCTGGTCCAAGATTGAAT
Les séquences correspondant aux amorces utilisées pour les amplifications
AFLP ont été retrouvées et montrent que la bande correspond à un fragment de
restriction
En déduisant les séquences correspondant aux amorces, la taille réelle du
fragment d'ADN de riz clone est de 471 pb.
L'utilisation des différents couples d'amorces (1-3), (1-4), (1-5) d'une part
et(2-3), (2-4), (2-5) d'autre part permet de valider le clonage de la bande AFLP
M1. L'amplification de1'ADN des variétés utilisées dans les croisements avec ces amorces ne montre
qu'une seule bande. Le fragment correspondant à la variété
Tog56581 est un peu plus important que celui des autres variétés (fig. 2).
Exemple 7 : Transformation de la séquence M1 en marqueur polymorphe
Un polymorphisme pour le marqueurM1 a été déterminé entre les parents de la population haploïde
doublée (IR64 x Azucena). Cette population compte plus de 300 marqueurs répartis sur les 12
chromosomes du riz. Pour cela, on s'est appuyé sur les sites de restriction de la séquence du marqueur
M1 déterminée sur le parent IR64 (fig. 3). Les amorces (1-3), (1-4) et (1-5) ont été utilisés pour
amplifier 1'ADN des parents des croisements qui a ensuite été digéré par des enzymes de restriction. Le
site de restrictionHpaII/MspI libère un fragment de 86 pb lorsque l'amorce 1 est utilisée. Ce site est
absent chez les variétés Gigante et
Azucena. (fig. 4).
Le marqueur a été testé sur les individus F2 du pool sensible et du pool résistant du croisement (IR64 x
Gigante). Tous les individus résistants ont le profil de la variété Gigante (absence du marqueur
AFLPM1 associée à l'absence du site de restrictionHpaII/MspI) à 1'exception de l'individu (5.11). Les
individus sensibles présentent le site de restrictionHpaII/MspI à l'état homozygote comme
la variété IR64 à l'exception de deux individus hétérozygotes qui sont recombinés
274/503
(fig. 5).
La séquence du marqueur Ml quel'on peut amplifier par des amorces
spécifiques correspond bien au marqueur AFLPMI. La digestion par 1'enzymeHpaII/MspI permet de
distinguer l'allèle venant du parent sensible (IR64) du parent résistant (Gigante).
Ces nouvelles données permettent de conforter la position du locus de résistance entre les marqueurs
MI et M2 et d'estimer les taux de recombinaison à 0,065 0,045 pour la distance entre M1 et le locus de
résistance et 0,11 0,047 pour la distance entre les marqueursM1 et M2.
Exemple 8 : Cartographie du marqueurMl
Soixante individus de la population (IR 64 x Azucena) ont été passés pour le marqueur MI :
amplification avec les amorces(1-3) et digestion par 1'enzymeHpaII/MspI, suivie d'une séparation des
fragments sur un gel d'agarose à 2,5 %.
La ségrégation du marqueur Ml est sans distorsion (fig. 6). Les résultats permettent de cartographier le
marqueur MI en utilisant un logiciel de cartographie (Mapmaker V3), qui permet de placer le marqueur
MI sur le chromosome 4 entre les marqueurs RG 163 et RG 214 (fig. 7). Cet intervalle représente la
zone où se situe le locus de résistance au RYMV.
La cartographie du gène de résistance au RYMV sur le chromosome 4 de la carte génétique du riz
permet d'identifier des marqueurs plus proches du locus de résistance. Il s'agit en particulier de
marqueurs microsatellitesRM252 et
RM273 ou tout autre marqueur à l'intérieur de l'intervalle(4-5cM) défini par ces marqueurs permettant
d'identifier un polymorphi