Genetic Diversity of Ficus carica L. Based on Non-Coding Regions
of Chloroplast DNA
Anurug Poeaim1*, Supattar Poeaim1, Kasem Soytong2 and Tassnart Krajangvuthi3
Department of Biology, Faculty of Science, King Mongkut’s Institute of Technology
Ladkrabang, Bangkok, 10520, Thailand
2
Major of Plant Pest Management Technology, Faculty of Agriculture,
King Mongkut’s Institute of Technology Ladkrabang, Bangkok, 10520, Thailand
3
Phratamnak Suan Pathum, Tumbon Bang Khayaeng, Amphoe Mueang,
Pathumthani, 12000, Thailand
1
Abstract
Ficus carica were analyzed for DNA sequence diversity in the non-coding region of chloroplast
DNA. The trnL (UAA) intron sequences was used as genetic markers and establishing refined
genetic relationships for differentiating F. carica collected from Phratamnak Suan Pathum
originating from diverse geographical areas. Using the c and d primers, a single DNA band of
approximately 550 bp was amplified from each fig cultivars. Twenty-one F. carica sequences
from this study and 7 public sequences from the GenBank database were revealed the presence of
2 main groups. The first group is monophyletic branch composed by Ventura cultivar. All the
remaining cultivars are ranged in the second cluster that comprises two sub-groups. Most of them
were revealed a very low genetic diversity. The result was suggest that direct sequencing of the
trnL (UAA) intron regions do not evolve rapidly enough to resolve relationships at these lower
taxonomic levels.
Keywords: Genetic Diversity, TrnL (UAA) Intron, Ficus carica
1. Introduction
Ficus carica L., a deciduous tree belonging to the Moraceae family, is commonly known as fig
tree. The fig is a typical Mediterranean fruit species which cultivated for its sweet fruits that are an
excellent source of minerals, vitamins and dietary fiber. This fruits are consumed either fresh or
dried and for industrial production such as jam and beverage. Different parts of the fig tree (leaves,
fruits, bark, root and latex) are also used traditionally for their medicinal properties.
F. carica is widely distributed in all the climatic stages and great diversity. More than
sixty cultivars are listed in various reports [1-2]. Traditionally, the distribution of genetic diversity
has been characterized using morphological markers such as leaf, fruit weight, shape and colors.
However, these characters are either highly influenced by environmental conditions or limited to
the fruit production season. Example, the leaf morphological characterization is difficult since the
leaves of fig have difference shape [3].
*Corresponding author . Tel: 662-329-8000 ext 6223
Email: kpanurug@kmitl.ac.th
The 8th International Symposium on Biocontrol and Biotechnology
163
In Thailand, there is one for fig cultivation for development of new typical agricultural
products and their increased offer at local markets, introduction of figs into food processing
industry, acquisition of new source of income for local growers and family farms. Recently,
collection from traditional plantations has been initiated and conserved at Phratamnak Suan
Pathum in Plant Genetic Conservation Project under the Royal initiative of Her Royal Highness
Princess Maha Chakri Sirindhorn. Collected fig has great diverse of morphological
characterization. Consequently, problems of synonymy and homonymy have been occurring.
At the time of the above research, genetic diversity at the molecular level had not been
investigated. The resulting information will contribute to the pool of background genetic
information which may then facilitate the selection of a suitable conservation or breeding program.
So, the main objective of this study was to determine the amount of genetic diversity and genetic
relationships between varieties obtained from various parts of world as well as establish a
molecular database for fig breeding programs.
2. Materials and Methods
2.1 Plant material
Two sets of F. carica were used in this study. The first includes 21 cultivars that the fresh leaves
were collected from Phratamnak Suan Pathum and the second, 7 public sequences of F. carica
from the GenBank database.
2.2 DNA extraction and amplifications
Genomic DNA was extracted from freshly harvested leaves using the Qiagen DNeasy plant
extraction kit (QIAGEN) following the manufacture’s instructions. The trnL (UAA) intron was
amplified using primers c (CGAAATCGGTAGACGCTACG)and d (GGGGATAGAGGGACTT
GAAC) of Taberlet et al. [4]. Amplification reactions were carried out in 25 µl final volume of
reaction mixture containing 200 µMol dNTPs, 0.8 pMol each primer, 10X PCR buffer and 1U Taq
DNA polymerase (Biolabs, England) and 100 ng of genomic DNA. The thermocycler was
programmed for an initial denaturation step at 95°C for 5 min, followed by 35 cycles of
denaturation at 94°C for 1 min 30 sec, 2 min of annealing at 55°C; extension was carried out at
72°C for 3 min and final extension step at 72°C for 5 min. PCR fragments were separated using
1% agarose gels electrophoresis in 1XTBE buffer, stained with ethidium bromide and
photographed on a UV transilluminator using a digital camera. The PCR products were purified
and then used directly for sequencing.
2.3 Phylogenetic analysis
All sequences were compared to others in GenBank using BLASTN and the best match recorded
and selected. The entire DNA sequences of 21 F. carica isolates from this study and 7 public
sequences of F. carica from the GenBank database were edited within Bioedit version 7.0.5.2.
Nucleotide sequences were aligned using the ClustalX 1.83 software. The consensus trees were
constructed the Phylip package version 3.6 with Neighbor-joining method by 1000 bootstrap
resembling. Phylogenetic inference was performed and exposed using TreeView program.
3. Results and Discussion
Molecular data are helpful in reconstructing phylogenetic relationships. The most widely used
markers in plant are from the internal transcribed spacer (ITS) regions of nuclear ribosomal DNA
The 8th International Symposium on Biocontrol and Biotechnology
164
(nrDNA). In recent, chloroplast DNA (cpDNA) is the most powerful tool for plant molecular
systematics and phylogenetic relationships studies using universal primers following [4] both
intron trnL (UAA) and intergenic spacer between the 3-exon of trnL (UAA) and trnF (GAA).
Those chloroplast genes are now used routine because direct sequencing of polymerase chain
reaction (PCR) products makes it relatively easy to obtain sequence data. So, the trnL (UAA)
intron sequence was used as genetic markers and establishing refined genetic relationships.
Twenty-one figs were amplified using the c and d primers; the designed PCR has
permitted to generate banding profiles using templates of total cellular DNA. A unique fragment
of approximately 550 bp was amplified from each fig cultivars. Sequencing directly from the
purified PCR products was used to sequence analysis. Blast search was performed in order to
confirm the identity of the sequences. Phylogenetic tree was constructed using neighbor-joining
(NJ) analysis of the chloroplast sequences data. Relationships among cultivars of fig-tree, the
dendrogram illustrated in Figure 1 has clustered the 28 cultivars into two main groups. The first
group is monophyletic branch composed by Ventura cultivar. All the remaining cultivars are
ranged in the second cluster that comprises two sub-groups. Sub-group 1 formed by the cultivars
Celeste, Adriano, Marylane seedless, Fioroni umbrella, Bifara, Brown turkey, Paradiso nero and
Fico gentile as well as Sawoudi (EU191023). The strong association at the DNA level between the
Paradiso nero and Fico gentile cultivars. This study suggests that these cultivars are use to
breeding program. Sub-group 2 contained about 18 cultivars that revealed relatively close
relationship was also detected. So, this study uncovered some intraspecific diversity in Figure 1.
Baraket et al. [5] was investigated the nucleotide variation of the trnL and trnF genes
intergenic spacer non-coding region indicates that the plastid DNA of fig has been undergoing
rapid expansion in their evolutionary history. On the other hand, genetic diversity based on trnL
intron sequences has highly conserved which the pairwise sequence divergence ranged from 0.000
to 0.035 with an average of 0.012. The low level variation exhibited by fig cultivars is probably
related to its slow evolution rate [6].
Molecular diversity of F. carica have been reported using various approaches, i.e.
isozymes [7], simple sequence repeats (SSRs) [8-9], randomly amplified polymorphic DNAs
(RAPD) [1, 10-13] restriction fragment length polymorphism (RFLP) [14] and amplified fragment
length polymorphism (AFLP) [15] as well as sequence of ribosomal DNA [16-17]. These
molecular markers can be effectively used to detect genetic diversity and the phylogenetic
relationship between Ficus varieties.
Cabrita et al. [15] was analyzed 11 Sarilop which is the main and standard cultivar for
commercial dried fig production in Turkey by three molecular marker techniques: isozymes,
RAPDs and AFLPs. Isozyme systems permitted the discrimination between Sarilop and
Sarizeybek that used as a control. The use of 31 10-mer primers in RAPD analysis allowed
splitting the 11 Sarilop into two groups of genetic similarity, but not to distinguish between all the
clones. However, eight combinations of EcoRI/MseI primers in AFLP analysis were enough to
clearly distinguish between all the Sarilop clones.
The present study shows that cytoplasm DNA markers can be used to develop a
molecular database for use in breeding program of the fig in the future. An understanding of
genetic diversity of F. carica can provide insight into the management of this species. So, the
enlarge number of markers by the use of other molecular methods are necessary in order to have a
deeper insight into the identification key in this crop. On the other hand, morphological would be
analyzes because of cultivars are selected by farmers mainly on the basis of agronomic traits such
as fruits size and taste.
The 8th International Symposium on Biocontrol and Biotechnology
165
Ventura
Celeste
Adriano
Marylane seedless
Fioroni umbrella
Bifara
Brown turkey
6
EU191023 Sawoudi
60
Paradiso nero
659
Fico gentile
1000
EU191014 Grichy
Isfahan
Italiano
Pingo de mel 2
Qila saif
Duaphine
Sugar
EU191017 Bither Abiadh
4
Black genoa
11
EU191005 Zidi1
141
EU191020 Dchiche Assal
Fracazzano
Conadria
Horai
3
Fico umbrella
10
Milanzana
54
EU191024 Khalt
948
EU191007 Widlani
Figure 1. Phylogenetic analysis on trnL (UAA) intron sequence of chloroplast DNA, 21 varities of
F. carica comparative with 7 other varities from GenBank using bootstrap 1,000 replicates and
Neighbour-joining algorithm. Bootstrap values are given at each branch point.
4. Conclusions
The trnL (UAA) intron sequences was used as genetic markers and establishing refined genetic
relationships for twenty-one F. carica and 7 public sequences from the GenBank database were
revealed the presence of 2 main groups. Most of them were revealed a very low genetic diversity.
The 8th International Symposium on Biocontrol and Biotechnology
166
The result was suggest that direct sequencing of the trnL (UAA) intron regions do not evolve
rapidly enough to resolve relationships at these lower taxonomic levels.
5. Acknowledgements
This work was supported by a grant of Faculty of Science, King Mongkut’s Institute of
Technology Ladkrabang. We are also grateful to Plant Genetic Conservation Project under the
Royal initiative of Her Royal Highness Princess Maha Chakri Sirindhorn at Phratamnak Suan
Pathum for providing the F. carica samples.
References
[1]
[2]
[3]
[4]
[5]
[6]
[7]
[8]
[9]
[10]
[11]
Salhi-Hannachi, A., Chatti, K., Saddoud, O., Mars, M., Rhouma, A., Marrakchi, M. and
Trifi, M., 2006. Genetic diversity of different Tunisian fig (Ficus carica L.) collections
revealed by RAPD fingerprints. Hereditas, 143, 15-22.
Mars, M., Chatti, K., Saddoud, O., Salhi-hannachi, A., Trifi, M. and Marrakchi, M., 2008.
Fig cultivation and genetic resources in Tunisia, an overview. Acta Horticulturae, 798, 27–
32.
Podgornik, M., Vuk, I., Vrhovnik, I., Mavsara, D.B., 2010. A survey and morphological
evaluation of fig (Ficus carica L.) genetic resources from Slovenia. Scientia Horticulturae,
125, 380-389.
Taberlet, P., Gielly, L., Pautou, G. and Bouvet, J., 1991. Universal primers for amplification
of three non-coding regions of chloroplast DNA. Plant Molecular Biology, 17, 1105-1109.
Baraket, G., Saddoud, O., Chatti, K., Mars, M., Marrakchi, M., Trifi, M., and Salhi
Hannachi, A., 2009. Chloroplast DNA analysis in Tunisian Fig cultivars (Ficus carica L.):
sequence variations of the trnL–trnF intergenic spacer. Biochemical Systematics and
Ecology, 36, 828–835.
Baraket, G., Abdelkrim, A.B., Saddoud, O., Chatti, K., Mars, M., Trifi, M. and Salhi
Hannachi, A., 2010. Molecular polymorphism of cytoplasmic DNA in Ficus carica L.:
Insights from non-coding regions of chloroplast DNA. Scientia Horticulturae, 125, 512–
517.
Hedfi, J., Trifi, M., Hannachi-Salhi, A., Ould Mohamed Salem, A., Rhouma, A. and
Marrakchi, M., 2003. Morphological and isoenzymatic polymorphism in Tunisian fig
(Ficus carica L.) collection. Acta Horticulturae. 605, 319-325.
Salhi-Hannachi, A., Trifi, M. and Zehdi, S., 2004. Inter simple sequence repeat
fingerprintings to assess genetic diversity in Tunisian fig (Ficus carica L.). Genetic
Resources and Crop Evolution, 51, 269-275.
Chatti, K., Saddoud, O., Salhi-Hannachi, A., Mars, M., Marrakchi, M. and Trifi, M., 2007.
Inferring of genetic diversity and relationships in a Tunisian fig (Ficus carica L.)
germplasm collection by random amplified microsatellite polymorphisms. Journal
International Plant Biology, 49, 386–391.
Khadari, B., Lashermes, Ph. and Kjellberg, F., 1995. RAPD fingerprints for identification
and genetic characterization of fig (Ficus carica L.) genotypes. Journal of Genetics and
Breeding, 49, 77-86.
ElisiaÂrio, P., Justo, E. and LeitaÄo, J., 1999. Identification of mandarin hybrids by
isozyme and RAPD analysis. Scientia Horticulturae, 81, 287-299.
The 8th International Symposium on Biocontrol and Biotechnology
167
[12]
[13]
[14]
[15]
[16]
[17]
Galderisi, U., Cipollaro, M., Di Bernardo, G., De Masi, L., Galano, G. and Cascino, A.,
1999. Identification of the edible fig “Bianco del Cilento” by random amplified
polymorphic DNA analysis. HortScience, 34(7), 1263-1265.
De Masi, L., Cipollaro, M., Di Bernardo, G., Galderisi, U., Galano, G., Cascino, A., Grassi,
G., Pavone, E. and Simeone, A., 2003. Clonal selection and molecular characterization by
RAPD analysis of the fig (Ficus carica L.) ‘‘dottato’’ and ‘‘bianco del cilento’’ cultivars in
Italy. Acta Horticulturae, 605, 65-68.
Khadari, B., Grout, C., Santoni, S. and Kjellberg, F., 2005. Contrasted genetic diversity and
differentiation among Mediterranean populations of Ficus carica L.: A study using
mtDNA RFLP. Genetic Resources and Crop Evolution, 52, 97–109.
Cabrita, L.F., Aksoy, U., Hepaksoy, S. and LeitaÄo, J.M., 2001. Suitability of isozyme,
RAPD and AFLP markers to assess genetic differences and relatedness among fig (Ficus
carica L.) clones. Scientia Horticulturae, 87, 261-273.
Weiblen, G.D., 2000. Phylogenetic relationships of functionally diocious Ficus (Moraceae)
based on ribosomal DNA sequences and morphology. American Journal of Botany, 87,
1342–1357.
Baraket, G., Saddoud, O., Chatti, K., Mars, M., Marrakchi, M., Trifi, M. and
SalhiHannachi, A., 2009. Sequence analysis of the internal transcribed spacers (ITS) region
of the nuclear ribosomal DNA (nrDNA) in fig cultivars (Ficus carica L.). Scientia
Horticulturae, 120, 34–40.
The 8th International Symposium on Biocontrol and Biotechnology
168