Supplementary methods
Cell culture
Murine neural stem cells derived from adult forebrain (adult NSC) were provided by
Luciano Conti (University of Milan, Italy) 1 and grown and differentiated into astrocytes
under same conditions as ES-derived NSC.
Inhibitors
Information as provided by manufacturer Tocris Biosciences, UK:
NU 7441 2 (Cat. No. 3712): Potent and selective DNA-dependent protein kinase (DNAPK) inhibitor (IC50 values are 14, 1700, 5000, >100000 and >100000 nM for DNA-PK,
mTOR, PI 3-K, ATM and ATR respectively). Displays no activity at a range of 60
diverse kinases at 10 μM.
KU 55933 3 (Cat. No. 3544): Potent, selective and competitive ATM kinase inhibitor (Ki
= 2.2 nM, IC50 values are 13, 2500, 9300, 16600, > 100000 and > 100000 nM at ATM,
DNA-PK, mTOR, PI 3-kinase, PI 4-K and ATR respectively).
BrdU incorporation and Ki67 assay
Cells were seeded on glass coverslips. For BrdU incorporation assay cells were treated
with 3.3 µM BrdU (Sigma Aldrich) for 24 hours prior to fixation. 4% paraformaldehyde
(PFA) fixed cells were subjected to DNAse I treatment while probed with primary mouse
anti-BrdU antibody (BD Pharmingen), followed by Alexa-fluor 488 labeled secondary
antibody (Invitrogen). For Ki67 assay, 4% PFA fixed cells were probed with FITClabeled
primary
mouse
anti-Ki67
antibody
(BD
Pharmingen).
Comparative
immunofluorescence analyses were performed in triplicates (for BrdU) with identical
acquisition parameters on an Olympus wide field microscope with MetaMorph software.
Quantification of BrdU or Ki67 positive cells was performed using ImageJ software.
1
Immunoblotting
Cells were lysed in NP40 lysis buffer and 20-50µg of whole cell lysate in Lämmli
loading buffer were resolved by SDS-PAGE, transferred to nitrocellulose membranes
(Protran) using Biorad electrophoresis systems and probed with primary and secondary
antibodies in 5% BSA
or skimmed milk, respectively. Mouse monoclonal primary
antibodies used were: PCNA (Abcam), p21CIP (Santa Cruz).
Gene expression analysis
Total RNA was extracted with Trizol reagent (Invitrogen) and precipitated with
isopropanol and ethanol. 1 µg of total RNA was used for retrotranscription using VILO®
reverse transcription kit (Invitrogen). cDNA was analyzed by quantitative RT-PCR
amplification on a Light Cycler 480 system using SYBR Green I assay (Roche). CTvalues were obtained by calculation of the second derivative. Primers were designed with
Roche UniversalProbe Library software against Mus musculus:
GADD45a: FP: AGAGCAGAAGACCGAAAGGAT; RP: GTACACGCCGACCGTAATG
p21CIP: FP: AACATCTCAGGGCCGAAA; RP: TGCGCTTGGAGTGATAGAAA
BAX: FP: GTGAGCGGCTGCTTGTCT; RP: GGTCCCGAAGTAGGAGAGGA
PUMA: FP: TTCTCCGGAGTGTTCATGC; RP: TACAGCGGAGGGCATCAG
References
1. Pollard SM, Conti L, Sun Y, Goffredo D, Smith A. Adherent Neural Stem (NS)
Cells from Fetal and Adult Forebrain. Cereb. Cortex 2006; 16(suppl_1): i112-120
2. Leahy JJJ, Golding BT, Griffin RJ, Hardcastle IR, Richardson C, Rigoreau L et
al. Identification of a highly potent and selective DNA-dependent protein kinase
(DNA-PK) inhibitor (NU7441) by screening of chromenone libraries. Bioorganic
& Medicinal Chemistry Letters 2004; 14(24): 6083-6087.
3. Hickson I, Zhao Y, Richardson CJ, Green SJ, Martin NMB, Orr AI et al.
Identification and Characterization of a Novel and Specific Inhibitor of the
Ataxia-Telangiectasia Mutated Kinase ATM. Cancer research 2004; 64(24):
9152-9159.
2
Supplementary figure Legends
Fig. S1. NSC-derived astrocytes are terminally differentiated and do not proliferate.
A After induction of astrocytic differentiation by 10% FCS, cells differentiate and
completely stop DNA replication, as shown by BrdU incorporation assay. 24h
BrdU pulse was given to astrocytes on day 7 of FCS-induced differentiation and
parental NSC. Cells were analyzed in triplicate by immunofluorescence using an
anti-BrdU antibody.
B Western blot of NSC and astrocytes indicating a strong downregulation of the Sphase relevant protein PCNA in the astrocytes.
Fig. S2. Images shown in Fig 1 are here shown as individual colour channels. Bar:
15µm.
Fig. S3. Foci formation of H2AX in irradiated NSCand astrocytes.
A
Confocal immunofluorescence analysis of NSC astrocytes irradiated with 1Gy to
better discriminate H2AX foci. Note the co-localisation of H2AX and 53BP1
foci in NSC, whereas 53BP1 foci are nearly undetectable in astrocytes even upon
50Gy of irradiation. Bar: 10µm.
B
Images shown in (A) split into individual colour channels. Bar: 10µm.DNA: blue,
H2AX:green, 53BP1:red and GFAP: gray.
Fig. S4. Transcriptional effect of p53 induction in irradiated astrocytes and NSC
A
Western blot analysis of NSC and astrocytes, irradiated and processed in parallel.
Membrane was probed with an antibody against p21CIP and normalized for αtubulin.
3
B
Irradiated NSC (at day 7 after 10Gy irradiation) display a robust induction of the
p53 target gene PUMA.
Fig. S5. Adult NSC show canonical DDR upon irradiation, while DDR in adult NSCderived astrocytes is strongly reduced.
A
Western blot analysis of adult murine NSC and astrocytes, irradiated and
processed in parallel. Membranes were probed with phospho-specific and total
antibodies and normalized for vinculin. Note: similarly to astrocytes described
elsewhere in the paper, adult NSC derived astrocytes show robust induction of
H2AX upon irradiation.
B
Quantitative RT-PCR analysis of gene expression in astrocytes derived from adult
murine NSC, normalized against parental NSC prior to serum-induced
differentiation. β2-microglobulin was used as housekeeping gene.
Fig. S6. Inhibition of ATM, but not of DNA-PK, negatively affects S/TQ kinase
activity in irradiated NSC.
A Western blot analysis of NSC and astrocytes, irradiated and processed in parallel.
Membranes were probed with phospho-specific and total antibody against ATM,
followed by the pS/TQ antibody in order to detect pan-PI3K-like DNA dependent
kinase activity. Membranes were normalized for vinculin.
Fig. S7. Raw data of representative FACS measurements presented in Fig. 4B.
Fig. S8. Images shown in Fig 4C are here shown as individual colour channels.
Bar: 10µm. DNA: blue, H2AX: green and GFAP: red.
4
Fig. S9. NSC-derived neurons are terminally differentiated and do not proliferate.
A After induction of neuron differentiation, NSC differentiate and exit the cell
cycle, as shown by the Ki67 assay. Parental NSC and neurons were analyzed by
immunofluorescence using a Ki67 antibody.
B Not irradiated NSC and neurons show no DDR activity, as detected by pS/TQ
immunofluorescence and confocal imaging. Bar: 10µm.
5