Li et al.,
SUPPLEMENTAL MATERIALS AND METHODS SECTION
Tissue samples
Forty eight fresh frozen tumor and normal tissue samples (21 ARMS, 20 ERMS and 7 normal
skeletal muscles) were used in the analyses. The RMS tumor tissues and the normal muscle samples
were obtained from cooperative human tissue network and from the tissue procurement facility at
the University of Minnesota respectively. For 3 RMS cases (FT-261, -271 and -281) patient
matched normal muscle tissues were also available. The institutional review board approved this
study. The basic clinical details of the tumor tissues are shown in the table 1.
miRNA and mRNA expression analysis
Total RNA extraction and purification were followed as described previously [26.]
miRNA
expression profiles were generated for all the 48 RMS and normal tissue samples. We used the
Illumina Sentrix Array Matrix for miRNA expression profiling as previously described (24). mRNA
expression profiles of RMS and normal tissue samples were generated using Illumina human (HT12) arrays, allowing high throughput expression profiling of 48,000 human RefSeq and UniGene
annotated genes (25). The array matrix was imaged using an Illumina BeadArray reader. Intensity
files were analyzed using BeadStudio version 3.1.1.
Quantitative real-time PCR
miRNAs and mRNAs were analyzed using the miScript PCR system (Qiagen, Valencia, CA) on
Light cycler 480 (Roche, Indianapolis, IN), following the manufacturer’s recommendations.
miRNAs were quantified with U6 small RNA serving as the normalization control, and mRNAs
with GAPDH as reference control. The fold expression and statistical significance were calculated
using 2 -∆∆ Ct method (Schmittgen and Livak, 2008).
Statistical analysis for miRNA and mRNA profiling data
miRNA and mRNA fluorescence values were obtained from the Illumina detection system without
background subtraction and were quantile normalized using GeneData Expressionist Software
(Genedata Inc, San Francisco, CA). Both datasets were then further normalized to the median
value for each RNA transcript. Statistically significant genes were determined using two-group ttest. A strict solution to the multiple testing problems associated with the statistical analyses of
1
Li et al.,
microarrays, the Bonferroni correction was used to correct p-values. For miRNAs, the p-value
cutoff was required to be less than 0.05/735 = 6.8e-5. For mRNA, the p-value cutoff used was
0.05/38000 = 1.32e-6. The data set was further filtered, and the ratio of the group median needed to
be greater than 2 fold for an RNA transcript to be stated as significant.
Unsupervised hierarchical clustering was carried out with Pearson correlation as the metric
following log base 2 transformation of mean centered data using Cluster3.0 (Van Huissteden, J.,
1990) and heat maps were generated from the CDT files generated by Cluster3.0 using Java
Treeview. Ingenuity pathways analyses (http://www.ingenuity.com/) tool was used to determine
functional enrichment and canonical pathway enrichment. B and H multiple testing corrected pvalues were used for the functional analyses enrichments.
Cell culture
ARMS cells lines (Rh30 and Rh18) and ERMS cell lines (JR1 and RD) and HEK293 were grown in
Dulbecco’s modified Egale’s Medium (DMEM, with 4g/L glucose, 4mM L-glutamine, and
110mg/L sodium pyruvate) (Hyclone, Logan, Utah) supplemented with 10% Fetal Bovine Serum
(FBS, GIBCO) at 37°C and 95% air and 5% CO2. These RMS cell lines were authenticated by the
presence of PAX3 or fusion PAX3- FOXO1fusion proteins.
Luciferase reporter vectors
Three kinds of luciferase reporter systems were used to validate miRNA and mRNA pairing and
targeting.
1) psiCHECKTM-2 based vectors (Promega, Madison, WI): Reporters were constructed based on
psiCHECKTM2 vector. Reporter psimiR-1 was generated with oligonucleotides containing the
reverse complement sequence (ATACATACTTCTTTACATTCCA) of mature miR-1 cloned into
the multiple cloning region (MCR) downstream of the stop codon of the SV40 promoted Renilla
luciferase gene in psiCHECKTM2, which made the expression of Renilla luciferase gene under the
regulation of the artificial 3’UTR sequence. Renilla luciferase activity was then used as an indicator
of the effect of the artificial 3’UTR on transcript stability and translation efficiency. Similarly,
reporter psimiR-206 contained oligonucleotides with the sequence reversely complementary to
miR-206 (CCACACACTTCCTTACATTCCA). As control, oligonucleotides containing reverse
complementary sequence of miR-206 with 2 points mismatch (CCACACACTTCCTTACtTTgCA)
2
Li et al.,
were inserted into the same MCR site downstream of Renilla luciferase gene to generate reporter
psimiR-206m. And Reporter psimiR-1m was constructed with oligonucleotides containing reverse
complementary sequence of miR-1 with 2 points mismatch (ATACATACTTCTTTACtTTgCA)
cloned into the downstream of Renilla luciferase gene. The psiCHECK™-2 Vector also contains a
constitutively expressed firefly luciferase gene, which served as an internal control to normalize
transfection efficiency.
2) 3’UTR Reporter Vectors:
Wild type and mutants of PAX3-3’UTR-sGG vectors PAX3-3’UTR-sGG (SwitchGear, Menlo
Park, CA) were constructed with 3’UTR of PAX3 (transcript variant PAX3I, mRNA, NCBI
Reference Sequence: NM_001127366.2) cloned into the MCR downstream of a Firefly luciferase
gene to express hybrid Firefly luciferase transcripts with 3’UTR of PAX3, which allowed to screen
potential PAX3-3’UTR targeting miRNAs. An empty 3’-UTR vector with its multiple cloning
regions removed was used as a control. Three mutants based on wild type PAX3-3’UTR-sGG were
generated. Mutation from ACATTCC to ACtTTgC was generated at the predicted conserved (site1:
3133) or poorly conserved (site2: 2158) binding site of miR-1/miR-206 to produce mutant PAX33’UTRS1m-sGG or PAX3-3’UTRS2m-sGG respectively. In another mutant PAX3-3’UTRDumsGG, both predicted binding sites of miR-1/miR-206, conserved (site3133) and poorly conserved
(site2158), were mutated. All mutants were generated with QuikChange Site-Directed Mutagenesis
Kit (Stratagene, Santa Clara, CA).
Wild type and mutant of E2F7-3’UTR-sGG vectors E2F7-3’UTR-sGG were constructed with
3’UTR of E2F7 cloned into the MCR downstream of a Firefly luciferase gene to allow to screen
potential E2F7-3’UTR targeting miRNAs by luciferase assay. With QuikChange Site-Directed
Mutagenesis Kit, mutation are conducted at the predicted binding site of miR-29 family (site5456)
from GGTGCTA to GcTGgTA to generate E2F7-3’UTRmut-sGG.
3) pGL4.73 Vector (Promega): pGL4.73 with a Renilla luciferase gene was co-transfected with all
3’-UTR reporter vectors, working as an internal control to normalize transfection efficiency.
3
Li et al.,
Transfection
All microRNAs including precursors, scrambled miRNA precursors, and precursor negative control
are from Ambion, Austin, TX. Three kinds of transfection reagents were used for three different
types of transfection.
1) DNA only transfection: LipofectamineTM 2000 (Invitrogen) was used to transfect DNA (reporter
vectors) into cells. According to the instructions of manufacturer, a plasmid DNA (µg) to
lipofectamineTM2000 (ul) ratio of 2.5:1 was used to transfect cells in 24-well plate. 6×104 cells were
inoculated in each well of 24-well plate. LipofectamineTM2000 was mixed with appropriate amount
of serum-free medium and incubated for 5min at room temperature. DNAs, after diluted with
serum-free culture medium, were combined with diluted lipofectamineTM2000. Mixture was
incubated for 20min at room temperature, and then added to each well containing cells and medium.
Cells were incubated at 37°C and 5% CO2 for 24hr for luciferase assay.
2) DNA and miRNA precursor co-transfection: Attractene Transfection Reagent was used to
transfect DNA (200ng) and miRNA precursor (10 nM) together into cells. According to
manufacturer’s instruction, shortly before transfection, 6×104 cells were seeded into each wells of
24-well plate. DNA was diluted with serum-free medium, and then 1.5ul Attractene Transfection
Reagent was added. Mixture was incubated for 10-15min at room temperature, and then added to
each well of 24-well plate. Luciferase assay was conducted after 24hr incubation to verify DNAmicroRNA pairing and repression of luciferase gene fused with artificial 3’UTRs.
3) miRNA precursor/scrambled precursor/precursor negative control transfection: HiPerFect
Transfection Reagent (Qiagen, Valencia, CA) was used to transfect miRNA precursor, scrambled
precursor, or negative control (10nM). Briefly, 6×104 cells were seeded into each wells of 24-well
plate shortly before transfection. miRNA precursors were diluted with FBS free medium and then
3ul HiPerFect Reagent was add. After vortexing the mixture was incubated for 5~10min at room
temperature and then add drop-wise into cells. Total RNA and protein were collected after 48hr of
transfection. Function assays including apoptosis, cell cycle and proliferation assay would be
conducted after 48hr of transfection.
4
Li et al.,
Luciferase assay
Dual-Luciferase Reporter Assay System (DLR assay system, Promega, Madison, WI) was used to
perform dual-reporter assays on psiCHECK2 based reporter systems. DLR Assay System was also
used to measure luciferase activity of cells co-transfected with 3’UTR vectors and pGL4.73 control
vector. Lucierase assay was conducted according to the manual of manufacturer on SynergyTM 2
(BioTek, Winooski, VT). After 24hr transfection, growth media were removed and cells were
washed gently with phosphate buffered saline. Passive lysis buffer (Promega, Madison, WI)
100ul/well was added and with gentle rocking for 15min at room temperature cell lysates were
harvested for DLR assay. 10ul of cell lysate were transferred in white opaque 96-well plate (Falcon,
353296). Assay on SynergyTM 2 for Firefly and Renilla luciferase activity were performed
sequentially to the cell lysate in each well. For each luminescence reading, after injector dispensing
assay reagents into each well, there would be a 2-second pre-measurement delay, followed by a 10second measurement period. Luciferase assays were analyzed based on ratio of Renilla/Firefly
(psiCHECK2 based vectors) or Firefly/Renilla (co-transfecting 3’UTR-sGG vectors with pGL4.73
vector as internal control) to normalize cell number and transfection efficiency.
Total RNA and protein isolation from cultured cells
Culture media were changed after 24 hr of transfection. Total RNAs and proteins were harvested
with mirVana PARIS kit (Ambion, Austin, TX) after 48hr of transfection.
Western Blotting
Standard western blot analysis was carried out using protein extracts from pre- or post-treated cells.
A rabbit polyclonal antibody to PAX3 (ab53571, Abcam) with dilution 1:100 was used to detect
PAX3 protein level, a mouse monoclonal antibody to CCND2 (ab3085, Abcam) with dilution of
1:100 was used to detect CCND2 protein level, and a rabbit polyclonal antibody to E2F7 (sc-66870,
Santa Cruz) with dilution of 1:100 was used to detect E2F7 protein levels. A mouse monoclonal
antibody to GAPDH (39-8600, Invitrogen) with dilution of 1:1000 was used to detect GAPDH
protein level. Goat anti-mouse IgG-AP (sc-2008) or goat anti-rabbit IgG-AP (sc-2034) was used as
secondary antibody with a dilution of 1:10,000. Western blotting bands were developed with ECF
Western Blotting Reagent Pack and the fluorescent bands were scanned with Storm 840 PhosphorChemifluoresence workstation (GE Healthcare, Piscataway, NJ).
5
Li et al.,
Apoptosis assay
Vybrant ® Apoptosis Assay Kit #8 (Molecular Probes, Eugene, OR) was used to determine
apoptosis in JR1 and Rh30 cells according to manufacturer’s instruction. 5×105 cells were seeded in
6-well tissue culture plate. After 24 hour of serum starving, cells were transfected with 10nM of
miR-29 a, b, or c precursors or negative control (all miRNA Precursors and negative control#1 were
from Ambion, Austin, TX) with HiPerFect (Qiagen, Valencia, CA). Apoptosis assays were
conducted after 48hrs of transfection. Cells were assayed with flow cytometry on BD FACSCalibur
(BD Biosciences, San Jose, CA) and analyzed with Flowjo 7.5.5 to determine population of live,
early and late apoptotic cells.
Cell cycle assay
After 48hr transfection, cells were harvested by trypsinization and washed with PBS. 70% pre-cold
(-20°C) Ethanol in PBS was used to re-suspend the cells and cells were stored at -20°C at lease
30min. Cells were centrifuged to remove ethanol, washed with PBS, and then re-suspended with
2μg/ml PI (MP Biomedicals, Solon, OH) and 200μg/ml RNase A (Qiagen) in PBS. Cell cycle assay
was conducted on BD FACSCalibur and analyzed with Flowjo 7.5.5.
Cell Proliferation assay
CellTiter 96 Aqueous One Solution Cell Proliferation Assay (Promega, Madison, WI) was used
according to manufacturer’s instruction with minor modification. Briefly, 48 hours after miR-29
transfection, 50μl of CellTiter 96 Aqueous One Solution Reagent was added into each well of the
24-well assay plates containing cells in 500μl of culture medium. After 2hr incubation at 37°C and
5% CO2, 100μl of culture medium from each well were transferred to a 96-well plate for absorbance
measurement at 490nm using Synergy2TM luminometer (BioTek, Winooski, VT).
6
Li et al.,
Table : Primers used in PAX3 3’UTR studies, primers designed based on PAX3 transcript variant I
Primer
No.
Primer
Name
Sequence
Location
1
PAX3
1373For
AACCGCTTCCTCCAAGCACT
PAX3 mRNA 1373-1392
2
PAX3
1544Rev
GAGAGGCCATTGCCAATGGT
PAX3 mRNA 1544-1425
3
PAX3
1455For
CAGGCATGGATTTTCCAGC
PAX3 mRNA 1455-1473
4
PAX3
1603Rev
CAGTCTGGGGCTGATGAGG
PAX3 mRNA 1603-1585
5
PAX3
1507For
TCCAACCCCATGAACCCC
PAX3 mRNA 1507-1524
Note: 45nt upstream from the
translocation site 1552
6
FOXO1
1271Rev
GCCATTTGGAAAACTGTGATCC
FOXO1 mRNA 1271-1250
Note: 254nt downstream from the
translocation site 1017
7
PAX3
1753For
AGTATGGACCCTGTCACAGGCTAC PAX3 mRNA 1753-1776
8
PAX3
2221Rev
TCTGCTTGCCCAAACCAGTCT
9
PAX3
2143For
CATCGAGGAGCTAGAACATTCCAT PAX3 mRNA 2143-2164
10
PAX3
3124Rev
CTACCTCATTCGTGGTTCCAAGAA
PAX3 mRNA 3124-3101
11
PAX3
2681For
CCTCATGGAT GCTTTGGCAA
PAX3 mRNA 2681-2700
12
PAX3
3270Rev
TGTTGGTTGAGGCTGCAACA
PAX3 mRNA 3270-3251
PAX3 mRNA 2221-2201
7