Intercontinental dispersal by a microendemic burrowing reptile
advertisement
Electronic Supplementary Material for “Intercontinental dispersal by a microendemic burrowing reptile (Dibamidae)” (Townsend et al.) I. Supplemental materials and methods (a) Divergence dating When used for node calibrations, translated log-normal (TL) distributions effectively place a hard bound on the minimum age and a soft bound (1) on the maximum age, a desirable property for most fossil calibrations (2). We thus constructed TL distributions in BEAST with the lower bound of the 95% highest probability density (HPD) at a point 1% more recent than the estimated fossil age, and we left (somewhat arbitrarily) long probability tails for the soft maxima. The following fossil-based calibration points were used (see figure S1 and table S1): (1) The oldest rhynchocephalian (3, 4) was used to constrain the rhynchocephalian-squamate split within lepidosaurs; (2) the oldest known stem scincomorphs (here defined as the clade containing the crown taxa Scincidae, Cordylidae, and Xantusiidae) (5, 6) were used to constrain the scincomorph-iguanian split; (3) the oldest known anguimorph (6, 7) was used to constrain the anguimorph-iguanian split; (4) the Lepidophyma-Xantusia split (8, 9), (5) the split between erycine and boiine boids (10), (6) the oldest known helodermatid (11) was used to constrain the helodermatid-anguid split, and (7) the oldest known crown pleurodont iguanian (12) was used to constrain the age of crowngroup pleurodont iguanians. (b) Ancestral area inference Our topological and divergence-dating results rule out Pangean vicariance and dispersal between Europe and North America as plausible explanations for the current bicontinental distribution of dibamids. Dispersal between Asia and North America is strongly implicated, but the direction of this dispersal is not certain. We used two different methods to infer the distribution of the most recent common ancestor (mrca) of mainland Asian Dibamus and Anelytropsis: (a) Dispersal-extinction-cladogenesis (DEC; 13) analysis in Lagrange v.20090327 and (b) ancestral-state reconstruction in Mesquite (14). For each taxon in both analyses, area of occurrence was coded as Mainland Asia, Malaysian Peninsula/Indonesia, or North America. In the DEC analysis, no ancestral areas were excluded a priori, and no temporal limitations were placed on dispersal. This method requires an ultrametric tree, and we used the BEAST chronogram for this purpose. The online “Lagrange configurator” (http://www.reelab.net/lagrange/configurator/index) was used to produce the Python script that was run locally. The DEC analysis found a 78% probability of an Old World origin (52% probability of a widespread ancestor occupying Mainland+Peninsula/Indonesia, 26% probability of a Peninsular/Indonesia ancestor), and a 15% probability that a widespread ancestor inhabited both Peninsula/Indonesia and North America (only splits within 2 log-likelihood units of the maximum for a given node are reported, thus the total is slightly less than 100%). This second scenario highlights a problematic aspect of DEC in this case. As noted above, vicariance of a transcontinentally-distributed ancestor can be rejected using tectonic and divergence-dating evidence. However, the DEC method is designed to allow both vicariance and dispersal as possibilities. While it is true that Lagrange allows the user to exclude some potential ancestral areas on the basis of biological implausibility (13), it is impossible to sever all connections between two areas. For example, it is impossible to exclude both Peninsula/Indonesia+North America and Mainland Asia+North America from consideration as potential species ranges. This same issue also makes analysis using only two codings (Old World or New World) meaningless; with that configuration, 100% probability is given to a widespread ancestor occupying Old World and New World. Ancestral-state reconstruction using models of character evolution (e.g., 15) is not entirely appropriate either (reviewed in 13). However, its disallowance of vicariant subdivision of widespread ancestral ranges may actually reflect some aspects of dibamid history better than the DEC method. We therefore also applied an ML-based version of this method to our system using Mesquite (14) with the Markov k-state, one-parameter model (all states equally probable). Likelihood optimization on the ML tree also gave 79% probability of an Asian distribution for the mrca of mainland Asian Dibamus and Anelytropsis (62% probability for mainland Asia, and 17% probability for Peninsula/Indonesia). In analyses in which taxa are given one of only two codings (Old World or New World), the probability of an Asian ancestral distribution is 95%. Thus, although both these methods of ancestral range inference have their limitations, each supports dispersal from Old World to New World. II. Geographic distribution of Dibamus and relative propensity for dispersal The family Dibamidae displays a remarkably conserved morphology, and many species are distinguishable by only relatively minor differences in scalation and vertebral counts. The past 25 years has seen the number of recognized species grow from nine (16) to 21 (17), an expansion largely resulting from the recognition of minute but clear morphological differences during re-examination of existing collections, rather than discovery of new populations. The current study has identified deep divergences among several morphologically similar species, and it seems likely that cryptic species exist. Even with the probable underestimate of species diversity in this group, a marked pattern of microendemism is apparent. Of the 21 currently recognized species of Dibamus, only two or three might be described as having wide distributions. These include the type species, D. novaeguineae, which probably occurs on at least western New Guinea, Sulawesi, and the Philippines, and D. leucurus, which occurs on Sumatra, Borneo, and the southeast Philippines (16). D. taylori probably occurs on several islands of the Lesser Sundas east of Wallace’s Line, from Lombock to Wetar (16). Most Indonesian species are confined to single major islands, and five Dibamus species are endemic to small coastal islands of the Malaysian peninsula, mainland Southeast Asia, and major Indonesian islands (16-20). Considering only mainland and peninsular forms, individual species’ distributions are almost uniformly small. For example, Vietnam has six species, four of which are only known from their type localities (20-22). Overall, more than half of Dibamus species are known only from type localities. While this is no doubt partly due to their rarity in collections, a general pattern of microendemism seems clear, and this in turn suggests the relatively low vagility that might be expected from limbless, burrowing animals. However, it is interesting to note that dibamids occur on both sides of Wallace’s Line, a characteristic that has often been cited as evidence of exceptional dispersal ability (16). Although this line (and its subsequent modifications) marks a sharp discontinuity in mammal distributions, birds and reptiles actually show a more gradual east-west change from Australian to Oriental faunal composition (e.g., see fig. 3.4 in 23). Several squamate reptile groups, including agamids, gekkonids, scincids, varanids, and acrochordid, colubrid, pythonid, elapid, typhlopid, viperid, and xenopeltid snakes straddle this line (24). That dibamids fall into this group is not entirely surprising, as it is easy to imagine these animals surviving short to moderate sea voyages within mats of flotsam washed into the ocean during heavy rains. Whether they would be similarly capable of a much longer trans-Pacific journey is unknown. The fact that several reptile taxa (among them several those whose distributions span Wallace’s Line) seem clearly to have crossed into the New World via Beringia (e.g., 25, 26, 27), and none appear to have made this move via the Pacific, suggests that an overland route is most likely for dibamids as well. I. SUPPLEMENTAL TABLES Table S1. Divergence date calibration priors used in BEAST. Median (95% CI) (mya) TLa zero-offset (mean, st.dev.) Node Relevant fossil Rhyncocephalian – squamate Scincomorph – iguanian Indet. taxon 231 (225, 301) 224 (2.0, 1.2) Balnealacerta 167 (162, 204) 161 (1.8, 1.0) Anguimorph – iguanian Parviraptor 167 (162, 204) 161 (1.8, 1.3) Xantusia – Lepidophyma Palaeoxantusia 57 (54.1, 105) 54 (1.0, 1.5) Erycinae-Boinae Titanoboa 59 (57.1, 108) 57 (1.0, 1.5) Helodermatid-anguid Primaderma 103 (97.4, 182) 97 (1.7, 1.4) Age of crown pleurodont iguanians a Translated lognormal. Saichangurvel 28.5 (25, 71) 77 (1.2, 1.5) Table S2. Likelihood-ratio test (LRT) comparisons of strict-clock vs. non-clock models for various character subsets of the dibamids-only dataset. Partition Interpretation 2 * lnLa All positions 85.4 Reject clock Nuclear only 109.8 Reject clock ND2 15.34 Fail to reject clock BDNF 10.96 Fail to reject clock CMOS 13.1 Fail to reject clock DNAH3 11.76 Fail to reject clock NKTR 199.76 Reject clock R35 19.12 Reject clock RAG1 16.14 Reject clock a Test statistic of the LRT, equal to twice the difference in log-likelihoods between the strict-clock and non-clock analyses. The 2 critical value for all comparisons is 15.51 (0.05 level). All strict-clock analyses placed Anelytropsis as the sister taxon of the mainland Dibamus clade. Table S3. GenBank and voucher numbers used in molecular analyses. Non-standard abbreviations: ATOL (Assembling the Tree of Life project number), AEH (Allen E. Hebert field series), AMB (Aaron M. Bauer field series), BPN (Brice P. Noonan), BSI (Sulawesi Biological Surveys and Inventory number of Jim McGuire), LG (Lee Grismer field series), REE (Robert E. Espinoza field series), RLB (Robert L. Bezy field number), SBH (S. Blair Hedges field series), and WES (Walter E. Schargel field series). TAXON Voucher ND2 BDNF CMOS AY662533 CAS 206704 AY662553 AB308463 AF128504 Leposoma parietale AY662543 A. xera AY662541 HQ876244 -- GU457846 GU457862 EU402625 A. xera AY662568 HQ876394 AF544722 AF294279 EU402616 -- -- EU402627 DQ465557 U71332 EU402619 AY987969 -- Sphenodon punctatus ISIS 373002 Acontias meleagris No voucher Aeluroscalobates felinus Agama agama LG 6115 ROM 19895 Alopoglossus angulatum H12975 Amphisbaena fuliginosa BPN 988 Anelytropsis papillosus Anilius scytale Aspidoscelis tigris MZFC 22828 WES 561 LSUMZ H0503 SAMA R54474 SDSU 4350 Basiliscus basiliscus DMH 86-271 BPU82680 Bipes biporus MVZ 236256 U71335 Boa constrictor Calabaria reinhardtii AEH 040 CAS 207831 AB177354 -- B. canaliculatus GU457877 EU402629 EU402631 Chamaeleo calyptratus MVZ 230099 AF448744 GU457847 Coleonyx mitratus Coleonyx variegatus Cordylosaurus subtesselatus DHL 446 TWR 1925 AMB 6860 HQ876230 HQ876231 HQ876225 Cordylus mossambicus SDSU 4354 AB308466 NC008774 AY167393 C. polyzonus AY662561 AF471115 AY099978 Chamaeleo sp. AF039477 -HQ876391 AY217849 GU457869 DQ100147 Daboia russelli CAS 213576 NC011391 Delma borea SAMA AY134583 Anolis carolinensis Aspidites melanocephalus AF039483 GU457870 DQ249061 HQ876229 EU402615 -AF137530 HQ876226 -- GU457876 EU402636 GU457867 AY987986 AF039482 AF471156 AY134547 Dibamus seramensis Dibamus tiomanensis Dipsosaurus_dorsalis Elgaria multicarinata Epicrates striatus Eryx colubrinus Eublepharis macularius Gambelia wislizenii R54004 ROM 36056 MVZ 224112 BSI 224 AMNH 144752 FMNH 258662 LSUMZ H9546 TNHC 59521 LG 4676 TWR 1146 SDSU 3858 SBH 102399 No voucher No voucher TWR 1965 Gekko gekko SDSU 3896 Gonatodes albogularis Goniurosaurus kuroiwae Heloderma suspectum AEH 003 KUZ R62087 ISIS 100503 Lampropeltis getula SDSU 4351 Lanthanotus borneensis Leiocephalus barahonensis Leiolepis belliana Lepidophyma flavimaculatum Leptotyphlops humilis Lichanura trivirgata ISIS 393113 SBH 101427 CAS 210725 LACM 128548 SDSU 3939 SAMA R54372 SDSNH 72826 Liolaemus belli Liotyphlops albirostris Micrurus fulvius Morunasaurus annularis Dibamus bourreti Dibamus bourreti Dibamus celebensis Dibamus greeri Dibamus montanus Dibamus novaeguineae Lialis burtonis Oplurus cyclurus HQ876245 AY662562 HQ876246 HQ876237 HQ876238 HQ876239 HQ876247 HQ876240 HQ876248 HQ876241 HQ876249 GU457863 HQ876395 AY662574 HQ876396 HQ876397 HQ876398 EU116679 HQ876250 HQ876251 AF049857 AF085620 --AB308467 U82682 MVZ 215314 AF114249 -AB308469 AF085603 L. calligaster DQ902243 AY662537 EF591774 U82689 HQ876242 HQ876243 GQ853275 GU457854 EU402638 DQ465570 GU457864 HQ876217 HQ876399 HQ876400 AF148705 AF039479 AY099966 DQ465568 HQ876392 AY217842 EU402614 AY172929 GU457866 HQ876232 GU457856 EU402645 EF534923 HQ876393 AY662566 GU457859 HQ876223 HQ876216 AB162908 GU457873 AB079597 EU402648 AY662564 DQ119594 AY987982 L. sylvaticum AY217891 AY099979 AY134599 GU457868 AF090850 -- EU402649 MVZ 196515 AF099223 HQ876220 SBH 172151 TWR Mi f MVZ 163062 UMMZ 228595 -AY059006 AF528720 O. cuvieri U82685 EU402650 EU402653 HQ876218 AY099974 L. elongatus AY367881 AF544727 EF137421 -- GU457850 EU099697 P. thalassinus AF049858 HQ876221 Uta stansburiana AF315389 EU423283 HQ876236 AY221342 Petrosaurus mearnsi TWR 534 Phelsuma lineata UMMZ 201554 DQ902091 Physignathus cocincinus Plestiodon fasciatus Polychrus marmoratus MVZ 226495 SDSU 3836 No voucher Rhacodactylus auriculatus ABTC 06734 Rhineura floridana CAS 195955 SAMA R33647 FMNH 261569 Saltuarius cornutus Shinisaurus crocodilurus U82690 AY607299 AF528738 R. chahoua DQ533741 AY605473 HQ876215 HQ876228 HQ876222 AF039476 AY217869 AY987983 HQ876235 AY172944 GU457878 AY369023 HQ876234 AY444022 S. platurus AY172941 AF085604 GU457857 AY662565 Stenocercus guentheri KU 202940 DQ080223 HQ876224 Strophurus ciliaris ABTC 28467 AY368996 GU457865 AB080237 HQ876227 AF114251 AY662542 T. reticulatus NC010971 U. acanthinurus U71325 HQ876233 GU457879 Tropidurus plica EF615737 S. intermedius AF039469 T. sexlineatus EF632288 EF534927 AY444025 EU402664 AF544733 GU457849 U. aegyptia AF137531 AF528734 HQ876219 -- EU920057 GU457860 U71328 AB179620 X. grandis XGU71333 EU402620 EU402668 DNAH3 NKTR R35 RAG1 Sphenodon punctatus Acontias meleagris Aeluroscalobates felinus Agama agama Alopoglossus angulatum GU457908 GU457931 HQ876417 EU402725 HQ876413 HQ876320 HQ876348 HQ876369 HQ876321 HQ876345 GU457969 GU457993 HQ876446 EU402825 HQ876442 Amphisbaena fuliginosa GU457936 HQ876252 HQ876281 HQ876298 HQ876253 HQ876278 HQ876285 HQ876352 GU457998 Anelytropsis papillosus Anilius scytale GU457923 EU402734 HQ876311 HQ876289 HQ876383 HQ876355 GU457985 EU402834 Teratoscincus scincus Trogonophis wiegmanni FMNH 255512 CAS 227618 MVZ 162541 Typhlops jamaicensis TNHC 55636 Uromastyx_hardwickii SDSU 4353 Takydromus ocellatus Xantusia vigilis Xenopeltis unicolor LSUMZ H13960 SAMA R51088 RLB 5518 CAS 212014 Xenosaurus platyceps MZFC 9561 Urostrophis vautieri Varanus acanthurus TAXON EU402617 V. rosenbergi AF039480 AF148703 DQ465561 X. grandis AY662567 Anolis carolinensis Aspidites melanocephalus Aspidoscelis tigris Basiliscus_basiliscus Bipes biporus Boa constrictor Calabaria reinhardtii Chamaeleo calyptratus Coleonyx mitratus Coleonyx variegatus Cordylosaurus subtesselatus Cordylus mossambicus Daboia russelli Delma borea Dibamus bourreti Dibamus bourreti Dibamus celebensis Dibamus greeri Dibamus montanus Dibamus novaeguineae Dibamus seramensis Dibamus tiomanensis EU402726 EU402736 EU402729 HQ876403 HQ876416 EU402738 EU402740 GU457909 HQ876418 HQ876419 Dipsosaurus_dorsalis HQ876406 Elgaria multicarinata Epicrates striatus Eryx colubrinus Eublepharis macularius GU457916 EU402746 EU402747 GU457925 Gambelia wislizenii HQ876404 Gekko gekko Gonatodes albogularis Goniurosaurus kuroiwae Heloderma suspectum Lampropeltis getula Lanthanotus borneensis Leiocephalus barahonensis Leiolepis belliana Lepidophyma flavimaculatum Leptotyphlops humilis Lialis burtonis Lichanura trivirgata EU402724 GU457927 HQ876420 GU457917 EU402752 GU457920 TBA GU457930 EU402745 GU457928 HQ876425 HQ876426 HQ876427 HQ876428 HQ876429 GU457924 HQ876430 HQ876431 HQ876411 HQ876402 GU457933 EU402755 GU457929 EU402756 HQ876266 HQ876297 HQ876282 HQ876258 HQ876286 HQ876291 HQ876293 HQ876255 HQ876299 HQ876300 HQ876277 HQ876334 HQ876365 HQ876349 HQ876326 HQ876353 HQ876357 HQ876359 HQ8763223 HQ876370 HQ876371 HQ876344 EU402826 EU402835 EU402829 TBA HQ876445 EU402837 EU402839 GU457970 HQ876447 HQ876448 HQ876276 -HQ876309 HQ876312 HQ876313 HQ876314 HQ876315 HQ876316 HQ876317 HQ876318 HQ876319 HQ876261 HQ876343 HQ876367 HQ876381 HQ876384 HQ876385 HQ876386 HQ876387 HQ876388 DQ119613 HQ876389 HQ876390 HQ876329 GU457992 EU402843 GU457990 HQ876454 AY662645 HQ876455 HQ876456 HQ876457 GU457986 HQ876458 HQ876459 CAS208708 FJ356747 HQ876270 HQ876292 -HQ876301 HQ876259 GU457977 EU402844 EU402845 GU457987 HQ876306 HQ876308 HQ876302 HQ876272 -HQ876274 HQ876268 HQ876338 HQ876358 HQ876360 HQ876372 BYU47329 HQ876327 HQ876378 HQ876380 HQ876373 HQ876340 HQ876362 -HQ876336 HQ876256 HQ876283 HQ876324 HQ876350 AY662587 HQ876296 HQ876310 HQ876294 HQ876364 HQ876382 HQ876361 EU402851 GU457991 EU402852 HQ876441 HQ876434 EU402824 GU457989 HQ876449 GU457979 EU402848 GU457982 HQ876439 GU457995 Liolaemus belli Liotyphlops albirostris Micrurus fulvius HQ876408 EU402757 EU402760 Morunasaurus annularis HQ876405 Oplurus cyclurus Petrosaurus mearnsi Phelsuma lineata Physignathus cocincinus Plestiodon fasciatus Polychrus marmoratus Rhacodactylus auriculatus Rhineura floridana Saltuarius cornutus Shinisaurus crocodilurus Stenocercus guentheri Strophurus ciliaris Takydromus ocellatus Teratoscincus scincus Trogonophis wiegmanni Typhlops jamaicensis Uromastyx_hardwickii Urostrophis vautieri Varanus acanthurus Xantusia vigilis Xenopeltis unicolor Xenosaurus platyceps GU457912 HQ876409 HQ876424 HQ876401 HQ876415 HQ876410 HQ876423 GU457938 HQ876422 GU457918 HQ876412 GU457926 HQ876414 HQ876421 GU457939 EU402770 GU457911 HQ876407 GU457921 EU402730 EU402774 EU402727 HQ876263 HQ876290 HQ876295 HQ876260 HQ876331 HQ876356 HQ876363 HQ876328 HQ876436 EU402853 EU402856 FJ356741 HQ876264 HQ876265 HQ876307 HQ876254 HQ876280 HQ876267 -HQ876287 HQ876305 HQ876273 HQ876269 HQ876304 HQ876279 HQ876303 HQ876288 -HQ876257 HQ876262 HQ876275 HQ876284 -HQ876271 HQ876332 HQ876333 HQ876379 HQ876322 HQ876347 HQ876335 HQ876377 DQ119613 HQ876376 HQ876341 HQ876337 HQ876375 HQ876346 HQ876374 HQ876354 HQ876366 HQ876325 HQ876330 HQ876342 HQ876351 HQ876368 HQ876339 GU457973 HQ876437 HQ876453 HQ876432 HQ876444 HQ876438 HQ876452 GU458000 HQ876451 GU457980 HQ876440 GU457988 HQ876443 HQ876450 GU458001 EU402866 GU457972 HQ876435 GU457983 EU402830 EU402870 EU402827 Table S4. Primers used in molecular analyses. A non-exhaustive listing of primers used for amplification and sequencing of each fragment is provided. Unless otherwise noted, all primers are from Townsend et al. (28). Novel primers developed for this study are indicated with an asterisk. Primer names ending with “f” are forward primers, and those ending with “r” are reverse primers. Gene Primer name Primer sequence (5’—3’) ND2 L4437(f)a (tRNAMET) AAGCTTTCGGGCCCATACC H5692(r)a (tRNAASN) TTGGGTGTTTAGCTGTTAA BDNF_f GACCATCCTTTTCCTKACTATGGTTATTTCATACTT BDNF_r CTATCTTCCCCTTTTAATGGTCAGTGTACAAAC G73b GCGGTAAAGCAGGTGAAGAAA G74b TGAGCATCCAAAGTCTCCAATC DNAH3_f1 GGTAAAATGATAGAAGAYTACTG DNAH3_r6 CTKGAGTTRGAHACAATKATGCCAT NKTR_f8* GTAArTGGGAyTCnGArTCAAATTC NKTR_r13* GTCTTYCTWACTTCATCAAACAGAG RAG1_f1ac CAGCTGYAGCCARTACCATAAAAT RAG1_r2c CTTTCTAGCAAAATTTCCATTCAT BDNF CMOS DNAH3 NKTR RAG-1 R35 a R35_fd GACTGTGGAYGAYTCGATCAGTGTGGTGCC R35_rd GCCAAAATGAGSGAGAARCGCTTCTGAGC Macey et al. (29) Saint et al. (30) c Wiens et al. (31) d Leaché (32) b III. SUPPLEMENTAL FIGURE Figure S1. BEAST chronogram illustrating complete outgroup sampling. Nodes marked by black dots were constrained using fossils as described in the main text and table S1. Scale units are million years ago (Myr). Supplemental References 1. Yang ZH, Rannala B. Bayesian estimation of species divergence times under a molecular clock using multiple fossil calibrations with soft bounds. Mol Biol Evol. 2006 Jan;23(1):212-26. 2. Benton MJ, Donoghue PCJ. Paleontological evidence to date the tree of life. Mol Biol Evol. 2007 Jan;24(1):26-53. 3. Evans SE, Prasad GVR, Manhas BK. Rhynchocephalians (Diapsida : Lepidosauria) from the Jurassic Kota Formation of India. Zool J Linn Soc. 2001 Nov;133(3):309-34. 4. Sues HD, Olsen PE. Triassic vertebrates of Gondwanan aspect from the Richmond Basin of Virginia. Science. 1990;249(4972):1020-3. 5. Evans SE. Jurassic lizard assemblages. In: Buffetaut E, Mazin J-M, editors. Proceedings of the Second Georges Cuvier Symposium, Revue de Paleobiologie, Special Volume 71993. p. 55-65. 6. Evans SE. Crown-group lizards from the Middle Jurassic of Britain. Palaeontographica A. 1998;250:1-32. 7. Evans SE. A new anguimorph lizard from the Jurassic and Lower Cretaceous of England. Palaeontology. 1994;37:33-49. 8. Estes R. Middle Paleocene lower vertebrates from Tongue River Formation, southeastern Montana. J Paleontol. 1976;50(3):500-20. 9. Sullivan RM. Fossil lizards from Swain Quarry Fort Union Formation, Middle Paleocene (Torrejonian), Carbon County, Wyoming. J Paleontol. 1982;56(4):996-1010. 10. Head JJ, Bloch JI, Hastings AK, Bourque JR, Cadena EA, Herrera FA, et al. Giant boid snake from the Palaeocene neotropics reveals hotter past equatorial temperatures. Nature. 2009;457(7230):715-U4. 11. Nydam RL. A new taxon of helodermatid-like lizard from the AlbianCenomanian of Utah. J Vert Paleontol. 2000;20(2):285-94. 12. Conrad JL, Norell MA. A complete Late Cretaceous iguanian (Squamata, Reptilia) from the Gobi and identification of a new iguanian clade. Am Mus Novit. 2007(3584):1-47. 13. Ree RH, Smith SA. Maximum likelihood inference of geographic range evolution by dispersal, local extinction, and cladogenesis. Syst Biol. 2008;57(1):4-14. 14. Maddison WP, Maddison DR. Mesquite: A modular system for evolutionary analysis (http://mesquiteproject.org). 1.1 ed2006. 15. Nepokroeff M, Sytsma KJ, Wagner WL, Zimmer EA. Reconstructing ancestral patterns of colonization and dispersal in the Hawaiian understory tree genus Psychotria (Rubiaceae): A comparison of parsimony and likelihood approaches. Syst Biol. 2003;52(6):820-38. 16. Greer AL. The relationships of the lizard genera Anelytropsis and Dibamus. J Herpetol. 1985;19(1):116-56. 17. Das I, Lim KKP. A new species of Dibamus (Squamata: Dibamidae) from Pulau Simeuleu, Mentawai Archipelago, Indonesia. Zootaxa. 2009(2088):15-23. 18. Diaz RE, Leong TM, Grismer LL, Yaakob NS. A new species of Dibamus (Squamata: Dibamidae) from West Malaysia. Asiat Herp Res. 2004(10):1-7. 19. Das I, Lim KKP. New species of Dibamus (Squamata : Dibamidae) from Pulau Nias, Indonesia. J Herpetol. [Article]. 2005 Mar;39(1):113-7. 20. Honda M, Ota H, Hikida T, Darevsky IS. A new species of the worm-like lizard, Dibamus Dumeril & Bibron 1839 (Squamata Dibamidae), from Vietnam. Trop Zool. 2001 Jun;14(1):119-25. 21. Ineich I. A new species of Dibamus (Reptilia, Squamata, Dibamidae) from Vietnam. Bull Soc Zool Fr. 1999;124(3):279-86. 22. Darevsky IS. Two new species of worm-like lizard Dibamus (Sauria: Dibamidae), with remarks on the distribution and ecology of Dibamus in Vietnam. Asiat Herp Res. 1992(4):1-12. 23. Whittaker RJ, Fernández-Palacios JM. Island Biogeography: Ecology, Evolution, and Conservation. 2nd ed. Oxford: Oxford University Press; 2007. 24. Pough FH, Andrews RM, Cadle JE, Crump ML, Savitsky AH, Wells KD. Herpetology. 3rd ed. Upper Saddle River: Prentice Hall; 2004. 25. Macey JR, Schulte JA, Strasburg JL, Brisson JA, Larson A, Ananjeva NB, et al. Assembly of the eastern North American herpetofauna: new evidence from lizards and frogs. Biol Lett. 2006;2(3):388-92. 26. Burbrink FT, Lawson R. How and when did Old World ratsnakes disperse into the New World? Mol Phylogenet Evol. 2007 Apr;43(1):173-89. 27. Brandley MC, Wang YZ, Guo XG, de Oca ANM, Ortiz MF, Hikida T, et al. Bermuda as an evolutionary life raft for an ancient lineage of endangered lizards. PLoS ONE. [Article]. 2010 Jun;5(6):4. 28. Townsend TM, Alegre RE, Kelley ST, Wiens JJ, Reeder TW. Rapid development of multiple nuclear loci for phylogenetic analysis using genomic resources: An example from squamate reptiles. Mol Phylogenet Evol. 2008;47(1):129-42. 29. Macey JR, Larson A, Ananjeva NB, Fang ZL, Papenfuss TJ. Two novel gene orders and the role of light-strand replication in rearrangement of the vertebrate mitochondrial genome. Mol Biol Evol. 1997;14(1):91-104. 30. Saint KM, Austin CC, Donnellan SC, Hutchinson MN. C-mos, a nuclear marker useful for squamate phylogenetic analysis. Mol Phylogenet Evol. 1998;10(2):259-63. 31. Wiens JJ, Kuczynski CA, Townsend TM, Reeder TW, Mulcahy DG, Sites JW, Jr. Combining phylogenomics and fossils in higher-level squamate phylogeny: Molecular data change the placement of fossil taxa. Syst Biol. 2010;59(59):674-88. 32. Leaché AD. Species tree discordance traces to phylogeographic clade boundaries in North American fence lizards (Sceloporus). Syst Biol. 2009;58(6):547-59.
