GENOTYPING OF SINGLE NUCLEOTIDE POLYMORPHISMS
USING LIGHTCYCLER GREEN-1
Michael Liew1, Robert Pryor2, Robert Palais2, Cindy Meadows1, Maria Erali1, Elaine
Lyon1, 2 and Carl Wittwer1, 2.
1
Institute for Clinical and Experimental Pathology, ARUP, Salt Lake City UT 841081221, USA.
2
Department of Pathology, University of Utah School of Medicine, Salt Lake City, UT
84132.
Address for correspondence:
Michael Liew
ARUP
Institute for Clinical and Experimental Pathology
500 Chipeta Way
Salt Lake City, UT 84108-1221
USA
Phone: (801) 583 2787 ext. 2179
Fax: (801) 584 5114
E-mail: liewm@aruplab.com
Running title: SNP genotyping using LCG-I
Keywords: PCR, MTHFR, Prothrombin, Factor V, Hemochromatosis
1
ABSTRACT
Up until now genotyping single nucleotide polymorphisms (SNPs) by melting curve
analysis has only been possible by using probes. The recent invention of the fluorescent
dye, LightCycler Green I (LCG-I), that enables heteroduplex visualization during
melting curve analysis now makes it possible to identify SNPs using real time
technology and high resolution melting analysis. The aim of this study was to
determine how effective LightCycler Green I is at identifying the different combinations
of SNPs. Four combinations of SNPs were determined to cover all possible
combinations; A/C, A/G, A/T and C/G. These changes were covered by the following
cases; MTHFR1298 (A/C), Factor II, Factor V, MTHFR677 (A/G), hemoglobin (A/T)
and H63D (C/G). Genotypes of all samples were previously identified by an alternative
method of genotyping based upon methods utilising labelled probes. In all cases it was
possible to distinguish the heterozygotes from the wild type and homozygous samples
based upon the heteroduplex peak that is detected. Homozygotes and wild type samples
were possible to differentiate based upon melting temperature, however the A/T and
C/G transitions were not differentiable unless spiked with a wild type sample and a
heteroduplex peak called. This procedure simplifies and reduces the cost of genotyping
SNPs by melting curve analysis.
2
INTRODUCTION
It has become increasingly clear that certain single nucleotide polymorphisms (SNPs) are
often associated with an increased risk for certain diseases. For example, the SNP
G1691A in Factor V (Leiden factor) leads to an increased risk of thromboembolic disease
[1, 2]. Another example is SNP C677T found in methylenetetrahydrofolate reductase
(MTHFR), where homozygosity is associated with intermediate and mild
hyperhomocystinemia and an increased risk for premature cardiovascular disease [3-5].
There are a variety of ways to identify SNPs [6]. Restriction fragment length
polymorphism (RFLP) has probably been around the longest and is still currently widely
used [7-9]. Real time polymerase chain reaction (PCR) and labelled probes have been
used extensively and successfully [10, 11]. Heteroduplex analysis using denaturing high
performance liquid chromatography (dHPLC)[12, 13] and temperature gradient capillary
electophoresis (TGCE)[14] has also provided a good screening tool for SNP detection.
Direct sequencing is also an option, although is not a good tool for high throughput
approaches. Similarly, pyrosequencing is another novel method of SNP genotyping [1517]. Finally SNPs have also been detected using mass spectrometry, in particular with
matrix assisted laser desorption/ionization time-of-flight (MALDI-TOF) instrumentation
[18, 19].
With regards to genotyping by real time PCR using labelled probes, the greatest
advantage it has is that the signal is very specific. The biggest disadvantage is the cost of
3
the labelled probes. With the advent of better discriminating DNA dyes, there is the real
possibility that genotyping can be performed without labelled probes. This would make
the assays more affordable. The disadvantages of dyes though is that it makes it more
difficult to perform multiplex analysis and non specific products such as primer dimers
can still be seen and can make data interpretation more difficult.
LightCycler Green 1 is a new DNA dye that unlike SYBR green I is able to identify
heteroduplexes by melting curve analysis [20]. Therefore it makes it possible to
genotype SNPs by heteroduplex detection present in heterozygous samples. If amplicons
are designed to maximize the difference in melting temperature of wild type and
homozygous samples, these also can be genotyped by melting curve analysis. The first
aim of this project was to characterize the melting curves of different combinations of
SNPs. The second aim was to design the amplicons as small as possible to maximize the
difference between wild type and homozygous samples. The amplicons were designed
using software specifically written to choose primers that flank the known SNP, therefore
keeping the amplicon size limited to about 50bp.
METHODS
Human samples
Anti-coagulated human blood was collected and shipped to ARUP at 2-8ºC. Once
obtained, DNA was extracted from the blood using the MagnaPure instrument according
to the manufacturer’s instructions. All samples that were obtained were de-identified
according to HIPAA regulations. Some of the samples used in this study were submitted
4
to ARUP Laboratories for mutation detection in the following markers; prothrombin
G20210A, Leiden factor (factor V) G1691A, methylenetetrahydrofolate reductase
(MTHFR) A1298C, and hemochromatosis C187G (H63D). Some of the samples were
submitted to ARUP for hemoglobin S assessment, while the remaining samples were
dried bloodspots obtained from NeoGen screening (Pittsburgh, PA). The last set of
samples were used for the detection of the SNPs G16A (HbC) and A17T (HbS) found in
-globin. It was possible to obtain DNA samples from at least three different individuals
for each genotype for each marker. The only exception was for the -globin markers.
No samples were identified that were mutant for HbC, and there were only single
samples available that were HbS mutant and compound heterozygotes for both. 104
samples (35 wild type, 35 heterozygote, 34 mutant) previously tested for factor V at
ARUP obtained for a concordance study.
Primer design
To make primer design as automated, standardized and rigorous as possible, primers were
designed using the software called SNPWizard. Sequence information regarding the SNP
is input into the program. The software than chooses primers that immediately flank the
SNP. Primer design is based upon primer melting temperature and mispriming
parameters. Misprimes are determined by two conditions. The first condition ensures
that the designed primers will not re-anneal with any section of the input sequence to
prevent the formation of alternative amplicons. The second condition ensures that the
designed primers will not form primer dimers that would interfere with the assay.
Melting temperature calculations are based upon implementation of the nearest-neighbor
5
thermodynamic models described previously [21-28]. Oligonucleotides were obtained
from Integrated DNA Technologies (Coralville, IA), Idaho Technologies Biochem (Salt
Lake City, UT), and Qiagen Operon (Alameda, CA).
Systematic study of SNP genotyping with plasmids
Engineered plasmids were used to systematically study melting curve genotyping of all
possible single base changes. The plasmids (DNA Toolbox, BioWhitaker Molecular
Applications, Rockland, ME) contained either A, C, G, or T at a defined position amid
40% GC content [29]. Primers with a Tm of 60 +/- 1°C were immediately adjacent to the
polymorphic position. Reaction conditions consisted of 50mM Tris, pH 8.3, 500 g/ml
BSA, 3 mM MgCl2, 200 M of each dNTP, 0.4 U Taq Polymerase (Roche), 1x
LightCycler Green I (LCG-I)(Idaho Technologies, Salt Lake City, UT) and 0.5 M each
primer with water up to 10l. The DNA templates were used at 108 copies and PCR was
performed with 35 cycles of 95°C with no hold, 55°C for 1s.
SNP genotyping of genomic DNA from clinical samples
PCR was performed in 10l volumes in a LightCycler (Roche Applied Systems,
Indianapolis, IN) with programmed transitions of 20°C/s unless otherwise indicated.
Samples were amplified using the LightCycler FastStart DNA Master Hybridization
Probe kit (Roche) according to manufacturer’s instructions. Reaction mixtures consisted
of approximately 25-50ng of genomic DNA as template, 3mM MgCl2, 1xLightCycler
FastStart DNA Master Hybridization Probes, 1xLightCycler Green I (Idaho
Technologies), 0.5M forward and reverse primers and 0.01U/l Escherichia coli (E.
6
coli) uracil N-glycosylase (Roche) with water up to 10l. Reactions were also overlayed
with 5l of molecular grade mineral oil to minimize evaporation. It also was important
to keep the volume of template limited to 10% of the reaction mix to minimize the
variation seen in the melting curves. In the case of -globin, the reaction mixture was the
same used for amplification of the plasmids. See Table 1 for the list of primers, amplicon
sizes and specific detail on cycle number and annealing temperature used for each SNP.
For all of the SNPs amplified except -globin, the following specifics applied. The PCR
was initiated with a 10min hold at 50C for contamination control by UNG and a 10min
hold at 95C for activation of the hot-start Taq. The numbers of cycles were kept
between 31 and 40 cycles. The thermal cycles consisted of 2 steps between 85C and the
appropriate annealing temperature without any holds. The thermal cycling conditions for
-globin amplification were initiated using a 10sec hold at 94C followed by cycling
between 90C for 0sec and 60C for 1sec. The ramp rates were kept at 20C/s unless
otherwise stated.
Melting Curve Acquisition
Melting analysis was performed either on the LightCycler immediately after cycling, or
on a high-resolution melting instrument (HR-1, Idaho Technology, Salt Lake City, UT).
When the LightCycler was used, the samples were first heated to 94°C C at 20°C/s,
cooled to 40°C at 20°C/s and held at 65°C for 20s, then melted at 0.05°C/s with
continuous acquisition of fluorescence until 85°C and rapidly cooled to 40°C at 20°C/s.
The HR-1 is a single sample instrument that surrounds one LightCycler capillary with an
7
aluminum cylinder. The system is heated by Joule heating through a coil wound around
the outside of the cylinder. Sample temperature is monitored with a thermocouple also
placed within the cylinder and converted to a 16-bit digital signal. Fluorescence is
monitored by epi-illumination of the capillary tip [18] that is positioned at the bottom of
the cylinder and also converted to a 16-bit signal. Approximately 50 data points are
acquired for every C. Prior to high-resolution melting, samples amplified in the
LightCycler were heated to 94°C at 20°C/s in the LightCycler and rapidly cooled to 40°C
at 20°C/s unless stated otherwise. The LightCycler capillaries were then transferred one
at a time to the HR1 and heated at 0.3°C/s. Plasmid samples were analyzed between
72C and 88C, -globin analyzed between 67C and 81C and all remaining SNPs
between 65C and 85C.
Melting Curve Analysis
LightCycler and high-resolution melting data were analyzed with custom software
written in LabView. Fluorescence vs temperature plots were normalized between 0 and
100 percent by first defining linear baselines before and after the melting transition of
each sample. Within each sample, the fluorescence of each acquisition was calculated as
the percent fluorescence between the top and bottom baselines at the acquisition
temperature. In some cases, derivative melting curve plots were calculated from the
Savitsky-Golay polynomials at each point [19]. Savitsky-Golay analysis used a seconddegree polynomial and a data window including all points within a 1°C interval. Melting
temperatures were obtained by finding the highest dF/dT value on the derivative plots.
All curves were plotted using Microsoft Excel.
8
Spiking experiments
Due to the difficulty in discriminating H63D wild type from mutant, heteroduplex
formation had to be induced by spiking amplicon with H63D wild type amplicon.
Therefore, if a mutant was present heteroduplexes would be seen during analysis of the
melting curves. Spiking was carried out in two ways. The first way was to add spike to
the amplicons once the PCR reactions were complete. In this case 1l of a known H63D
wild type was added to the PCR reactions of samples that looked like either a wild type
or mutant. The mixtures were then heated to 94°C C at 20°C/s and cooled to 40°C at
20°C/s using the LightCycler and analyzed on the HR1.
The second method was to add the spike to the PCR reaction. In this method,
approximately 5ng of genomic DNA from a H63D wild type sample was added to the
PCR reactions. A duplicate set of samples without spike needs to be run at the same
time. PCR amplifications are done as described followed by melting curve analysis.
Then melting curves with and without spike need to be compared in order to be
genotyped. Samples with no heteroduplexes in either are wild type, samples with
heteroduplexes only in the presence of spike are mutants, and samples with
heteroduplexes in both are heterozygous.
Genotyping using the normalized melting curves
To determine if the HR1 assay was comparable to the assays currently used, 104 samples
of factor V were tested and compared to results from real time PCR assays used at ARUP
9
laboratories for mutation detection. A smaller group of 19 samples (6 wild type, 7
heterozygotes, 6 mutants) were used to determine how much variation could be seen
within each genotype. Then samples were chosen from each of the genotypes to use as a
cutoff control using the normalized melting curves (Figure 1). In the case of the wild
type and mutant genotypes, controls were chosen such that they were as close together as
possible. Then, to make the genotype call, the unknown curves had to firstly have the
same shape as one of the controls. Wild type genotypes were called if the curves were
closest to or had a higher melting temperature than the wild type control. Mutant
genotypes were called if the curves were closest to or had a lower melting temperature
than the mutant control. Heterozygote genotypes were called based upon being parallel
with the heterozygote control, and could fall on either side of it. Derivative curves were
also used to see heteroduplex peaks in the heterozygous samples.
RESULTS
SNP analysis of the DNA toolbox
SNP analysis of the results from the DNA toolbox demonstrate that each type of
heterozygous SNPs and homozygous SNPs has a distinctive normalized melting curve on
the HR1 (Figure 2). The homozygous SNPs separate very well. The AA homozygous
SNP melts first followed by TT, GG then CC (Figure 2A). In addition, there is a greater
separation between the AA/TT homozygous SNPs when compared to the GG/CC
homozygous SNPs. There is one AA SNP that overlaps the TT SNPs. The normalization
process amplifies subtle differences seen in the different melting curves, so this is
believed to be caused by sample to sample variation.
10
With the exception of 2 SNPs, the heterozygous SNPs separated very well from each
other (Figure 2B). The AT heterozygous SNP melted first, followed by the GT. The AG
and CT SNPs melted next and had overlapping curves. These were then followed by AC,
and finally by CG. It is also possible to differentiate a homozygous SNP from a
heterozygous SNP based upon curve shape (Figure 2C). The normalized curves of
homozygous SNPs, has only homoduplexes which leads them to maintain a relatively flat
plateau prior to melting. In contrast, the heterozygous SNPs has a more rapid decrease
in fluorescence initially caused by the melting of heteroduplex DNA followed by the
melting of the homoduplex DNA.
SNP analysis of clinical samples
The data acquired using the HR-1 was of a better resolution when compared to the data
acquired by the LightCycler (Figure 3). In addition, the HR1 was far better at detecting
heteroduplexes. In the figure shown, the the heteroduplexes detected by the LightCycler
were distinctive 1 cycle later than the HR1. In other cases, where the heteroduplex is
only a slight shoulder, the LightCycler has difficulty picking those up (data not shown).
One of the disadvantages that was observed using this method is that of contamination.
Since the amplicons are so small, preventing contamination was a challenge, and was
difficult to eliminate.
With the exception of H63D, all genotypes were distinguishable from each other in the
SNPs genotyped (Figure 4). In all six cases, the heterozygotes were very distinguishable
11
from the mutant and wild type samples. In addition, for -globin, a sample that was a
compound heterozygote for HbC and HbS was distinguishable as well (Figure 4E). With
the exception of the H63D, wild type and mutant samples were very well separated and
could be genotyped. In addition, for -globin, a sample that was a mutant for HbS was
clearly distinguishable as well (Figure 4E). SNP analysis of the 104 factor V samples
and all of the markers genotyped using LightCycler Green I and HR-1 were 100%
concordant with the results obtained by ARUP (Table 2).
The most difficult marker to differentiate wild type from mutant was H63D. Based upon
the DNA toolbox result it should have been resolvable, but nearest neighbour
thermodynamics also has a role to play. This appears to be the case because the H63D
wild type (CC) has a slightly lower melting temperature compared to the mutant (GG)
(Figure 4D), which is contradictory to the DNA toolbox result (Figure 2A).
In order to discriminate the H63D wild type and mutant samples, 2 approaches were
implemented. The first approach involved spiking the wild type or mutant samples with
a known wild type sample following PCR amplification. The presence of a heteroduplex
can be clearly seen when the wild type and mutant amplicons are mixed together (Figure
5A). The second approach involved spiking the PCR reaction mixture with a known
amount of wild type sample then proceeding with amplification (Figure 5B). Samples are
easily genotyped either having no heteroduplex curves (wild type), one heteroduplex
curve (mutant) or 2 heteroduplex curves (heterozygous).
12
DISCUSSION
In this report we expand on what has previously been found using LightCycler Green I
and the HR1 instrument for SNP genotyping. Keeping the amplicon limited to 40-50bp
by using primers that immediately flank the known SNP we were able to successfully
discriminate different combinations of SNP using engineered plasmids from a DNA
toolbox [29]. The results compare favorably with what is known about the expected
behaviour of nucleotides when melted. It has been known for a long time that adenine
and thymine have a lower melting temperature when compared to guanine and cytosine
and this was reflected in the high resolution melting curves of homozygous SNPs (ref).
Heterozygotes were also melted previously, and these results were in agreement with
those (ref).
We were also able to successfully genotype the following SNPs that are used as clinical
markers; G20210A in prothrombin, G1691A in factor V, A1298C in MTHFR and C187G
in hemochromatosis. These results were 100% concordant with tests that ARUP
routinely performs. These SNPs have been extensively studied using real time PCR and
fluorescent probes (ref). All of these studies have demonstrated 100% concordance when
compared to established methods of SNP genotyping.
It appears that a substitution involving a G↔C or an A↔T may make it more difficult to
distinguish a wild type from a mutant sample in this study. The additional approaches
used in this report were both successful, but each has their own disadvantages. The
disadvantage for spiking post-amplification was that the PCR tubes require opening and
13
therefore contamination is an issue. The disadvantage for spiking pre-amplification is
that the number of tubes needed per run is doubled, therefore increasing cost and
reducing throughput. However, the advantages and benefits would have to be weighed
up to decide which approach would be used by a particular laboratory.
The results here describe a rapidly developing method for genotyping SNPs. The design,
methodology and analysis are simple and can be applied to a wide variety of targets. The
greatest advantages of this assay are that the amplification is rapid due to the small
amplicon sizes, there is high resolution between wild type, heterozygous and
homozygous mutant samples and is inexpensive due to the elimination of labelled probes.
The biggest disadvantage encountered with this particular study were problems with
contamination. This problem can be greatly reduced by ensuring that purified template
DNA has a concentration of at least 50ng/l, optimizing the annealing temperature and
by adjusting the number of cycles to reduce the contamination while amplifying enough
product to obtain distinct melting curves for each genotype. In addition, in this study, by
using a fluorescence intensity cutoff it was possible to distinguish it from a specimen that
does contain template DNA.
There is no question about the importance of SNP genotyping. The assay described here
provides a simple, rapid and inexpensive method for doing so. It provides a solid assay
for genotyping SNPs, but also could be applied to high throughput screening of SNPs.
This is a useful tool that will greatly help in the detection of SNPs.
14
ACKNOWLEDGEMENTS
The authors would like to thank Jamie Williams for her technical assistance.
REFERENCES
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
Bertina, R.M., et al., Mutation in blood coagulation factor V associated with
resistance to activated protein C. Nature, 1994. 369(6475): p. 64-7.
Voorberg, J., et al., Association of idiopathic venous thromboembolism with
single point-mutation at Arg506 of factor V. Lancet, 1994. 343(8912): p. 1535-6.
Deloughery, T.G., et al., Common mutation in methylenetetrahydrofolate
reductase. Correlation with homocysteine metabolism and late-onset vascular
disease. Circulation, 1996. 94(12): p. 3074-8.
den Heijer, M. and M.B. Keijzer, Hyperhomocysteinemia as a risk factor for
venous thrombosis. Clin Chem Lab Med, 2001. 39(8): p. 710-3.
Kluijtmans, L.A., et al., Thermolabile methylenetetrahydrofolate reductase in
coronary artery disease. Circulation, 1997. 96(8): p. 2573-7.
Kwok, P.Y. and X. Chen, Detection of single nucleotide polymorphisms. Curr
Issues Mol Biol, 2003. 5(2): p. 43-60.
Ochi, M., et al., The absence of evidence for major effects of the frequent SNP
+299G>A in the resistin gene on susceptibility to insulin resistance syndrome
associated with Japanese type 2 diabetes. Diabetes Res Clin Pract, 2003. 61(3): p.
191-8.
Ronai, Z., M. Sasvari-Szekely, and A. Guttman, Miniaturized SNP detection:
quasi-solid-phase RFLP analysis. Biotechniques, 2003. 34(6): p. 1172-3.
Woo, J.G., et al., The -159 C-->T polymorphism of CD14 is associated with
nonatopic asthma and food allergy. J Allergy Clin Immunol, 2003. 112(2): p.
438-44.
Lay, M.J. and C.T. Wittwer, Real-time fluorescence genotyping of factor V Leiden
during rapid-cycle PCR. Clin Chem, 1997. 43(12): p. 2262-7.
von Ahsen, N., et al., Rapid detection of prothrombotic mutations of prothrombin
(G20210A), factor V (G1691A), and methylenetetrahydrofolate reductase
(C677T) by real-time fluorescence PCR with the LightCycler. Clin Chem, 1999.
45(5): p. 694-6.
Lilleberg, S.L., In-depth mutation and SNP discovery using DHPLC gene
scanning. Curr Opin Drug Discov Devel, 2003. 6(2): p. 237-52.
Wolford, J.K., et al., High-throughput SNP detection by using DNA pooling and
denaturing high performance liquid chromatography (DHPLC). Hum Genet,
2000. 107(5): p. 483-7.
Li, Q., et al., Integrated platform for detection of DNA sequence variants using
capillary array electrophoresis. Electrophoresis, 2002. 23(10): p. 1499-511.
Fakhrai-Rad, H., N. Pourmand, and M. Ronaghi, Pyrosequencing: an accurate
detection platform for single nucleotide polymorphisms. Hum Mutat, 2002. 19(5):
p. 479-85.
15
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
Ronaghi, M., Pyrosequencing for SNP genotyping. Methods Mol Biol, 2003. 212:
p. 189-95.
Hochberg, E.P., et al., A novel rapid single nucleotide polymorphism (SNP)-based
method for assessment of hematopoietic chimerism after allogeneic stem cell
transplantation. Blood, 2003. 101(1): p. 363-9.
Sauer, S. and I.G. Gut, Genotyping single-nucleotide polymorphisms by matrixassisted laser-desorption/ionization time-of-flight mass spectrometry. J
Chromatogr B Analyt Technol Biomed Life Sci, 2002. 782(1-2): p. 73-87.
Wise, C.A., et al., A standard protocol for single nucleotide primer extension in
the human genome using matrix-assisted laser desorption/ionization time-of-flight
mass spectrometry. Rapid Commun Mass Spectrom, 2003. 17(11): p. 1195-202.
Wittwer, C.T., et al., High-resolution genotyping by amplicon melting analysis
using LCGreen. Clin Chem, 2003. 49(6 Pt 1): p. 853-60.
Allawi, H.T. and J. SantaLucia, Jr., Nearest neighbor thermodynamic parameters
for internal G.A mismatches in DNA. Biochemistry, 1998. 37(8): p. 2170-9.
Allawi, H.T. and J. SantaLucia, Jr., Thermodynamics of internal C.T mismatches
in DNA. Nucleic Acids Res, 1998. 26(11): p. 2694-701.
Allawi, H.T. and J. SantaLucia, Jr., Nearest-neighbor thermodynamics of internal
A.C mismatches in DNA: sequence dependence and pH effects. Biochemistry,
1998. 37(26): p. 9435-44.
Allawi, H.T. and J. SantaLucia, Jr., Thermodynamics and NMR of internal G.T
mismatches in DNA. Biochemistry, 1997. 36(34): p. 10581-94.
Bommarito, S., N. Peyret, and J. SantaLucia, Jr., Thermodynamic parameters for
DNA sequences with dangling ends. Nucleic Acids Res, 2000. 28(9): p. 1929-34.
Peyret, N., et al., Nearest-neighbor thermodynamics and NMR of DNA sequences
with internal A.A, C.C, G.G, and T.T mismatches. Biochemistry, 1999. 38(12): p.
3468-77.
SantaLucia, J., Jr., H.T. Allawi, and P.A. Seneviratne, Improved nearest-neighbor
parameters for predicting DNA duplex stability. Biochemistry, 1996. 35(11): p.
3555-62.
SantaLucia, J., Jr., A unified view of polymer, dumbbell, and oligonucleotide DNA
nearest-neighbor thermodynamics. Proc Natl Acad Sci U S A, 1998. 95(4): p.
1460-5.
Highsmith, W.E., Jr., et al., Use of a DNA toolbox for the characterization of
mutation scanning methods. I: construction of the toolbox and evaluation of
heteroduplex analysis. Electrophoresis, 1999. 20(6): p. 1186-94.
16
FIGURE LEGEND
Figure 1. Schematic representation of method used to confirm genotypes of concordance
study. Thick line-wild type (WT), thin line-mutant (MUT), and open squaresheterozygous (HET). The labelled arrows indicate where curves must lie in order to be
designated a specific genotype.
Figure 2. Normalized high resolution melting curves of different types of SNPs
amplified from the DNA toolbox. A) Homozygous SNPs, B) Heterozygous SNPs and C)
Homozygous and heterozygous SNPs. Curves are all shown in triplicate.
Figure 3. Derivatized melting curve analysis of Factor V samples comparing the
LightCycler (A) to the HR1 (B). Thick line: wild type(wt), thin line: heterozygous(het),
line with squares: mutant(mut) and gray line: no template control.
Figure 4. Normalized high resolution melting curves from prothrombin(A), factor V(B),
MTHFR1298(C), H63D(D) and HbC/HbS(E). Each genotype is shown in triplicate, with
each replicate represented by either a square, triangle or diamond. Grey filled symbols
denote wild type samples, black filled symbols denote mutant samples and the open
symbols denote the heterozygous samples.
17
Table 1. Primer sequences, amplicon size and thermal cycling conditions used for each
clinical marker.
PRIMER SEQUENCE (AMPLICON
THERMAL
5’3’
SNP
SIZE)
CYCLING
Prothrombin
5’3’
3’5’
GTTCCCAATAAAAGTGACTCTCAG
GCACTGGGAGCATTGAGG (45bp)
Ta=63ºC, 39
cycles.
Factor V
5’3’
3’5’
CAGATCCCTGGACAGG
CAAGGACAAAATACCTGTATTC
(43bp)
Ta=55ºC, 32
cycles.
MTHFR A1298C
5’3’
3’5’
GGAGGAGCTGACCAGTGAA
AAGAACAAAGACTTCAAAGACACTT
(46bp)
Ta=55ºC, 35
cycles.
H63D
5’3’
3’5’
CCAGCTGTTCGTGTTCTATGAT
CACACGGCGACTCTCAT(40bp)
Ta=63ºC, 35
cycles.
-globin
5’3’
3’5’
Ta=60ºC, 35
cycles.
Table 2. Marker list with number of samples within each genotype and genotypes
identified by ARUP and using LightCycler Green I (LCG-I) and the HR1
instrument(HR1).
MARKER
Factor V
GENOTYPES
Wild type
Heterozygous
Mutant
ARUPa
35
35
34
LCG-I/HR1b
35
35
34
Prothrombin
Wild type
Heterozygous
Mutant
8
3
11
8
3
11
MTHFR1298
Wild type
Heterozygous
Mutant
7
7
7
7
7
7
H63D
Wild type
6
6
Heterozygous
6
6
Mutant
6
6
a Number of samples identified by ARUP as a particular genotype
b Number of samples identifed as a particular genotype using LightCycler Green I and
HR1 instrument.
18
19