Supplemental Figure Legend
Figure S1. Deletion of FoxO1/3/4 in primary MEFs. Relative expression levels of FoxO1/3/4
were detected by quantitative RT-PCR in FoxO1/3/4 L/L, Rosa26-CreERT2 MEFs with or
without 4OHT treatment.
Figure S2. FoxO deletion does not affect amino acid or serum deprivation-induced
mTORC1 inactivation. (A) FoxO WT and KO MEFs were cultured in medium with or without
amino acids, or re-added with amino acids after amino acid deprivation, and then subjected to
western blotting analysis. (B) FoxO WT and KO MEFs were cultured in serum free medium for
different hours as indicated, and then subjected to western blotting analysis.
Figure S3. FoxO regulation of S6K and S6 phosphorylation is mTORC1-dependent. FoxO
WT and KO MEFs were cultured in glucose containing or free medium, with or without 20 nm
rapamycin, for 24 hours and subjected to western blotting analysis.
Figure S4. FoxO regulation of energy stress-induced apoptosis is mTORC1-independent.
(A) Representative FACS analysis showing Annexin V staining of FoxO WT and KO MEFs
which were cultured in glucose containing or free medium with or without rapamycin treatment.
(B) Bar graph showing the percentages of Annexin V positive cells of FoxO WT and KO MEFs
which were cultured in glucose containing or free medium with or without rapamycin treatment.
Figure S5. The representative images of various RCC cells after glucose deprivation for 48
hours.
Figure S6. FoxO knockdown renders cells more resistant to glucose starvation-induced
apoptosis. Bar graph showing the percentages of Annexin V positive cells of UOK101 cells
infected with control shRNAs or FoxO1 and FoxO3 shRNAs cultured in glucose free medium
for different hours as indicated.
Figure S7. FoxO knockdown does not affect energy stress-induced AMPK, Raptor or TSC2
phosphorylation. 786-O cells infected with control shRNAs or FoxO1 and FoxO3 shRNAs
1
were treated with 1mM AICAR with different hours, and subjected to western blotting as
indicated.
Figure S8. FoxO regulation of BNIP3 expression in response to energy stress is mTORC1independent. FoxO WT and KO MEFs were cultured in glucose containing or free medium,
with or without 20 nm rapamycin, for 24 hours and subjected to western blotting analysis to
detect BNIP3 expression. The S6 and S6K phosphorylation levels are shown in Figure S3.
Figure S9. FoxO and BNIP3 are not involved in energy stress-induced autophagy. (A and
B) FoxO WT and KO MEFs were either deprived of glucose for 24 hours (A) or treated with
1mM AICAR for 2 hours (B), and subjected to western blotting analysis. (C and D) Cells
infected with control shRNA or BNIP3 shRNA were either deprived of glucose for 24 hours (C)
or treated with 1mM AICAR for 2 hours (D), and subjected to western blotting analysis.
Figure S10. AMPK or Lkb1 deficiency does not affect glucose starvation-induced BNIP3
expression. (A and B) AMPK WT and KO MEFs were cultured in glucose containing or glucose
free medium for 24 hours, and then subjected to either western blotting (A) or real time PCR
analyses (B) to detect BNIP3 expression. (C and D) Lkb1 WT and KO MEFs were cultured in
glucose containing or glucose free medium for 24 hours, and then subjected to either western
blotting (C) or real time PCR analyses (D) to detect BNIP3 expression.
Figure S11. Reexpression of BNIP3 in p38β KO cells suppress mTORC1 activation under
energy stress condition. p38β WT and KO MEFs with stable expression of either empty vector
(EV) or BNIP3 were treated with 1 mM AICAR for 2 hours, and then subjected to western
blotting analysis.
Figure S12. FoxO deficiency does not affect TSC1/Rictor expression or AKT
phosphorylation under energy stress conditions. (A and B) FoxO WT and KO MEFs were
either deprived of glucose for 24 hours (A) or treated with 1mM AICAR for 2 hours (B), and
subjected to western blotting analysis as indicated.
Table S1. The list of genes which are regulated by FoxO under glucose starvation
condition. The table is provided as an Excel file, showing the genes with information including
2
gene ID, gene symbol, gene type (up- or down-regulated), expression levels under different cell
lines/conditions as indicated. + G: cells cultured in glucose containing medium; - G: cell
cultured in glucose free medium.
Supplemental Experimental Procedures
Constructs and primers. The mouse BNIP3 cDNA was amplified from BNIP3
expression plasmid (gift from Dr. Hsiao-Sheng Liu) and then subcloned into pBabe vector. The
mouse BNIP3 promoter region was amplified by PCR from mouse genomic DNA, and then
subcloned into pGL3-Basci vector.
The primer sequences used in this study are:
Primer name
Primer sequence
BNIP3-Prom-F1
CCTCCTTCTAAATTAAGCTGTTCTT
BNIP3-Prom-R1
GGGAGGCTGTTGTAATTCCTC
BNIP3-Lucfe-kpnF1
GGCATCCATTCTTGAAGTGC
BNIP3-Lucfe-xoh1R1
CTTCAGGGCTGAAAGGGTTT
BNIP3-mut#1-promF1
GACATTGTCTGGGAAAACACGAAACACCAAATGAAGCTG
BNIP3-mut#1-promR1
CAGCTTCATTTGGTGTTTCGTGTTTTCCCAGACAATGTC
BNIP3-mut#2-promF2
GTATAACCTTAGCACTCCAcACgAAACAAACGGAAATCAAG
BNIP3-mut#2-promR2
CTTGATTTCCGTTTGTTTcGTgTGGAGTGCTAAGGTTATAC
BNIP3-RV-F-Bamh1
CGGAATTCCGTCAGAAGGTGCTAGTGGAAGT
BNIP3-RV-R-Ecor1
CGGGATCCCGATGGACTACAAAGACGATGAC
BNIP3-Prom-F1 and BNIP3-Prom-R1 are used for BNIP3 Chip-qPCR; BNIP3-LucfekpnF1 and BNIP3-Lucfe-xoh1R1 are used for PGL3-BNIP3 promoter vector construction;
BNIP3-mut#1-promF1, BNIP3-mut#1-promR1, BNIP3-mut#2-promF2, and BNIP3-mut#2promR2 are used for mutation of FoxO binding sites in the pGL3-BNIP3 promoter vector;
BNIP3-RV-F-Bamh1 and BNIP3-RV-R-Ecor1 are used to construct pBABE-BNIP3 vector; The
mouse BNIP3 cDNA was amplified from BNIP3 expression plasmid (Gift from Dr. Hsiao-Sheng
Liu) and then subcloned into pBabe vector.
3
The mouse BNIP3 shRNAs sequences (Open Biosystems) used are as below:
m-BNIP3 shRNA#2: CCCAGCATGAATCTGGACGAA
m-BNIP3 shRNA#3: AGAAGTTGAAAGTATCCTGAA
The human BNIP3 shRNAs sequences (Thermo Scientific) used are as below:
h-BNIP3 shRNA#1:ATGGCCAGCAAATGAGAGAGC
h-BNIP3 shRNA#5:AATAAACACAAGTGACGTGGC
4