Supplement 3. Striatal upregulation of VEGF mRNA in the rat model of LID
A gene chip microarray data set from total striatal mRNA prepared in a previous study (Konradi et al., 2004) was screened for possible upregulation of VEGF mRNA.
In this study, 6-OHDA lesioned rats had received single daily injections of L-
DOPA/benserazide (6/12 mg/kg i.p) or saline for 22 days and had been killed 18 hours after the last injection. Total striatal mRNAs from the side ipsilateral to the lesion was examined using Affymetrix RG-U34A gene chip arrays. Comparisons were made between the following three experimental groups: L-DOPA-treated dyskinetic rats, L-DOPA-treated non-dyskinetic cases, and saline-treated controls
(n=6 in each group). To complement the microarray data, the cellular expression pattern of VEGF mRNA was examined in the striatum using radioactive in situ hybridization histochemistry according to our well-established protocols (complete methodological descriptions can be found in Konradi et al. 2004). For this analysis, we used a small set of chronically L-DOPA-treated dyskinetic rats and saline treated controls (n=4 and 3, respectively), which had sustained identical 6-OHDA lesions and treatment procedures as in the microarray study. Sixteen µm-thick cryostat-cut sections from the mid-caudal striatum were hybridized to a 35 S-3´-labeled, oligonucleotide probe complementary to VEGF-A mRNA (from 5’ to 3’ end,
GCTTTCTCCGCTCTGAACAAGGCTCACAGTGAACGCTCCAGG). This oligonucletide probe had 100% homology with the rat VEGF-A genomic sequence and did not exhibit any significant homology with unrelated genes. The hybridization signal was visualized by dipping the slide-mounted sections in photographic emulsion
(LM-1, Amersham Pharmacia). Following appropriate exposure, development, and fixing step, sections were counterstained with Cresyl violet. Sample areas from the lateral striatum (4 areas per side per animal) were digitized in a Nikon Eclipse 80

microscope under a 20x objective. Cells showing positive hybridization (dense aggregates of silver grains covering a cell profiles) were automatically counted by an image analysis software using a Bayesian pixel classifier system, excluding labeling of background pixels (Visiomorph, Visiopharm DK).
Additional methodological details regarding animal and tissue preparation, gene chip microarray analysis, and in situ hybridization histochemistry can be found in Konradi et al. (Neurobiol Dis 17: 219-236) doi:10.1016/j.nbd.2004.07.005.
Results
The RG-U34A arrays had 4 probe sets for VEGF-A (Table S2), all of which were significantly upregulated in chronically L-DOPA-treated dyskinetic rats compared to saline-treated controls. Only the probe set, rc_AA850734_at, showed significant upregulation in the non-dyskinetic cases (Table S2).
Table S2. Gene-chip microarray regulation of VEGF-A
Probe set name Accession no.
1370081_a_at
Fold change
Dykinetic/
Saline
AF080594 1.34 p-value
(t-test)
Fold change
Non-
Dyskinetic/
Saline
0.032 1.18
p- value
(t-test)
Fold change
Dyskinetic/
Nondyskinetic
0.076
1.14 p-value
(t-test)
0.251
M32167_g_at rc_AA850734_at
L20913_s
M32167
AA850734
L20913
1.36
1.25
1.21
0.005 1.23
0.013 1.14
0.008 1.11
0.069
1.11
<0.0001
1.09
0.056
1.03
0.214
0.178
0.772
In situ hybridization histochemistry showed a clear increase in the number of cells that exhibited a positive signal for VEGF mRNA following chronic L-DOPA treatment compared to saline injection (148 ± 11% vs 85 ± 15% of the values measured on the corresponding contralateral intact side, respectively; t-test, p =0.03).

Fig. S2 . Photomicrographs of striatal sections processed for in situ hybridization analysis of VEGF mRNA (counterstained with Cresyl violet). A, saline treated control animal; B, chronically L-DOPA treated dyskinetic animal. Scale bar, 50 µm.
References
Konradi C, Westin JE, Carta M, Eaton ME, Kuter K, Dekundy A, et al.
Transcriptome analysis in a rat model of L-DOPA-induced dyskinesia.
Neurobiology of disease. 2004 Nov;17(2):219-36.