Impact of Cytokine Gene Polymorphisms on Risk and Treatment

advertisement
Impact of Cytokine Gene Polymorphisms on Risk and Treatment Outcomes of Aplastic Anemia
Journal: the Annals of Hematology
Yun-Gyoo Lee1, Inho Kim1, 4, 5, Jin Hee Kim2, 6, Ji-Yeon Bae4, Ji-Hyun Kwon1, Dong-Yeop Shin1,
Jong-Eun Lee7, Eun Young Song3, Hyun Kyoung Kim3, Sung-Soo Yoon1, 4, Sung Sup Park3, Dong
Soon Lee3, Kyou-Sup, Han3, Myoung Hee Park3, Yun-Chul Hong2, 6, Seonyang Park1, 4, 5, ByoungKook Kim1, 4
1
Department of Internal Medicine, 2Preventive Medicine, 3Laboratory Medicine, Seoul National
University Hospital, Seoul, Korea
4
Cancer Research Institute, 5Diagnostic DNA chip Center, Seoul National University College of
Medicine, Seoul, Korea
6
Institute of Environmental Medicine, Seoul National University Medical Research Center, Seoul,
Korea
7
DNA Link Inc., Seoul, Korea
Corresponding author
Inho Kim, M.D., Ph.D.,
Department of Internal Medicine
Seoul National University Hospital
101 Daehang-ro, Jongno-gu, Seoul 110-744, Korea
Tel: 82 2 2072 0834
Email: [email protected]
Genotyping Method
The genotyping was screened using single base primer extension assay using ABI PRISM SNaPShot
Multiplex kit (ABI, Foster City, CA, USA) according to manufacturer’s recommendation. Briefly, the
genomic DNA flanking the interested single nucletide polymorphism (SNP) was amplified with PCR
reaction with Forward and Reverse primer pairs and standard PCR reagents in 10μL reaction volume,
containing 10ng of genomic DNA, 0.5pM of each oligonucleotide primer, 1μL of 10X PCR buffer,
250M dNTP (2.5mM each) and 0.25 unit i-StarTaq DNA Polymerase (5unit/µl) (iNtRON
Biotechnology, Sungnam, Kyungki-Do, Korea). The PCR reactions were carried out as follows; 10 min
at 95℃ for 1 cycle, and 35 cycles on 95℃ for 30s, Tm℃ for 1min, 72℃ for 1min followed by 1 cycle
of 72℃ for 10mins. After amplification, the PCR products were treated with 1 unit each of shrimp
alkaline phosphatase (SAP) (USB Corporation, Cleveland, OH, USA) and exonuclease I (USB
Corporation, Cleveland, OH, USA) at 37℃ for 75 minutes and 72℃ for 15 minutes to purify the
amplified products. One microliter of the purified amplification products were added to a SNaPshot
Multiplex Ready reaction mixture containing 0.15pmols of genotyping primer for primer extension
reaction. The primer extension reaction was carried out for 25cycles of 96℃ for 10 seconds, 50℃ for 5
seconds, and 60℃ for 30 seconds. The reaction products were treated with 1 unit of SAP at 37℃ for 1
hour and 72℃ for 15 minutes to remove excess fluorescent dye terminators. One microliter of the final
reaction samples containing the extension products were added to 9 μL of Hi-Di formamide (ABI,
Foster City, CA). The mixture was incubated at 95℃ for 5 min, followed by 5min on ice and then
analyzed by electrophoresis in ABI Prism 3730xl DNA analyzer. Analysis was carried out using
Genemapper software (version 4.0; Applied Biosystems). Table 1 shows the primer sets and Tm used
for the SNaPshot assay.
Table 1. Primer sets and Tm for the SNaPshot assay.
Gene
SNP name (rs number)
-2353A/T (rs7139169)
IFNG
-1616C/T (rs2069705)
+874A/T (rs2430561)
-1037C/T (rs1799724)
-1031C/T (rs1799964)
Strand
Reverse
Reverse
Forward
Forward
Forward
Primer sequence
Forward
GCAGAAGACACGCGAATAG
Reverse
ATCCTCCTTAAAATTAATCTTAGATTCTC
Genotyping
GGTTTATACTTTTCTAAGAGTTCTG
Forward
CAGTTTTACAGGTAAGGAGACTGAG
Reverse
TTTGCATTTCTACCTGTACTGTGTA
Genotyping
TATCTAGCTATATGATTGTGAGTTA
Forward
ATATTCAGACATTCACAATTGATT
Reverse
TATTATACGAGCTTTAAAAGATAGTTCC
Genotyping
TTTATXCTTACAACACAAAATCAAATC
Forward
TAGGAGAATGTCCAGGGCTAT
Reverse
AGGCTCTTTCACTCCCTGG
Genotyping
GTCGAGTATGGGGACCCCCMNTTAA
Forward
CAGAGAGCTTCAGGGATATG
Reverse
GTCTCCTGTAACCCATTCCT
Genotyping
AAGGAGAAGCTGAGAAGA
Forward
GGGAGAACAAAAGGATAAGG
Reverse
TGAAGCTCTCACTTCTCAGG
Genotyping
AAGTCGAGTATGGGGACCCCC
Forward
AGAAGGAAACAGACCACAGAC
Reverse
GGGAAAGAATCATTCAACCA
Genotyping
TAGGTTTTGAGGGGCATG
Forward
TCAGAGCTGACCCCAGCTAA
Reverse
GGCCACCGTCCTCATCTC
Genotyping
CCTCCTGACCCTTCCATCC
Forward
GCCCATCTAGGTTATTTCC
Reverse
TGCCAGTCACTTCCTACC
Genotyping
AGCAGCGGTAGCAGCAGC
Forward
GCGATTTGGCTTAAGTTGTT
Reverse
GAGAAGTCAGGGTGAGGAAG
Genotyping
GCAACATGAGAGGCTCACAGACGTT
TNF
-863C/A (rs1800630)
-308G/A (rs1800629)
-590 C/T (rs1800469)
Forward
Forward
Forward
TGFB
P10L C/T (rs1800470)
FAS
-670G/A (rs1800682)
Reverse
Reverse
Tm
Additive
55
-
55
-
60
-
55
-
55
Betaine
55
Betaine
55
Betaine
65
Betaine
60
Betaine
60
-
Download