Supplemental Material
Supplementary Table 1
Primer extension and SS RT-PCR
Leishmania infantum LSU γ 101-118 forward
5’-CCTTTTTACTTCTCGCGT-3’
Leishmania infantum LSU γ 1-22 forward
5’-TAGTGGTAATGCGAAACACTTG-3’
Leishmania infantum LSU γ 196-213 reverse
5’-ACACCCCAGGTTTTTGCT-3’
Leishmania infantum 18S rRNA 649-671 forward
5’-TATTAATGCTGTTGCTGTTAAAG-3’
Leishmania infantum 18S rRNA reverse
(complementary to nucleotides 928-946)
5’-ACAAAAGCCGAAACGGTAG-3’
Leishmania infantum LSU α 1-21 forward
5’-ACAGACCTGAGTGTGGCAGGA-3’
Leishmania infantum LSU α reverse (complementary
to nucleotides 245-266)
5’-CAATGGGCTAACACCTTCTTTG-3’
Leishmania infantum 5.8S 1-20 forward
5’-TATACAAAAGCAAAAATGTC-3’
Leishmania infantum 5.8S reverse (complementary to
nucleotides 244-262)
5’-GTTCGACACTGAGAATATG-3’
Trypanosoma brucei LSU γ 1-20 forward
5’-ACTGTGGAAATGCGAAACAC-3’
Trypanosoma brucei LSU γ reverse (complementary to
nucleotides 195-213)
5’-ACACCCCAGGTTTTTGCT-3’
Trypanosoma brucei LSU γ 101-118 forward
5’-GCCTCTCGACTTCTCGCG-3’
Human 28S rRNA forward (1-18 nt of 28S rRNA)
5’-CGCGACCTCAGATCAGAC-3’
Human 28S rRNA reverse (complementary to
nucleotides 199-216 of the 28S rRNA)
5’-GGCCTCGATCAGAAGGAC-3’
5’ and 3’ end mapping of sense and
antisense LSU γ rRNAs
Ambion adapter specific outer primer
5’-GCTGATGGCGATGAATGAACACTG-3’
Ambion adapter specific inner nested primer
5’CGCGGATCCGAACACTGCGTTTGCTGGCTTTGATG-3’
Oligo-dT primer
5’-CGGGATCCTTTTTTTTTTTTTTTTTT-3’
1
Overexpression constructs
Leishmania infantum LSU 1.2 forward
5’-GGTTAGGACGAAGCTTATG-3’
Leishmania infantum LSU 1.2 reverse
5’-CCCAAGCTTACTTGGATGCATCACAAAC-3’
LinHEL67 ORF forward
5’-GCTCTAGAATGTATAAGAATCAGGCGCAAC-3’
LinHEL67 ORF reverse
5’-CCAAGCTTCTACTGACCAAAGACGTCAGATCG-3’
Gene targeting constructs
HYG targeting cassette
Primers for amplification of the 5’flank region of the
LinHEL67 gene
5’flank of HEL67 forward
5’-AGTATAGCAGGGATGGAGG-3’
5’GGTGAGTTCAGGCTTTTTCATGATTCCTGCTTAGCAAACG-3’
5’flank of HEL67 reverse
Primers for hygromycin gene amplification
HYG forward
5’-ATGAAAAAGCCTGAACTCACC-3’
HYG reverse
5’ACACGGAGTTTTACTACTCCATCTATTCCTTTGCCCTCGGAC
GAG-3’
Primers for amplification of the 3’ flank region of the
LinHEL67 gene
3’flank HEL67 forward
5’-ATGGAGTAGTAAAACTCCGTGT-3’
5’-GACAGAGAAAAGCGTGTGTG-3’
3’flank HEL67 reverse
NEO targeting cassette
Primers for amplification of the 5’flank region of the
LinHEL67 gene
5’flank HEL67 forward
5’-AGTATAGCAGGGATGGAGG-3’
5’-GGTGAGTTCAGGCTTTTTCATGATTCCTGCTTAGCAAACG-3’
5’flank HEL67 reverse
Primers for neomycin gene amplification
NEO forward
5’-ATGATTGAACAAGATGGATTG-3’
NEO reverse
5’ACACGGAGTTTTACTACTCCATTCAGAAGAACTCGTCAAGA
AG-3’
2
Supplemental Figure Legends
Supplemental Figure S1. Antisense RNA complementary to all ribosomal RNA species is
naturally produced in Leishmania. (A) Single-stranded (SS)-RT-PCR was performed for both
sense and antisense rRNA using reverse and forward primers, respectively (see Supplementary
Table 1). The SS-cDNA was prepared using forward primers for antisense RNA and reverse
primers for sense RNA against 18S rRNA (298 bp), 5.8S rRNA (262 bp) and LSU α (28S α)
rRNA (266 bp). Arrow marks indicate amplified fragments obtained for respective sense and
antisense RNA. -RT, cDNA was prepared without RT enzyme, (+), genomic DNA was used as a
template for control. (B) Northern blot hybridization was carried out to detect antisense RNA
complementary to each of the rRNAs mentioned above using single-stranded sense riboprobes.
Supplemental Figure S2. Mapping of the ends of mature sense and antisense LSU γ rRNAs
and derived fragments. (A) Pairwise sequence alignments of sLSU γ and asLSU γ rRNA
complementary regions mapped by 5'-RACE to detect 5' ends and polyA polymerase strategy for
detecting 3' ends. The sequence of six clones (three for the sense and three for the asLSU γ
rRNA) is shown here. (B) Schematic diagram of complementary ends are depicted with arrow
marks and doted lines. The solid line indicates the complementary ends and dotted lines indicate
the fragments with one nucleotide overhang. Numbers 1, 57, 150, 213 indicate positions in the
sLSU γ rRNA, and -1, -58, -151 and -213 positions in the asLSU γ RNA.
Supplemental Figure S3. The 5′ ends of the sense LSU γ rRNA-derived fragments were mapped
by 5′ RACE using Ambion RLM-5′ RACE kit. LSU γ rRNA fragments were aligned with the
mature sense LSU γ rRNA (213 nt) by Clustalw method using Bioedit. A representative number
of sequenced clones is shown here.
3
Supplemental Figure S4. (A, B upper panel) Leishmania lysates from unstressed (upper panel)
and temperature (37°C)-stressed (bottom panel) promastigotes for 24 hrs were loaded onto linear
15-45% (w/w) sucrose gradient and fractionated by ultracentrifugation and by continuously
recording absorbance at 254 nm. The small ribonuclear protein complexes (RNPs), 40S and 60S
ribosomal subunits, 80S monosome and polysome peaks are indicated. (A, B bottom panels)
Effect of temperature stress on sense (s) and antisense (as) LSU γ rRNA fragmentation. Total
RNA extracted from unstressed and temperature-stressed L. infantum promastigotes was isolated
from sucrose gradient fractions corresponding to RNPs (F1 to F2), 40S subunit (F3), 60S subunit
(F4), 80S monosome (F5 and F6) and polysomes (F7 to F12), resolved on 10% urea-acrylamide
gel and analyzed by northern blot hybridization with the 173 nt ss-DNA probe corresponding to
nucleotides 41-213 of the sense LSU γ rRNA and recognizing the asLSU γ RNA or with the
5′end-labeled 42 nt oligonucleotide probe complementary to nucleotides 172-213 of the sense
LSU γ rRNA (membrane exposure for 2 hrs). The northern blot data obtained with the unstressed
parasites are also shown in Figure 1D and 1E but we have included them also here to facilitate
direct comparisons. Sense and antisense LSU γ rRNA fragments are marked within a bracket and
the mature sense and antisense LSU γ rRNAs are indicated with an arrow. Plain arrows indicate
sense or antisense LSU γ rRNA fragments with a similar length between unstressed and heatstressed parasites. Open arrows indicate sense or antisense LSU γ rRNA fragments with a
different length between unstressed and heat-stressed parasites corresponding most likely to new
cleavage events.
Supplemental Figure S5. High concentrations of cytotoxic but not apoptosis-inducing drugs
failed to induce antisense LSU γ RNA fragmentation. (A) Primer extension analysis on total
RNA of L. infantum amastigotes treated with high concentrations of G418 (125 µg/ml) and
paramomycin sulphate (750 µg/ml) for 24 hrs using a primer corresponding to nucleotides 101118 of sLSU γ rRNA to detect asLSU γ cleavage products. Miltefosine (MF)-treated samples
were used as a positive control for the induction of asLSU γ RNA fragmentation. The size of
cleavage fragments was compared with an end-labeled ΦX174 DNA/HinfI dephosphorylated
DNA marker (Promega) (M). (B) Primer extension analysis as described in A but using a primer
complementary to nucleotides 96-213 of sLSU  rRNA to detect sLSU γ rRNA cleavage
4
products. MF-treated samples were used as a positive control for the induction of sLSU γ rRNA
degradation.
Supplemental Figure S6. Effect of miltefosine treatment on general translation in
Leishmania. Representative A254 nm polysome profiling analysis of 15% to 45% sucrose density
ultracentrifugation of L. infantum untreated (A) and miltefosine (MF: 40 µM)-treated
promastigotes (B) for 24 h. The 40S and 60S ribosomal subunits, 80S monosome and polysome
peaks are indicated. The MF treatment leads to the disappearance of ribosomal peaks and
translation inhibition due to the induction of apoptosis.
Supplemental Figure S7. LSU rRNA degradation appears generally at the same time
interval than antisense LSU  RNA fragmentation. Log-phase L. infantum amastigotes (OD
0.4) were treated with MF 20 µM for 1 to 8 h. The RNA was isolated by Trizol and used for
primer extension analysis to detect both asLSU γ RNA fragmentation (A) (forward primer
corresponding to nucleotides 101-118 of LSU γ rRNA; see Supplementary Table 1) and sense
LSU γ rRNA degradation (B) (reverse primer complementary to nucleotides 196-213 of LSU γ
rRNA; see Supplementary Table 1).
Supplemental Figure S8. MS/MS analysis of proteins bound to both the sense and antisense
LSU γ rRNAs as determined by UV-crosslinking. The mass-spectrometry (MS/MS) results of
UV-crosslinked proteins bound to the sense LSU γ rRNA analyzed by Scaffold 3. An ATPdependent RNA helicase of 67 kDa encoded by LinJ.32.0410 gene (TriTrypDB;
http://tritrypdb.org) (previous systematic name was LinJ32_V3.0770), which belongs to a highly
conserved subfamily of DEAD-box helicases, is shown in blue box with a solid arrow mark.
Supplemental Figure S9. Sequence alignment of the Leishmania ATP-dependent DEAD-box
helicase HEL67 with homologues from other eukaryotes. Sequence comparison of L. infantum
HEL67 with corresponding homologues using ClustalW2. The ClustalW2 aligned sequences were
used for box shade by BOXSHADE 3.21 program. The L. infantum HEL67 sequence was
compared with the C. elegans Vbh-1 homologue, Saccharomyces cerevisiae Ded1 homologue,
DEAD-box protein homologue of Drosophila melanogaster (VASA), Mus musculus VASA
5
homologue, and Neurospora crassa CYT-19 homologue. Identical amino acids in all sequences
are shaded in black. Black bar underlined regions have DEAD-box conserved amino acids.
ATPase A motif (AXTGXGKT) is marked by a red bar, SAT region (critical role unwinding
helicase action) is marked by a blue bar and the region involved in ATP hydrolysis is underlined
by a green bar. Gaps denoted by dashes have been introduced into the output by ClustalW in
order to align the sequences.
6