Supplementary Methods
Construction of transformation vectors. The DNA encoding OspA from Borrelia
burgdorferi strain B31 (a kind gift of Y.F.Chang, Cornell University) 1 served as starting
point for all further cloning steps. For cloning of the full-length OspA, PCR amplification was
used to generate a sequence stretch at the 3´-end encoding for 6 histidine residues and to
introduce appropriate cloning sites (NcoI at the 5´- and XbaI at the 3´-end). The coding
sequence of OspA was placed between the 5´- and 3´-regulatory sequences of the tobacco
psbA gene provided by the vector pKG27, a derivative of pJS25 2.
The ospA-T gene, a shortened version of ospA which lacks the 5’ extension of 45 nucleotides
encoding the lipoprotein signal sequence, was amplified by PCR with primers
CATGTGCAAGCAAAATGTTAGTAGCAGC and GGCTTCTAGATTATTTTAAAGCG,
the latter creating an XbaI restriction site at the 3’-end. For cloning with the plasmid pKG27
the PCR product was digested with the restriction enzyme XbaI and the vector pKG27 was
first linearized with NcoI and subsequently blunted with Mung Bean nuclease, followed by
XbaI digestion and ligation.
The expression cassette was subcloned into the expression vector pNT2 which provided the
aadA gene for selection on spectinomycin 3 and the flanking regions (rbcL and accD). Plastid
transformation of tobacco plants (Nicotiana tabacum cv. petit havana) was achieved via
particle bombardment 4.
For DNA blot analysis of transplastomic plants total cellular DNA was extracted from leafs
based on the CTAB (cetyltrimethylammonium bromide)-based method 5. 2 µg total DNA
were digested over night with the restriction enzyme EcoRI, separated on a 0.7% agarose gel
and blotted onto nylon membranes (Nytran N, Schleicher & Schuell, Dassel, Germany).
Subsequent hybridization with either digoxygenin-11-dUTP-labled rbcL or ospA probes in
hybridization buffer and detection of the labelled probes was done according to the manual of
the supplier (Roche Molecular Biochemicals, Mannheim, Germany).
Protein extraction and immunoblot analysis. For protein extraction plant material was
taken from greenhouse-grown plants. To obtain total cellular protein, 100 mg leaf-tissue was
homogenized in 1 ml ice-cold extraction puffer (PBS (23 mM Na2HPO4; 17 mM NaH2PO4;
100 mM NaCl); 0.3% Triton X-114; 1 mM PMSF). After incubation for 20 min at 4°C, two
centrifugation steps were performed at 4°C for 20 min at 14000×rpm to remove the cell
debris. The supernatant was used for determination of protein amount by BCA test (Perbio,
Bonn, Germany) and for phase partitioning (see below). 3 µg of extracted proteins were used
for immonoblot analysis. Thus, the samples were separated by polyacrylamide electrophoresis
and transferred to a PVDF membrane (Amersham Biosciences, Freiburg, Germany). After an
o/n incubation in blocking solution (5% skim milk powder in 1× PBS) the membrane was
incubated with a mouse anti-OspA monoclonal antibody (Fitzgerald, Concord, MA) at a
1:10000 dilution in PBST (1× PBS; 0.05% Tween 20). For detection a HRP conjugated
secondary antibody and the Western Blot Chemiluminesence reagent (Perbio) was used.
Metabolic labelling. Protoplasts (prepared from young leaves from sterile grown cell culture
plants as described in 6 were diluted to 106/ml in 200 µl aliquots. [9,10-3H] palmitic acid at a
concentration of 200 µCi was added and samples were incubated under illumination and
gentle shaking for 4 hours. After lysis through repeated freeze/thaw cycles and the addition of
Triton X-100 (final concentration 0.5%) OspA was immunoprecipitated with monoclonal
antibody M492912 (Fitzgerald, Concord, USA) utilizing the SizeX system (Pierce) according
to the accompanied protocol. After elution of labelled OspA from the solid support with
buffer containing 1% lithium dodecyl sulfate (LDS) the solution was concentrated with
Microcon spin devices (Micropor) and subsequently separated on a 12.5% Bis-Tris NuPage
gel (Invitrogen Corp, Carlsbad, USA). Gels were fixed in a mixture of isopropanol:acetic
acid:water (25:10:65) for 30 minutes on a rotary shaker, followed by an incubation in Amplify
solution (Amersham Biosciences) for another 30 minutes. The gel was dried under vacuum
and exposed to a pre-flashed film (Hyperfilm MP, Amersham Biosciences) for 14-20 days at 80ºC.
Purification of the histidine-tagged OspA. 5 g leaf material were ground under liquid
nitrogen and incubated in 45 ml lysis buffer (50 mM NaH2PO4, 300 mM NaCl, 10 mM
imidazol and 0.5% Triton X-114 ) for 20 min at 4°C. After clearing the supernatant was
incubated with 2.5 ml Probond Ni-Sepharose (Invitrogen) for 30 min at 4°C. The suspension
was then loaded onto a column and washed with 3 × 3 ml wash buffer (50 mM NaH2PO4, 300
mM NaCl, 20 mM Imidazol 0.5% Triton X-114 ), bound OspA-protein was eluted with 4 × 3
ml elution buffer (50 mM NaH2PO4, 300 mM NaCl, 250 mM Imidazol, 0.5% Triton X-114 ).
For phase partitioning 7 the eluted fractions were incubated at 37 °C until the detergent
formed a clearly visible clouding. After centrifugation at 30 °C for 10 min at 14 000 the upper
phase was discarded, the detergent-faction was diluted (1:25 with 100 mM HEPES pH 7.5,
200 µl) and subjected to a second affinity chromatography at MagneHis Bead® (Promega) to
eliminate the detergent and salts. The beads were washed three times with 1 ml wash buffer
(100 mM HEPES; 10 mM imidazol, 0.5% Triton X-114), followed by three washing steps
with 10 mM ammonium acetate pH 7.5. The bound rec. OspA protein was eluted with 300 µl
0.1% trifluoroacetic acid (TFA) and 20 µl of the eluted fractions and of the crude extract was
used for SDS PAGE.
Mass spectrometry. The analysis was performed by Matrix Assisted-Laser-DesorptionIonization Time-Of-Flight Mass Spectrometry (MALDI-TOF-MS). For this, the eluted
fraction containing the protein was concentrated under vacuum, and 4 µl of pure formic acid
were added to 5 µl of concentrated rcOspA (250 pmol). The sample was then diluted with 36
µl of a mixture of isopropanol-methanol-water (4:4:1, by volume). A matrix solutions was
prepared by dissolving cyano-4-hydroxycinnamic acid in acetonitrile/water (50:50, v/v)
containing 0.1% TFA at a concentration of 7 µg/µl. The protein sample was mixed with an
equal volume of matrix solution and deposited onto the target. Calibration was performed in a
close external mode using bovine serum albumin (single charged M+ and double charged M2+)
ions.
Spectra were acquired on a Voyager DE-PRO mass spectrometer (Applied Biosystems) in a
positive linear delayed extraction mode, using an accelerating voltage of 25 kV, a pulse delay
time of 300 ns and a grid voltage of 92%. About 200 scans were averaged for each spectrum
to improve signal-to-noise level.
Generation of immune sera and analysis of antibodies by ELISA and western blot
BALB/c mice were repeatedly immunized, into the base of the tail, with 10 µg of the
respective rec. proteins (chloroplast-derived rcOspA, E.coli-derived rbOspA) in the presence
of 100 µl of MPL-TDM adjuvant (composed of monophosphoryl Lipid A and synthetic
trehalose dicorynomycolate; Sigma, Deisenhofen, Germany) and bled on the indicated days
p.i. Specific Ab for OspA or core protein in IS was quantified by a solid-phase ELISA as
described 8 using as substrates 1 µg/ml of the respective recombinant proteins (OspA, wtcore). Ab with the same specificity as the mAb LA-2, which recognizes the main protective
epitope of OspA 9, were measured by a competitive ELISA, as described 10. Western blot
analysis, using whole-cell lysate (aliquots of frozen samples of spirochetes in PBS are
dissolved in non-reducing SDS buffer; 10% Glycerol, 2% SDS, 0.01% bromophenol blue in
62.5 mM Tris/HCl pH 6.8, and treated for 3 min at 950C) of B. burgdorferi strain ZS7
(2.5×106 cell equivalents/lane) or recombinant proteins (250 ng/lane) as antigen preparation,
was done as described 10.
1.
Chang, Y.F. et al. FEMS Microbiol. Lett. 109, 297-301 (1993).
2.
Staub, J.M. & Maliga, P. Embo J. 12, 601-606 (1993).
3.
Svab, Z., Harper, E.C., Jones, J.D. & Maliga, P. Plant Mol. Biol. 14, 197-205 (1990).
4.
Svab, Z. & Maliga, P. Proc. Natl. Acad. Sci. U. S. A. 90, 913-917 (1993).
5.
Rogers, S.O. & Bendich, A.J. Plant Mol. Biol. 5, 69-76 (1985).
6.
Treuter, E., Nover, L., Ohme, K. & Scharf, K.D. Mol. Gen. Genet. 240, 113-125
(1993).
7.
Bordier, C. J. Biol. Chem. 256, 1604-1607 (1981).
8.
Kramer, M.D. et al. Immunobiology 181, 357-366 (1990).
9.
Schaible, U.E. et al. Proc. Natl. Acad. Sci. U. S. A. 87, 3768-3772 (1990).
10.
Simon, M.M. et al. Eur. J. Immunol. 26, 2831-2840. (1996).